Method of preparing ddx27-deletion zebrafish mutants

11406090 · 2022-08-09

Assignee

Inventors

Cpc classification

International classification

Abstract

A method of preparing a ddx27-deletion zebrafish mutant, including: determining a target of ddx27 knockout on a sixth exon of the ddx27 in a zebrafish and designing a gRNA sequence; using primers T7-ddx27-sfd and tracr rev for PCR amplification with a pUC19-gRNA scaffold plasmid as a template; purifying and transcribing the PCR product obtained in vitro to produce gRNA; introducing the gRNA and a Cas9 protein into the zebrafish; and culturing the zebrafish to obtain a zebrafish ddx27 mutant of stable inheritance. In addition, the application also discloses a phenotype of the ddx27-deletion zebrafish mutant, which plays an important role in investigating the biological function.

Claims

1. A method of preparing a ddx27-deletion zebrafish mutant, comprising: (1) determining a target on the sixth exon of a ddx27 gene in a zebrafish and designing a guide RNA (gRNA), wherein the target consists of the sequence of SEQ ID NO: 1, and the gRNA consists of the sequence of SEQ ID NO: 6; (2) designing and synthesizing an upstream primer T7-ddx27-sfd and a downstream primer tracr rev; (3) using primers T7-ddx27-sfd and tracr rev for PCR amplification with a pUC19-gRNA scaffold plasmid as a template; (4) transcribing and transforming the PCR product obtained in step 3 in vitro to produce the gRNA; (5) introducing the gRNA and a Cas9 protein into the zebrafish; and (6) culturing the zebrafish obtained in step 5 to obtain a zebrafish ddx27 mutant.

2. The method of claim 1, wherein in step 3, the primer T7-ddx27-sfd consists of the sequence of SEQ ID NO: 2.

3. The method of claim 1, wherein in step 3, the primer tracr rev consists of the sequence of SEQ ID NO: 3.

4. The method of claim 1, wherein step 5 further comprises: mixing the gRNA with the Cas9 protein to produce a mixture and microinjecting the mixture into a 1-cell stage embryo of the zebrafish; wherein a final concentration of the gRNA is 80-100 ng/μL; a final concentration of the Cas9 protein is 800 ng/μL; and a total volume of the mixture is 1 μL.

5. The method of claim 1, wherein step 6 further comprises: (i) examining embryos of the zebrafish introduced with the gRNA and the Cas9 protein and a wild-type zebrafish to measure ddx27 knockout efficiency so as to determine that an F.sub.0 ddx27-knockout zebrafish is cultured to be an adult zebrafish; (ii) outcrossing the adult F.sub.0 ddx27-knockout zebrafish with the wild-type zebrafish to test heritability and effective mutations, thereby screening an F.sub.1 zebrafish with heritable and effective mutation for feeding to adult zebrafish; wherein an F.sub.1 zebrafish ddx27 mutant is obtained by genotype identification; (iii) incrossing the same F.sub.1 zebrafish ddx27 mutants to obtain an F.sub.2 zebrafish ddx27 mutant; and (iv) identifying the homozygous F.sub.2 zebrafish ddx27-knockout mutant as the zebrafish ddx27 mutant of stable inheritance.

6. The method of claim 5, wherein in step (i), the ddx27 knockout is examined by using a primer sequence comprising an upstream primer ddx27-F that consists of the sequence of SEQ ID NO: 4 and a downstream primer ddx27-R that consists of the sequence of SEQ ID NO: 5.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows the examination of ddx27 knockout in an F.sub.0 zebrafish, where FIG. 1A shows gel electrophoresis results of PCR product from the ddx27 of an F.sub.0 zebrafish embryo; FIG. 1B shows gel electrophoresis results of digestion by T7E1 endonuclease; and FIG. 1C is a peak map showing the sequencing results of PCR products.

(2) FIGS. 2A-C show the germline transmission test results of the ddx27 of F.sub.0 zebrafish, where FIGS. 2A and 2B show gel electrophoresis results of digestion by T7E1 endonuclease; and FIG. 2C is a peak map showing the sequencing results of PCR products.

(3) FIGS. 3A-B show the genotype detection results of the ddx27 in an F.sub.1 adult zebrafish, where FIG. 3A shows part of the gel electrophoresis results of digestion by T7E1 endonuclease; and FIG. 3B shows alignment results of sequencing of monoclones selected by ligation and transformation of PCR products.

(4) FIGS. 4A-C show statistical results of phenotypes of mutants of different ddx27 deletion types (P value is greater than 0.05 as demonstrated by chi-square test, so that the difference is not significant which is consistent with Mendel's law of inheritance), where FIG. 4A is a statistical histogram showing proportions of various phenotypes of ddx27-27 bp; FIG. 4B is a statistical histogram showing proportions of various phenotypes of ddx27-14 bp; and FIG. 4C is a statistical histogram showing proportions of various phenotypes of ddx27-5 bp.

(5) FIGS. 5A-F show comparison between zebrafish mutants of different ddx27 deletions and wild-type zebrafish in phenotype (3 days post fertilization, dpf), where FIG. 5A shows comparison between the ddx27-27 bp zebrafish mutant and the wild-type zebrafish in phenotype (3 dpf); FIG. 5B shows comparison between the ddx27-14 bp zebrafish mutant and the wild-type zebrafish in phenotype (3 dpf); FIG. 5C shows comparison between the ddx27-5 bp zebrafish mutant and the wild-type zebrafish in phenotype (3 dpf); FIG. 5D shows comparison between 10 ddx27-27 bp zebrafish mutants and 10 wild-type zebrafish in phenotype (3 dpf); FIG. 5E shows comparison between 10 ddx27-14 bp zebrafish mutants and 10 wild-type zebrafish in phenotype (3 dpf); and FIG. 5F shows comparison between 10 ddx27-5 bp zebrafish mutants and 10 wild-type zebrafish in phenotype (3 dpf).

(6) FIG. 6 is a gel electrophoresis image showing the genotype detection results of F.sub.2 ddx27-27 bp zebrafish.

(7) FIG. 7 is a gel electrophoresis image showing the genotype detection results of F.sub.2 ddx27-14 bp zebrafish.

(8) FIG. 8 is a gel electrophoresis image showing the genotype detection results of F.sub.2 ddx27-5 bp zebrafish.

DETAILED DESCRIPTION OF EMBODIMENTS

(9) The invention will be illustrated in detail below with reference to the embodiments. The following embodiments will help those skilled in the art further understand the invention, but are not intended to limit the invention in any way. It should be noted that some adjustments and improvements made by those skilled in the art without departing from the spirit should still fall within the scope of the invention.

EXAMPLE 1

(10) 1 Materials and Instruments

(11) 1.1 Experimental Sample

(12) Zebrafish used herein were all derived from the AB strain and were purchased from the Zebrafish Platform of Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences.

(13) 1.2 Plasmid

(14) The pUC19-gRNA scaffold plasmid was referred to a literature (Chang N, Sun C, Gao L, Zhu D, Xu X, Zhu X, Xiong J W, Xi J J. Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos, Cell Res, 2013, 23 (4):465-472).

(15) The pUC19-gRNA scaffold plasmid was used as a template in the synthesis of gRNA product and had a sequence shown in GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTT GAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO.7).

(16) 1.3 Reagent

(17) DNA Clean & Contentrator-5 (ZYMO RESEARCH, D4004); Ordinary DNA purification kit (TIANGEN BIOTECH CO., Ltd., DP204-03); MAXIscriptt® T7 in vitro Transcription Kit (Ambion, AM1314); Absolute ethanol (Sinopharm Chemical ReagentCo., Ltd., 10009218); GenCrispr NLS-Cas9-NLS (GenScript, Z03389-25); Premix Taq™ (Ex Taff Version 2.0 plus dye) (TAKARA, RR902); DNA Marker I (TIANGEN BIOTECH CO., Ltd, MD101-02); T7endonuclease 1 (NEW ENGLAND BioLab® Inc., M0302L); Rapid Plasmid Miniprep kit (TIANGEN BIOTECH CO., Ltd, DP105); DH5a competent cells (TIANGEN BIOTECH CO., Ltd, CB101-03); 2BEasyTaq PCR SuperMix (+dye) (TAKARA, AS111-12); LB Broth (Sangon Biotech (Shanghai) Co., Ltd., D915KA6602); LB Broth agar (Sangon Biotech (Shanghai) Co., Ltd, D911KA6566); and pMD™ 19-T Vector Cloning Kit (TAKARA, 6013).

(18) 1.4 Instruments

(19) PCR instrument (BIO-RAD, cl 000 Touch™ Thermal Cycler); Small centrifuge (eppendorf, Centrifuge 5424); Vortex mixer (VORTEX-GENIE, G560E); UV spectrophotometer (Thermo Scientific, Nanodrop 2000C); Electrophoresis apparatus (BIO-RAD, PowerPac Basic); Gel imager (Bio-Rad, Gel Doc EZ Imager); Electronic balance (METTLER TOLEDO, AL104); Glass capillary (WPI, TW100E-4); Milli-Q Direct 8 Ultra-pure Water System (Millipore, Milli-Q Direct 8); Vertical puller (NARISHIGE, PC-10); Thermostatic shaker (Innova, 40R); Microgrinder (NARISHIGE, EG-400); Micro syringe pump (WARNER, PLI-100A); Thermostatic water bath (Shanghai Jing Hong Laboratory Instrument Co., Ltd., H1401438, DK-8D); 4° C. Refrigerator (Haier, HYC-610); −40° C. Low-temperature refrigerator (Haier, DW-40L508); -80° C. Ultra-low temperature freezer (Panasonic, MDF-U53V); and High-Pressure Steam Sterilization Pot (SANYO Electric Co., Ltd., MLS-3780).

(20) 2. Method

(21) 2.1 Synthesis of gRNA

(22) (1) Design of Target

(23) a. Downloading of Sequence

(24) The Ensembl database was searched and the sequence of ddx27 in the zebrafish was downloaded.

(25) b. Design of Target

(26) The target was designed at the exon sequence following ATG of the ddx27 gene using the website http://zifit.partners.org/ZiFiT/ChoiceMenu.aspx (Table 1). The target of the ddx27 was designed at the sixth exon.

(27) c. Detection for the Specificity of the Target

(28) The designed target sequence was verified for the specificity by blast alignment on the NCBI website.

(29) d. Detection of Parents

(30) The tail of the WT zebrafish for gene knocking out was cut and lysed with a base to obtain the genomic DNA. The genomic DNA was then used to amplify a sequence near the target by PCR.

(31) e. Detection of Digestion

(32) The WT zebrafish was treated with T7E1 endonuclease to determine whether the T7E1 enzyme can digest the amplified fragment. If the fragment cannot be digested, the T7E1 enzyme was suitable for the subsequent detection of knockout, and if the fragment was digested, it is required to select a specific enzyme for digestion detection based on amplified sequence.

(33) f. Identification by Sequencing

(34) The PCR products were sequenced. By alignments of peak maps and sequences, the parents were confirmed to be homozygous and no natural mutation occurred, thus ensuring that the subsequently prepared mutants were generated by gene knockout.

(35) TABLE-US-00001 TABLE 1 Target sequence of ddx27 Number Full Length of of Number Number Target Chromo- length/ mRNA/ amino of of sequence Gene some bp bp acids/aa introns exons (5′-3′) Exon ddx27 6 41352 2626 776 20 21 GGACAGA 6 TTCATGT CCTGGA (SEQ ID NO. 1)

(36) (2) Design of the Primers for Detection

(37) It should be ensured that the designed primers were greater than 100 bp away from both sides of the target. Moreover, the difference between the distance between the upstream primer and the target and the distance between the downstream primer and the target were preferably greater than 100 bp, at least 50 bp. The primers used for amplification should be specific and the amplified fragment had a length of about 500 bp. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Table 2).

(38) TABLE-US-00002 TABLE 2 Information about primers used in the experiment Length of the digested Full fragments/ Primers Sequence (5′-3′) length/bp bp T7-ddx27-sfd AATACGACTCACTATAGGACAGATTCATGTCCTGGAGTTTT 120 — AGAGCTAGAAATAGC (SEQ ID NO. 2) trac rev AAAAAAAGCACCGACTCGGTGCCAC (SEQ ID NO. 3) — — ddx27-F GAAAGGAAAGAGGAAAATGG (SEQ ID NO. 4) 487 190 + 297 ddx27-R TTCGTTGTTTGATTCCTATT (SEQ ID NO. 5)

(39) (3) Synthesis of gRNA Product

(40) The pUC19-gRNA scaffold plasmid was used as a template, and the fragment was amplified using primers T7-ddx27-sfd and tracr rev and 2×EasyTaq PCR SuperMix (+dye), and purified using a kit.

(41) (4) In-Vitro Transcription

(42) The reaction system was shown in Table 3.

(43) TABLE-US-00003 TABLE 3 Nuclease-free Water to 20 μL DNA template 1 μg 10 × Transcription Buffer 2 μL 10 mM ATP 1 μL 10 mM CTP 1 μL 10 mM GTP 1 μL 10 mM UTP 1 μL T7Enzyme Mix 2 μL

(44) It should be noted that 10×Transcription Buffer and T7Enzyme Mix were finally added.

(45) The reaction system was mixed uniformly, centrifuged for a short time and incubated at 37° C. for 80 minutes. The reaction system was further added with TURBO DNase (1 μL), mixed uniformly, centrifuged for a short time and incubated at 37° C. for 15 minutes.

(46) (5) Purification of gRNA

(47) a. To the in-vitro transcription system (20 μL) were added LiCl (2.5 μL, 4 M) and absolute ethanol (100 μL). The reaction system was mixed uniformly, centrifuged for a short time and placed in the −80° C. freezer for at least 1 hour.

(48) b. Then the reaction system was transferred from the freezer and centrifuged at 4° C. and 12,000 rpm for 15 minutes. The supernatant was discarded, and the precipitate was washed with 70% ethanol and centrifuged at 4° C. and 8,000 rpm for 5 minutes. The supernatant was discarded and the centrifuge tube was transferred to a fume hood to allow the complete evaporation of ethanol.

(49) c. Based on the amount of the precipitate, an appropriate amount of DEPC water was added to dissolve the gRNA precipitate.

(50) d. Concentration and OD value were measured using the Nanodrop, and length of the sequence was detected by electrophoresis.

(51) The gRNA had a sequence shown in TAATACGACTCACTATAGGCATCTGCATGA ATACACAGTTTTAGAGCTAGAA ATAGCGGACAGATTCATGTCCTGGACGTTATCAACTTGAAAAAGTGGCACC GAGTCGGTGCTTTTTTT (SEQ ID NO.6).

(52) 2.2 Microinjection

(53) The gRNA was mixed with the Cas9 protein (GenCrispr NLS-Cas9-NLS, GenScript Biotech Co., Ltd., Z03389-25) and injected into the one-cell stage embryo zebrafish by a microinjector. In each injection, some uninjected embryos of the same batch were left and used as the control group. Final concentrations of the gRNA and the Cas9 protein after mixing were 100 ng/μL and 800 ng/μL, respectively.

(54) 2.3 Verification of Knockout and Determination of Knockout Efficiency (T7E1 Digestion Test)

(55) a. Extraction of Genome from Zebrafish Eggs

(56) 5 eggs in each group were added with NaOH (3.5 μL, 50 mM) and incubated at 95° C. for 20 minutes. During the incubation, the eggs were shaken and centrifuged for a short time once. Then the eggs were added with Tris.Math.HCl (3.5 μL, 1M, pH≈8.0), shaken vigorously for uniform mixing, and centrifuged.

(57) b. PCR Amplification of the Target Fragment

(58) The target fragment was amplified according to the primers designed near the target.

(59) The PCR reaction system was shown in Table 4.

(60) TABLE-US-00004 TABLE 4 H.sub.2O to 25 μL Enzyme 12.5 μL F  0.5 μL R  0.5 μL Template 10 ng

(61) The PCR reaction conditions were described as follows: pre-denaturation at 98° C. for 2 seconds; 32 cycles with each cycle consisting of denaturation at 98° C. for 10 seconds, annealing at 60.3° C. for 30 seconds and extension at 72° C. for 1 minute; extension at 72° C. for 5 minutes; and storage at 4° C.

(62) The electrophoresis was performed using 2% agarose gel at 120 V for 25 minutes.

(63) c. Detection of T7E1 Endonuclease Digestion

(64) TABLE-US-00005 TABLE 5 H.sub.2O to 10 μL PCR product   5 μL Buffer 1.1 μL

(65) The reaction system was incubated at 95° C. for 5 minutes, cooled to room temperature, added with the T7E1 endonuclease (0.25 μL) and incubated at 37° C. for 45 minutes.

(66) d. Detection by Electrophoresis

(67) After electrophoresis, the agarose gel was imaged by a gel electrophoresis imager, and the target band was observed to determine whether the knockout was successful.

(68) 2.4 Identification of Genotypes of Homozygous Zebrafish ddx27 Mutants

(69) Genotypes of zebrafish of different deletion types were screened and identified.

(70) 3. Results

(71) 3.1 Construction of ddx27 Mutant

(72) 3.1.1 Test Results of ddx27 Knockout in F.sub.0 Zebrafish

(73) The results of T7E1 digestion demonstrated the successful knockout of ddx27. The sequencing peak map showed the presence of overlapping peaks at the target, demonstrating that the ddx27 was knocked out (FIGS. 1A-1C).

(74) 3.1.2 Test Results of Germline Transmission of ddx27 in F.sub.0 Zebrafish

(75) 6 F.sub.0 adult zebrafish which were detected to involve successful knockout of ddx27 were outcrossed with the wild-type zebrafish to generate F.sub.1 embryos and 5 embryos in one tube. 3-4 tubes of embryos were digested by T7E1 endonuclease for identification. The digestion results indicated that the mutation in 2 zebrafish was passed to the offspring (FIGS. 2A-2C).

(76) 3.1.3 Identification of Phenotype of F.sub.1 Heterozygous Zebrafish ddx27 Mutant

(77) 72 zebrafish obtained by outcrossing were detected for their ddx27 gene using tail-cutting method. As shown in the detection results of the T7E1 digestion, 22 positive zebrafish were generated, which were then subjected to TA cloning to determine the occurrence of effective mutation.

(78) Among the 22 zebrafish involving effective mutation, after screening, there were 5 mutants involving 27 bp deletion, 13 mutants involving 14 bp deletion and 4 mutants involving 5 bp deletion (FIGS. 3A-3B).

(79) 3.1.4 Observation and Photographing of Phenotype of F.sub.2 Zebrafish ddx27 Mutant

(80) (1) The heterozygous mutants of different ddx27 deletion types were incrossed, and the eggs were collected and cultured for observation of early embryo development. Obvious developmental delays and deformities such as small head, small eyes and pericardical edema were observed 3 days post fertilization. In each mutation type, 3 pairs of different heterozygous mutants were used as parents for spawning, and the numbers of abnormal phenotype and its siblings were counted for chi-square test. The results showed that the difference among the three mutation types was not significant, which was consistent with Mendel's law of inheritance (FIGS. 4A-4C).

(81) (2) To further determine the phenotypes of the ddx27 mutants, the zebrafish mutants of different ddx27 deletion types and the wild-type zebrafish (3 dpf) were observed and photographed and used for subsequent identification of genotypes (FIGS. 5A-5F).

(82) 3.1.5 Identification of genotypes of F.sub.2 Homozygous ddx27 Zebrafish Mutants

(83) (1) A single embryo of the F2 zebrafish derived from incrossing of ddx27.sup.+/− (−27 bp) mutants (3 dpf) was detected by electrophoresis. The genotypes were determined based on the bands. The results showed that there were 6 positive heterozygous zebrafish and 4 wild-type zebrafish, and zebrafish in the abnormal phenotype group were all homozygous, which was consistent with FIG. 5D (FIG. 6).

(84) (2) A single embryo of the F2 zebrafish derived from incrossing of ddx27.sup.+/− (−14 bp) mutants (3 dpf) was detected by electrophoresis. The genotypes were determined based on the bands. The results showed that zebrafish in the abnormal phenotype group were all homozygous, which was consistent with FIG. 5E (FIG. 7).

(85) (3) A single embryo of the F.sub.2 zebrafish derived from incrossing of ddx27.sup.+/− (−5 bp) mutants (3 dpf) was detected by electrophoresis. The genotypes were determined based on the bands. The results showed that zebrafish in the abnormal phenotype group were all homozygous, which was consistent with FIG. 5F (FIG. 8).