High yield lactic acid production using mixed cultures

11390892 · 2022-07-19

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention is in the field of a method of producing lactic acid in high yield in a sequencing batch reactor. Therein glucose may be used as feedstock for bacteria, which ferment the glucose into lactic acid. The reactor is operated under at least partly defined non-axenic conditions and in a cyclic mode.

Claims

1. A method of producing lactic acid in a sequencing batch reactor comprising: adaptively cycling at least once between (i) a reaction phase, (ii) an effluent phase, and (iii) a feed phase, wherein in the reaction phase: (ia1) maintaining the pH at a predetermined level between 5.6 and 8.5, (ia2) maintaining the temperature at 30-80-° C., (ia3) stirring the reaction phase, (ib) adding a base when the pH is below the predetermined level until the pH is at or above the predetermined level, (ic1) allowing fermentation to continue during a fermentation time until fermentation reaches a stationary phase wherein the pH is constant during at least 10 minutes, (ic2) when fermentation has reached the stationary phase removing part of a produced effluent to the effluent phase, and (ic3) adding feed to the reaction phase, in the effluent phase: (iia) removing at least part of produced lactic acid from the effluent, and in the feed phase: (iiia) providing an aqueous feed mixture comprising: >10 g/l of a saccharide comprising compound, wherein the saccharide compound is selected from glucose, sucrose, fructose, galactose, lactose, disaccharides, oligo saccharides, poly saccharides, starch, inulin, or a combination thereof, and >1 g peptide/100 g saccharide compound, wherein the peptide concentration in the feed phase is between 1-30 g peptide/100 g saccharide, adding, at a start of the reaction phase, a mixed starting culture capable of fermenting the saccharide into lactic acid, and wherein a biomass hydraulic retention time is controlled to between 4-144 hours.

2. The method according to claim 1, wherein microbial biomass is cycled at least once between the reaction phase, the effluent phase, and the feed phase.

3. The method according to claim 1, wherein the feed phase comprises >80 g/l saccharide compound.

4. The method according to claim 1, wherein the peptide concentration in the feed phase is between 2-20 g peptide/100 g saccharide.

5. The method according to claim 1, wherein the peptide is selected from monopeptides, dipeptides, tripeptides, tetrapeptides, is provided as microbial biomass, is provided as recycled microbial biomass, and combinations thereof.

6. The method according to claim 1, wherein a reactor size is 50-1000 m.sup.3.

7. The method according to claim 1, wherein the sequencing batch reactor is a sequencing fed batch reactor.

8. The method according to claim 1, wherein no sterilization is carried out, no inoculation is carried out, and/or no live yeast is present in feed phase stock.

9. The method according to claim 1, wherein the feed phase comprises vitamin B and/or a metabolic precursor thereof.

10. The method according to claim 9, wherein the vitamin B is selected from vitamin B1, vitamin B2, vitamin B3, vitamin B5, vitamin B6, vitamin B7, vitamin B12, a salt of said vitamins, and combinations thereof.

11. The method according to claim 9, wherein the metabolic precursor is selected from metabolic precursors for coenzyme in catabolism of sugar, cofactor FAD, cofactor FMN, coenzyme NAD, coenzyme NADP, coenzyme A, a metabolic coenzyme, a fatty acid metabolism coenzyme, an amino acid metabolism coenzyme, and combinations thereof.

12. The method according to claim 1, wherein a culture titer of lactic acid of >40 g/l is maintained during the reaction phase.

13. The method according to claim 1, wherein a magnesium cation concentration in the feed phase is 0.1-5 g/l, and/or wherein a calcium cation concentration in the feed phase is >1.5 mg Ca/g saccharide compound.

14. The method according to claim 1, wherein the mixed starting culture is enriched for L-lactic acid producing microorganisms.

15. The method according to claim 1, wherein a biomass hydraulic retention time is controlled to between 18-96 hours.

16. The method according to claim 1, wherein the reaction phase comprises >10% Streptococci.

17. The method according to claim 1, wherein a hydraulic retention time (HRT) is from 1-8 days.

18. The method according to claim 1, wherein the base is selected from hydroxides, oxides, ammonia, and combinations thereof.

19. The method according to claim 1 wherein the pH is maintained at 7.0±0.5, the temperature is maintained at 30-55° C., the peptide concentration is >2 g/100 g saccharide compound, a vitamin B is present at >0.1 g/l, and wherein >98% L-lactic acid is produced on a mol lactate/mol saccharide compound basis.

20. The method according to claim 1, further comprising (iib) providing a remainder of the effluent phase to the feed phase.

Description

SUMMARY OF THE FIGURES

(1) FIGS. 1a-b, 2, and 3a-b and 4 show some details of the present invention.

DETAILED DESCRIPTION OF FIGURES

(2) In FIG. 1a a schematic representation of the present adaptive cycle is shown. A feed phase is provided with a saccharide, and typically mixed. The feed is provided, in an adaptive cyclic mode, to a reaction phase, wherein microorganisms produce lactic acid from the saccharide. In the reaction phase the pH is measured. Upon decrease of the pH a source of base is activated, and base is added until the pH reaches a predetermined level. Then the addition of base is stopped, for the time being. The effluent of the reaction phase is transferred to an effluent phase, and the lactic acid is removed. A remainder of the effluent phase is fed back to the feed phase.

(3) Initially base is added to the reaction phase, in order to compensate the pH for the lactic acid being formed. The amount of base over time decreases, until a plateau is reached. Then addition of base is stopped, as no further lactic acid is formed. The reactor volume as function of time/phase of operation is shown. Phases in a single adaptive cycle and theoretical associated base dosage profiles of the sequencing batch reactor used to perform adaptive base adaptive cycling. The adaptive cycle length was controlled by imposing a maximum base constant time, after which a new adaptive cycle was initiated, starting from the effluent phase.

(4) FIG. 2: Result of a FISH image using the str probe (light grey), specific for the streptococcus genus (Trebesius et al. 2000) compared to the EUB338 probe mix (dark grey) (Amann et al. 1990).

(5) FIGS. 3a-b show microscopic images of bacterial cultures at pH=5 (left) and pH=7 (right), clearly showing that different bacteria are present at the higher pH.

(6) FIG. 4: Development of the read abundance of the 16S rRNA gene V3-V4 region in time on genus level. Various species are found, which develop over time in amount. Streptococcus, Enterobacteriaceae, Citrobacter, Klebsiella, and Clostridium are found in relatively high amount.

EXAMPLES

(7) Materials and Methods

(8) Reactor Operation

(9) The enrichment was carried out in a 3 L bioreactor with a working volume of 2 L. Anaerobic conditions were maintained by continuously sparging the reactor with N2 at a rate of 216 mL min-1 (@T=273K, P=105 kPa). The culture was taken out of the reactor for biofilm removal from reactor walls and head three times per week. The reactor was continuously agitated at a speed of 300 rpm using mechanical stirrers. Reactor temperature was maintained at 30□C by recirculating water heated at 31° C. (E300 thermostat, Lauda, Germany) in the outer wall of the reactor. To prevent culture broth evaporation, the off-gas was cooled using a cryostat set to 5° C. Reactor pH was maintained at 5.0±0.2 using 8 mol L.sup.−1 NaOH and 1 mol L.sup.−1 HCl solutions (ADI 1030 Bio controller, Applikon, The Netherlands). To prevent excessive foaming, anti-foaming agent (3% v:v anti-foam C, Sigma Aldrich, Germany) was added in equal amounts and at equal speed as NaOH during 10 g L.sup.−1 glucose fermentations.

(10) Enrichment Medium

(11) The enrichment at 10 g L.sup.−1 glucose was performed using a medium to which NH.sub.4Cl, KH.sub.2PO.sub.4 and FeCl.sub.2.4H.sub.2O were added to obtain a set molar C:N:P:Fe ratio of 100:5:1:0.33 and 1.5 g yeast extract was added per 10 g of glucose. Glucose and yeast extract solutions were autoclaved separately at 110° C. for 20 minutes and then combined. Salts were supplied to the reactor from a second vessel, which was autoclaved at 121° C. Magnesium concentrations were adjusted to increasing glucose concentrations. Trace elements were supplied in sufficient amounts.

(12) SBR Phases and Start-Up

(13) The reactor was operated in SBR mode. In a start-up phase for culture development the reactor was operated in batch mode until glucose was entirely consumed. For inoculation of the enrichment, 10 mL (0.5% v/v) of suspended and sieved (150 μm filtered) soil from the botanical garden of TU Delft was used (pH 7.4) and 10 mL of anaerobic digester sludge (Harnaschpolder, The Netherlands). After the start-up phase the SBR mode with an exchange ratio of 50% was entered. Three different SBR phases are distinguished: the effluent phase (5 minutes), the feed phase (4 minutes) and the reaction phase. The length of the reaction phase was dependent on the speed of microbial conversions in the reactor: adaptive base adaptive cycling was used to control the adaptive cycle time (FIG. 1). The base constant time was initially kept at 90 minutes to avoid biomass washout, as an initial lag phase was observed in the adaptive cycles at the start of the enrichment. Throughout the enrichment, the base constant time was gradually decreased to 20 minutes.

(14) Batch with 100 g L.sup.−1 Glucose at pH 5

(15) Anaerobicity, temperature, pH, agitation and broth evaporation were controlled as described for the sequencing batch reactors. After 2.5 days of operation the reactor was spiked with 0.25 times the initial amount of trace elements.

(16) Samples for monitoring biomass growth (OD660), glucose consumption and product formation were taken every 30 minutes for the first 2.5 hours of the cultivation. After this, samples were taken every hour until t=8 h and finally 3 samples per day were taken. The final biomass concentration was calculated by measuring the volatile suspended solids (VSS) at the end of the fermentation.

(17) SBR Operation at pH 7

(18) The enrichment at pH 7 was carried out as described for pH 5, but the pH was controlled at 7.2±0.2 using 8 mol L.sup.−1 NaOH. The reactor was inoculated with 5 mL suspended and sieved soil and 5 mL anaerobic digester sludge. Adaptive base adaptive cycling with a minimal base constant time of 10 minutes was used for the first two weeks of enrichment, after which a fixed adaptive cycle length of 90 minutes was set. Initially, the culture broth was agitated at 300 rpm. However, after 145 SRTs the stirring speed was increased to 600 rpm to improve mass transfer of carbon dioxide to the gas phase.

(19) Batch with 100 g L.sup.−1 Glucose at pH 7

(20) The batch reactor was operated as described for the batch process at pH 5. The reactor was inoculated with cell pellets of approximately 1 L of the culture obtained at the end of the enrichment at pH 7. Samples were taken every 30 minutes for the first 3.5 hours and every hour until glucose was nearly depleted (<16 mM residual glucose). Anti-foam was added manually when foaming occurred. Culture was stored in the fridge overnight before collecting the pellet for VSS determination.

(21) Analytical Methods

(22) The gas productivities (H.sub.2 and CO.sub.2) and acid/base dosages for pH control were monitored on-line using MFCS software (Sartorius, Germany) and a Rosemount Analytical NGA 2000 (Emerson, USA). Biomass concentrations were monitored both by measuring optical density (OD660) and the amount of VSS in the broth as described earlier using 150 mL effluent (APHA/AWWA/WEF 1999), calculated assuming a biomass molecular weight of 24.6 g mol.sup.−1. Both OD and VSS were always determined in duplicate. Glucose, ethanol and VFA concentrations were determined using high performance liquid chromatography (HPLC) using an Aminex HPX-87H column (BioRad, USA) at 59° C. coupled to a refractive index- and ultraviolet detector (Waters, USA). 1.5 mmol L.sup.−1 phosphoric acid was used as eluent. Biomass was removed from the reactor samples by centrifugation and filtration using a 0.22 μm membrane filter (Millipore, Millex-GV, Ireland).

(23) Microbial Community Analysis

(24) DNA was extracted from cell pellets from different time points in the enrichment using the DNAeasy microbial extraction kit (Qiagen Inc., Germany) following manufacturer's instructions and sent to Novogene (Hong Kong, China) for 16S rRNA amplicon sequencing of the V3-V4 region as described by Rombouts et al., (2019).

(25) Fluorescent in situ hybridization (FISH) was used for analyzing the microbial community with epifluorescence microscopy (Axioplan 2 imaging, Zeiss, Germany). Fixation and overnight hybridization were performed as described by Johnson et al. (2009) using the probes listed in table 1. An additional DAPI staining targeting all microbial cells was used by incubating the slides for 15 minutes with 10 μL of 10 mg mL.sup.−1 DAPI solution after washing and drying.

(26) TABLE-US-00001 Microorganism Probe Formamide (%) Sequence (5′ .fwdarw. 3′) Eubacteria EUB338 5-30 GCTGCCTCCCGTAGGAGT Lactobacillus Lacto772 25 YCACCGCTACACATGRAGTTCCACT Lactococcus Lactococcus4  5 CTGTATCCCGTGTCCCGAAG Megasphaera Mega-X 25 GACTCTGTTTTTGGGGTTT Streptococcus Str 30 CAC TCT CCC CTT CTG CAC Enterobacteriaceae Ent183 20 CTC TTT GGT CTT GCG ACG

(27) Results

(28) A product spectrum was monitored in time of both enrichments. Lactate was the main fermentation product in both conditions. At 30 SRTs, the amount of trace elements was doubled, leading to mainly lactate production. At pH 7, a 5.4 times higher productivity was reached. What is very surprising is that only L-lactic acid is produced at pH 7, while a nearly racemic mixture is produced at pH 5.

(29) TABLE-US-00002 pH 5 pH 7  10 g L.sup.−1 Maximum obtained lactate yield 0.76 0.69 glucose (g.sub.p g.sub.s.sup.−1) Maximum obtained productivity 1.16 6.24 (g L.sup.−1 h.sup.−1) Ratio D:L - lactate 53:47 1:99 Y.sub.x/s (Cmol.sub.x Cmol.sub.s.sup.−1) 0.14 0.20 q.sub.s (Cmol.sub.s Cmol.sub.x.sup.−1 h.sup.−1) 0.74 2.25 μ.sub.average (h.sup.−1) 0.11 0.46 100 g L.sup.−1 Y.sub.LA/s (g.sub.p g.sub.s.sup.−1) 0.60 0.59 glucose Final attained lactate concentration 57.6 56.6 (g L.sup.−1) Y.sub.x/s (Cmol.sub.x Cmol.sub.s.sup.−1) 0.09 0.14 Average productivity (g L.sup.−1 h.sup.−1) 0.73 4.72

(30) The microbial community analysis revealed that the pH enrichment was predominated by Lactobacillus species. A significant side population of Megasphaera was detected.

(31) At pH 7, Streptococcus was observed to be predominant genus, with also several Enterobacteriaceae genera occurring, such as Klebsiella and Citrobacter. The amount of Streptococcus was shown to be very dominant, in the range of >90% of the biomass.

(32) Further tests have been performed, using 100 g/l glucose producing 82 g/l lactate, with a L:D ratio of 1:99. The biomass yield was 0.08 Cmol-x/Cmol-S and a productivity of 2.35 g/L/h was obtained.

CONCLUSIONS

(33) Obtaining selective L-lactic acid production using mixed cultures without sterilisation and a pure culture inoculum was achieved. An acidic environment at pH 5 was tested in comparison to a neutral pH environment at pH 7 under the same cultivation conditions. A complex medium was used, as this stimulates the growth of lactic acid bacteria. The adaptive cycle times could be adjusted to the time base dosage stopped and the substrate, glucose, was assumed to be depleted (the ‘plateau’ was reached). It was found that lactic acid bacteria could be successfully enriched at both pH 5 and pH 7 using the described enrichment strategy. Further, lactic acid production at pH 7 is favoured over pH 5, as the productivity is higher and there is selective production of L-lactic acid.

(34) Inventors have obtained a high yield of lactic acid on glucose using a defined medium and defined bioreactor conditions. A stable yield of >70% LA g/g of glucose, and a productivity of 6.2 g/l*h in a 21 bioreactor at 10 g/l glucose and a titer of lactic acid of 57 g/l is obtained in the reactor. These conditions, or more explicitly, these ecological parameters, can be applied to optimize current large-scale fermentations producing lactic acid. Also, current waste streams can be used to ferment these to lactic acid at high yield and refine the lactic acid out of the stream.

(35) With the present method and system, a maximum obtained yield of 0.69 (molp mols.sup.−1), a maximum obtained productivity of 6.24 (g L.sup.−1 h.sup.−1), a ratio D:L-lactate of 0-100, and a final attained lactate concentration of 56.6 (g L.sup.−1) were obtained.

(36) Below results of prior art documents and the present invention are compared.

(37) Table best achieved results on the basis of yield

(38) TABLE-US-00003 Present Akao et Tang et al. Liang et al. Zhang et Parameter invention al. 2007 2016 2015 al. 2008 pH 7.0 6 pH to 6 every Uncontrolled, 7 12 hours around 3.5 Temperature 30° C. 55° C. 37° C. 35° C. 35° C. HRT and SRT 34 hours 240 hours 120 hours 24 hours 120 hours Ratio 7 31.4 10.9 56.1 25.2 peptides/carbohydrates (g/100 g) Carbohydrate concentration 100 83 56.8 11.97 99.14 feed (g L.sup.−1) Yield lactic acid on 0.82 0.73 0.54 0.63 0.65 carbohydrate (g/g) Productivity (g LA L.sup.−1 h.sup.−1) 2.42 0.33 0.25 0.16 0.53 Lactic acid concentration at 82.3 39.6 30.5 7.5 64 the end of the experiment, product titer (g L.sup.−1) Ratio D:L 1:99 3:97 Not reported Not reported 40:60

(39) So for the best results it is noted that Akaou used a different temperature, with still lower yield and much lower productivity, Tang sets the pH to 6 every 12 hours, which has nothing to do with controlling, and Liang has an uncontrolled pH. Yields of lactic acid are much lower, and productivity is a factor lower, and typically almost an order lower. Also the D:L ratio is much better.