SINGLE-GENE SINGLE-BASE RESOLUTION RATIO DETECTION METHOD FOR RNA CHEMICAL MODIFICATION

Abstract

Provided is a method for detecting the chemical modification of a target RNA site X, comprising the steps as follows: (1) acquiring an RNA sample and selecting in the RNA sample a target RNA segment comprising the target RNA site X; (2) SELECT; (3) PCR amplification; (4) comprising the PCR cycle threshold value with a reference PCR cycle threshold value, or comparing the PCR amplification product quantity with a reference PCR amplification product quantity, so as to determine whether there is a target chemical modification in the target RNA site X. Further provided are a method for identifying a substrate target site of RNA modification enzyme or RNA demodification enzyme and a method for quantifying an RNA modification rate in a transcript.

Claims

1. A method for detecting a chemical modification of an RNA target site X, comprising: (1) obtaining an RNA sample, and selecting a target RNA segment containing an RNA target site X in the RNA sample; (2) SELECT step: designing an up probe Px1 and a down probe Px2 for an upstream sequence and a downstream sequence of the RNA target site X within the target RNA segment, respectively, elongating the down probe Px2 through a DNA polymerase to obtain an elongated down probe Px2, and ligating the up probe Px1 and the elongated down probe Px2 through a ligase to obtain a SELECT product; wherein, the up probe Px1 is complementary paired with the upstream sequence of the RNA target site X, and the first nucleotide of 5′-terminal of the up probe Px1 is complementary paired with a nucleotide located at a site with a distance of 1 nt from the RNA target site X at the upstream sequence of the RNA target site X; the down probe Px2 is complementary paired with the downstream sequence of the RNA target site X, and the first nucleotide of 3′-terminal of the down probe Px2 is complementary paired with a nucleotide located at a site with a distance of 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nt from the RNA target site X at the downstream sequence of the RNA target site X; (3) PCR amplification step: performing PCR amplification of the SELECT product obtained in step (2), determining a threshold cycle of PCR or an amount of PCR amplification product; and (4) comparing the threshold cycle of PCR to a threshold cycle of PCR reference, or comparing the amount of PCR amplification product to an amount of PCR amplification product reference, to determine if the target chemical modification is present at the RNA target site X.

2. The method according to claim 1, wherein the chemical modification is selected from the group consisting of m.sup.6A modification, m.sup.1A modification, pseudouridine modification, and 2′-O-methylation modification.

3. The method according to claim 1, wherein the DNA polymerase is Bst 2.0 DNA polymerase or Tth DNA polymerase; and the ligase is selected from the group consisting of SplintR ligase, T3 DNA ligase, T4 RNA ligase 2, and T4 DNA ligase.

4. The method according to claim 1, wherein, in step (4), the threshold cycle of PCR reference is a threshold cycle of first PCR reference or a threshold cycle of second PCR reference, wherein: the threshold cycle of first PCR reference is: a threshold cycle of PCR of a first reference sequence determined by a method as same as that of the target RNA segment, wherein the first reference sequence comprises at least a nucleotide sequence II, and the nucleotide sequence II comprises a nucleotide sequence sharing a same nucleotide sequence with a nucleotide sequence I in the target RNA segment, wherein the nucleotide sequence I is a nucleotide sequence from a nucleotide that is complementary paired with the first nucleotide of 3′-terminal of the up primer of the site X to a nucleotide that is complementary paired with a nucleotide of 5′-terminal of the down primer of the site X in the RNA target segment, and no target chemical modification is present in an RNA target site X1 of the first reference sequence corresponding to the RNA target site X of the target RNA segment; or the threshold cycle of second PCR reference is: a threshold cycle of PCR of a second reference sequence determined by a method as same as that of the target RNA segment, wherein the second reference sequence comprises at least a nucleotide sequence II, and the nucleotide sequence II comprises a nucleotide sequence sharing a same nucleotide sequence with a nucleotide sequence I in the target RNA segment, wherein the nucleotide sequence I is a nucleotide sequence from a nucleotide that is complementary paired with a nucleotide of 3′-terminal of the up primer of the site X to a nucleotide that is complementary paired with a nucleotide of 5′-terminal of the down primer of the site X in the RNA target segment, and the target chemical modification is present in an RNA target site X2 of the second reference sequence corresponding to the RNA target site X of the target RNA segment.

5. The method according to claim 4, wherein: when the threshold cycle of PCR is more than the threshold cycle of first PCR reference, it is determined that the target chemical modification is present in the RNA target site X; or when the threshold cycle of PCR is equal to the threshold cycle of second PCR reference, it is determined that the target chemical modification is present in the RNA target site X.

6. The method according to claim 5, wherein, when the threshold cycle of PCR is at least 0.4-10 cycles more than the threshold cycle of first PCR reference, it is determined that the target chemical modification is present at the RNA target site X.

7. The method according to claim 1, wherein, in step (4), the amount of PCR amplification product reference is an amount of first PCR amplification product reference or an amount of PCR second amplification product reference, wherein: the amount of first PCR amplification product reference is: an amount of PCR amplification product of a first reference sequence determined by a method as same as that of the target RNA segment, wherein the first reference sequence comprises at least a nucleotide sequence II, and the nucleotide sequence II comprises a nucleotide sequence sharing a same nucleotide sequence with a nucleotide sequence I in the target RNA segment, wherein the nucleotide sequence I is a nucleotide sequence from a nucleotide that is complementary paired with a nucleotide of 3′-terminal of the up probe Px1 of the site X to a nucleotide that is complementary paired with a nucleotide at 5′-terminal of the down probe Px2 of the site X in the RNA target segment, and no target chemical modification is present in an RNA target site X1 of the first reference sequence corresponding to the RNA target site X of the target RNA segment; or wherein, the amount of second PCR amplification product reference is: an amount of PCR amplification product of a second reference sequence determined by a method as same as that of the target RNA segment, wherein the second reference sequence comprises at least a nucleotide sequence II, and the nucleotide sequence II comprises a nucleotide sequence sharing a same nucleotide sequence with a nucleotide sequence I in the target RNA segment, wherein the nucleotide sequence I is a nucleotide sequence from a nucleotide that is complementary paired with a nucleotide of 3′-terminal of the up probe Px1 of the site X to a nucleotide that is complementary paired with a nucleotide of 5′-terminal of the down probe Px2 of the site X in the RNA target segment, and the target chemical modification is present in an RNA target site X2 of the second reference sequence corresponding to the RNA target site X of the target RNA segment.

8. The method according to claim 7, wherein: when the amount of PCR amplification product is less than the amount of first PCR amplification product reference, it is determined that the target chemical modification is present in the RNA target site X; or when the amount of PCR amplification product is equal to the amount of second PCR amplification product reference, it is determined that the target chemical modification is present in the RNA target site X.

9. The method according to claim 1, the method further comprises following steps: (c) controlling initial RNA input amounts, randomly selecting an RNA non-target site N in the target RNA segment; designing an up probe Pn1 and a down probe Pn2 for an upstream sequence and a downstream sequence of the RNA non-target site N, respectively, elongating the down probe Pn2 through a DNA polymerase to obtain an elongated down probe Pn2, and ligating the up probe Pn1 and the elongated down probe Pn2 through a ligase to obtain a SELECT product; performing PCR amplification of the SELECT product, and determining a threshold cycle of FOR; controlling the initial RNA input amounts of the target RNA segment according to the threshold cycle of PCR, so that the initial RNA input amounts of the target RNA segment is equal to initial RNA input amounts of a first reference sequence or a second reference sequence; wherein, the first reference sequence comprises at least a nucleotide sequence II, and the nucleotide sequence II comprises a nucleotide sequence sharing a same nucleotide sequence with a nucleotide sequence I in the target RNA segment, wherein when the site N is located upstream of the site X, the nucleotide sequence I is a nucleotide sequence from a nucleotide that is complementary paired with a nucleotide of 3′-terminal of the up probe Pn1 of the site N to a nucleotide that is complementary paired with a nucleotide of 5′-terminal of the down probe Px2 of the site X in the target RNA segment; when the site N is located downstream of the site X, the nucleotide sequence I is a nucleotide sequence from a nucleotide that is complementary paired with a nucleotide of 3′-terminal of the up probe Px1 of the site X to a nucleotide that is complementary paired with a nucleotide of 5′-terminal of the down probe Pn2 of the site N in the target RNA segment; and no target chemical modification is present in an RNA target site X1 of the first reference sequence corresponding to the RNA target site X of the target RNA segment; or the second reference sequence comprises at least a nucleotide sequence II, and the nucleotide sequence II comprises a nucleotide sequence sharing a same nucleotide sequence with a nucleotide sequence I in the target RNA segment, wherein when the site N is located upstream of the site X, the nucleotide sequence I is a nucleotide sequence from a nucleotide that is complementary paired with a nucleotide of 3′-terminal of the up probe Pn1 of the site N to a nucleotide that is complementary paired with a nucleotide of 5′-terminal of the down probe Px2 of the site X in the target RNA segment, when the site N is located downstream of the site X, the nucleotide sequence I is a nucleotide sequence from a nucleotide that is complementary paired with a nucleotide of 3′-terminal of the up probe Px1 of the site X to a nucleotide that is complementary paired with a nucleotide of 5′-terminal of the down probe Pn2 of the site N in the target RNA segment; and target chemical modification is present in an RNA target site X2 of the second reference sequence corresponding to the RNA target site X of the target RNA segment.

10. The method according to claim 1, wherein the SELECT step is performed in a reaction system comprising: an RNA sample; dNTP; a DNA polymerase; a ligase.

11. The method according to claim 1, wherein the SELECT step is performed at a reaction temperature of 30-50° C.

12. The method according to claim 1, wherein the method further comprises following step prior to the step (1): treating the RNA sample with an RNA demodification enzyme or a mixture of the RNA demodification enzyme and EDTA, respectively; wherein the RNA sample treated with the RNA demodification enzyme is used as a first reference sequence.

13. The method according to claim 1, wherein the RNA sample is total RNA, mRNA, rRNA, or lncRNA extracted from cells.

14. A method for identifying a target site of an RNA modification enzyme or an RNA demodification enzyme, comprising: (1) preparing RNA modification enzyme—deficient or RNA demodification enzyme—deficient cells, or RNA modification enzyme—low expressed or RNA demodification enzyme—low expressed cells, culturing the cells and extracting an RNA after culturing the cells; (2) determining a threshold cycle of PCR or an amount of PCR amplification product for an RNA target site X according to the steps (1)-(3) in the method of claim 1; (3) comparing the threshold cycle of PCR with a threshold cycle of PCR reference, or comparing the amount of PCR amplification product with an amount of PCR amplification product reference, to determine if a chemical modification is performed by the RNA modification enzyme or the RNA demodification enzyme at the RNA target site X, wherein, the threshold cycle of PCR reference is a threshold cycle of PCR for a normal cell determined by a method as same as that of the RNA modification enzyme—deficient or the RNA demodification enzyme—deficient cells, or the RNA modification enzyme—low expressed or the RNA demodification enzyme—low expressed cells, the amount of PCR amplification product reference is an amount of PCR amplification product for the normal cell determined by a method as same as that of the RNA modification enzyme—deficient or the RNA demodification enzyme—deficient cells, or the RNA modification enzyme—low expressed or the RNA demodification enzyme—low expressed cells; wherein the target site is a single gene-single site.

15. The method according to claim 14, wherein the RNA chemical modification is selected from the group consisting of m.sup.6A modification, m.sup.1A modification, pseudouridine modification and 2′-O-methylation modification; the RNA chemical modification enzyme includes m.sup.6A modification enzyme.

16. A method for quantifying a RNA modification rate in transcripts, comprising: (1) obtaining an RNA sample, and selecting a target RNA segment containing an RNA target site X in the RNA sample; (2) determining an amount of the target RNA segment in the RNA sample, comprising: (2a) randomly selecting an RNA non-target site N in the target RNA segment; designing an up probe Pn1 and a down probe Pn2 for an upstream sequence and a downstream sequence of the RNA non-target site N, respectively, elongating the down probe Pn2 through a DNA polymerase to obtain an elongated down probe Pn2, and ligating the up probe Pn1 and the elongated down probe Pn2 through a ligase to obtain a SELECT product; performing PCR amplification of the SELECT product, and determining a threshold cycle N of FOR; (2b) gradient diluting a reference sequence to a series of concentrations, obtaining a threshold cycle Nn of PCR corresponding to each concentration by the method of step (2a), and determining a standard curve 1 according to the concentrations and the threshold cycle Nn of PCR; wherein the reference sequence is a first reference sequence, a second reference sequence, or a mixture of the first reference sequence and the second reference sequence in any ratio, the reference sequence comprises at least a nucleotide sequence II, and the nucleotide sequence II comprises a nucleotide sequence sharing a same nucleotide sequence with a nucleotide sequence I in the target RNA segment, wherein when the site N is located upstream of the site X, the nucleotide sequence I is a nucleotide sequence from a nucleotide that is complementary paired with a nucleotide of 3′-terminal of the up probe Pn1 of the site N to a nucleotide that is complementary paired with a nucleotide of 5′-terminal of the down probe Px2 of the site X in the target RNA segment, when the site N is located downstream of the site X, the nucleotide sequence I is a nucleotide sequence from a nucleotide that is complementary paired with a nucleotide of 3′-terminal of the up probe Px1 of the site X to a nucleotide that is complementary paired with a nucleotide of 5′-terminal of the down probe Pn2 at the site N in the target RNA segment, and no target modification is present in an RNA target site X1 of the first reference sequence corresponding to the RNA target site X of the target RNA segment, and target chemical modification is present in an RNA target site X2 of the second reference sequence corresponding to the RNA target site of X of the target RNA segment; (2c) comparing the threshold cycle N of PCR with the standard curve 1, and determining the amount of the target RNA segment in the RNA sample; (3) mixing the first reference sequence and the second reference sequence in a series of molarity ratios to obtain a series of mixtures, and applying the (2) SELECT step and (3) PCR amplification step in the method of claim 1 to the mixtures to obtain a threshold cycle A1 of PCR or an amount A2 of PCR amplification product, determining a standard curve 2 according to the molarity ratios and the threshold cycle A1 of PCR or according to the molarity ratios and the amount A2 of PCR amplification product; (4) applying the (2) SELECT step and (3) PCR amplification step in the method of claim 1 to the sample RNA to obtain a threshold cycle B1 of PCR or an amount B2 of PCR amplification product; and (5) comparing the threshold cycle B1 of PCR or the amount B2 of PCR amplification product with the standard curve 2, to quantify the modification rate of the RNA target site X in the RNA sample.

17. The method according to claim 16, wherein the RNA sample is total RNA, mRNA, rRNA, or lncRNA extracted from cells.

18. The method according to claim 1, wherein a length of sequence of the up probe Px1 that is complementary paired with the upstream sequence of the RNA target site X is 15-30 nt; a length of sequence of the down probe Px2 that is complementary paired with the downstream sequence of the RNA target site X is 15-30 nt.

19. The method according to claim 1, wherein determining the threshold cycle of PCR is performed by qPCR fluorescence signal, or determining the amount of PCR amplification product is performed by polyacrylamide gel electrophoresis.

20. The method according to claim 3, wherein the DNA polymerase is Bst 2.0 DNA polymerase; the ligase is SplintR ligase or T3 DNA ligase.

Description

DESCRIPTION OF THE DRAWINGS

[0074] In order to illustrate the examples of the present application and the technical solutions of the prior arts more clearly, the drawings used in the examples and the prior arts are briefly described below. Obviously, the drawings in the following description are only some examples of the present application. For those ordinary skilled in the art, other drawings can be also obtained according to these drawings without any creative work.

[0075] FIG. 1 shows a schematic diagram of SELECT method for m.sup.6A detection. m.sup.6A in RNA is selected twice in a one-tube reaction: in the first selection step, an m.sup.6A mark hinders the ability of DNA polymerase to elongate the target sequence by preventing the addition of a thymidine on the down probe opposite to the m.sup.6A site; in the second selection step, m.sup.6A marks that are present in the RNA template selectively prohibit DNA-ligase-catalyzed nick ligation between the up probe and the down probe; the final elongated and ligated products are then quantified by qPCR.

[0076] FIG. 2 shows the evaluation on site N selection. (a) the bar plot of the threshold cycle (C.sub.T) of qPCR, showing SELECT results for detecting X, X−1, X−2, X−4, X−6, X+1 and X+2 sites in Oligo1-m.sup.6A and Oligo1-A; (b) the bar plot of the threshold cycle (C.sub.T) of qPCR, showing SELECT results for detecting X, X−1, X−2, X−4, X−6 sites in Oligo2-m.sup.6A and Oligo2-A; 1 fmol RNA is used in this assay; error bars indicate mean±s.d for 2 biological replicates x 2 technical replicates.

[0077] FIG. 3 shows the optimized SELECT results for detecting m.sup.6A in the model oligonucleotides. (a) the real-time fluorescence amplification curves and bar plot of the threshold cycle (C.sub.T) of qPCR, showing SELECT results for detecting the site X and site N (for input control) in Oligo1-m.sup.6A versus Oligo1-A; (b) the real-time fluorescence amplification curves and bar plot of the threshold cycle (C.sub.T) of qPCR, showing SELECT results for detecting the site X and site N (for input control) in Oligo2-m.sup.6A versus Oligo2-A; error bars indicate mean±s.d for 3 biological replicates x 2 technical replicates; Rn is the raw fluorescence for the associated well normalized to the fluorescence of the passive reference dye (ROX).

[0078] FIG. 4 shows the results of the combination of SELECT method with PCR and TBE-PAGE for detecting the model of Oligo1-m.sup.6A versus Oligo1-A.

[0079] FIG. 5 shows the results of verifying the selectivity of SELECT method by mixing Oligo1-m.sup.6A and Oligo1-A in different ratios. (a) real-time fluorescence amplification curves, showing SELECT results for detecting the mixture Oligo1-m6A with Oligo1-A with known m.sup.6A ratios; (b) the linear relationship between the relative products of SELECT (2C.sub.T values normalized to 2% of the 2C.sub.T value of 100% m.sup.6A) and m.sup.6A fraction.

[0080] FIG. 6 shows the bar plot of the threshold cycle (C.sub.T) of qPCR (left y axis) and the line plot of different C.sub.T (ΔC.sub.T) (right y axis), showing the results of performance test of 7 ligases used in the SELECT method: SplintR ligase (a), T3 DNA ligase (b), T4 RNA ligase 2 (c), T4 DNA ligase (d), T7 DNA ligase (e), 9° N™ DNA ligase (f) and Taq DNA ligase (g). Error bars indicate mean±s.d for 2 biological replicates x 2 technical replicates.

[0081] FIG. 7 shows the bar plot of the C.sub.T of qPCR (left y axis) and the line plot of different C.sub.T (ΔC.sub.T) (right y axis), showing the optimization of following reaction conditions: temperature (a), dTTP concentration (b), Bst 2.0 DNA polymerase amount (c) and SplintR ligase amount (d) in SELECT for detecting site X in Oligo1-m.sup.6A and Oligo1-A. Error bars indicate mean±s.d for 2 biological replicates x 2 technical replicates.

[0082] FIG. 8 shows the effects of dTTP and dNTP on site X and site N in Oligo1-m.sup.6A and Oligo1-A by the SELECT detection method. Error bars indicate mean±s.d for 3 biological replicates x 2 technical replicates.

[0083] FIG. 9 shows the amplification efficiency of qPCR primers used in SELECT method. SELECT method detects the DNA fragments produced by Oligo1, in TA clone pGEM-T vector. (a) Oligo1 qPCR amplicon sequence confirmed by Sanger sequencing; (b) linear relationship between C.sub.T and recombinant plasmid concentration lg. The amplification efficiency of the designed qPCR primer is 97.2% calculated by the slope of −3.39. Error bars indicate mean±s.d for 2 biological replicates x 3 technical replicates.

[0084] FIG. 10 shows the results of more down probes used in SELECT method, in which the first nucleotide of the 3′ terminal of the down probe is complementary paired with the nucleotide located at a site with a distance of 2 nt (a), 3 nt (b) and 4 nt (c) from the RNA target site X at the downstream sequence of the RNA target site X.

[0085] FIG. 11 shows the results of the combination of SELECT with an FTO-assisted demethylation step for detecting m.sup.6A sites in total RNA or polyA-RNA. (a) the FTO-assisted SELECT m.sup.6A detection method; (b) coomassie blue staining of recombinant FTO protein purified from E. coli; (c) UPLC-MS/MS detection for the content of m.sup.6A in RNA, the m.sup.6A demethylation activity of FTO in total RNA or polyA-RNA isolated from HeLa or HEK293T cells, EDTA chelates the cofactor Fe.sup.2+ and inactivates FTO.

[0086] FIG. 12 shows real-time fluorescence amplification curves and bar plot of the threshold cycle (C.sub.T) of qPCR, showing SELECT results for detecting m.sup.6A4190 and A4194 sites (for input control) in A2511 of 28S rRNA (30 ng) of HeLa cells.

[0087] FIG. 13 shows real-time fluorescence amplification curves and bar plot of the threshold cycle (C.sub.T) of qPCR, showing SELECT results for detecting m.sup.6A2515 and m.sup.6A2577, m.sup.6A2611, A2511 and A2624 (for input control) in lncRNA MALAT1 (10 ng) of HeLa cells.

[0088] FIG. 14 shows real-time fluorescence amplification curves and bar plot of the threshold cycle (C.sub.T) of qPCR, showing SELECT results for detecting m.sup.6A1211 and A1207 (for input control) in mRNA H1F0 (1 μg) of HEK293 cells.

[0089] FIG. 15 shows the putative m.sup.6A site in mRNA H1F0 of HEK293 cells in several reported m.sup.6A sequencing data.

[0090] FIG. 16 shows polyacrylamide gel electrophoresis (PAGE) results of PCR amplification of the elongated and ligated products, by using FTO-assisted SELECT for detecting m.sup.6A4190 and m.sup.6A4194 (for input control) sites in 28S rRNA and m.sup.6A2577 and A2614 (for input control) in lncRNA MALAT1. For m.sup.6A4190, A4194, m.sup.6A2577 and A2614 sites, the length of PCR product is 79 bp, 79 bp, 100 bp and 101 bp, respectively, and the cycle of PCR is 22, 21, 29 and 25, respectively.

[0091] FIG. 17 shows the C.sub.T bar plot of the FTO-assisted SELECT results for detecting the m.sup.6A2577 site (a) and A2614 site (b) in lncRNA MALAT1 by using different amounts of polyA-RNA; error bars indicate mean±s.d for 2 biological replicates x 3 technical replicates.

[0092] FIG. 18 shows SELECT results for quantifying the m.sup.6A fraction in the transcripts.

[0093] FIG. 19 shows SELECT results for the identification of the biological target site of the m.sup.6A modification enzyme METTL3. (a) SELECT in combination with genetics methods used for the identification of the biological target site of m.sup.6A modification enzymes; (b) Western blotting shows that the METTL3 protein level is reduced in METTL3.sup.+/− HeLa heterozygous cells; (c) UPLC-MS/MS shows the total m.sup.6A levels in control cells and METTL3.sup.+/− HeLa heterozygous cells; (d) real-time fluorescence amplification curves and bar plot of the threshold cycle (C.sub.T) of qPCR, showing SELECT results for detecting m.sup.6A2515 and A2511 (for input control) in lncRNA MALAT1 in control versus METTL3.sup.+/− cells, establishing that the 2515 site of MALAT1 is a biological target site of METTL3. Error bars indicate mean±s.d for 2 biological replicates×3 technical replicates.

[0094] FIG. 20 shows SELECT results for the identification of the biological target site of the m.sup.6A modification enzyme METTL3. (a) linear relationship between C.sub.T of qPCR of MALAT1 and relative concentration 1 g of reverse transcription mixture, the amplification efficiency of the designed qPCR primer of MALAT1 is 102.7% calculated by the slope of −3.26; (b) the real-time fluorescence amplification curves of the MALAT1 segment in the control and METTL3.sup.+/− samples, and the C.sub.T is shown in the table. The amount of total RNA is measured by Qubit, and the amount of MALAT1 in the total RNA from the control and METTL3.sup.+/− samples is quantified by qPCR. The amount of MALAT1 in METTL3.sup.+/− is 1.526 times as much as in the control, calculated by 2ΔC.sup.T method. 2 μg total RNA from METTL3.sup.+/− cells and 3.05 μg total RNA from control cells are used in this assay; error bars indicate mean±s.d for 2 biological replicates x 3 technical replicates.

[0095] FIG. 21 shows the real-time fluorescence amplification curves and bar plots, showing SELECT results for detecting other types of RNA modifications. It shows SELECT results for detecting the site X and site N of Oligo4-m.sup.1A versus Oligo4-A (a), Oligo1-Am versus Oligo1-A (b), and Oligo5-Ψ versus Oligo5-U (c). 1 fmol RNA is used in this assay. Error bars indicate mean±s.d for 2 biological replicates x 3 technical replicates.

DETAILED DESCRIPTION OF THE INVENTION

[0096] In order to illustrate the objects, technical solutions, and advantages of the present application more clearly, the present application is further described in detail with reference to the drawings and examples. Unless otherwise specified, the reagents and experimental materials used in the examples are all conventional commercially available reagents and experimental materials, and the methods used in the examples are well known and conventional methods to those skilled in the art.

Experimental Methods

[0097] 1. Cell Culture and RNA Extraction

[0098] HeLa cells, HEK293T cells, and METTL3.sup.+/− HeLa heterozygous cells produced by CRISPR/cas9 were cultured in DMEM medium (purchased from Corning) containing 10% FBS (purchased from Gibco) and 1% penicillin-streptomycin (purchased from Corning) at 37° C. and 5% CO.sub.2. According to the manufacturer's instructions, total RNA was extracted with TRIzol reagent (purchased from ThermoFisher Scientific). Two rounds of polyA selection were carried out from total RNA with Dynabeads Oligo (dT).sub.25 (purchased from ThermoFisher Scientific, item number 61002) according to the manufacturer's instructions to isolate PolyA-RNA.

[0099] 2. Western Blotting

[0100] The protein levels of METTL3 in control cells and METTL3.sup.+/− HeLa heterozygous cells were detected by Western blotting. The METTL3.sup.+/− HeLa heterozygous cells were obtained by CRISPR/Cas9 knockout, and the control cells are HeLa cells obtained through CRISPR/Cas9 by using non-targeted sgRNA, the METTL3 gene in the control cells was not knockout as described above. Briefly, the control cells and METTL3.sup.+/− cells were collected, mixed with 2×SDS loading buffer (100 mM Tris-HCl, pH 6.8, 1% SDS, 20% glycerol, 25% β-mercaptoethanol, 0.05% bromophenol blue) and incubated at 95° C. for 15 minutes. After centrifugation at 12,000 rpm, the samples were separated by SDS-PAGE and transferred from the gel to the PVDF membrane. Antibody staining was performed with METTL3 antibody (purchased from Cell Signaling Technology) and ACTIN antibody (purchased from CWBIO). Finally, the film was imaged by the Tanon 5500 chemiluminescence imaging system.

[0101] 3. Select Method

[0102] Total RNA, polyA-RNA or synthetic RNA oligonucleotides were mixed with 40 nM up probe, 40 nM down probe and 5 μM dTTP (or dNTP) in 17 μl 1× CutSmart buffer (50 mM potassium acetate, 20 mM Tris-acetic acid, 10 mM magnesium acetate, 100 μg/ml BSA, pH 7.9, at 25° C.). The probe and RNA were annealed by incubating the mixture under the following temperature gradient: 90° C., 1 minute; 80° C., 1 minute; 70° C., 1 minute; 60° C., 1 minute; 50° C., 1 minute, then 40° C., 6 minutes. Subsequently, a 3 μl mixture containing 0.01 U Bst 2.0 DNA polymerase, 0.5 U SplintR ligase and 10 nmol ATP was added to the mixture to obtain a final reaction mixture with a volume of 20 μl. The final reaction mixture was incubated at 40° C. for 20 minutes, denatured at 80° C. for 20 minutes and kept at 4° C. to obtain the SELECT product.

[0103] 4. qPCR

[0104] The SELECT product obtained in step 3 was subjected to a real-time quantitative PCR (qPCR) reaction in Applied Biosystems ViiA™ 7 real-time PCR system (Applied Biosystems, USA). The 20 μl qPCR reaction system was consisted of 2×Hieff qPCR SYBR Green Master Mix (purchased from Yeasen), 200 nM qPCR upstream primer (qPCRF), 200 nM qPCR downstream primer (qPCRR), 2 μl of the above SELECT product and the balance of ddH.sub.2O. qPCR was run under the following conditions: 95° C., 5 minutes; (95° C., 10 s, 60° C., 35 s)×40 cycles; 95° C., 15s; 60° C., 1 minute; 95° C., 15s (the fluorescence was collected at a heating rate of 0.05° C./s); and kept at 4° C. The data was analyzed by QuantStudio™ Real-Time PCR software v1.3.

[0105] 5. TBE-PAGE Electrophoresis Analysis of PCR Products

[0106] Before qPCR, 2 μl of SELECT product was mixed with 2×Taq Plus Master Mix (purchased from Vazyme), 400 nM qPCR upstream primer, 400 nM qPCR downstream primer to obtain a total volume of 25 μl of the mixture. Then, PCR of the site X (29 cycles) and site N (26 cycles) was carried out. 10 μl PCR products were subjected to electrophoresis on a 12% non-denaturing TBE-PAGE gel with 0.5% TBE buffer in an ice bath. TBE-PAGE gel was stained with YeaRed nucleic acid gel stain (purchased from Yeasen), and photographed with Tanon 1600 gel imaging system (Tanon).

[0107] 6. Ligation and qPCR Based on Different Ligases

[0108] 80 thiol of synthetic RNA oligonucleotide was mixed with 40 nM T upstream primer (SEQ ID NO. 6) and 40 nM downstream primer (SEQ ID NO. 7) in 18 μl 1× reaction buffer. It should be noted that, compared with the primers used in SELECT, the T upstream primer was introduced one more base T at the 3′ terminal. The base T was necessary to be artificially introduced at the 3′ terminal because no DNA polymerase was used for reverse transcription in the method to synthesize T opposite to m.sup.6A or A. 1× CutSmart buffer (50 mM potassium acetate, 20 mM Tris-acetic acid, 10 mM magnesium acetate, 100 μg/ml BSA, pH 7.9, at 25° C.) was used to detect SplintR ligase, T4 DNA ligase and T4 RNA ligase 2 (dsRNA ligase).

[0109] 1×T3 DNA ligase reaction buffer (66 mM Tris-HCl, 10 mM MgCl.sub.2, 1 mM ATP, 1 mM DTT, 7.5% PEG 6000, pH 7.6, at 25° C.) was used to detect T3 DNA ligase and T7 DNA ligase.

[0110] 1×9° N DNA ligase reaction buffer (10 mM Tris-HCl, 600 μM ATP, 2.5 mM MgCl.sub.2, 2.5 mM DTT, 0.1% Triton X-100, pH 7.5, at 25° C.) was used to detect 9° N DNA ligase.

[0111] 1×Taq DNA ligase reaction buffer (20 mM Tris-HCl, 25 mM potassium acetate, 10 mM magnesium acetate, 10 mM DTT, 1 mM NAD, 0.1% Triton X-100, pH 7.6, at 25° C.) was used to detect Taq DNA ligase.

[0112] The probe and RNA were annealed by incubating the mixture under the following temperature gradient: 90° C., 1 minute; 80° C., 1 minute; 70° C., 1 minute; 60° C., 1 minute; 50° C., 1 minute; then 40° C., 6 minutes. 2.sub.11.1 of a mixture containing 10 nmol ATP and ligase with the specified concentration was added (only added in the detection of SplintR ligase, T4 DNA ligase and T4 RNA ligase 2) to the above annealed mixture. The final reaction mixture was reacted at 37° C. for 20 minutes, then denatured at 95° C. for 5 minutes, and kept at 4° C. Subsequently, qPCR was carried out in the same manner as in step 3.

[0113] 7. Clone, expression and purification of recombinant FTO protein

[0114] The truncated human FTO cDNA (ΔN31) was subcloned into the pET28a vector. The plasmid was transformed into BL21-Gold (DE3) E. coli competent cells. The expression and purification of the FTO protein were performed according to procedures well known to those skilled in the art (for example, see G. Jia, et al., Nat. Chem. Biol. 2011, 7, pages 885-887). The purified FTO protein was identified by 12% SDS-PAGE electrophoresis.

[0115] 8. FTO-Mediated Demethylation of m.sup.6A

[0116] The total RNA or polyA-RNA was treated with FTO protein according to methods well known to those skilled in the art (see, for example, G. Jia, et al., Nat. Chem. Biol. 2011, 7, pages 885-887). For the experimental group: 40 μg total RNA or 2 μg polyA-RNA was mixed with FTO, 50 mM HEPES (pH 7.0), 2 mM L-ascorbic acid, 300 μM α-ketoglutarate (α-KG), 283 μM (NH.sub.4).sub.2Fe(SO.sub.4).sub.2.6H.sub.2O and 0.2 U/μl RiboLock RNase inhibitor (purchased from ThermoFisher Scientific), and reacted at 37° C. for 30 minutes. The reaction was quenched by adding 20 mM EDTA. For the control group: 20 mM EDTA should be added before the demethylation reaction. The RNA was recovered by phenol-chloroform extraction and ethanol precipitation, and then detected by the SELECT method.

[0117] 9. Quantification of m.sup.6A by UPLC-MS/MS

[0118] 200 ng RNA was digested with 1 U nuclease P1 (purchased from Wako) in 10 mM ammonium acetate buffer at 42° C. for 2 hours, and then incubated with 1 U rSAP (purchased from NEB) in 100 mM MES (pH6.5) at 37° C. for 4 hours. The digested sample was centrifuged at 15,000 rpm for 30 minutes, and 5 μl of the solution was injected into UPLC-MS/MS. The nucleotides were separated by ZORBAX SB-Aq column (Agilent) in UPLC (SHIMADZU), and detected by Triple Quad™ 5500 (AB SCIEX). The nucleotides were quantified based on the m/z transition of the parent ions and daughter ions: for A, m/z is 268.0 to 136.0, for m.sup.6A, m/z is 282.0 to 150.1. The commercially available nucleotides were used to plot a standard curve, and the ratio of m.sup.6A/A was calculated precisely according to the standard curve.

[0119] In the context, the term “threshold cycle (C.sub.T)”, also known as the threshold cycle value, refers to the number of amplification cycles when the fluorescence signal of the amplification product reaches the set fluorescence threshold during the qPCR amplification process.

[0120] In the context, the term “upstream” refers to the position and/or direction away from the transcription or translation initiation site in the DNA sequence or messenger ribonucleic acid (mRNA), that is, the position close to the 5′ terminal or the direction toward the 5′ terminal. The term “downstream” refers to the position and/or direction away from the transcription or translation initiation site in the DNA sequence or messenger ribonucleic acid (mRNA), that is, the position close to the 3′ terminal or the direction toward the 3′ terminal.

[0121] In the context, the term “a nucleotide located at a site with a distance of 1 nt from the RNA target site X at the upstream sequence of the RNA target site X” refers to a nucleotide at the position adjacent to the RNA target site X at the upstream sequence of the RNA target site X. For example, if the RNA target site X is defined as the 0 th position, then the nucleotide located at a site with a distance of 1 nt from the RNA target site X at the upstream sequence of the RNA target site X is at −1 position, and the nucleotide located at a site with a distance of 1 nt from the RNA target site X at the downstream sequence of the RNA target site X is at +1 position

[0122] In the context, RNA modification enzyme refers to an enzyme capable of chemically modifying the nucleotides in RNA. For example: m.sup.6A modification enzyme can convert A into m.sup.6A, m.sup.6A modification enzyme includes, for example, (1) methyltransferase complex and (2) METTL16. The methyltransferase complex is selected from the group consisting of METTL3, METTL14, WTAP, KIAA1429 (also known as VIRMA or VIRILIZER), HAKAI, ZC3H13, RBM15 and RBM15B, or combination thereof. The enzymes that form m.sup.1A modification, pseudouridine modification and 2′-O-methylation modification in RNA also belong to RNA modification enzymes.

[0123] In the context, RNA demodification enzyme refers to an enzyme that removes chemical modifications on nucleotides in RNA and converts the modified nucleotides into ordinary A, U, C or G. FTO and ALKBH5 are demodification enzyme of m.sup.6A. The m.sup.6A modification and the m.sup.1A modification are converted to A under the action of the demodification enzyme. The pseudouridine modification is converted to U under the action of the demodification enzyme.

TABLE-US-00001 TABLE 1 Model RNA oligonucleotides used in the present application Name Sequence (5′->3′) Features Oligo1 rArUrGrGrGrCrCrGrUrUr X represents A, CrArUrCrUrGrCrUrArArA m6A or Am, rA rGrCr wherein Am UrUrUrUrGrGrGrGrCrUr represents 2′-O- UrGrU methyl adenosine Oligo2 rArUrGrGrGrCrCrGrUrU X represents rCrAtUrCrUrGrCrUrArA A or m.sup.6A rArA rGrC rUrUrUrUrGrGrGrGrCrU rUrGrU Oligo3 rArGrUrArGrCrUrUrArG X represents rUrUrUrGrArArArArArU A or m.sup.6A rGrUrGrArA rUrUr CrGrUrArArCrGrGrAr ArGrUrArArUrUrC Oligo4 rUrGrGrGrGrUrCrUrC X represents A, rCrCrCrGrCrGrCrArG m.sup.6A (N1- rGrUrUrCrG rArUrC methyl adenosine) rCrCrGrCrCrGrArGrU rArCrGrU rCrA Oligo5 rGrGrGrGrArArGrArG X represents rCrArArCrArArArGrC U or Ψ rArArGrCrArArGrArC rGrArCrArArGrGrArA rGrCrArArArArCrArA rCrArCrGrCrCrArGrA rCrArCrGrGrGrArArG rArG rCrArGrArCrG rArCrCrArCrArCrGrA rArGrArArCrCrArCrA rCrArGrArGrCrArArG rGrArArArCrArCrCrA rArCrArCrCrArCrCrA rCrCrGrCrArGrArGrA rGrArGrArArArGtGrG rArCrArGrGrGrArCrA rCrCrArArGrCrArGrG rCrArCrArGrArArCrA rArG Note: 1. The lowercase letter r to the left of bases A, U, C, and G indicates (hat the nucleotide is a ribonucleotide; 2. The underlined part represents the classical conservative motif of m.sup.6A.

TABLE-US-00002 TABLE 2 Primers used in qPCR in step 6 of the experimental method Name Sequence (5′->3′) Oligo1-X-T- tagccagtaccgtagtgcgtg upstream AGCCCCAAAAGCAGT (SEQ primer ID NO. 6) Oligo1-X- 5phos/CCTTTTAGCAGATGAA downstream CGGCcagaggctgagtcgc primer tgcat (SEQ ID NO. 7) Note: 5phos represents 5′phosphorylation.

TABLE-US-00003 TABLE 3 Probes used in the SELECT method of the present application Name Sequence (5′->3′) Oligo3-X- Tagccagtaccgtagtgcg downstream tgAGCCCCAAAAGCAG probe/ (SEQ ID NO. 8) Oligo2-X- downstream probe Oligo1-X- 5phos/CCTTTTAGCAGA upstream TGAACGGCcagag probe gctgagtcgctgcat (SEQ ID NO. 9) Oligo2-X- 5phos/TCTTTTAGCAGA upstream TGAACGGCcagag probe gctgagtcgctgcat (SEQ ID NO. 10) Oligo1-X − 1- Tagccagtaccgtagtgc downstream gtgAGCCCCAAAAGCAG probe T (SEQ ID NO. 31) Oligo2-X − 1- Tagccagtaccgtagtgc downstream gtgAGCCCCAAAAGCAG probe T (SEQ ID NO. 12 ) Oligo1-X − 1- 5phos/CTTTTAGCAGAT upstream GAACGGCcagaggc probe/ tgagtcgctgcat Oligo2-X − 1- (SEQ ID NO. 13) upstream probe Oligo1-X − 2- tagccagtaccgtagtgc downstream gtgAGCCCCAAAAGCAG probe TC (SEQ ID NO. 14) Oligo2-X − 2- tagccagtaccgtagtgc downstream gtgAGCCCCAAAAGCAG probe TT (SEQ ID NO. 15) Oligol-X − 2- 5phos/TTTTAGGAGATG upstream AACGGCcagaggctg probe/ agtcgctgcat  Oligo2-X − 2- (SEQ ID NO. 16) upstream probe Oligo1-X − 4- tagccagtaccgtagtg downstream cgtgAGCCCCAAAAGCAG probe TCCT (SEQ ID NO. 17) Oligo2-X − 4- tagccagtaccgtagtg downstream cgtgAGCCCCAAAAGCAG probe TTCT  (SEQ ID NO. 18) Oligo1-X − 4- 5phos/TTAGCAGATGAA upstream CGGCcagaggagagt probe/ cgctgcat  Oligo2-X − 4- (SEQ ID NO. 19) upstream probe Oligo3-X − 6- tagccagtaccgtagtgcg downstream tgAGCCCCAAAAGCAG probe TCCTTT (SEQ ID NO. 20) Oligo2-X − 6- tagccagtaccgtagtgcg downstream tgAGCCCCAAAAGCAG probe TTCTTT (SEQ ID NO. 23) Oligo1-X − 6- 5phos/AGCAGATGAAC upstream GGCcagaggctgagtcg probe/ ctgcat (SEQ ID NO. 22) Oligo2-X − 6- upstream probe Oligo1-X + 1- tagccagtaccgtagtgc downstream gtgAGCCCCAAAAGCA probe (SEQ ID NO. 23) Oligo1-X + 1- 5phos/TCCTTTTAGCAG upstream ATGAACGGCcaga probe ggctgagtcgctgcat (SEQ ID NO. 24) Oligo1-X + 2- tagccagtaccgtagtgc downstream gtgACAAGCCCCAAAAG probe C (SEQ ID NO. 25) Oligo1-X + 2- 5phos/GTCCTTTTAG downstream CAGATGAACGGCcag aggctgagtcgctgcat (SEQ ID NO. 26) Oligo4-X- tagccagtaccgtagtgc downstream  gtgTGACGTAGTCGGCA probe GGAT (SEQ ID NO. 27) Oligo4-X- 5phos/CGAACCTGCGCG upstream  GGGcagaggctgagtcg probe ctgcat (SEQ ID NO. 28) Oligo4-X − 7- tagccagtaccgtagtgc downstream  gtgGTCGGCAGGATTCG probe AACC (SEQ ID NO. 29) Oligo4-X − 7- 5phos/GCGCGGGGAGAC upstream  CCCcagaggctgagtc probe gctgcat (SEQ ID NO. 30) Oligo5-X- tagccagtaccgtagtgc downstream  gtgCTTCGTGTGGTCGTC probe TG (SEQ ID NO. 31) Oligo5-X- 5phos/CTCTTCCCGTGT upstream  GTGGcagaggctgagtc probe gctgcat (SEQ ID NO. 32) Oligo4-X + 4- tagccagtaccgtagtgc downstream  gtgTGGTTCTTCGTGTGG TCG (SEQ ID NO. 33) Oligo4-X + 4- 5phos/CTGACTCTTCCC upstream  GTGTGcagaggctgag probe tcgctgcat (SEQ ID NO. 34) 28S_m6A4190_ Tagccagtaccgtagtgc downstream  glgCGCCTTAGGACACC probe TGCG (SEQ ID NO. 35) 28S_m6A4190_ 5phos/TACCGTTTGACA upstream  GGTGTAcagaggctg probe agtcgctgcat (SEQ ID NO. 36) 28S_A4194- tagccagtaccgtagtgc downstream  gtgAGCTCGCCTTAGGA probe CACC (SEQ ID NO. 37) 28S_A4194- 5pbos/GCGT7ACCGITT upstream  GACAGGTcagaggc probe tga gtcgctgcat (SEQ ID NO. 38) MALAT1_m.sup.6A2515_ tagccagtaccgtagtgc downstream  gtgAATTACTTCCGTTAC probe GAAAG (SEQ ID NO. 39) MALAT1_m.sup.6A2515_ 5phos/CCTTCACATTTT upstream  TCAAACTAAGCTACTca probe gaggctgagtcgctgcat (SEQ ID NO. 40) MALAT1_m.sup.6A2577_ tagccagtaccgtagtgc downstream  gtgGGATTTAAAAAATA probe ATCTTAACTCAAAG (SEQ ID NO. 41) MALAT1_m.sup.6A2577_ 5phos/CCAATGCAAAAA upstream  CATTAAGTcagaggctg probe agtcgctgcat (SEQ ID NO. 42) MALAT1_A2511_ tagccagtaccgtagtgc downstream  gtgAATTACTTCCGTTAC probe GAAAGTCCT (SEQ ID NO. 43) MALAT1_A2511_ 5phos/CACATTTTTCAA upstream  ACTAAGCTACTcagagg probe ctgagtcgctgcat (SEQ ID NO. 44) MALAT1_m.sup.6A2611- tagccagtaccgtagtg downstream probe cgtgGTCAGCTGTCAAT TAATGC (SEQ ID NO. 45) MALAT1_m.sup.6A2611- 5phos/AGTCCTCAGGAT upstream probe TTAAAAAATAATCTTAAC cagaggctgagtcgctg cat (SEQ ID NO. 46) H1F0-m6A1211- Tagccagtaccgtagtgc downstream probe gtgCATTAGATTGGTTGT TGCTG (SEQ ID NO. 47) H1F0-m6A1211- 5phos/CCTTGCACAACT upstream probe GGTTAAcagaggctg agtcgctgcat (SEQ ID NO. 48) H1F0-A1207- tagccagtaccgtagtg downstream cgtgTGGTTGTTGCTGT probe CCT (SEQ ID NO. 49) H1F0-A1207- 5phos/GCACAACTGGT npstream probe TAAGGAAAcagaggct gagtcgctgcat (SEQ ID NO. 50)

TABLE-US-00004 TABLE 4 Primers used for qPCR of SELECT products Name Sequence (5′-> 3+40) qPCRF ATGCAGCGACTCAGCCTCTG (SEQ ID NO. 51) qPCRR TAGCCAGTACCGTAGTGCGTG (SEQ ID NO. 52) MALAT1_gPCRF GACGGAGGTTGAGATGAAGCT (SEQ ID NO. 53) MALAT1_gPCRR ATTalOGGCTCTGTAGTCCT (SEQ ID .NO. 54)

Example 1 SELECT Method in Combination with qPCR for Detecting m.SUP.6.A Modification in Model m.SUP.6.A RNA Oligonucleotide

[0124] Two kinds of model 42-mer RNA Oligos with an internal site X (X=m.sup.6A or A): Oligo1 (SEQ ID NO.1) and Oligo2 (SEQ ID NO.2) were subjected to SELECT method. According to whether there is a methylation modification at the site X, the model oligonucleotides were divided into 4 categories: Oligo1-m.sup.6A, Oligo1-A, Oligo2-m.sup.6A, and Oligo2-A.

[0125] (1) Controlling the Initial RNA Input Amounts

[0126] Given that the initial RNA input amounts directly affected the OCR amplification cycles, the inventors simultaneously detected a non-m.sup.6A modification site (also called site N) in model oligonucleotides to control the initial RNA input amounts (FIG. 2a). In theory, a same threshold cycle (C.sub.T) of OCR will be detected by SELECT for an site N in both Oligo1-m.sup.6A and Oligo1-A, indicating that the initial RNA input amounts are equal; in the same way, a same threshold cycle of OCR will be detected by SELECT for an site N in both Oligo2-m.sup.6A and Oligo2-A.

[0127] The inventors performed SELECT at 6.sup.th nt of the upstream sequence of site X to 2.sup.nd nt of the downstream sequence of site X (X−6 to X+2) in order to determine site N. The results showed that any non-m.sup.6A modification site except the site of 1 bp upstream and downstream of m.sup.6A site (m.sup.6A±1) can be used as an site N for controlling the initial RNA input amounts (see FIGS. 2b and 2c). In this example, the X−6 site (i.e., at 6.sup.t11 nt of the upstream sequence of site X) was set as the site N in each model oligonucleotide for controlling the initial RNA input amounts.

[0128] (2) SELECT Method in Combination with qPCR for Detecting m.sup.6A Modification in Model m.sup.6A RNA Oligonucleotides

[0129] According to the SELECT method in step 3 of the above experimental methods, the Bst 2.0 DNA polymerase and SplintR ligase were reacted with Oligo1-m.sup.6A, Oligo1-A, Oligo2-m.sup.6A, and Oligo2-A, to obtain Oligo1-m.sup.6A, Oligo1-A, Oligo2-m.sup.6A, and Oligo2-A products of SELECT, respectively.

[0130] The SELECT products were subjected to qPCR in Applied Biosystems ViiA™7 real-time PCR system (Applied Biosystems, USA). The data was analyzed by QuantStudio™ Real-Time PCR software v1.3. FIGS. 3a and 3b showed SELECT results for detecting site X (FIG. 3a, left, and FIG. 3b, left) and site N (FIG. 3a, right, and FIG. 3b, right) in Oligo1-m.sup.6A, Oligo1-A, Oligo2-m.sup.6A, and Oligo2-A, respectively, in which results of site N were input control.

[0131] It can be seen that, when controlling the RNA input amounts to be same (i.e., C.sub.Ts of amplification of the site N for Oligo1-m.sup.6A versus Oligo1-A were same; C.sub.Ts of amplification of the site N for Oligo2-m.sup.6A versus Oligo2-A were same), the threshold cycle difference of amplification (ΔC.sub.T) of the site X for Oligo1-m.sup.6A versus A-oligo was up to 7.6 cycles for Oligo1 containing a GGXCU sequence and 4 cycles for Oligo2 containing a GAXCU sequence (FIGS. 3a and 3b), demonstrating that the SELECT method of the present application can efficiently distinguish m.sup.6A-modified sites from unmodified sites.

Example 2 SELECT Method in Combination with PCR and TBE-PAGE for Detecting m.SUP.6.A Modification in Model m.SUP.6.A RNA Oligonucleotide

[0132] The SELECT products of Oligo1-m.sup.6A and Oligo1-A obtained in Example 1 were subjected to PCR by using experimental method 3 and then subjected to TBE-PAGE electrophoresis analysis. FIG. 1c showed the results of TBE-PAGE gel electrophoresis. It can be seen that, compared with the site N of Oligo1-m.sup.6A and Oligo1-A and the site X of Oligo1-A, almost no band of PCR product was observed for the site X of Oligo1-m.sup.6A. It can be seen that the SELECT method of the present application has significant selectivity for m.sup.6A compared to adenosine (A) without methylation modification (FIG. 4).

Example 3 Verification of the Selectivity of SELECT Method

[0133] In order to accurately evaluate the performance of the SELECT method of the present application, Oligo1-m.sup.6A and Oligo1-A were mixed in the ratios of 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, respectively, and detected by SELECT method in combination with qPCR. FIG. 5a showed the linear relationship between the relative products of qPCR (2.sup.C.sub.T values normalized to the 2.sup.C.sub.1 value of 100% m.sup.6A) and m.sup.6A fraction in the sample. The experiment was repeated 3 times. Error bars, mean±s.d. Rn (normalized reporter) was the ratio of the fluorescence emission intensity of the fluorescent reporter group to the fluorescence emission intensity of the reference dye.

[0134] The SELECT method of the present application had a very high sensitivity, as shown in FIG. 5b, the SELECT method could distinguish A from m.sup.6A sites at target template concentrations ranging from 0.25 fmol to 100 fmol. The maximal ΔC.sub.T of 7.62 cycles for a tested site X was observed for the 1 fmol RNA Oligo1 sample, suggesting that the selectivity of SELECT method for detecting m.sup.6A in RNA is up to 196.7-fold (2.sup.7.62).

Example 4 SELECT Method in Combination with qPCR for Detecting m.SUP.6.A Modification in Model m.SUP.6.A RNA Oligonucleotide

[0135] According to the method of step 6 in experimental methods, using the model oligonucleotide of Oligo1 (SEQ ID NO. 1) in Example 1 as a template, the performance of 7 ligases: SplintR ligase, T3 DNA ligase, T4 RNA ligase 2, T4 DNA ligase, T7 DNA ligase, 9° N DNA ligase, and Taq DNA Ligase were tested. The results were shown in FIG. 6, it can be seen that SplintR ligase, T3 DNA ligase, T4 RNA ligase 2 and T4 DNA ligase had a selectivity for m.sup.6A, among which SplintR ligase and T3 DNA ligase had a good selectivity, and SplintR ligase had a relative high efficiency for ligation and was suitable for the detection of low-trace sample.

Example 5 SELECT Method Reaction Condition Test-1

[0136] According to the method of Example 1, the present application expanded the reaction conditions for both the elongation and ligation steps, and settled on a simple one-tube reaction system. Specifically, this example tested the following reaction conditions: three reaction temperatures: 37° C., 40° C., and 42° C. (FIG. 7a); six concentrations of dTTP: 0, 5 μM, 10 μM, 20 μM, 40 μM, and 100 μM (FIG. 7b); five amounts of Bst 2.0 DNA polymerase: 0, 0.0005 U, 0.002 U, 0.01 U, and 0.05 U (FIG. 7c); and five amounts of SplintR ligase: 0, 0.1 U, 0.5 U, 1 U, and 2 U (FIG. 7d).

[0137] It can be seen from FIGS. 7a-d that the SELECT method exhibited a good selectivity for m.sup.6A at 37-42° C., 5-100 μM dTTP, 0.0005-0.05 U Bst 2.0 DNA polymerase, and 0.1-2 U SplintR ligase. The most preferable reaction conditions were: the reaction temperature of 40° C., 5 μM dTTP, 0.01 U Bst 2.0 DNA polymerase, and 0.5 U SplintR ligase.

[0138] According to the method of Example 1, dTTP was replaced with dNTP, and it was found that dNTP could be used for the elongation step (see FIG. 8).

[0139] TA clone of the Oligo1-produced DNA fragments in pGEM-T vector were detected by SELECT method. The sequence of the Oligo1 qPCR amplicon was confirmed by Sanger sequencing (see FIG. 9a). The probe used for SELECT comprised two parts: qPCR adaptor and complementary strand of RNA template (melting temperature should exceed 50° C.). The PCR amplicons obtained by subjecting SEQ ID NO. 1 to SELECT detection with SEQ ID NO. 8 and SEQ ID NO. 9 were cloned into the pGEM-T vector, quantified by Nanodrop, and diluted stepwise (10-fold dilution for each step) to obtain standard samples, performed fluorescence quantitative PCR detection to plot a curve, and calculated adaptor amplification efficiency. The amplification specificity and efficiency of the primers targeting the site X were tested for the m.sup.6A status, the amplification efficiency of the designed qPCR primer was 97.2% calculated by the slope of −3.39, which confirmed that designed qPCR adaptor was sufficient for qPCR amplification (see FIG. 9b).

Example 6 Reaction Condition Test of SELECT Method-2

[0140] According to the method of Example 1, the present application designed more down probes: in which the first nucleotide of the 3′ terminal was complementary paired with the nucleotide located at a site with a distance of 2 nt, 3 nt and 4 nt from the RNA target site X at the downstream sequence of the RNA target site X. FIG. 10 showed these down probes could achieve good results for detection.

Example 7 Verification of FTO Demethylation Activity

[0141] FTO was an m.sup.6A demethylase; it was Fe.sup.2+ and α-KG dependent, when EDTA was added to the reaction system to chelate free Fe.sup.2+, the m.sup.6A site could not be demethylated by FTO. FIG. 11a showed the process of FTO-assisted SELECT method for m.sup.6A detection. FIG. 11b showed the SDS-PAGE image of the coomassie blue staining of recombinant FTO protein purified from E. coli.

[0142] According to the method of step 1 of the experimental methods, the total RNA of HeLa cells and the total RNA of HEK293T cells, and the polyA-RNA of HeLa cells were extracted, respectively. The experimental group was treated with FTO, and the control group was treated with FTO+EDTA. The specific steps were as follows: for the experimental group: 40 μg total RNA or 2 μg polyA-RNA was mixed with FTO, 50 mM HEPES (pH 7.0), 2 mM L-ascorbic acid, 300 μM α-ketoglutarate (α-KG), 283 μM (NH.sub.4).sub.2Fe(SO.sub.4).sub.2.6H.sub.2O and 0.2 U/μl RiboLock RNase inhibitor (purchased from Thermo Fisher Scientific), and reacted at 37° C. for 30 minutes. The reaction was quenched by adding 20 mM EDTA. For the control group: 20 mM EDTA was added before the demethylation reaction. The RNA was recovered by phenol-chloroform extraction and ethanol precipitation. FTO+EDTA-treated or FTO-treated samples were tested by the SELECT method described in step 3 of the experimental methods. The experiment was repeated 3 times, the error bars represented the mean±s.d.

[0143] FIG. 11c showed the FTO demethylation activity for m.sup.6A in total RNA or polyA-RNA isolated from HeLa or HEK293T cells. It can be seen that the levels of m.sup.6A in the total RNA of HeLa cells, polyA-RNA of HeLa cells and total RNA of HEK293T cells treated with FTO were significantly reduced: about 90% of the m.sup.6A sites were removed from the FTO-treated HeLa and HEK293T RNA samples, but not the FTO+EDTA cannot remove the m.sup.6A site.

Example 8 FTO-Assisted SELECT Method for Detecting m.SUP.6.A Modifications in rRNA, lncRNA and mRNA

[0144] It should be noted that, 28S rRNA was detected by total RNA of HeLa cells, lncRNA MALAT1 was detected by polyA-RNA, and mRNA H1F0 was detected by total RNA of HEK293T cell.

[0145] The experimental group was treated with FTO, and the control group was treated with FTO+EDTA. The specific steps were as follows: for the experimental group: 40 μg total RNA or 2 μg polyA-RNA was mixed with FTO, 50 mM HEPES (pH 7.0), 2 mM L-ascorbic acid, 300 μM α-ketoglutarate (α-KG), 283 μM (NH.sub.4).sub.2Fe(SO.sub.4).sub.2.6H.sub.2O and 0.2 U/μl RiboLock RNase inhibitor (purchased from Thermo Fisher Scientific), and reacted at 37° C. for 30 minutes. The reaction was quenched by adding 20 mM EDTA. For the control group: 20 mM EDTA was added before the demethylation reaction. The RNA was recovered by phenol-chloroform extraction and ethanol precipitation. FTO+EDTA-treated or FTO-treated samples were tested by the SELECT method described in step 3 of the experimental methods. In the SELECT method, the amounts of various RNAs were as follows: HeLa cells 28S rRNA, 30 ng, HeLa cells lncRNA MALAT1, 10 ng; HEK293T cells mRNA H1F0, 1 μg. m.sup.6A4190 and A4194 sites (input control) in HeLa cells 28S rRNA were detected; m.sup.6A2515 and A2511 (input control), as well as m.sup.6A2577, m.sup.6A2611 and A2614 sites (input control) in HeLa cells lncRNA MALAT1 were detected; and m.sup.6A1211 and A1207 sites (input control) in HEK293T cells mRNA H1F0 were detected. The experiment was repeated 3 times, the error represented the mean±s.d.

[0146] The combination of SELECT method and FTO demethylation step enabled clear identification of the known m.sup.6A4190 site present on 28S rRNA in HeLa (FIG. 12, left), and simultaneous analysis targeting a known non-m.sup.6A site (A4194, N site) on same rRNA, the input control N site showed no difference between the FTO-versus the FTO-EDTA-treated samples (FIG. 12, right).

[0147] The combination of SELECT method and FTO demethylation enabled clear identification of three known m.sup.6A sites: m.sup.6A2515, m.sup.6A2577 and m.sup.6A2611 on the lncRNA MALAT1 transcript from HeLa cells; two non-m.sup.6A sites: A2511 and A2614 on the MALAT1 transcript for controlling the initial RNA input amount showed no difference between the FTO-versus the FTO-EDTA-treated samples (FIG. 13).

[0148] In addition to reconfirming the above known m.sup.6A sites, the combination of SELECT method of the present application and the FTO demethylation step was used to detect the presumed m.sup.6A sites on mRNA transcripts by the reported sequencing data of m.sup.6A from HEK293T and HeLa cells (the 1211 site in the 3′ UTR of H1F0, see FIG. 15). The results verified that the 1211 position in the mRNA of HEK293T cells was modified by m.sup.6A (FIG. 14). Thus, SELECT of the present application was an easy and highly effective method for precisely and efficiently identifying m.sup.6A sites on rRNA, lncRNA, and mRNA molecules from biological samples.

[0149] FTO-assisted SELECT method could also identify cellular m.sup.6A sites by PAGE analysis (see FIG. 16).

[0150] In addition, the detection limit of the input amount could be lowered to 0.2 ng of polyA-RNA (approximately 200-1400 cells) by using the method of this example (see FIG. 17).

Example 9 SELECT Method for Quantifying the m.SUP.6.A Fraction in the Transcripts

[0151] The SELECT method of the present application was also used to determine the m.sup.6A fraction of the m.sup.6A2515 site on MALAT1 lncRNA in HeLa. According to the sequence containing the 2488-2536 position of m.sup.6A2515 from HeLa cell MALAT1, an RNA of Oligo3 (SEQ ID NO. 3) consist of 49 nucleotides with an internal X site (in which X=m.sup.6A or A) was synthesized as a standard RNA. Firstly, different amounts of the standard RNA with either A, m.sup.6A, or a mixture were used to perform SELECT method in step 3 of the experimental methods at the A2511 site to generate a linear plot to quantify the amount of cellular MALAT1 transcript. The result showed that 3 μg of HeLa total RNA contained 0.936±0.048 fmol of MALAT1 transcripts (FIG. 18a). A series with 0.936 fmol of the standard RNA mixture with a known m.sup.6A fraction obtained by mixing Oligo3-m.sup.6A and Oligo3-A with 3 μg of HeLa total RNA were subjected to SELECT for analyzing the modification fraction at the MALAT1 m.sup.6A2515 site. 0.936 fmol of the standard RNA mixture with a different m.sup.6A fraction was used to run SELECT method in step 3 of the experimental methods at the m.sup.6A2515 site to generate a linear plot to quantify the absolute m.sup.6A fraction at the MALAT1 m.sup.6A2515 site in biological samples. The result showed that the m.sup.6A fraction at the MALAT1 m.sup.6A2515 site was 0.636±0.027 in HeLa (FIG. 18b). SCARLET et al. reported that the m.sup.6A fraction at the MALAT1 m.sup.6A2515 site was 0.61±0.03. Therefore, SELECT could precisely and conveniently determine the m.sup.6A fraction from total RNA.

[0152] FIG. 18 showed SELECT for determining the m.sup.6A fraction at the m.sup.6A2515 site of MALAT1 in HeLa. a) Quantification of MALAT1 transcripts in 3 μg of HeLa total RNA. A series of amount gradients of standard RNA (Oligo3) and 3 μg of HeLa total RNA were carried out for SELECT analysis at MALAT1 A2511 site. Real-time fluorescence amplification curves were shown in the left panel. The amount of MALAT1 transcripts calculated from the standard curve (right panel) was 0.936±0.048 fmol in 3 μg of HeLa total RNA. b) Quantification of the m.sup.6A fraction at the m.sup.6A2515 site of MALAT1 in HeLa. A series with 0.936 fmol of the standard RNA mixture with a known m.sup.6A fraction obtained by mixing Oligo3-m.sup.6A and Oligo3-A with 3 μg of HeLa total RNA were subjected to SELECT for analyzing the modification fraction at the MALAT1 m.sup.6A2515 site. Real-time fluorescence amplification curves were shown in the left panel, the right panel showed the m.sup.6A fraction at the MALAT1 2515 site calculated by the standard curve was 0.636±0.027 in HeLa cells. The error bars represented the mean±standard deviation. 2 biological replicates×2 technical replicates.

Example 10 SELECT Method for Identifying the Biological Target Site of the m.SUP.6.A Modification Enzyme METTL3

[0153] SELECT was also a powerful tool for functional studies of m.sup.6A metabolism because it can also be used in combination with genetics methods to confirm whether or not a particular m.sup.6A modification enzyme function to modify a specific m.sup.6A site. The m.sup.6A2515 site on MALAT1 lncRNA was used as a proof-of concept experimental system. It is reported that, two m.sup.6A modification enzyme METTL16 containing a catalytic subunit METTL3 could bind MALAT1 transcripts, but the enzyme responsible for the m.sup.6A modification of the 2515 site has not been confirmed. The CRISPR/Cas9 system was used to generate METTL3.sup.+/− HeLa heterozygous cells in the present application; noted that homozygous METTL3.sup.+/− cells were lethal. FIG. 19a showed that m.sup.6A was significantly reduced in METL3.sup.+/− HeLa heterozygous cells compared to the control.

[0154] Western blotting confirmed that the heterozygous cells had reduced METTL3 levels by using anti-METTL3 antibodies (FIG. 19b). m.sup.6A was quantified by UPLC-MS/MS in step 9 of the experimental methods, the UPLC-MS/MS analysis showed that the total m6A levels in polyA-RNA were significantly lower in METTL3.sup.+/− cells than in control cells (FIG. 19c). Subsequently, by using SELECT method in step 3 of the experimental methods, it was demonstrated that the extent of m.sup.6A modification at the 2515 site was significantly reduced in the METTL3.sup.+/− cells compared to the control (FIG. 19d). Consistent with a specific role of METTL3 in methylating the 2515 site, no significant difference was observed in the amplification of the non-m.sup.6A A2511 site for controlling for initial RNA input amounts. Therefore, the 2515 site of MALAT1 was determined to be the biological target site of METTL3.

[0155] Note that m.sup.6A mediated mRNA degradation. To ensure that the total RNA from the control and METTL3.sup.+/− cells loaded on SELECT contained equal amounts of MALAT1 transcripts, the inventors also performed qPCR analysis to adjust the amount of input total RNA (see FIG. 20).

Example 11 SELECT Method for Detecting Other Types of RNA Modifications

[0156] The inventors found that, by using the model oligonucleotides Oligo3 (SEQ ID NO. 3), Oligo4 (SEQ ID NO. 4), and Oligo5 (SEQ ID NO. 5) listed in Table 1 and the up probes and down probes listed in Table 3, the SELECT method in combination with the qPCR of Example 1 could effectively distinguish other RNA modifications, such as Ni-methyladenosine (m.sup.1A) and 2′-O-methyladenosine (Am), but could not distinguish pseudouridine (ψ) (see FIG. 21).

[0157] The examples described above are only a part of the examples of the present application, not all of the examples. Based on the examples in the present application, all other examples obtained by those of ordinary skill in the art without creative work shall fall within the protection scope of the present application.