High efficiency aptamer complex comprising branched DNA and aptamer, and use thereof

11414667 · 2022-08-16

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a highly efficient aptamer complex comprising a branched DNA and an aptamer, and a pharmaceutical use thereof. More specifically, the aptamer complex of the present invention relates to a highly efficient aptamer complex including a Y-shaped DNA as the branched DNA and using vascular endothelial growth factor (VEGF) as a target molecule. The aptamer complex of the present invention and a pharmaceutical composition comprising the same as an active ingredient are expected to be widely used in the medical field since the binding efficiency with the target molecule is more remarkable than that of the conventional aptamer.

Claims

1. An aptamer complex comprising a branched DNA, an aptamer corresponding to a target sequence, and a terminal DNA, wherein the branched DNA is a Y-shaped DNA, wherein the Y-shaped DNA is any one or more selected from the group consisting of SEQ ID NOs: 1 to 6 and wherein the aptamer corresponding to the target sequence is any one or more selected from the group consisting of SEQ ID NOs: 7 and 9.

2. The aptamer complex according to claim 1, wherein the protein corresponding to the target sequence is vascular endothelial growth factor (VEGF).

3. The aptamer complex according to claim 1, wherein the terminal DNA is any one or more selected from the group consisting of SEQ ID NOs: 13 and 14.

4. A drug delivery system comprising the aptamer complex of claim 1 as an active ingredient.

5. A pharmaceutical composition for treating a cancer, comprising the aptamer complex of claim 1 as an active ingredient.

6. The pharmaceutical composition for treating a cancer according to claim 5, wherein the cancer is any one or more selected from the group consisting of melanoma, small cell lung cancer, non-small cell lung cancer, brain tumor, liver cancer, thyroid tumor, gastric cancer, prostate cancer, breast cancer, ovarian cancer, bladder cancer, lung cancer, colorectal cancer, breast cancer, prostate cancer, glioblastoma, cervical cancer, endometrial cancer, kidney cancer, colon cancer, pancreatic cancer, esophageal carcinoma, head and neck tumor, mesothelioma, sarcoma, cholangioma, small intestine adenocarcinoma, childhood malignant cancer, and epidermal cancer.

7. A kit for diagnosing a cancer, comprising the aptamer complex of claim 1 as an active ingredient.

Description

DESCRIPTION OF DRAWINGS

(1) FIG. 1 is a drawing showing a schematic view of manufacturing the CA designed in the present invention, according to an embodiment of the present invention.

(2) FIG. 2 is a drawing showing the results of confirming the generation and size of constructs of the CAs by electrophoresis, according to an embodiment of the present invention.

(3) FIG. 3 is a drawing showing the results of a dynamic light scattering analysis of the CAs including various concentrations of Blu_end, according to an embodiment of the present invention.

(4) FIG. 4 is a drawing showing the results of a dynamic light scattering analysis of the OA, AA, and CA, according to an embodiment of the present invention.

(5) FIG. 5 is a drawing showing the results of a transmission electron microscope analysis of the CA, according to an embodiment of the present invention.

(6) FIG. 6 is a drawing showing the results of an atomic force microscope analysis of the CA, according to an embodiment of the present invention.

(7) FIG. 7 is a drawing showing the results of a synchrotron X-ray scattering measurement of the CA, according to an embodiment of the present invention. More specifically, FIG. 7A shows a representative X-ray scattering profile of the DNA complex, and FIG. 7B shows the Guinier transform values, and FIG. 7C shows the Kratky expression graph.

(8) FIG. 8 is a drawing showing the results of confirming the stability in the serum of OA, AA, and CA, according to an embodiment of the present invention.

(9) FIG. 9 is a drawing showing the results of measuring the hVEGF capture ability according to the degradation rate of the OA, AA, and CA as the kit, according to an embodiment of the present invention.

(10) FIG. 10 is a drawing showing the results of measuring the hVEGF capture ability of the OA, AA, and CAby ELISA, according to an embodiment of the present invention.

(11) FIG. 11 is a drawing showing the results of measuring the cytotoxicity of the OA, AA, and CA by MTT, according to an embodiment of the present invention.

(12) FIG. 12 is a drawing showing the results of evaluating the degree of cell uptake and internalization of the CA with the CA prepared with FAM fluorescently labeled Blu_end, according to an embodiment of the present invention.

(13) FIG. 13 is a drawing showing the results of tracking changes in tumor size in the short term after administration by the injection of the OA, AA, CA, or CSc into cancer cell-administered mice, according to an embodiment of the present invention.

(14) FIG. 14 is a drawing showing the results of tracking changes in tumor size in the long term after administration by the injection of the OA, AA, CA, or CSc into cancer cell-administered mice, according to an embodiment of the present invention.

(15) FIG. 15 is a drawing showing the overall shapes of the tumor tissues obtained on day 28 after administration by the injection of the OA, AA, CA, or CSc into cancer cell-administered mice, according to an embodiment of the present invention.

(16) FIG. 16 is a drawing showing the results of tracking changes in body weight of mice in the long term after administration by the injection of the OA, AA, CA, or CSc into cancer cell-administered mice, according to an embodiment of the present invention.

(17) FIG. 17 is a drawing showing the results of CD-31 tumor marker staining on day 28 after administration by the injection of the OA, AA, CA, or CSc into cancer cell-administered mice, according to an embodiment of the present invention.

(18) FIG. 18 is a drawing showing the results of H & E staining on day 28 after administration by the injection of the OA, AA, CA, or CSc into cancer cell-administered mice, according to an embodiment of the present invention.

BEST MODE

(19) Hereinafter, the present invention will be described in more detail through examples. It will be apparent to those skilled in the art that these examples are only for illustrate the present invention in more detail and the scope of the present invention is not limited to these examples in accordance with the gist of the present invention.

Example 1: Preparation and Physical Analysis of Target Molecular Capture Construct

Example 1-1. Preparation of Constructed Aptamer (CA) Complex

(20) In this study, a target molecular capture platform was designed using a “constructed aptamer (CA) complex,” which is an aptamer complex based on a Y-shaped DNA structure. The basic structure of the CA is composed of (1) two Y-shaped DNAs (Y-5, Y-3), which are the framework of the entire structure, (2) Y_Vapt, which is a aptamer capable of hybridizing with a Y-shaped DNA protrusion, and (3) Blu_end as DNA for blunt end formation. The Blu_end is a kind of terminal DNA, and was used to block the overhang (a single strand from which unpaired nucleotides protrude) of the Y-shaped DNA. In the CA platform of the present invention, hybridized oligomer aptamers are used for specific interaction and capture with target molecules. A schematic view of the constructed aptamer complex is shown in FIG. 1.

(21) In this example, to capture human VEGF (hVEGF) overexpressed at the tumor site, the CA was prepared into a hairpin structured hVEGF DNA aptamer (Y_Vapt). Specifically, 6 types of Y-shaped branched DNAs (Y01-5, Y02-5, Y03-5, Y01-3, Y02-3, Y03-3), Blu_end, and Y-Vapt were mixed in the correct amount and annealed under the conditions in Table 1. In the case of CA, the generation of the CA is determined according to the ratio between Blu_end DNA and Y-shaped DNA. When various amounts of Blu_end were used to prepare the CA, it was designated as CA_G # (# of generation). hVEGFaptamer was prepared in the same manner as known technology (Lee, J, et al., J. Chem. Mater. 2016, 28, 3961; and Potty, A, et al., Biopolymers 2009, 91, 145). The sequence information of each material is set forth in Table 2, and when there is a modification at the 5′-end, it is indicated in square brackets.

(22) TABLE-US-00001 TABLE 1 Order 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Temperature 95 85 80 75 70 65 60 55 50 45 40 30 20 4 [° C.] Time [min] 5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 5

(23) TABLE-US-00002 TABLE 2 SEQ ID NO Designation Sequence (5′-3′) bp SEQ ID Y01-5 GCTCCTCGCCTGAAGCTCGATGAATAGCG 45 NO: 1 GTCAGATCCGTACCTA SEQ ID Y02-5 GCTCCTCGCCTGAAGCTTCGTTCGCAATA 45 NO: 2 CGACCGCTATTCATCG SEQ ID Y03-5 GCTCCTCGCCTGAAGCTTAGGTACGGATC 45 NO: 3 TGCGTATTGCGAACGA SEQ ID Y01-3 ATCCATGCCTAGACTGGCGATAAGTAGCT 41 NO: 4 GTCCGCTCCTCG SEQ ID Y02-3 GCTACTTATCGCCAGCATAACGCTTGCTT 41 NO: 5 GTCCGCTCCTCG SEQ ID Y03-3 AGCAAGCGTTATGCGTCTAGGCATGGATT 41 NO: 6 GTCCGCTCCTCG SEQ ID Y_Vapt AGCTTCAGGCGAGGAGCCCACCCCGTCTT 64 NO: 7 CCAGACAAGAGTGCAGGGGTGGCGAGGAG CGGACA SEQ ID Pri_Vapt CCCGTCTTCCAGACAAGAGTGCAGGG 26 NO: 8 SEQ ID Phos_Vapt [Phos]TTTTTAAGCTTGTCCGCTCCTCG 75 NO: 9 CCACCCCTGCACTCTTGTCTGGAAGACGG GGTGGGCTCCTCGCCTGAAGCTT SEQ ID Y_Sc AGCTTCAGGCGAGGAGCCCACTATTATGG 64 NO: 10 AACCGAATTTTGTTTCATGTGGCGAGGAG CGGACA SEQ ID Pri_Sc TATTATGGAACCGAATTTTGTTTCAT 26 NO: 11 SEQ ID Phos_Sc [Phos]TTTTTAAGCTTGTCCGCTCCTCG 75 NO: 12 CCACATGAAACAAAATTCGGTTCCATAAT AGTGGGCTCCTCGCCTGAAGCTT SEQ ID Blu_end TGTCCGCTCCTCG 13 NO: 13 SEQ ID FAM_Blu_end [FAM]TGTCCGCTCCTCG 13 NO: 14

(24) In Table 2 above, [Phos] indicated in the sequence indicates that the sequence is phosphorylated, and [FAM] indicates that a fluorescent substance is linked to the sequence.

(25) The prepared CA was stored at 4° C. until use and confirmed for the generation and size of the construct with polyacrylamide gel electrophoresis (PAGE 6%, stained with SYBR Gold®, 100 V for 45 minutes), and the results are shown in FIG. 2. In FIG. 2, the annealed product (line 4) moved less than Y-5 (line 2) and Y-3 (line 3), indicating that the molecular weight was greater.

(26) As a control for the CA of the present invention, an oligomeric aptamer (OA) complex, an oligomeric scrambled DNA (OSc), an amplified aptamer (AA) complex, an amplified scrambled DNA (ASc), and a constructed scrambled DNA (CSc) were tested. For the OA, an oligomerichVEGFaptamer DNA was prepared by simple annealing. For the CSc, it was prepared by replacing Y_Vapt used for the preparation of CA with Y_Sc, and is a constructed scrambled DNA without VEGF capture ability, which corresponds to a control. The concentrations of aptamers in the OA, AA, and CA remained the same.

Example 1-2. Preparation of Amplified Aptamer (AA) Complex

(27) According to CircLigase™ protocol, which is the well-known technique, cyclic DNA was obtained using Phos_Vapt and Phos_Sc as templates. More specifically, the phosphorylated modified DNA was mixed with ATP, MgCl.sub.2, and ligase enzyme in a buffer, and reacted at 60° C. for 12 hours. After the enzyme inactivation process was carried out, the reaction was carried out for 30 minutes at 37° C. with 20 U of exonuclease I and 100 U of exonuclease III, and the enzyme inactivation process was carried out again. The synthesized cyclic DNA was purified by DNA PrepMate™-II, and then confirmed by polyacrylamide gel electrophoresis, and the concentration was measured by ultraviolet absorption at 280 nm.

(28) A “rolling circle amplification (RCA)” process was carried out to prepare the amplified aptamer (AA) complex using the synthesized cyclic DNA, and then F29 polymerase protocol was carried out. Specifically, a buffer including dNTP, BSA, and F29 polymerase was added to the prepared cyclic Phos_Vapt and Pri_Vapt, and mixed well, and then the solution was sufficiently reacted at 30° C. Then, the solution was reacted at 80° C. to inactivate the enzyme, and then cooled slowly. The amplified aptamer complex using Phos_Sc and Pri_Sc was also prepared in the same manner.

Example 1-3. Dynamic Light Scattering (DLS) Analysis of Prepared Aptamers

(29) Samples were prepared by a method of dissolving CA including 1 nmol OA, 10 pmol primer AA amplified for 4 hours, or 1 nmol aptamer in 50 mL of PBS. The size of each aptamer in the solution was measured using a Zetasizer Nano (Malvern Instruments, Malvern, UK). The measured results are shown in FIGS. 3 and 4. As a result of the experiment, the average diameters of the CA_G3, CA_G4, and CA_G5 were found to be 112.6 nm, 132.0 nm, and 159.4 nm, respectively, and the CA without Blu_end was found to be 123.5 nm. On the other hand, the diameters of the OA and AA were measured to be 8.9 nm and 510.0 nm, respectively, and it was found that the AA had a very large diameter compared to the CA.

Example 1-4. Image Analysis of Prepared Aptamers

(30) Samples for transmission electron microscope (TEM) were prepared by a method of depositing 10 mM CA on a carbon grid coated with an ultrathin carbon film (400 mesh, Ted Pella, Redding, Calif., USA). The grid was dried for one day before measurement, and TEM images were obtained by JEM-1011 (JEOL, Tokyo, Japan).

(31) Samples for atomic force microscope (AFM) were prepared by treating newly cut mica (Pelco Mica sheets, Ted Pella Corp.) with NiCl.sub.2 and incubating for 10 minutes. The CA was dissolved in PBS including 10 mM NiCl.sub.2, and the dissolved solution was deposited on the washed mica. After reaction for 30 minutes, the mica surface was washed with deionized water and dried. The dried samples were scanned in non-contact mode using VEECO Dimension 3100/Nanoscope V (VECCO).

(32) The images obtained by measuring the CA (CA_G4) with the TEM and AFM are shown in FIGS. 5 and 6. As a result of the experiment, the spherical structure of the CA was confirmed, and the particle size was 105±9 nm.

Example 1-5. Synchrotron X-Ray Scattering Measurement of Prepared Aptamers

(33) Samples were prepared into 50 μL of PBS solution, and synchrotron X-ray scattering measurements were carried out on a 4C beamline. All samples were measured at 25° C. and sample-to-detector distances of 4 m and 1 m. Scattering data was collected through a two-dimensional charge-coupled detector (Model Rayonix 2D Mar, USA) using an X-ray radiation source of λ=0.0756 nm with an exposure time of 60 seconds, and the 2D scattering data was averaged circularly with respect to the beam center and normalized by monitoring the intensity of the X-ray beam transmitted through the scintilliation counter located at the back of the sample. Thereafter, the solvent scattering effect was removed from the scattering data by calculating the scattering intensity I (q) of the spherical particles in the solvent medium by an equation according to a known technique (Li, T, et al., Chem. Rev. 2016, online publishing) and treating it with the Guinier equation to extract the rotation radius (Rg) of the DNA complex (Guinier, A, et al., Wiley: New York, 1955). The results of the X-ray scattering measurements are shown in FIG. 7.

(34) A representative X-ray scattering profile of the DNA complex is shown in FIG. 7A. In FIG. 7B, the maximum value of GuinierqRg was found to be 1.16 and the limit value of qRg was found to be 1.33. The generalized Kratky expression of X-ray data is shown in FIG. 7C, and it could be found that the local minimum value near q=0.34 nm does not reach zero. This is a characteristic of a spherical particle having a curved surface, and indicates that the prepared aptamer complex is a spherical object with an uneven surface.

Example 1-6. Confirmation of the Stability in Serum of Prepared Aptamers

(35) To confirm the stability of the low polymer aptamer complex (oligomeric aptamer; OA), amplified aptamer (AA) complex, and constructed aptamer (CA) complex to DNA nuclease in serum, the aptamer complexes were mixed in a 10% fetal bovine serum (FBS) solution and reacted for 3 days in a dark place at 37° C. The stability for the low polymer aptamer complex was analyzed by polyacrylamide gel electrophoresis, and the stability for the amplified aptamer complex and constructed aptamer complex was analyzed by agarose gel electrophoresis. The results are shown in FIG. 8. As a result of the experiment, it was observed that the OA was completely deteriorated after 12 hours, but the AA showed little progress of deterioration for 3 days. This indicates that the highly entangled structure of the AA is difficult to degrade by DNA nuclease, but the OA as a short DNA is easily degraded. For the CA_G4, it was found that its resistance to DNA nuclease was similar compared to that of the AA, but the degradation process was faster than the AA. From this, it could be found that the CA has an appropriate level of resistance to DNA nuclease.

(36) The hVEGF capture ability of the OA and CA_G4 according to the degradation rate is shown in FIG. 9. As a result of carrying out hVEGF capture experiments with samples incubated in serum for 0 hour (immediately after preparation), 12 hours, 1 day, 2 days, or 3 days, the capture efficiency of the CA_G4 was found to be 100% immediately after preparation, and the capture efficiency was found to be 71.7% when incubated for 3 days. However, the OA was shown to capture little hVEGF independent of serum incubation time. These results indicate that the ability of the CA_G4 to capture target molecules is fairly stable even in serum.

Example 2: Analysis of Biological Effects of Target Molecular Capture Constructs

Example 2-1. Confirmation of Capture Ability of OA, AA, and CA in hVEGF-Containing Solution

(37) To confirm the hVEGF capture ability of OA, AA, and CA, each prepared sample was mixed with hVEGF solution for 4 hours at room temperature, and the mixed solution was filtered through a PD-10 column (Sephadex G-25, GE Healthcare, Sweden). The amount of non-purified hVEGF was measured by the hVEGF enzyme-linked immunosorbent assay kit (ELISA kit, Komabiotech) according to the manufacturer's guidelines (absorbance measurement at 490 nm by VICTOR3 V™ (Multilabel Counter, Perkin Elmer, Wellesley, Mass., USA)). The hVEGF capture ability of other samples such as OSc, ASc, and CSc was measured in the same way, and the results are shown in FIG. 10.

(38) As a result of the experiment, the OA and CA (CA_G4) had a remarkable capture efficiency, but the AA showed a relatively low capture efficiency. These results indicate that exposure of the reaction site of the DNA structure is very important to efficiently capture the target molecule. The overall structure of the CA is similar to that of the OA. However, the AA forms a highly entangled structure by the RCA process, so the target aptamer is not exposed to hVEGF, and thus, the interaction with the target molecule is low. The hVEGF capture efficiency of the CA was found to be saturated when the aptamer concentration reached 50 pmol (CA_G4=50 pmol aptamer).

Example 2-2. Confirmation of Cytotoxicity of Prepared Aptamer Complexes

(39) Cytotoxicity of each aptamer complex (OA, AA, and CA) was evaluated using standard MTT assay. First, A549 cells (lung adenocarcinoma cells) were seeded in 96-well plates at a density of 5×10.sup.3 cells/well and incubated in a CO.sub.2 incubator for 24 hours. The cells were treated with various concentrations (0, 250, 500, 1000, 1500, or 2500 nM) of OA, AA, or CA in serum-free medium (DMEM) for 6 hours, and the supernatant was removed and incubated in fresh serum-containing medium (DMEM) for 20 hours. Then, the mixture was replaced with fresh medium including MTT solution (5 mg/mL), and further reacted for 4 hours. The supernatant was removed and DMSO was added to each well to dissolve purple formazan crystals in the cells, and then absorbance was measured at 570 nm using a microplate spectrofluorometer (VICTOR3 V Multilabel Counter, Perkin Elmer, Wellesley, Mass., USA). The measured value was expressed as a relative percentage based on the measured value of the control sample added with medium only. The results of the MTT assay are shown in FIG. 11.

(40) As a result of the experiment, the cell viability was not significantly reduced at an aptamer concentration of 0 to 250 pmol, and thus, all of the tested aptamer complexes were found to be biocompatible.

Example 2-3. Confirmation of Degree of In Vitro Cell Uptake and Internalization

(41) To evaluate the degree of cell uptake and internalization of CA, CA manufactured with FAM fluorescently labeled Blu_end was prepared and treated with A549 cells. More specifically, A549 cells were seeded on a glass cover slip placed on a 12-well plate at a density of 2×10.sup.4 cells/well and incubated for 18 hours. Thereafter, the culture broth (DMEM) was replaced with fresh serum-free DMEM containing FAM-labeled CA (containing 0.5 nmol FAM), and incubated for an additional 5 hours. After incubation, cold DPBS was added to block cell uptake, and the cells were washed and finally fixed at 4° C. overnight with 10% neutral buffered formalin (NBF). The cells on the cover slip were stained with DAPI and observed with a confocal laser scanning microscope (Modified Zeiss Axio Observer, Z1 epi-fluorescence microscope), and the image results are shown in FIG. 12.

(42) As a result of the experiment, it was confirmed that the green fluorescence signal of the FAM-labeled CA was expressed in the nuclear region overlapping with the DAPI blue fluorescence, so that the cell internalization of the CA was smooth.

Example 2-4. Confirmation of In Vivo Cancer Treatment Effect of Prepared Aptamer Complexes

(43) All animal experiments in the present invention were carried out with the approval of the POSTECH Biotech Center Ethics Committee. First, A549 cells (1×10.sup.8) were subcutaneously inoculated into the flanks of each female BALB/c-nu/nu mouse, and then the mice were randomly divided into 5 groups (n=3), and OA, AA, CA, or CSc was administered by injection on days 1 and 5. The CSc has the same structure as the CA in vivo, but the DNA sequence is a different aptamer complex.

(44) The anticancer effect of the administered aptamers on A549 cells was analyzed by measuring the tumor diameter with a caliper. The measured values were converted into tumor volumes using the equation described in Table 3 below.

(45) TABLE-US-00003 TABLE 3 Tumor Volume = a × b.sup.2 × 0.5 Wherein, a is a short dimension, and b is a long dimension.

(46) After administration of each aptamer, tumor tracking and body weight change in mice were monitored until day 28, and the results are shown in FIGS. 13 to 16.

(47) More specifically, FIGS. 13 and 14 show changes in tumor size. As a result of the experiment, it was found that the aptamer-untreated control increased the tumor size by 14.4 times on day 28, whereas the OA, AA, and CSc were increased by 8.9 times, 9.5 times, and 13.1 times, respectively. These are reduced levels compared to the aptamer-untreated control, but not significant levels with anti-tumor therapy. On the other hand, for the CA, it was found that the tumor was increased by 1.3 times on day 28, and thus, the tumor growth inhibitory effect was remarkable. The overall morphology of the tumor obtained on day 28 is shown in FIG. 15.

(48) The body weight change of the mice is shown in FIG. 16. There was no significant change in the body weight of the mice until day 28 in all tested groups. This indicates that the designed OA, AA, and CA are not toxic under biological conditions.

Example 2-5. Confirmation of Histological and Chemical Changes in Tumor Tissue

(49) For immunohistochemical analysis, each aptamer complex (OA, AA, CA, or CSc) was administered to tumor cell-injected mice, and then, the mice were sacrificed on day 4. Tumors were excised and fixed in 10% NBF for 24 hours, and then embedded with paraffin and sliced to a thickness of 4 mm using a Finesse ME microtome. To confirm histological changes of the tumor, tumor sections were stained with hematoxylin and eosin (H & E) and an ×10 magnification image was obtained with an optical microscope (Nikon eclipse 80i, USA).

(50) In the case of immunohistochemical staining using CD-31 antibody, the sections sliced into a thickness of 4 mm were treated with a blocking solution (containing 5 w/v % BSA) for 15 minutes to prevent non-specific binding, washed several times with PBS, and treated with primary antibody for 1 hour at room temperature. Thereafter, these were treated with goat anti-rabbit IgG-FITC-labeled secondary antibody for 1 hour. Finally, the cover slip was mounted with a mounting medium including DAPI, and stored in a dark place at 4° C. Fluorescence images were obtained with a confocal laser scanning microscope (Modified Zeiss Axio Observer, Z1 epi-fluorescence microscope) at ×40 magnification.

(51) The image results are shown in FIGS. 17 and 18. As a result of the experiment, tumor tissues were stained with CD-31 to express green fluorescence (FITC) in the aptamer-untreated control, OA, AA, and CSc, but green fluorescence was hardly expressed in the CA. Even in H&E staining, apoptosis and necrosis were clearly observed in the CA, but not significantly showed in all other groups. These results indicate that the CA has a remarkable effect in killing tumor cells by capturing hVEGF and suppressing angiogenesis at the tumor site compared to other aptamer complexes.