COLANIC ACID PRODUCTION USING MUTANT E. COLI
20220213520 · 2022-07-07
Assignee
Inventors
- Kyoung Heon Kim (Seoul, KR)
- Yong-Su Jin (Champaign, IL)
- Eun Ju YUN (Seoul, KR)
- In Jung KIM (Seoul, KR)
- Hyeong Min HAN (Seoul, KR)
- Sora Yu (Namyangju-si, KR)
Cpc classification
C12P19/04
CHEMISTRY; METALLURGY
International classification
C12P19/04
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a medium composition for culturing a strain for mass production of colanic acid and a method of mass producing colanic acid using the same. Ingredients for the culture medium of the present invention and their concentrations may be optimized using a statistical method, and used to greatly increase the production amount of colanic acid.
Claims
1. A method of producing colanic acid, comprising: preparing a mutant E. coli JM109 strain by removing the waaF gene from an E. coli JM109 strain; and culturing the prepared mutant E. coli JM109 strain in a fermentation medium.
2. The method of claim 1, wherein the fermentation medium comprises glucose, tryptone and sodium phosphate (Na.sub.2HPO.sub.4).
3. The method of claim 2, wherein the fermentation medium further comprises sodium chloride (NaCl), magnesium sulfate (MgSO.sub.4), calcium chloride (CaCl.sub.2) and potassium phosphate (KH.sub.2PO.sub.4).
4. The method of claim 3, wherein the fermentation medium comprises 10 to 30 g/l of glucose, 7 to 15 g/l of sodium phosphate, 1 to 5 g/l of potassium phosphate, 0.1 to 1 g/l of sodium chloride, 1 to 5 g/l of tryptone, 0.1 to 0.5 g/l of magnesium sulfate and 0.005 to 0.02 g/l of calcium chloride.
Description
DESCRIPTION OF DRAWINGS
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
MODES OF THE INVENTION
[0026] Hereinafter, the present invention will be described in detail with reference to the following examples. The following examples are merely provided to exemplify the present invention, and the contents of the present invention are not limited to the following examples.
[Example 1] Gene Removal
[0027] A strain used in the present invention is E. coli JM109 ΔwaaF, and the waaF gene was removed from a general E. coli JM109 strain. A strategy used for gene removal is λ-red recombination technology, and is schematically illustrated in
[0028] 1) A sequence fragment including a kanamycin-resistant gene between flippase recognition targets (FRTs), and upstream and downstream genes having homology with flanking regions of waaF was amplified using pKD4 plasmids by PCR.
[0029] The primer set used for the amplification of the sequence fragment is as follows:
TABLE-US-00001 Forward primer: (SEQ ID NO: 1) 5′-ATGGTGCCGTCCATTATTATCGCGGATGCCGGAAGTTAACGAAG CTATTCTTGTGTAGGCTGG AGCTGCTTC-3′ and Reverse primer: (SEQ ID NO: 2) 5′-GATAACCCTCCGCAGCGTCACC TTTACGCACTTTGTGATAGCC GGTAATCATGGGAATTAGCCATGGTCC-3′.
The underlined sequence areas of the primers indicate the homologous recombination areas of waaF.
[0030] 2) A pKD46 plasmid was inserted into E. coli JM109.
[0031] 3) A linear DNA template amplified in 1) was inserted into the E. coli JM109 into which the pKD46 plasmid was inserted, and then the pKD46 plasmid was expressed.
[0032] 4) A strain from which only the waaF gene was removed from the conventional E. coli JM109 was completed by insertion and expression of a pCP20 plasmid expressing a flippase recombination protein.
[Example 2] Fermentation Conditions
[0033] As a basic medium used for medium optimization, a M9 minimal medium, which is a medium that can easily show the influence of each ingredient and has minimal effect on analysis was selected, and the composition of the minimal medium was partially changed, and the concentration range of the medium ingredients was varied for use. Particularly, before optimization, the composition of the M9 minimal medium is as follows: 10.00-30.00 g/l of glucose, 1.00-2.00 g/l of tryptone, 3.00-10.00 g/l of sodium phosphate (Na.sub.2HPO.sub.4), 1.50-4.50 g/l of potassium phosphate (KH.sub.2PO.sub.4), 0.12-0.36 g/l of magnesium sulfate (MgSO.sub.4), 0.005-0.017 g/l of calcium chloride (CaCl.sub.2) and 0.50 g/l of sodium chloride (NaCl). As a result of investigation, it was found that when a temperature was low, a large amount of colanic acid is produced, so fermentation was performed at 25° C. In addition, as detailed conditions, the cultivation was carried out in a 250 ml Erlenmeyer flask containing a 50 ml medium by shaking culture at 200 rpm, and then after 24 hours, the degree of bacterial growth and the production amount of colanic acid were measured.
[Example 3] Quantification of Colanic Acid
[0034] The quantification of colanic acid was carried out in the manner of specifically quantifying glucuronic acid, which is one of the monomers. After the recovery of the cultured medium, and then the medium was reacted at 90 to 95° C. for 10 minutes to inactivate a protein. The resulting solution was then centrifuged at 4° C. and 10,000×g for 30 minutes, thus bacterial cells were separated in the form of a pellet, and colanic acid was present in a supernatant. After recovery of only the supernatant, ethanol was added at a volume corresponding to three times the volume of the supernatant to precipitate colanic acid. Again, the precipitate was recovered through centrifugation at 4° C. and 10,000×g for 30 minutes, dissolved in distilled water and used for the quantification of glucuronic acid. The quantification of glucuronic acid was carried out as follows:
[0035] 1) 5 ml of a 12.5 mM sodium tetraborate-sulfuric acid solution was added to 1 ml of a sample, and reacted at 100° C. for 5 minutes.
[0036] 2) After sufficiently cooling, 100 μl of a solution in which hydroxydiphenyl was dissolved in a 0.5% (w/v) sodium hydroxide aqueous solution at 1.5 g/l was added and sufficiently mixed.
[0037] 3) A glucuronic acid concentration of the corresponding sample was calculated by substituting the absorbance of the solution measured at 526 nm into a standard graph.
[0038] 4) The standard graph was plotted with a glucuronic acid standard solution.
[Example 4] Selection of Optimal Carbon Source
[0039] The degree of bacterial growth and the production amount of colanic acid were measured by changing only the type and concentration of a carbon source while leaving other ingredients of the MO minimal medium as they are. As carbon sources, a total of six sources such as glucose, sucrose, glycerol, xylose, molasses and a malt extract were used. Specifically, in the fermentation medium containing 6.78 g/l of Na.sub.2HPO.sub.4, 3.00 g/l of KH.sub.2PO.sub.4, 0.50 g/l of NaCl, 1.00 g/l of NH.sub.4Cl, 0.24 g/l of MgSO.sub.4 and 0.011 g/l of CaCl.sub.2,
[0040] the carbon source was added at a concentration of 5, 10, 15 or 20 g/l and the production amount of colanic acid was measured.
[0041] As shown in
[Example 5] Selection of Optimal Nitrogen Source
[0042] As known from the previous experiment, 20 g/l of glucose was selected as a carbon source, and the bacterial growth and the production amount of colanic acid were measured with various types and concentrations of nitrogen sources while leaving other factors as they are. A total of 7 nitrogen sources, which include peptone, tryptone, a yeast extract, urea, and a corn concentrate as organic nitrogen sources, and ammonium sulfate and ammonium chloride as inorganic nitrogen sources, were used. Specifically, the production amount of colanic acid was measured by adding 0.5, 1 or 1.5 g/l of the nitrogen source to a fermentation medium including 20.00 g/l of glucose, 6.78 g/l of Na.sub.2HPO.sub.4, 3.00 g/l of KH.sub.2PO.sub.4, 0.50 g/l of NaCl, 0.24 g/l of MgSO.sub.4, and 0.011 g/l of CaCl.sub.2.
[0043] As shown in
[0044] As a result, according to Examples 4 and 5, glucose and tryptone were used as a carbon source and a nitrogen source, respectively, and the final composition of the M9 minimal medium included glucose, sodium phosphate, potassium phosphate, sodium chloride, tryptone, magnesium sulfate and calcium chloride.
[Example 6] Statistical Method for Optimizing Culture Medium for Colanic Acid Synthesis
[0045] <6-1> Fractional Factorial Design (FFD)
[0046] As the first step for optimizing the concentrations of medium ingredients in earnest, FFD is an experiment for examining how much each component affects the production amount of colanic acid.
[0047] To screen the most important ingredients in a culture medium that affects colanic acid production, FFD was made using Minitab 18.1 (Minitab, State College, Pa., USA). FFD formed 18 experimental mixtures consisting of six independent variables with three levels (−1, 0 and 1) (Tables 1 and 2). In FFD, the amounts (g/l) of glucose (X1), tryptone (X2), Na.sub.2HPO.sub.4 (X3), KH.sub.2PO.sub.4 (X4), MgSO.sub.4 (X5) and CaCl.sub.2 (X6) were used as independent variables, and the amount (mg/1) of colanic acid produced by E. coli JM109 ΔwaaF (Y1) and a cell density (OD600; Y2) was used as dependent variables. The coded value of the dependent variables was obtained by the following equation:
[0048] Here, x.sub.i is a level (coded value) of a medium ingredient, X.sub.i is an actual value of a medium ingredient at the level x.sub.i, X.sub.0 is an actual value of a medium ingredient at the baseline, and ΔX.sub.i is a step change value. All experiments were performed in triplicate.
[0049] Based on the experimental result of FFD, regression analysis was performed to identify a component having a significant effect on colanic acid production. It simply means that when X.sub.i has a high absolute value of a coefficient estimate, X.sub.i has an important effect on colanic acid production. When X.sub.i is a negative coefficient estimate, it means that X.sub.i has a negative effect on colanic acid production, and when X.sub.i is a positive coefficient estimate, there is a positive effect.
[0050] Experimental concentrations were determined based on the M9 minimal medium and previous experiments, and are summarized in Table 1. FFD was designed with the determined concentrations, and after the experiment was carried out according to the design, the degree of bacterial growth and the production amount of colanic acid were measured and summarized in Table 2. To obtain an exact result, regression analysis was performed, and the regression analysis result is shown in Table 3. As a result of regression analysis, it was confirmed that X2 and X3, that is, tryptone and Na.sub.2HPO.sub.4 have a great effect on the production amount of colanic acid, and as a concentration increases in the determined concentration range, it was found that the production amount of colanic acid increases. Therefore, as a subsequent experiment, an experiment of optimizing concentrations of these two ingredients was carried out.
TABLE-US-00002 TABLE 1 Setting of FFD concentration range Independent variable Level.sup.a (g/l) Variable −1 0 +1 X.sub.1 Glucose 10 20 30 X.sub.2 Tryptone 1.0 1.5 2.0 X.sub.3 Na.sub.2HPO.sub.4 3.78 6.78 9.78 X.sub.4 KH.sub.2PO.sub.4 1.5 3.0 4.5 X.sub.5 MgSO.sub.4 0.12 0.24 0.36 X.sub.6 CaCl.sub.2 0.005 0.011 0.017 .sup.ax.sub.1 = (X.sub.1 − 20)/10; x.sub.2 = (X.sub.2 − 1.5)/0.5; x.sub.3 = (X.sub.3 − 6.78)/3; x.sub.4 = (X.sub.4 − 3)/1.5; x.sub.5 = (X.sub.5 − 0.24)/0/12; x.sub.6 = (X.sub.6 − 0.011)/0.006
TABLE-US-00003 TABLE 2 Experiment design by FFD and its result Run x.sub.1 x.sub.2 x.sub.3 x.sub.4 x.sub.5 x.sub.6 Y.sub.1 (CA; mg/l).sup.a Y.sub.2 (OD.sub.600).sup.a 1 −1 1 1 −1 −1 −1 1289.8 ± 20.1 2.02 ± 0.05 2 1 1 −1 −1 −1 1 822.1 ± 71.6 1.58 ± 0.05 3 −1 1 −1 −1 1 1 752.4 ± 30.4 1.79 ± 0.04 4 1 1 −1 1 −1 −1 817.3 ± 17.9 1.66 ± 0.08 5 0 0 0 0 0 0 1201.7 ± 72.8 1.71 ± 0.06 6 −1 −1 1 −1 1 1 1075.3 ± 33.9 1.18 ± 0.03 7 −1 −1 −1 −1 −1 −1 671.5 ± 51.6 1.22 ± 0.01 8 1 −1 −1 −1 1 −1 690.6 ± 20.7 1.07 ± 0.09 9 −1 1 1 1 −1 1 1287.0 ± 13.1 2.43 ± 0.03 10 −1 −1 −1 1 −1 1 224.0 ± 11.7 1.48 ± 0.02 11 1 1 1 1 1 1 1447.3 ± 88.8 2.33 ± 0.09 12 1 −1 1 −1 −1 1 1075.3 ± 24.4 1.24 ± 0.07 13 1 −1 1 1 −1 −1 849.1 ± 15.8 1.27 ± 0.01 14 1 1 1 −1 1 −1 1210.6 ± 45.7 2.09 ± 0.08 15 1 −1 −1 1 1 1 676.3 ± 32.3 1.31 ± 0.05 16 0 0 0 0 0 0 1356.3 ± 49.8 1.66 ± 0.01 17 −1 −1 1 1 1 −1 770.8 ± 18.8 1.41 ± 0.08 18 −1 1 −1 1 1 −1 954.8 ± 73.6 1.76 ± 0.08 .sup.aData were expressed as means ± standard deviations of triplicate experiments
TABLE-US-00004 TABLE 3 Regression analysis for FFD result Source Coefficient estimate Mean square F-value p-value.sup.a Model 117087 13.09 0.028 Intercept 913.4 0.000 X.sub.1 35.2 19814 2.22 0.233 X.sub.2 159.3 405992 45.40 0.007 X.sub.3 212.3 720865 80.62 0.003 X.sub.4 −35.1 19679 2.20 0.235 X.sub.5 33.9 18363 2.05 0.247 X.sub.1 × X.sub.2 −33.5 17977 2.01 0.251 X.sub.1 × X.sub.4 34.0 18493 2.07 0.246 X.sub.1 × X.sub.6 50.1 40168 4.49 0.124 X.sub.2 × X.sub.4 89.0 126744 14.17 0.033 Curvature 237603 26.57 0.014 Residual 8942 Lack of fit 7435 0.62 0.668 Pure error 11956 .sup.aThe results with P-values higher than 0.3 are not shown. *R2 = 0.9839
[Example 7] Steepest Ascent Method
[0051] To determine the optimal concentrations of the two ingredients selected by FFD, first, a steepest ascent method for detecting an approximate optimal concentration was carried out. In the determined concentration range, the higher the concentrations of both components, the higher the amount of production of colanic acid. Therefore, an approximate optimal concentration range for both components was determined by measuring the degree of bacterial growth and the production amount of colanic acid while increasing the concentrations of both components together. Referring to Table 4, as expected, as the concentrations of both components increased, the production amount of colanic acid increased and reached the maximum value in the 8.sup.th experiment. Accordingly, it was confirmed that the optimal conditions were about 2.90 g/l for tryptone, and about 10.98 g/l for Na.sub.2HPO.sub.4.
TABLE-US-00005 TABLE 4 Experiment design by steepest ascent method and its result Run X.sub.2 X.sub.3 CA (mg/l) OD.sub.600 1 1.50 6.78 1224.9 ± 11.4 1.52 ± 0.06 2 1.70 7.38 1326.7 ± 78.3 1.70 ± 0.01 3 1.90 7.98 1391.3 ± 179.4 1.85 ± 0.04 4 2.10 8.58 1593.3 ± 107.0 2.08 ± 0.08 5 2.30 9.18 1581.3 ± 69.9 2.23 ± 0.08 6 2.50 9.78 1691.0 ± 82.2 2.34 ± 0.07 7 2.70 10.38 1830.0 ± 65.6 2.49 ± 0.06 8 2.90 10.98 1887.4 ± 110.4 2.67 ± 0.10 9 3.10 11.58 1701.4 ± 53.7 2.78 ± 0.04
[Example 8] Surface Response Method Using Central Composite Design (CCD)
[0052] Based on the result obtained by the steepest ascent method, CCD was performed before and after the optimal conditions for the approximate concentrations of tryptone and Na.sub.2HPO.sub.4.
[0053] Specifically, to determine the optimal concentrations of two ingredients for a culture medium (that is, tryptone and Na.sub.2HPO.sub.4) for maximum production of colanic acid, CCD was performed with five code values (−1.414, −1, 0, 1 and 1.414). The code values of two factors (tryptone and Na.sub.2HPO.sub.4) were calculated using the following equation:
[0054] A three-dimensional model was selected to simulate the optimal concentrations of tryptone and Na.sub.2HPO.sub.4 based on regression analysis. The equation of the three-dimensional model is as follows:
γ=b.sub.0+Σb.sub.1x.sub.i+Σb.sub.2x.sub.j+Σb.sub.3x.sub.ix.sub.j+Σb.sub.4x.sub.i.sup.2+Σb.sub.5x.sub.j.sup.2+Σb.sub.6x.sub.i.sup.2x.sub.j+Σb.sub.7x.sub.ix.sub.i.sup.2 (2)
[0055] Here, x.sub.i and x.sub.j are code values of independent variables, and y is an expected response (colanic acid production amount). Various regression coefficients affecting the response (y), such as b.sub.0, b.sub.1, b.sub.2, b.sub.3, b.sub.4, b.sub.5 and b.sub.6, represent an intercept (b0), linear coefficients (b1, b2), a 2-factor interaction coefficient (b3), secondary coefficients (b4, b5) and tertiary coefficients (b6, b7). Each coefficient of the 3D model for colanic acid production was obtained by regression analysis. Based on a fixed model, a response surface plot was made to find the optimal concentrations of tryptone and Na.sub.2HPO.sub.4 for production of colanic acid using Design-Expert 7.0 (Stat-Ease, Minneapolis, Minn., USA).
[0056] The result is shown in Table 5, and the regression analysis result is shown in Table 6. Based on these, the production amount of colanic acid according to the tryptone and Na.sub.2HPO.sub.4 concentrations was expressed in a 3D surface plot (
TABLE-US-00006 TABLE 5 Experiment design by CCD and its result Factor.sup.a Run x.sub.2 x.sub.3 CA (mg/l).sup.b OD.sub.600.sup.b 1 −1 −1 1771.3 ± 37.2 2.53 ± 0.01 2 −1 1 1503.6 ± 48.9 2.57 ± 0.03 3 0 −1.414 1649.7 ± 47.1 2.75 ± 0.01 4 0 0 1837.3 ± 65.0 2.63 ± 0.08 5 0 0 1704.2 ± 79.0 2.76 ± 0.02 6 0 0 1751.4 ± 96.0 2.72 ± 0.06 7 −1.414 0 1873.4 ± 112.0 2.56 ± 0.11 8 1 −1 1651.3 ± 221.6 2.33 ± 0.08 9 1.414 0 1639.5 ± 61.7 2.69 ± 0.09 10 0 0 1808.7 ± 110.8 2.71 ± 0.02 11 0 0 1840.2 ± 171.0 2.68 ± 0.13 12 1 1 1774.5 ± 101.0 2.62 ± 0.10 13 0 1.414 1788.6 ± 188.9 2.72 ± 0.01 .sup.ax.sub.2 = (X.sub.2 − 2.9)/0.2; x.sub.3 = (X.sub.3 − 10.98)/0.6 .sup.bData were expressed as means ± standard deviations of triplicate experiments.
TABLE-US-00007 TABLE 6 Regression analysis for CCD result Source Coefficient estimate Mean square F-value p-value Model 15961.07 4.71 0.054 Intercept 1795.22 X.sub.2 −82.68 27345.92 8.06 0.036 X.sub.3 49.10 9644.83 2.84 0.153 X.sub.2 × X.sub.3 97.72 38198.51 11.26 0.020 X.sub.2.sup.2 −35.06 8551.89 2.52 0.173 X.sub.3.sup.2 −53.68 20042.24 5.91 0.059 X.sub.2.sup.2 × X.sub.3 −85.26 14537.75 4.29 0.093 X.sub.2 × X.sub.3.sup.2 120.42 29000.23 8.55 0.033 Residual 3391.46 Lack of fit 7848.15 3.45 0.137 Pure error 2277.28 *R.sup.2 = 0.8682
[Example 9] Confirmation of Optimal Medium
[0057] As a result of cultivation in a fermentation medium containing 20.00 g/l of glucose, 2.63 g/l of tryptone, 10.62 g/l of Na.sub.2HPO.sub.4, 3.00 g/l of KH.sub.2PO.sub.4, 0.50 g/l of NaCl, 0.24 g/l of MgSO.sub.4, and 0.011 g/l of CaCl.sub.2 at 25° C. and 200 rpm, as the optimal conditions, it was confirmed that the maximum colanic acid production amount is 2052.8 mg/l (