Hepatitis C Virus Detection Kit

Abstract

Provided is a hepatitis C virus detection kit, a method for detecting hepatitis C virus, and a method for preparing a reagent or kit for detecting the hepatitis C virus. The kit contains a primary antibody and a second antibody for detecting a hepatitis C virus core antigen, wherein the primary antibody is directed against an epitope in a 95th-117th amino acid sequence of the hepatitis C virus core antigen or specifically binds to the 95th-117th amino acid sequence of the hepatitis C virus core antigen; and the second antibody is directed against an epitope in a 55th-72nd amino acid sequence of the hepatitis C virus core antigen or specifically binds to the 55th-72nd amino acid sequence of the hepatitis C virus core antigen. The kit has high sensitivity, good stability, and simple operation, and can be used for rapid detection of early acute hepatitis C.

Claims

1. A hepatitis C virus detection kit, comprising a primary antibody and a second antibody for detecting a hepatitis C virus core antigen in a sample from a subject, wherein the primary antibody is directed against an epitope in a 95th-117th amino acid sequence of the hepatitis C virus core antigen or specifically binds to the 95th-117th amino acid sequence of the hepatitis C virus core antigen, and the second antibody is directed against an epitope in a 55th-72nd amino acid sequence of the hepatitis C virus core antigen or specifically binds to the 55th-72nd amino acid sequence of the hepatitis C virus core antigen.

2. The kit of claim 1, wherein the primary antibody is a capture antibody, the second antibody is a labeled antibody, or the primary antibody is a labeled antibody, and the second antibody is a capture antibody; preferably, the primary antibody is a capture antibody, and the second antibody is a labeled antibody.

3. The kit of claim 2, wherein the capture antibody is bound to a solid phase, and the labeled antibody is labeled by a detectable label.

4. The kit of claim 1, further comprising a primary antigen and/or a second antigen for detecting a hepatitis C virus antibody in a sample from a subject.

5. The kit of claim 4, wherein the primary antigen is a capture antigen, the second antigen is a labeled antigen; or the primary antigen is a labeled antigen, and the second antigen is a capture antigen.

6. The kit of claim 5, wherein the capture antigen is bound to a solid phase, and the labeled antigen is labeled by a detectable label.

7. The kit of claim 3, wherein the solid phase comprises magnetic particles, latex particles and a microtitration plate.

8. The kit of claim 1, comprising a virus lysis solution, for example, a phosphate buffer.

9. The kit of claim 8, wherein the virus lysis solution comprises 10-100 mM phosphate buffer, 0.5%-1% (m/v) denaturant, e.g., SDS, 0.5%-1% (m/v) surfactant, e.g., NP-40, TRITONX-100 and/or TWEEN-20, 0.5%-1% (m/v) protective protein, e.g., BSA, 1%-2.5% (mlv) ammonium sulfate, and 0.1%-10% (mlv) absolute ethyl alcohol.

10. The kit of claim 1, wherein the sample comprises a healthy or pathological biological tissue, cell or body fluid, for example, a blood sample, for example, plasma, serum, blood products, for example, seminal fluid or vaginal secretion, and wherein the hepatitis C virus comprises HCV genotypes I/1a, II/1b, III/2a, IV/2b, V/3a and VI/3b.

11. A method for detecting a hepatitis C virus, the method comprising: contacting a sample from a subject with the primary antibody and the second antibody, wherein the primary antibody is directed against an epitope in a 95th-117th amino acid sequence of the hepatitis C virus core antigen or specifically binds to the 95th-117th amino acid sequence of the hepatitis C virus core antigen; and the second antibody is directed against an epitope in a 55th-72nd amino acid sequence of the hepatitis C virus core antigen or specifically binds to the 55th-72nd amino acid sequence of the hepatitis C virus core antigen.

12. The method of claim 11, wherein the method further comprises: contacting the sample from the subject with the primary antigen and/or the second antigen from hepatitis C virus; the primary antigen and/or the second antigen may be, for example, a hepatitis C virus core antigen, E1, E2, NS2, NS3 NS4 and NS5, for example, the primary antigen and/or the second antigen originate from different positions of a same hepatitis C virus antigen, for example, a 7th-48th amino acid sequence from the hepatitis C virus core antigen, for example, a 7th-21st amino acid sequence and/or 29th-48th amino acid sequence from the hepatitis C virus core antigen; for example, the primary antigen and/or the second antigen comprises any one of the following amino acid fragments or a combination thereof: 1st-56th amino acids of an HCV core antigen, 1201st-1490th amino acids of NS3, a 1883rd-1925th amino acid sequence of NS4; 1st-35th amino acids of an HCV core antigen, 1223rd-1426th amino acids of NS3, a 1890th-1923rd amino acid sequence of NS4; for example, an amino acid sequence as shown in SEQ ID NO:1 and/or SEQ ID NO:2.

13. A method for preparing a reagent or kit for detecting a hepatitis C virus, wherein a primary hepatitis C virus core antigen and a second hepatitis C virus core antigen are used in preparation of antibodies, the primary hepatitis C virus core antigen comprises or consists of 55th-72nd amino acids of the hepatitis C virus core antigen; and the second hepatitis C virus core antigen comprises or consists of 95th-117th amino acids of the hepatitis C virus core antigen.

14. The method of claim 13, wherein the antibodies are monoclonal antibodies.

15. The method of claim 13, wherein the method comprises preparation of a kit for detecting a hepatitis C virus, wherein the kit comprises the antibody, and further comprises one or two antigens of hepatitis C virus; the one or two antigens may be, for example, a hepatitis C virus core antigen, E1, E2, NS2, NS3, NS4 and NS5, for example, different positions from a same hepatitis C virus antigen, for example, a 7th-48th amino acid sequence from the hepatitis C virus core antigen, for example, a 7th-21st amino acid sequence and/or 29th-48th amino acid sequence from the hepatitis C virus core antigen; for example, the one or two antigens comprise any one of the following amino acid sequence or a chimeric fragment thereof: 1st-56th amino acids of an HCV core antigen, 1201st-1490th amino acids of NS3, a 1883rd-1925th amino acid sequence of NS4; 1st-35th amino acids of an HCV core antigen, 1223rd-1426th amino acids of NS3, a 1890th-1923rd amino acid sequence of NS4; for example, an amino acid sequence as shown in SEQ ID NO:1 and/or SEQ ID NO:2.

16. The kit of claim 3, wherein the detectable label comprises fluorescence labeling, chromophore labeling, electron-dense labeling, chemiluminescent labeling, radiolabeling, enzyme labeling; for example, radioisotope, fluorophore, rhodamine and derivatives thereof, luciferase, fluorescein, horse radish peroxidase, alkaline phosphatase, β-galactosidase, glucoamylase, lysozyme, saccharides oxidase, glucose oxidase, galactose oxidase, glucose-6-phosphate dehydrogenase, biotin/avidin, spin labeling, phage labeling; for example, acridinium ester labeling; for example, wherein fluorescence labeling, e.g., acridinium ester labeling, is added by an adapter, e.g., biotin-avidin.

17. The kit of claim 4, wherein the primary antigen and/or second antigen is a hepatitis C virus core antigen, E1, E2, NS2, NS3, NS4 and NS5; for example, the primary antigen and/or second antigen originate from different positions of a same hepatitis C virus antigen.

18. The kit of claim 17, wherein, 1st-56th amino acids of the hepatitis C virus core antigen, for example, 1st-35th amino acids of the hepatitis C virus core antigen, for example, a 7th-48th amino acid sequence from the hepatitis C virus core antigen, for example, a 7th-21st amino acid sequence and 29th-48th amino acid sequence from the hepatitis C virus core antigen; for example, 1201st-1490th amino acids of NS3, a 1883rd-1925th amino acid sequence of NS4; 1223rd-1426th amino acids of NS3, and a 1890th-1923rd amino acid sequence of NS4; for example, the primary antigen comprises any one of the following amino acid fragments or a combination thereof: 1st-56th amino acids of an HCV core antigen, 1201st-1490th amino acids of NS3, a 1883rd-1925th amino acid sequence of NS4; and the second antigen comprises any one of the following amino acid sequence or a combination thereof: 1st-35th amino acids of an HCV core antigen, 1223rd-1426th amino acids of NS3, a 1890th-1923rd amino acid sequence of NS4; for example, an amino acid sequence as shown in SEQ ID NO:1 and/or SEQ ID NO:2.

19. The kit of claim 3, wherein the detectable label comprises fluorescence labeling, chromophore labeling, electron-dense labeling, chemiluminescent labeling, radiolabeling, enzyme labeling; for example, radioisotope, fluorophore, rhodamine and derivatives thereof, luciferase, fluorescein, horse radish peroxidase, alkaline phosphatase, β-galactosidase, glucoamylase, lysozyme, saccharides oxidase, glucose oxidase, galactose oxidase, glucose-6-phosphate dehydrogenase, biotin/avidin, spin labeling, phage labeling; for example, acridinium ester labeling; for example, fluorescence labeling, e.g., acridinium ester labeling, is added by an adapter, e.g., biotin-avidin.

20. The kit of claim 8, wherein, the virus lysis solution comprising a denaturant, a surfactant, a protective protein, ammonium sulfate and absolute ethyl alcohol.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0048] FIG. 1 shows a schematic diagram of antigen-antibody combination detection in a nonlimiting embodiment of the present disclosure.

[0049] FIG. 2:A:PCR amplified product diagram, 1. DNA marker (DL2000); 2. PCR amplified products; B: PCR identification diagram of a PKO-C175C recombinant plasmid; 1. PCR amplified products; 2. PCR amplified products of a PKO-C175 colony.

[0050] FIG. 3: Induction expression analysis and purity analysis on a recombination fusion protein. A:1. Protein marker (KD); 2. BL21(DE3) is free of a PKO-C175 expression plasmid; 3. BL21(DE3) contains the PKO-C175 expression plasmid and is induced by non-IPTG; 4. BL21(DE3) contains the PKO-C175 expression plasmid and is induced by IPTG for 4 h. B: 1. Protein marker (KD); 2. BL21(DE3) contains the PKO-C175 expression plasmid and is induced by IPTG for 4 h; 3. Affinity purification of a C175-A sample containing a fusion protein; 4. Sample C175-B after removing the fusion protein via enterokinase digestion.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0051] The kit for the antigen-antibody combination detection of hepatitis C virus via a magnetic bead and a preparation method will be mainly further described specifically with reference to the drawings and specific examples below.

[0052] Reagents and Materials:

Example 1 HCV Antigen Preparation

[0053] (1) Preparation of an HCV-AgI envelope antigen: by means of genetic engineering, a lot of molecular biology analysis software were used to analyze and screen out HCV NS3, NS4, and a dominant epitope segment of the core antigen, and the sequence was SEQ ID NO. 1 (named W135); and the codons were optimized, and primers were designed (W135-F (SEQ ID No. 4):CGCGGATCCATGTCTACCAACCCGAAACCG; W135-R (SEQ ID No. 5):CCGGAATTCACGAGAAGCGAAAGCGATCA) to amplify a DNA segment corresponding to W135, and the forward primer respectively carried a BamHI restriction enzyme cutting site, and the reverse primer carried an EcoRI restriction enzyme cutting site. PCR fragments were recovered by a kit (purchased from Shanghai Huashun Biological Engineering Co., Ltd.), and digested by BamHI and EcoRI (enzymes for each molecular biology used in the present disclosure were purchased from Dalian Takara Bio Inc.), and linked onto an expression vector pET-24a (Novagen, Art. No.: 69864-3) after being subjected to BamHI and EcoRI digestion, thus obtaining a recombinant plasmid pET-24a-W135.

[0054] The above positive clone was subjected to shaking culture in a 500 ml LB medium with a 100 ug/ml kanamycin sulfate (Sangon Biotech, hereinafter referred to as, Sangon, Art. No.: KB0286) at 37° C. till OD600=1.0 around, then the remaining product was induced by IPTG (Sangon, Art. No.: IB0168) having a final concentration of 0.5 mM for 4 h at 37° C. The culture was centrifuged for 20 min at 4° C., 5000 g to collect bacterial cells, and bacterial cells in per liter of bacteria solution were resuspended by 20 ml a lysis buffer (50 mMTirs-HCl, pH=8.0, 1 mM EDTA, 100 mM NaCl), and ultrasonicated; The culture was centrifuged for 20 min at 4° C., 12000 g, and identified by SDS-PAGE electrophoresis, the majority of the target proteins were distributed in supernatant of the lysis solution. The supernatant was collected, and dropwisely added with a saturated ammonium sulfate solution (Guangdong Guanghua Chemical Reagents Company, Art. No.: 7783-202, pH was adjusted to 7.4) till ammonium sulfate had a final concentration of 25%, standing for 30 mm at 4° C.; centrifuged for 20 min at 4° C., 12000 g to collect supernatant, and the supernatant was continuously dropwisely added with a saturated ammonium sulfate solution till ammonium sulfate had a final concentration of 40%, standing for 30 mm at 4° C.; centrifuged for 20 min at 4° C., 12000 g to collect precipitate, then the precipitate was dissolved by a 5 ml equilibration buffer (10 mM Na.sub.2HPO.sub.4, 1.8 mM KH.sub.2PO.sub.4, 140 mM NaCl, 2.7 mM KCl, 25 mM imidazole (Sigma-Aldrich, Art. No.: 15513), pH=8.0). An equilibration buffer with a 10-fold column bed volume was used for the equilibrium of a Ni-NTA affinity column (Qiagen, Art. No.: 30210), then a protein sample was added, and the unbound protein was washed by the equilibration buffer with a 10-fold medium volume; the target protein was eluted by a 5-fold-volume elution buffer (20 mM Na.sub.2HPO.sub.4, 300 mM NaCl, 250 mM imidazole, pH=8.0), and imidazole was dialyzed, and a protein concentration was measured, and the protein was stored at −20° C. for further use.

[0055] (2) Preparation of an HCV-AgII labeled antigen: by means of genetic engineering, a lot of molecular biology analysis software were used to analyze and screen out HCV NS3, NS4, and a dominant epitope segment of the core antigen, and the sequence was SEQ ID No. 2 (named W102); and the codons were optimized, and primers were designed (W102-F (SEQ ID No. 6):CGCGGATCCATGTCTACCAACCCGAAACCG; W102-R (SEQ ID No. 7):CCGGAATTCAGCGATCAGACGGTTCATCCAC) to amplify a DNA segment corresponding to W102, and the forward primer respectively carried a BamHI restriction enzyme cutting site, and the reverse primer carried an EcoRI restriction enzyme cutting site. PCR fragments were recovered by a kit (purchased from Shanghai Huashun Biological Engineering Co., Ltd.), and digested by BamHI and EcoRI (enzymes for each molecular biology used in the present disclosure were purchased from Dalian Takara Bio Inc.), and linked onto an expression vector pGEX-6P-I (Phamacia, Art. No.: 27-4597-01) after being subjected to BamHI and EcoRI digestion, thus obtaining a recombinant plasmid of the labeled antigen of the present disclosure, hereinafter referred to as, 6P-W102.

[0056] The above positive clone was inoculated in a 500 ml LB medium containing 100 ug/ml ampicillin sodium (Sangon Biotech, Art. No.: A0339) for shaking culture at 37° C. till OD600=1.0 around, then the remaining product was induced by IPTG having a final concentration of 0.5 mM for 4 h at 37° C. The culture was centrifuged for 20 min at 4° C., 5000 g to collect bacterial cells, and bacterial cells in per liter of bacteria solution were resuspended by 20 ml a blood lysis buffer (50 mMTirs-HCl, pH=8.0, 1 mM EDTA, 100 mM NaCl), and ultrasonicated; The culture was centrifuged for 20 min at 4° C., 2000 g, and identified by SDS-PAGE electrophoresis, 80% of the target proteins were distributed in supernatant of a lysis solution. The supernatant was collected, and dropwisely added with a saturated ammonium sulfate solution till ammonium sulfate had a final concentration of 15%, standing for 30 mm at 4° C.; centrifuged for 20 min at 4° C., 12000 g to collect supernatant, then the supernatant was continuously and dropwisely added with a saturated ammonium sulfate solution till ammonium sulfate had a final concentration of 45%, standing for 30 min at 4° C.; centrifuged for 20 min at 4° C., 12000 g to collect precipitate, and then the precipitate was dissolved by a 10 ml equilibration buffer (pH=7.3 PBS, 140 mM NaCl, 2.7 mM KCl, 10 mM Na.sub.2HPO.sub.4, 1.8 mM NaH.sub.2PO.sub.4). An equilibration buffer with a 10-fold column bed volume was used for the equilibrium of a GSTrap affinity column (Ainersham, Art. No.: 17-5130-02), then a protein sample was added, and the unbound protein was washed by the equilibration buffer with a 10-fold medium volume; the target protein was eluted by a 5-fold-volume elution buffer (50 mM Tris-HCl, and 10 mM reduced glutathione (Amreseo, Art. No.: 0399), pH=8.0), and a protein concentration was measured, and the protein was stored at −20° C. for further use.

[0057] Similarly, HCV-AgI-1 and HCV-AgII-1 were prepared, where HCV-Ag 1-1 had a 1201st-1490th amino acid sequence of NS3, and HCV-AgII-1 had a 1890th-1923rd amino acid sequence of NS4.

Example 2 Preparation Process of HCV-Monoclonal Cells and Antibody Screening

[0058] 2.1 Obtaining of C175 Gene Segments of an HCV Core Antigen Protein and Construction of PET32a-C175 Clone

[0059] By means of genetic engineering, a lot of molecular biology analysis software were used to analyze and screen out dominant epitope segments of the core antigen, and the sequence was SEQ ID No. 3 (named C175); and the codons were optimized, and primers were designed (C175-F (SEQ ID No. 8):CGCGGATCCATGTCTACCAACCCGAAACCG; C175-R (SEQ ID No. 9):CCGGAATTCAGAGAAAGAGCAACCCGGCA) to amplify a DNA segment corresponding to C175; a PCR product was taken and identified by 1.5% agarose gel, an specific band about 500 bp could be seen and corresponded to the size of expected 525 bp, and the target band was cut off for recovery. The fragment digested by double enzymes BamHI and EcoRI was linked into a PET32a vector digested by double enzymes BamHI and EcoRI, then transformed into a BL21(DE3) strain and identified by PCR, a recombinant plasmid PET32a-C175 was subjected to sequencing to prove whether a gene C175 was inserted into the vector correctly without any base or amino acid mutation, thus ensuring a correct reading frame.

[0060] 2.2 Prokaryotic Expression and Purification of a Fusion Protein C175

[0061] Based on the above method, the genetically engineered bacteria containing the recombinant plasmid PET32a-C175 were induced by IPTG having a final concentration of 0.25 mM for 4 h. The result shows that there was an band of induced expression about 33 KD in the induced sample. The fusion protein was mainly expressed in a soluble form, and the molecular weight thereof accorded with the theoretical molecular mass. The remaining bacteria were ultrasonicated and centrifuged to collect supernatant, and the supernatant was subjected to Ni-affinity chromatography to obtain the fusion protein. A portion of the obtained fusion protein was reserved for further use, and another portion was digested by enterokinase to remove an N-terminal fusion protein, and reverse affinity chromatography was performed to obtain a non-fusion target protein, stored for further use. The protein sample was subjected to SDS-PAGE gel analysis; the fusion protein sample was named C175-A, about 33 KD, and the non-fusion protein sample was named C175-B, about 20 KD; and the purified target protein had a purity of 90% above.

[0062] 2.3 Antigenicity of HCV Core Antigens C175-A and C175-B

[0063] Purified target proteins C175-A and C175-B were respectively coated onto an ELISA plate to detect the HCV positive quality control serum by an indirect ELISA method; the result showed that 8 copies of quality control serum had better reactivity to two proteins and showed positive reaction; C175-A had a mean value of 1.090, and C175-B had a mean value of 1.219; 8 copies of non-HCV positive clinical serum for parallel comparison showed negative reaction, C175-A had a mean value of 0.025, and C175-B had a mean value of 0.014; by making a comparison between C175-A and C175-B, C175-B had slightly better reactivity. Directed to the result, researchers may consider that the assisted expression of the fusion protein PET32a and low temperature induction rendered the HCV core antigen protein to have better antigenicity.

[0064] As shown in the table below: Reactivity of the recombinant HCV core antigens C175-A and C175-B

TABLE-US-00002 ELISA of the recombinant HCV antigens C175-A and C175-B Positive P1 P2 P3 P4 P5 P6 P7 P8 C175-A 0.232 0.541 0.876 1.023 1.325 1.275 1.579 1.872 C175- B 0.415 0.587 0.965 1.334 1.397 1.382 1.657 2.013 Negative N1 N2 N3 N4 N5 N6 N7 N8 C175-A 0.032 0.024 0.018 0.021 0.023 0.028 0.017 0.034 C175-B 0.011 0.012 0.007 0.015 0.02 0.018 0.005 0.023

[0065] By comparison, C175-A and C175-B antigens had good reactivity to the HCV antibody positive serum; overall, the reactivity of C175-B was higher than C175-A; therefore, C175-B was selected to immunize mice.

[0066] 3 Immunization of Mice by a Recombinant Antigen

[0067] 1 ml C175-B antigen was taken and mixed with equivalent amount of freund's complete adjuvant, then the mixture was multi-injected into BALB/c mice subcutaneously/abdominally, and immunity was enhanced by injected abdominally 14 d after the primary immunization, and after injecting 4 injections for enhancing immunization, blood sampling was performed on the tail for titer determination, and the titer was up to the fusion requirements. Spleen was taken out under aseptic conditions for fusion use 3 d after mice were immunized for the last time.

[0068] 3.1 Preparation of a Hybridoma Cell Line

[0069] (1) Preparation of Feeder Cells Peritoneal macrophage of BALB/c mice served as feeder cells. BALB/c mice were sacrificed by cervical dislocation 1 d before fusion, and completely soaked by 75% ethyl alcohol, then skin of abdomen was opened by scissors under sterile operation in a super clean bench to expose peritoneum, and 5 mL RPMI 1640 basic culture solution was injected abdominally with an injector, and the peritoneum was washed repeatedly, and the washing fluid was recycled, then the obtained peritoneum was centrifuged for 5 min at 1000 rpm to preserve precipitate, then resuspended by a RPMI 1640 screening culture solution (a RPMI 1640 complete culture solution containing HAT), then cell concentration was adjusted to 1×10.sup.5/mL, then cells were added to a 96-well plate with 150 μL/well, and cultured overnight at 37° C., and 5% C02.

[0070] (2) Preparation of Immune Spleen Cells Spleen was taken out under aseptic conditions for fusion use 3 d after mice were immunized for the last time, and put on a plate, and washed for once by a RPMI 1640 basic culture solution, then put on a nylon net of a small beaker for grinding and filtering, and made into a cell suspension. The cell suspension was centrifuged to discard supernatant, and resuspended by a RPMI 1640 basic culture solution, and the operation was repeated for three times for counting.

[0071] (3) Preparation of Myeloma Cells

[0072] Mice myeloma cells Sp2I0 (stored by Fapon Biotech Inc.) were screened by 8-azaguanine, then cultured to a logarithmic phase, and two big bottles were taken and made into a cell suspension, and the cell suspension was centrifuged to discard supernatant, and resuspended by a RPMI 1640 basic culture solution, and the operation was repeated for three times for counting.

[0073] (4) Cell Fusion and HAT Selection of Hybridoma

[0074] Myeloma cells were mixed with immune spleen cells according to a ratio of 1:10, and washed for once with a RPMI 1640 basic culture solution in a 50 mL plastic centrifugal tube, and centrifuged for 8 min at 1200 rpm. Supernatant was discarded, and cells were mixed evenly, and slowly added with 1 mL 50% PEG1500 for fusion, 1 min after fusion, 15 mL RPMI 1640 basic culture solution was added to terminate cell fusion. Cells were centrifuged for 5 min at 1000 rpm. Supernatant was discarded, and cells were slightly suspended with 50 mL RPMI 1640 screening culture solution, and divided equally onto 10 pieces of 96-well plates having feeder cells, 50 μL/well, and cultured at 37° C., 5% CO.sub.2. When cells were cultured to the 6th day, HT culture solution (a RPMI 1640 complete culture solution containing HT) was changed for twice.

[0075] 3.2 Screening of Antibodies of Anti-HCV Core Antigen Protein C175

[0076] Core antigens C175-A and C175-B were coated on an ELISA plate overnight at 4° C., then blocked by 0.02 M pH=7.2 PBS containing 10% fetal bovine serum or 1% skim milk powder, 0.15 ml/well for 2 h at 37° C.; cells were added to culture supernatant for 30 min at 37° C., then 30 min later, goat-anti-mouse IgG labeled by horseradish peroxidase (produced by Fapon Biotech Inc., Art. No.: BA-PAB-MU0001) 2000-fold diluted was added at 37° C., 30 min later, 100 μL pH=5.0 citric acid-phosphate buffer containing 0.1% (M/V) o-phenylenediamine and 0.1% (V/V) hydrogen peroxide was added per well at 37° C. for 15 min, then 50 μl dilute sulphuric acid solution was added per well, and absorbance at 450 nm was measured. A RPMI 1640 complete culture solution served as a negative control, when a ratio of a measured value to a control value was ≥2.0, it was positive cell well.

[0077] 3.3 Construction of Monoclonal Antibody Cell Strains of Anti-HCV Core Antigen Protein

[0078] Cells were fused for 3 times and obtained 12 cell strains stably secreting anti-HCV core antigen 175B recombinant protein monoclonal antibodies in total, and the titer was within 10.sup.5-10.sup.7. The anti-HCV core antigen monoclonal antibodies were subjected to identification and classification of monoclonal antibodies by ELISA, where 6 monoclonal antibodies 3C-28, 11C-13, 14C-1, 1D-9, 8H-53, and 5G-28 were type IgG1; and 6 monoclonal antibodies 14C-77, 4G-19, 5B-36, 8D-73, 3G-42, and 2H-49 were type IgG2.

[0079] 3.4 Epitope Identification of Anti-HCV Core Antigen McABs

[0080] Cells were fused for 3 times and obtained 21 cell strains stably secreting anti-HCV core antigen 175B recombinant protein monoclonal antibodies in total, and the titer was within 10.sup.5-10.sup.7.The anti-HCV core antigen monoclonal antibodies were subjected to identification and classification of monoclonal antibodies by ELISA, where 6 monoclonal antibodies 3C-28, 11C-13, 14C-1, 1D-9-10, 8H-53, and 5G-28 were type IgG1; and 6 monoclonal antibodies 14C-77, 3F-41, 58-36, 8D-73, 7C-14-9, 2H-49, and 12F-19 were type IgG2a; and monoclonal antibodies 4D-19, 3C-7, 2D-32, 5G-12, 6F-78, 6G-5-1, and 15D-8 were type IgG2b.

[0081] 3.4 Epitope Identification of Anti-HCV Core Antigen McABs

[0082] 8 HCV short peptide antigens A1-A8 were respectively coated on micro-wells, PBS+20% NBS served as a diluent to dilute monoclonal antibodies to a concentration of primary antibodies, 1 ug/mL; goat-anti-mouse IgG served as a second antibody, and epitopes of the monoclonal antibodies were determined according to the reaction condition of each monoclonal antibody to different antigens.

[0083] The result was shown in the table below: the monoclonal antibodies prepared by the C175-B antigen could identify 5 epitopes; there is no monoclonal antibody to identify C70-100 and C120-C175; where the number of monoclonal antibodies identifying C17-35, C55-72 and C95-117 epitopes was up to the maximum, there were 5 monoclonal antibodies to identify C17-35, 6 monoclonal antibodies to identify C60-72 (C55-72 via further verification by analysis), and 7 monoclonal antibodies to identify C100-120aa (C95-117 via further verification by analysis). It can be seen from the above epitope identification that the major epitopes identified by antibodies were distributed into three segments C17-35, C55-72, and C95-117, moreover, the three segments had best reactivity to the antigen.

Epitope Identification of the HCV-Core Monoclonal Antibody

[0084]

TABLE-US-00003 Epitope identification of the HCV-core monoclonal antibody Monoclonal A1 A2 A3 A4 A5 A6 A7 A8 Scope of the No. antibody No. C1-25 C17-35 C30-49 C41-59 C55-72 C70-100 C95-117 C120-175 epitope identification 1 3C-28 − + + − − − − − 26-35aa 2 1D-9-10 − − − − + − − − 60-72aa 3 7B-18 − − − − − − + − 100-120aa 4 4G-19 − + − − − − − − 28-35aa 5 12F-19 − + − − − − − − 28-35aa 6 8H-53 − − − − − − + − 100-120aa 7 14C-77 − − − − + − − − 60-72aa 8 8D-73 − − − − + − − − 60-72aa 9 3C-7 − − − + − − − − 35-42aa 10 6F-78 − − − − − + − 100-120aa 11 5B-36 − − − − + − − − 60-72aa 12 5G-12 − − − − + − − − 60-72aa 13 11C-13 − − − − − − + − 100-120aa 14 14C-1 − + − − − − − − 28-35aa 15 5G-28 − − + − − − − − 35-42aa 16 2H-49 − − − − − − + − 100-120aa 17 2D-32 − + − − − − − − 26-35aa 18 6G-5-1 − − − − + − − − 60-72aa 19 3F-41 + − − − − − − −  1-25aa 20 15D-8 − − − − − − + − 100-120aa 21 7C-14-9 − − − − − − + − 100-120aa

[0085] 3.5 Antibody pairing Screening:

[0086] 21 monoclonal antibodies were subjected to an orthogonal experiment by an ELISA sandwich method. To detect the dilution, screening high-sensitivity compatible monoclonal antibodies by the C175B core antigen; magnetic beads-coated by 30-28, 140-1, 6F-78, 11C-13, 15D-8, and 3G-42 were paired with AE-labeled 14C-77, ID-9-10, 2H-49, and 8D-73 to show that 20 groups of monoclonal antibodies had good compatibility, capable of detecting 97 pg/ml; where 48.5 ng/mL could be detected when 140-1, 6F-78 and 11C-13 were paired with AE-labeled 1D-9-10, 14C-77, 2H-49, and 8D-73, showing that the highest sensitivity of 48.5 ng/mL could be detected for 4 groups of monoclonal antibodies. Moreover, it can be also seen that 14-77 had high affinity when used for labeling terminals and other antibodies, and could be reacted with 20 monoclonal antibodies, and had the maximum pairing success rate.

[0087] See the table below

TABLE-US-00004 Table of Data analysis on the minimum limit of detection (LOD) of the recombinant antigen by cross pairing with 24 groups of antibodies Reactivity of the C175B Cross pairing recombinant Magnetic bead antigen coated with AE-labeled antibody antibody Epitope 55-72aa 55-72aa 55-72aa 55-72aa 95-117aa 95-117aa 55-72aa 55-72aa 3C-28 17-35aa * / * / * / * / 14C-1 17-35aa * * * * * * * * 6F-76 95-117aa * * * * * * * * 11C-13 95-117aa * * * * * * * * 15D-8 95-117aa * / * / * / * / 3G-42 95-117aa * * * * * * * *

[0088] Remarks: / denotes no reaction after pairing, * denotes that the C175B antigen had better reactivity to two groups of antigen concentration (97 ng/ml and 48.5 ng/ml).

[0089] The pairing result indicated that epitopes C17-35 and C95-117 had activity superior to others when used for coating; epitopes C55-72 had activity superior to others when used for labeling; the combination effect of epitopes C95-117 and C55-72 was superior to the combination of C17-35 pairing to C55-72 in sensitivity.

[0090] 3.6 Screening of Natural Positive Samples of the Core Antigen

[0091] 78 samples (PCR positive and antibody positive) were collected in this laboratory; HCV core antigen detection kits purchased from Shandong Laibo Biotechnology Co., Ltd. were used to detect the positive core antigens in the 78 serum samples. The result showed that in the 78 serum samples, 47 samples had S/CO greater than the critical value, where the most of the serum samples had low reactivity, only 10 samples had S/CO greater than 5, and others were distributed within 1.0-5 of S/CO, indicating that the core antigen had a very low content in serum, additionally, a portion of may be probably neutralized by antibodies. Therefore, higher-activity antibody pairing was required to improve the detection sensitivity of the core antigen, and these core antigen positive samples were used in the subsequent process for screening the pairing monoclonal antibodies with high reactivity to natural core antigen positive samples.

[0092] 3.7 Screening of Compatible Monoclonal Antibodies Having a High Detection Rate to Natural Core Antigen Positive Samples by a Magnetic Affinity Immunoassay Platform of a Double-Antibody Sandwich Method.

[0093] We could not predict the detection rate of the screened antibody pairs to the core antigen positive samples in; therefore, antibodies 3C-28, 14C-1, 11C-13, 15D-8, and 3G-42 were respectively coated on magnetic beads and then paired with AE-labeled 14C-77, ID-9-10, 2H-49, and 8D-73, there were 20 groups of compatible monoclonal antibodies; 10 RNA-positive groups were picked; 5 groups having S/CO greater than 5 and 5 groups having S/CO greater than 1-4 were selected to survey the reaction situation to the natural positive samples: the detection rate of core positive samples via the cross-paired monoclonal antibody combination.

TABLE-US-00005 Reactivity to 10 core antigen positive samples pairing Cross Labeled 1D-9-10- 14C-TT- 2H-49- 8D-T3- Envelope antibody AE AE AE AE antibody Epitope C55-72aa C55-72aa C95-117aa C55-72aa 3C-28 17-35aa 6 copies  8 copies 5 copies 6 copies magnetic bead 14C-1 17-35aa 6 copies  8 copies 4 parts 8 parts magnetic bead 6F-78 magnetic 95-117aa 7 copies  9 copies 6 copies 6 parts bead 11C-13 95-117aa 8 copies 10 copies 5 parts 8 copies magnetic bead 15D-8 95-117aa 7 copies  8 copies 5 parts 7 copies magnetic bead 3G-42 95-117aa 8 copies  8 copies 4 parts 8 parts magnetic bead

[0094] Through the above screening, it can be seen that the monoclonal antibody pair of a combination of C95-117aa as an envelope paired with C55-72aa labeling has the maximum detection rate; 10 copies of serum were detected by 11C-13 paired with 14C-77-AE, superior to other pairing group, followed by a combination of C15-35aa paired with C55-72aa; the combination of C95-117aa as an envelope antibody paired with C95-117aa labeling and the combination of C17-35aa paired with 95-117aa had a minimum detection rate. The above result indicated that the dominant epitope pair for detecting the core antigen was mainly focused on the combination of C95-117aa as an envelope paired with C55-72aa labeling and the combination of C15-35aa paired with C55-72aa as an envelope antibody paired with C55-72aa labeling. Two groups of dominant epitope combinations were selected for the amplification of positive and clinical serum.

[0095] 3.8 Comparison on the Amplification of the Positive and Clinical Negative Serum in the Two Groups of Dominant Epitope Combinations

TABLE-US-00006 Comparison on sensitivity and specificity Copies of the Copies of positive the false samples positive detected samples in the detected in 48 core the 300 antigen clinical Envelope Labeled positive Detection negative Specificity antibody Epitope antibody samples rate (%) samples (%) 3C-28 17-35aa 14C-77-AE 40 copies 83.30% 3   99% magnetic bead 14C-1 17-35aa 14C-77-AE 42 copies 87.50% 4 98.60% magnetic bead 6F-78 95-117aa 14C-77-AE 46 copies 95.80% 2 99.30% magnetic bead 11C-13 95-117aa 14C-77-AE 48 copies   100% 1 99.60% magnetic bead 15D-8 95-117aa 14C-77-AE 44 copies  91.6% 1 99.50% magnetic bead 3G-42 95-117aa 14C-77-AE 46 copies  95.8% 2 99.30% magnetic bead

[0096] Conclusion: by comparison, the combination of 11C-13 envelope antibody paired with 14C-77 labeling having a consistent detection rate with the Shandong Laibo kit was screened, and the specificity also satisfied requirements. Other pairing had the problem of missing of partial low-value samples, which showed that the combination of C95-117aa envelope antibody paired with C55-72aa labeling was the optimum, and the combination of 11C-13 envelope antibody paired with 14C-77 labeling was superior to other pairing in sensitivity and specificity. Therefore, such a pairing was selected for the combined detection combination, thus achieving the preparation of a combined detection kit by a staggered epitope way.

[0097] Moreover, monoclonal antibodies specifically binding to a sequence in a 95-117 region and a sequence in a 55-72 region were purchased (HCV-Core-McAb23 and HCV-Core-McAb19were purchased from Fapon Biotech Inc.; the HCV-Core-McAb23 monoclonal antibody specifically bound to the sequence of the 95-117 region in the HCV core antigen; and the HCV-Core-McAb19 monoclonal antibody specifically bound to the sequence of the 55-72 region in the HCV core antigen). The antibodies with the highest sensitivity to C175-B and the reactivity of 10 natural samples positive to HCV-core antigens were measured. The result indicated that 10 natural samples were detected out via all the combinations of antibodies 2C-18, 3D-10, 5G-22, and HCV-Core-McAb23 directed against the epitope of the 95-117 region and 6G-15, 7H-3, and HCV-Core-McAb19 directed against the epitope of the 55-72 region; the reactivity to the core antigen was high, the detection rate of the natural HCV-core antigen positive samples was high, and the negative serum had good background. The above result also indicated that the detection sensitivity and specificity of the antibody combination directed against amino acids in 95-117aa and 55-72aa epitopes were superior to the pairing directed against other epitope antibodies. In the following experiment, an antibody 11C-13 as an envelope antibody/14C-77-AE pairing was selected for the experiment. 11C-13 was named HCV-AbI and 14C-77-AE was named HCV-AbII for the combined detection pairing.

Example 3 Preparation of Magnetic Bead-Labeled Antigens and Antibodies

[0098] 1) 10 mg carboxyl magnetic beads (Merk EM1-100/40 carboxyl magnetic beads) were taken and washed for 4 times with a activation buffer (100 mM MES, pH=5.5), 10 mL each time, and finally added with 8 mL activation buffer for ultrasonic dispersion. About NHS (10 mg) and EDC (5 mg) were weighed, (NHS (N-hydroxysuccinimide was purchased from Thermo, model: 24510) and EDC was purchased from Thermo, model: 22891), and respectively dissolved into 10 mg/mL and 1 mg/mL, then added with 1 mL NHS solution and 1 mL EDC solution, and mixed evenly, and subjected to rotary for 10 min at 30 rpm and room temperature.

[0099] 2) Magnetic separation was performed and supernatant was discarded without washing, and 9 mL crosslinked buffer (the same as the activation buffer: 100 mM MES, pH=5.5) was added directly for ultrasonic dispersion; the activated magnetic beads were divided into two parts; one part of 4.5 ml activated magnetic beads were taken and added to HCV-AbI 0.5 mL (4.0 mg/mL), and another part of 4.5 ml magnetic beads were added to 0.5 ml HCV-AgI (passed a Zeba spin desalting column before adding, and purchased from Thermo, model: 89891) for rotary (30 rpm) reaction for 4 h at room temperature.

[0100] 3) The magnetic beads were washed with 10 mL cleaning solution for twice; 10 mL blocking buffer (containing 0.5% BSA) was added for rotary (30 rpm) reaction for 4 h at room temperature.

[0101] 4) The magnetic beads were washed with 10 mL cleaning solution for 3 times; finally, 5 mL magnetic bead preservation liquid (25 mM MES+150 mM NaCl+0.2% (w/v) Casein+1 mM EDTA+5% (v/v) NBS+0.2% Proclin-300) was added respectively for resuspending to a final concentration of 10 mg/mL (solid content), stored at +2° C. to +8° C.

Example 4 Preparation of Avidin (SA) Coupling with Acridinium Ester (AE)

[0102] Example: The purified SA having a purity greater than 90% was taken and put to a dialysis bag for dialysis with 20 m MPB (pH=7.4) for 4 h; according to a ratio, AE (acridinium ester) was added for coupling (AE was purchased from Heliosense NSP-SA-NHS, model: 199293-83-9) and labeling for 10 min, and subsequently dialyzed for 4 h continuously, and the remaining solution was sucked out from the dialysis bag, and 50% glycerin was added for preservation at −20° C. for further use.

Example 5 Preparation of n Biotinylated HCV Antigen In Vitro

[0103] 1) sulfo-NHS-LC-biotin was used for labeling an amino of HCV antigen for description herein, and the labeling procedure was as follows:

[0104] 2) 1 mg HCV-AgII antigen was taken and dialyzed by a buffer (100 mM PB+150 mM NaCl, pH=7.2) overnight;

[0105] 3) biotin solution: 2.2 mg sulfo-NHS-LC-biotin were dissolved into 0.4 ml ultrapure water, and 143 μl biotin was taken and added to the above dialyzed antigen;

[0106] 4) a protein solution was mixed with the biotin solution according to a molar ratio of 1:50, and crosslinked for 2 h at 0-4° C.;

[0107] 5) the reaction solution was dialyzed in a buffer containing 0.05% SDS PB (100 mM PB, pH=7.2) to remove free biotin;

[0108] and 6) glycerin having a final concentration of 50% was added to the reaction solution for storage at −20° C. for further use.

Example 6 Preparation of a Biotinylated HCV Antibody In Vitro

[0109] 1) 4 mg HCV-AbII was taken and dialyzed by a buffer (100 mM PB+150 mM NaCl, pH=7.2) overnight;

[0110] 2) biotin solution: 2.2 mg sulfo-NHS-LC-biotin were dissolved into 0.4 ml ultrapure water, and 53 μl biotin was taken and added to the above dialyzed antibody;

[0111] 3) a protein solution was mixed with the biotin solution according to a molar ratio of 1:20, and crosslinked for 2 h at 2° C.-8° C., and dialyzed in a buffer containing 0.05% SDS PB (100 mM PB, pH=7.2) to remove free biotin;

[0112] and 4) glycerin having a final concentration of 50% was added to the reaction solution for storage at −20° C. for further use.

Example 7 Lysis Solution for Detecting the Antigen-Antibody Combination Detection

[0113] 1) 10-100 mM, preferably, 20 mM PB phosphate buffer was selected;

[0114] 2) denaturant: SDS had a concentration of 0.5%-1%, preferably, 0.8%.

[0115] 3) surfactant: NP-40 had a concentration of 0.5%-1%, preferably, 0.5%. TRITONX-100 and TWEEN-20 were added to 0.5%-1%, preferably, 0.5%.

[0116] 4) BSA protective protein: the concentration was 0.5%-1%, preferably, 1%.

[0117] 5) ammonium sulfate had a concentration of 1%-2.5%, preferably, 1%.

[0118] 6) absolute ethyl alcohol: the concentration may be 0.1%-10%, preferably, 1%.

[0119] Note: the above concentration ratio was a mass-volume ratio, and 1% denoted 1 g/100 mL

Example 8 Preparation of a Reagent in the Kit

[0120] 1. A magnetic bead working solution (preparation of a mixed solution of magnetic bead-labeled HCV-AbI and HCV-AgI): 10 mg/ml prepared HCV-AgI magnetic bead was diluted by a preservation liquid to 0.2 mg/ml, and 10 mg/ml HCV-AbI magnetic bead was diluted by a preservation liquid to 0.2 mg/ml, and the previous two groups of solution were mixed by a volume ratio of 1:2 for further use.

[0121] 2. A biotin working solution (preparation of a mixed solution of biotinylated HCV-AbII-BIO and HCV-AgII-BIO):

[0122] the labeled HCV-AgII-BIO was diluted by a biotin diluent (containing 20 mM PB+150 mM NaCl+0.1% Casein-2Na+0.1% P300+0.1% mercaptoethanol) to 0.2 mg/ml; and HCV-AgII-BIO was diluted by an HCV biotin diluent (containing 20 mM PB+150 mM NaCl+0.1% Casein-2Na+0.1% P300+0.1% mercaptoethanol) to 0.2 mg/mL, then the above two diluent were mixed by a ratio of 1:2 (the biotin diluent contained 1:1000 mercaptoethanol), where a reductant may be DTT, mercaptoethanol, and the like, preferably, mercaptoethanol.

[0123] 3. Preparation of an avidinylated label SA-AE:

[0124] SA-AE was diluted by a diluent, 200 mM HEPES+0.5% BSA+0.1% sodium azide to 0.5 pg/ml for further use, and 0.5 μg/ml blocker was added.

[0125] 4. Preparation of a lysis solution.

[0126] 5. Preparation of a 20× cleaning solution, and the cleaning solution was diluted to 1× for further use.

[0127] 6. Preparation of negative/positive quality control substances

[0128] 7. Preparation of an triggers.

[0129] A kit 1 was prepared by the above steps.

[0130] Similarly, HCV-AgI and HCV-AgII were replaced with HCV-AgI-I and HCV-AgII-1 in the kit to prepare a kit 2.

Example 9: Operation Process

[0131] 1. Preparation of a detection reagent;

[0132] 2. 50 μl magnetic bead working solution (a mixed solution of antigen and antibody magnetic beads)+100 μl sample+50 μl biotin working solution (a mixed solution of antigen and antibody biotin) were added per well for reaction for 15 min in a thermostat at 37° C.; then 50 μl lysis solution was added for reaction for 15 min in the thermostat at 37° C., and washed for 4 times;

[0133] 3. 200 μl avidinylated SA-AE was added per well for reaction for 10 min in a thermostat at 37° C., and washed for 4 times;

[0134] 4. 100 μl triggers A and 100 μl triggers B were added to measure a luminance value with an automatic chemiluminiscence instrument, and the luminance value was compared to the critical value, thus judging as positive or negative.

TABLE-US-00007 TABLE 5 Data comparison of antigen-antibody combined detection and single detection; result judgment: >1 denoted positive; and <1 denoted negative. Test results of the kit 1 Test Test Test by the Test by the result of result of combined combined the the magnetic magnetic magnetic magnetic bead bead bead bead detection detection detection detection antibody- antibody- Serum Serum core antibody core core Positive background background antigen kit antigen kit 1 antigen kit 2 sample No. antigen antibody kit (s/co) (s/co) (s/co) (s/co) P1 − + 0.04 15.17 16.25 16.51 P2 − + 0.04 11.65 10.6 10.84 P3 − + 0.12 12.89 13.51 13.29 P4 − + 0.025 9.46 10.04 10.11 P5 − + 0.04 14.36 13.04 13.20 P6 − + 0.05 17.03 18.1 18.03 P7 − + 0.07 15.84 16.96 16.87 P8 + + 2.33 9.26 16.3 16.22 P9 + + 4.56 12.64 15.69 15.06 P10 + + 5.24 15.5 18.5 18.27 P11 + + 4.63 10.25 16.13 15.83 P12 + + 6.18 5.63 14.25 14.05 P13 + + 3.05 6.25 13.25 12.94 P14 + + 1.54 9.56 12.54 12.38 P15 + + 2.98 15.73 18.1 17.53 P16 + − 4.56 0.051 5.46 4.86 P17 + − 10.53 0.062 11.45 11.23 P18 + − 6.12 0.016 8.15 7.98 P19 + − 5.26 0.032 5.42 5.36 P20 + − 3.64 0.047 3.79 3.83 200 pg/ml + − 5.13 0.042 5.45 5.55 core antigen quality control substance 100 pg/ml + − 2.09 0.032 3.514 3.64 core antigen quality control substance N1 − − 0.042 0.021 0.044 0.041 N2 − − 0.021 0.015 0.020 0.017 N3 − − 0.015 0.040 0.015 0.013 N4 − − 0.035 0.012 0.028 0.031 N5 − − 0.016 0.018 0.013 0.015 N6 − − 0.015 0.028 0.016 0.014 N7 − − 0.029 0.027 0.026 0.022 N8 − − 0.017 0.039 0.024 0.019 N9 − − 0.077 0.032 0.081 0.052 N10 − − 0.023 0.033 0.022 0.029 N11 − − 0.029 0.041 0.027 0.021 N12 − − 0.065 0.037 0.057 0.043 N13 − − 0.045 0.032 0.044 0.040 N14 − − 0.017 0.025 0.018 0.024 N15 − − 0.031 0.044 0.029 0.033 N16 − − 0.066 0.029 0.072 0.060 N17 − − 0.033 0.033 0.028 0.031 N18 − − 0.025 0.045 0.028 0.037 N19 − − 0.059 0.046 0.058 0.046 N20 − − 0.026 0.035 0.022 0.028 Comparison data of the lysis solution: Sohlin control lysis solution for Novel lysis Lysis solution for combination solution of the single detection of Sample Background detection present disclosure the core antigen Original fold of Ab+ 7.32 16.56 2.68 HCVP1 HCVP1/20 Ab+ 3.99 10.98 1.32 HCVP1/40 Ab+ 2.27 7.31 0.92 HCVP1/80 Ab+ 0.96 11.25 0.46 HCVP1/160 Ab+ 0.47 8. 56 0.15 HCVP1/2000 Ab+ 0.19 3.32 0.10 Original fold of Ab+ 8. 61 20.68 3.19 HCVP2 HCVP2/100 Ab+ 5.77 15.10 1.52 HCVP2/200 Ab+ 2.93 16.72 0.91 HCVP2/400 Ab+ 2.13 6.68 0.33 HCVP2/1000 Ab+ 0.74 3.54 0.28 HCVP2/4000 Ab+ 0.07 0.12 0.11 Sera 462 Ag+/Ab− 1.82 2.11 2.28 Sera 464 Ag+/Ab− 2.09 2.73 2.59 LC1 Ag−/Ab− 0.66 0.14 0.15 LC2 Ag−/Ab− 0.36 0.14 0.15 LC3 Ag−/Ab− 0.36 0.15 0.16 LC4 Ag−/Ab− 0.42 0.14 0.14 Data analysis table for the comparison on the effect of the lysis solution: (S/CO) result judgment: >1 denoted positive; and <1 denoted negative.

[0135] Conclusion: it can be seen from the above results that the adjusted lysis solution for the antigen-antibody combination detection had no influence on the detection of the antibody, and had lysis influences on the detection of the antigen, thus improving the detection rate of the antigen.

[0136] Therefore, the anti-HCV antigen monoclonal antibody of the present disclosure has no overlapped epitope, thus avoiding the problem that epitopes are difficultly staggered for the antigen-antibody combination detection. The anti-HCV antigen monoclonal antibody and HCV recombinant antigen of the present disclosure are free of cross reaction, thus free from influencing the activity and advantageously avoiding the problem of cross reaction and loss of the detection activity. The method and kit of the present disclosure remarkably shortens the window phase, reduces the risk of missing detection and workload, and lowers the manpower, instrument and reagent costs of the two methodologies when used for detection alone, thus improving the virus detection rate and sensitivity.