Mannanase PMAN5A mutant having improved heat resistance, gene thereof, and application
11407987 · 2022-08-09
Inventors
- Huiying Luo (Beijing, CN)
- Bin YAO (Beijing, CN)
- Weina Liu (Beijing, CN)
- Yuan Gu (Beijing, CN)
- Tao Tu (Beijing, CN)
- Yuan Wang (Beijing, CN)
- Yaru Wang (Beijing, CN)
- Huoqing Huang (Beijing, CN)
- Yingguo Bai (Beijing, CN)
- Xiaoyun Su (Beijing, CN)
- Kun Meng (Beijing, CN)
Cpc classification
C12Y302/01025
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
International classification
A61K38/47
HUMAN NECESSITIES
C12N15/63
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a mannanase PMan5A mutant having improved heat resistance, a gene encoding the mutant and application thereof. The mutant is obtained by a substitution of histidine with tyrosine at amino acid residue 93, phenylalanine with tyrosine at amino acid residue 94, leucine with histidine at amino acid residue 356, and/or alanine with proline at amino acid residue 389. The thermal tolerance of the single site mutation mutant H93Y, L356H and A389P are greatly improved over that of the wild-type mannanase PMan5A, and the thermal tolerance of the combination mutants shows the stack effect of the single site mutation, demonstrating the amino acids at the sites of 93, 94, 356, and 389 play an important role for the thermal stability of the mannanase of GH5 family.
Claims
1. A mannanase mutant comprising a substitution at amino acid residue 93 of said mannanase mutant, wherein the mannanase mutant is a PMan5A having the amino acid sequence of SEQ ID NO: 2, wherein histidine is substituted with tyrosine at amino acid residue 93, and wherein said mannanase mutant has improved thermal stability and further comprises a substitution at amino acid residues 94, and/or 356, and/or 389.
2. The mannanase mutant of claim 1, wherein phenylalanine is substituted with tyrosine at amino acid residue 94, and/or leucine is substituted with histidine at amino acid residue 356, and/or alanine is substituted with proline at amino acid residue 389.
3. The mannanase mutant of claim 1, wherein said mannanase mutant is recombinantly prepared by: (1) transforming a host cell with a recombinant vector comprising a gene encoding the mannanase mutant to obtain a recombinant strain; (2) culturing the recombinant strain and inducing to express a recombinant mannanase mutant; and (3) recovering and purifying the recombinant mannanase mutant.
Description
BRIEF DESCRIPTIONS OF THE DRAWINGS
(1)
(2)
EMBODIMENT
(3) Test Materials and Reagents
(4) 1. Strains and vectors: host: Pichia pastoris GS115; and vector pPIC9;
(5) 2. Enzymes and other biochemical reagents: Site-Mutation Kit, restriction endonucleases; and ligase.
(6) 3. Medium:
(7) (1) E. coli. LB medium: 1% of peptone, 0.5% of yeast extract, and 1% of NaCl, natural pH;
(8) (2) YPD medium: 1% of yeast extract, 2% of peptone, and 2% of glucose;
(9) (3) MD solid medium: 2% of glucose, 1.5% of agarose, 1.34% of YNB, and 0.00004% of biotin;
(10) (4) BMGY medium: 1% of yeast extract; 2% of peptone; 1.34% of YNB, 0.00004% of Biotin; and 1% of glycerol(V/V).
(11) (5) BMMY medium: 1% of yeast extract; 2% of peptone; 1.34% of YNB, 0.00004% of Biotin; and 0.5% of methanol (V/V).
(12) Suitable biology laboratory methods not particularly mentioned in the examples as below can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N Y, 1989), and other kit laboratory manuals.
Example 1 Constructing the Strain Comprising the Mutant Mannanase
(13) (1) Constructing the Expression Vector and Expressing in Pichia pastoris GS115
(14) The mutation primers H93Y F/R, F94Y F/R, L356H F/R and A389P F/R (as shown in Table 1) were designed at the sites of H93, F94, L356 and A389, for performing the PCR application using plasmid Pman5A-pPIC9 comprising the mannanase gene from Penicillium sp. WN1 as the template with Site-Mutation Kit. The PCR product was demethylated by DMT enzyme and transformed into DMT competent cells, followed by selecting monoclonal cells and verifying the positive transformants by DNA sequencing. The transformants confirmed by sequencing were used to prepare a large number of recombinant plasmids.
(15) TABLE-US-00014 TABLE 1 Primers for constructing the mutant of the wild mannanase PMan5A Length Primers Sequence (5′.fwdarw.3′) (bp) H93Y F GACGGTAAAAAGGGGTACTTTGCTGG 26 H93Y R ACCCCTTTTTACCGTCAATCACGAAG 26 F94Y F GTAAAAAGGGGCACTATGCTGGTACA 26 F94Y R TAGTGCCCCTTTTTACCGTCAATCACG 27 L356H F GTATGGTTCAACTAGTCACTGTAGCTCC 28 L356H R TGACTAGTTGAACCATACTCTTCGAGGA 28 A389P F GAGTACTGGACAGTCTCCGCATGACGAGT 29 A389P R CGGAGACTGTCCAGTACTCAATGTATCAC 29
(16) The recombinant vector that was connected with the expressing vector pPIC9 and confirmed by sequencing was linearized with the endonuclease Dra I and transformed into competent cells of Pichia pastoris GS115, followed by being cultured for 2 to 3 days at 30° C., and selecting the transformants on MD plates for the further expression test to obtain the recombinant yeast strain.
(17) (2) Screening of the Transformants with High Mannanase Activity
(18) The single colony on the MD plate was selected with a sterilized toothpick and numbered on the MD plates which were incubated at 30° C. for 1 to 2 days until the colony grown. The transformants were inoculated in a centrifuge tube containing 3 mL BMGY medium, and cultured according to their number, cultured at 30° C. and 220 RPM for 48 h followed by centrifuging at 3,000×g for 15 min to remove supernatant, and adding 1 mL BMMY medium containing 0.5% of methanol into the centrifuge tube for induction culturing at 30° C. and 220 RPM for 48 h to collect the supernatant by centrifuging at 3,000×g for 5 min for detecting the activity. Finally, the transformant with high glucose oxidase activity were screened out. The particular operation refers to Pichia pastoris expression manual.
Example 2 Preparation of the Mannanase Mutant and Wild Enzyme Fermentation Broth
(19) (1) Expression of the Mutant Gene at Shake Flask Level in Pichia pastoris
(20) The screened transformant with the highest activity was inoculated in 30 ML of YPD medium for 48 h for seed amplification, followed by being incubated in 300 mL of BMGY for 48 h at 30° C. and 220 rpm, and then being spun down by centrifuging at 3000 rpm for 5 min to remove the supernatant. The obtained precipitate was suspended in 200 mL of BMMY containing 0.5% of methanol to induce the mannanase gene expression at 30° C. and 220 rpm with addition of 1 mL of methanol solution every 12 hours to keep concentration of methanol as 0.5% by compensating the loss of methanol. After induction, the supernatant was recovered by spinning to test the activity of the enzyme.
(21) (2) Purifying the Recombinant Mannanase
(22) The supernatant of the recombinant mannanase expressed in the shaking bottle was collected followed by being concentrated with 10 kDa membrane package while replacing the medium of the fermentation broth with low salt buffer, and further concentrated with 10 kDa ultrafiltration tube. The concentrated solution was further purified with ion exchange chromatography by loading 2.0 mL of the wild mannanase and the mutants concentrate into anion column sold under the trademark HiTrap® Q Sepharose® XL pre-balanced with 10 mMPBS (pH 7.2), and eluting with NaCL in linear gradient of 0 to 1 mol/L, to detect enzyme activity and determine protein concentration of the eluent collected step by step.
Example 3 Measuring the Activity and the Properties of the Recombinant Mannanase
(23) The enzymatic activity of mannanase was determined with UV spectrophotometer by the steps of performing the enzymatic reaction at the certain temperature and pH for 10 min, wherein 1 mL of said enzymatic reaction system included 100 μL of appropriate diluted enzyme solution and 900 μL of substrate, adding 1.5 mL of DNS to terminate the reaction, boiling for 5 min, cooling, measuring the absorbance at 540 nm and calculating the enzymatic activity. A unit of enzymatic activity (U) is defined as the amount of enzyme to produce 1 μmol of reducing sugar by decomposing carrageenan per minute under given conditions.
(24) (1) Measuring the Optimum Temperature and Thermal Stability for the Wild and the Mutant Mannanase
(25) The wild and the mutant mannanase were reacted in the different temperatures from 40 to 90° C. at pH 5.0 in citric acid disodium hydrogen phosphate buffer system to determine their optimum temperature.
(26) As shown in
(27) The optimum temperatures of the double-sites mutation mutant H93Y/F94Y, H93Y/L356H, H93Y/A389P and L353/A389P were 80° C., 80° C., 85° C. and 75° C. which were 10° C., 10° C., 15° C. and 5° C. higher than that of the wild mannanase Pman5A respectively, wherein the optimum temperature of the mutant H93Y/A389P was only increased by 5° C. comparing with that of the single-site mutation mutant H93Y, and the double-sites combination mutation mutants showed the stack effect to the increase of the optimum temperature comparing with the single-site mutation mutants H93Y and A389P.
(28) And, the combination mutation mutants H93/L353/A389P and H93/F94Y/L353/A389P showed the same stack effect, and have the optimum temperatures increased to 85° C.
(29) (2) Measuring T.sub.m Values of the Wild and the Mutant Mannanase
(30) 0.25 mg of the protein sample was solved into 1 mL of 10 mM citric acid disodium hydrogen phosphate buffer solution in pH 7.2 to scan at 25 to 100° C. with the scanning speed of 1° C./min. The results were shown in Table 2.
(31) TABLE-US-00015 TABLE 2 T.sub.m values of the wild and the mutant mannanase variant T.sub.m (° C.) Δ T.sub.m (° C.) Pman5A 61.8 ± 0.04 H93Y 69.2 ± 0.02 7.5 F94Y 61.8 ± 0.05 0.1 L356H 63.5 ± 0.18 1.7 A389P 66.8 ± 0.21 5.0 H93Y/F94Y 69.4 ± 0.11 7.6 H93Y/L356H 70.4 ± 0.02 8.7 H93Y/A389P 71.9 ± 0.09 10.1 L356H/A389P 67.4 ± 0.10 5.6 H93Y/F94Y/L356H 69.7 ± 0.28 7.9 H93Y/L356H/A389P 75.3 ± 0.08 13.5 H93Y/F94/L356H/A389P 75.5 ± 0.12 13.8
(32) As shown in Table 2, the T.sub.m values of the wild mannanase Pman5A was 61.8° C., and those of the single site mutation mutants H93Y and A389P were 69.2° C. and 66.8° C., which were increased by 7.5° C. and 5.0° C. comparing that of the wild mannanase respectively. And, the T.sub.m value of said two sites combination mutation mutant was increased to 71.9° C. which was 10.1° C. higher than that of the wild mannanase Pman5A, demonstrating the importance of the sites of H93 and A389 for the thermal stability of the wild mannanase Pman5A and the stack effect.
(33) Although the T.sub.m values of the mutants F94Y and L356H were increased comparing that of the wild mannanase Pman5A, when combined with the other sites, the obtained mutants showed the stack effect of the T.sub.m values. For example, the T.sub.m value of the mutant H93Y/L356H/A389P was 75.3° C., and increased by 0.3° C. when combined with the mutation of F94Y.
(34) (3) Determination of T50 Value and Half-Life of Mutant and Wild Mannanase
(35) The mutant and wild mannanase were diluted to 70 μg/mL with Na.sub.2HPO.sub.4-citric acid buffer at pH 5.0, followed by being treated for 30 min at the different temperatures of 60 to 80° C. without the substrate, and being putting on the ice to determine the remaining activity at pH 5.0 and their optimum temperatures. The results were shown in Table 3.
(36) The mutant and wild mannanase were diluted to 70 μg/mL with Na.sub.2HPO.sub.4-citric acid buffer at pH 5.0, followed by being treated for 30 min at the temperatures of 70° C., 75° C. and 80° C. without the substrate, and being putting on the ice to determine the remaining activity at pH 5.0 and their optimum temperatures and calculate the time of the remaining enzyme activity being half of the highest enzyme activity at a certain temperature, which was half-life at such temperature. The results were shown in Table 3.
(37) TABLE-US-00016 TABLE 3 T.sub.50 and t.sub.1/2 values of the wild and the mutant enzyme t.sub.1/2 (min) T.sub.50 (° C.) 70° C. 75° C. 80° C. Pman5A 66 4 2 — H93Y 73 64 10 3 F94Y 66 4 2 — L356H 68 14 4 — A389P 70 45 5 2 H93Y/F94Y 73 75 17 3 H93Y/L356H 75 / 55 5 H93Y/A389P 79 / 120 14 L356H/A389P 70 31 5 3 H93Y/F94Y/L356H 76 / 47 5 H93Y/L356H/A389P 79 / 120 14 H93Y/F94/L356H/A389P 80 / 180 27 wherein “/” indicates that the treatment time is too long to be determined; and “—” indicates there is no enzyme activity within 2 min of treatment
(38) As shown in Table 3, the T.sub.50 values of the wild mannanase Pman5A was 66° C., and those of the single site mutation mutants H93Y, L356H and A389P were 73° C., 68° C. and 70° C. which were increased by 7.0° C., 2.0° C. and 4° C. comparing that of the wild mannanase Pman5A, respectively, while the T.sub.50 value of the mutant F94Y kept unchanged, thus demonstrating that the mutations of H93Y, L356H and A389P were the keys for improving the thermal stability of the wild mannanase of GH5 family and generated a stack effect.
(39) And, the T.sub.50 values of the combination mutation mutants H93Y/L356H and H93Y/A389P were increased by 2° C. and 6° C. compared that of the mutant H93Y, and the T.sub.50 value of the combination mutation mutant L356H/A389P was increased by 2° C. compared with that of the mutant L356H, thus demonstrating that the combination mutation mutants showed the stack effect to the thermal stability.
(40) The multi-sites combination mutation mutant H93Y/F94Y/L356H, H93Y/L356H/A389P and H93Y/F94Y/56H/A389P showed the improved thermal stability, and had the T.sub.50 values of 76° C., 79° C. and 80° C. which were 10° C., 13° C. and 14° C. higher than that of the wild mannanase Pman5A.
(41) And, t.sub.1/2 values of the four single-site mutation mutants H93Y, F94Y, L356H and A389P were 64 min, 4 min, 14 min and 45 min at 70° C., showing the improvement of the thermal stability, and the thermal stability of the combination mutation mutants ranked as the mutant L353/A389P<the mutant H93Y/F94Y<the mutant H93Y/F94Y/L356H<the mutant H93Y/A389P<the mutant H93Y/L356H/A389P<the mutant H93Y/F94Y/L356H/A389P at 75° C., demonstrating the stack effect of the combination mutation mutants to the improvement of the thermal stability, wherein the mutant H93Y/F94Y/L356H/A389P had the best thermal stability of remaining half of the enzyme activity after being treated for 3 h at 75° C., and had a half-life of 27 min at 80° C.
(42) (4) Determination of the Kinetic Parameters of the Mutant and Wild Mannanase
(43) The enzyme activity was determined by reacting for 5 min at 85° C., 80° C. and 70° C. and pH5.0 using the different concentrations of locust bean gum in 5 mg/mL, 2.5 mg/mL, 2 mg/mL, 1 mg/mL, 0.75 mg/mL, 0.5 mg/mL, and 0.375 mg/mL as the substrate, and the K.sub.m value and V.sub.max value were calculated with software GraFit7. The results were shown in Table 4.
(44) TABLE-US-00017 TABLE 4 the kinetic parameters of the mutant and wild mannanase V.sub.max Specific K.sub.m (μmol min.sup.−1 kcat/K.sub.m activity (mg mL.sup.−1) mg.sup.−1) (mL s.sup.−1 mg.sup.−1) (U mg.sup.−1) Pman5A 0.51 1115 1628 1276 H93Y 0.68 1862 2066 1537 F94Y 0.87 2048 1758 1612 L356H 0.87 2489 2155 1237 A389P 0.86 1679 1471 1609 H93Y/F94Y 0.70 1941 2067 1769 H93Y/L356H 0.68 2046 2263 1585 H93Y/A389P 0.81 2261 2081 1742 L356H/A389P 0.73 1977 2039 1712 H93Y/F94Y/ 0.73 2468 2549 1921 L356H H93Y/L356H/ 0.58 1641 2134 2202 A389P H93Y/F94/ 0.67 2225 2485 2226 L356H/A389P
(45) As shown in Table 4, the catalytic efficiency of all the mutants were improved compared with that of the wild mannanase Pman5A, wherein the improvement of the catalytic efficiency of the mutants ranked as the single site mutation mutant<double-sites mutation mutant<multiple-sites mutation mutant. The specific activity was increased from 1276 U/mg of the wild mannanase Pman5A to 2226 U/mg of the combination mutation mutants H93Y/F94Y/L356H/A389, which increased by about 0.7 times, and the catalytic efficiency was increased by 0.5 times.