TREATING CHRONIC LIVER DISEASE
20220220206 · 2022-07-14
Inventors
Cpc classification
C07K2317/76
CHEMISTRY; METALLURGY
A61P29/00
HUMAN NECESSITIES
C07K16/2842
CHEMISTRY; METALLURGY
C07K16/22
CHEMISTRY; METALLURGY
A61P1/16
HUMAN NECESSITIES
International classification
Abstract
This document provides methods and materials involved in treating chronic liver disease (e.g., non-alcoholic fatty liver disease such as nonalcoholic steatohepatitis (NASH)). For example, methods and materials for using one or more inhibitors of an integrin β1 (ITGβ1) polypeptide, one or more inhibitors of an integrin α9 polypeptide (ITGα9), and/or one or more inhibitors of a vascular cell adhesion molecule 1 (VCAM-1) polypeptide to treat a mammal having chronic liver disease are provided.
Claims
1. A method for treating chronic liver disease in a mammal, wherein said method comprises administering an inhibitor of an integrin β1 (ITGβ1) polypeptide or an inhibitor of a vascular cell adhesion molecule 1 (VCAM-1) polypeptide to said mammal.
2. The method of claim 1, wherein said mammal is a human.
3. The method of claim 1, wherein said chronic liver disease is a non-alcoholic fatty liver disease.
4. The method of claim 3, wherein said non-alcoholic fatty liver disease is nonalcoholic steatohepatitis (NASH).
5. The method of claim 1, said method comprising administering an inhibitor of an ITGβ1 polypeptide to said mammal.
6. The method of claim 5, wherein said inhibitor of an ITGβ1 polypeptide is an ITGβ1 neutralizing antibody.
7-8. (canceled)
9. The method of claim 1, said method comprising administering an inhibitor of a VCAM-1 polypeptide to said mammal.
10. The method of claim 9, wherein said inhibitor of a VCAM-1 polypeptide is a VCAM-1 neutralizing antibody.
11. The method of claim 1, wherein said method comprises identifying said mammal as being in need of treatment of said chronic liver disease before said administering step.
12. A method for reducing liver inflammation in a mammal having chronic liver disease, wherein said method comprises administering an inhibitor of an integrin β1 (ITGβ1) polypeptide or an inhibitor of a vascular cell adhesion molecule 1 (VCAM-1) polypeptide to said mammal.
13. A method for reducing liver fibrosis in a mammal having chronic liver disease, wherein said method comprises administering an inhibitor of an integrin β1 (ITGβ1) polypeptide or an inhibitor of a vascular cell adhesion molecule 1 (VCAM-1) polypeptide to said mammal.
14. The method of claim 12, wherein said mammal is a human.
15. The method of claim 12, wherein said chronic liver disease is a non-alcoholic fatty liver disease.
16. The method of claim 15, wherein said non-alcoholic fatty liver disease is nonalcoholic steatohepatitis (NASH).
17. The method of claim 12, said method comprising administering an inhibitor of an ITGβ1 polypeptide to said mammal.
18. The method of claim 17, wherein said inhibitor of an ITGβ1 polypeptide is an ITGβ.sub.1 neutralizing antibody.
19-20. (canceled)
21. The method of claim 12, said method comprising administering an inhibitor of a VCAM-1 polypeptide to said mammal.
22. The method of claim 21, wherein said inhibitor of a VCAM-1 polypeptide is a VCAM-1 neutralizing antibody.
23. The method of claim 12, wherein said method comprises identifying said mammal as being in need of said reduced liver inflammation or said reduced liver fibrosis before said administering step.
Description
DESCRIPTION OF THE DRAWINGS
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
DETAILED DESCRIPTION
[0042] This document provides methods and materials involved in treating chronic liver disease (e.g., non-alcoholic fatty liver disease such as NASH). For example, this document provides methods and materials for administering one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide to a mammal (e.g., a human) having a chronic liver disease to treat chronic liver disease.
[0043] Any appropriate mammal having chronic liver disease (e.g., non-alcoholic fatty liver disease such as NASH) can be treated as described herein (e.g., by administering one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide). In some cases, a mammal can be an obese mammal. In some cases, a mammal can have type 2 diabetes. In some cases, a mammal can have a metabolic syndrome. Examples of mammals that can be treated as described herein include, without limitation, humans, non-human primates such as monkeys, dogs, cats, horses, cows, pigs, sheep, mice, and rats.
[0044] When treating a mammal (e.g., a human) having a chronic liver disease as described herein (e.g., by administering one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide), the chronic liver disease can be any type of chronic liver disease. In some cases, a chronic liver disease to be treated as described herein can be a fatty liver disease such as a non-alcoholic fatty liver disease. Examples of chronic liver diseases that can be treated as described herein include, without limitation, NASH, and non-alcoholic fatty liver (NAFL; simple fatty liver). In cases where a chronic liver disease to be treated as described herein is non-alcoholic fatty liver disease, the non-alcoholic fatty liver disease can be a diet-induced non-alcoholic fatty liver disease such as diet-induced NASH.
[0045] In some cases, a mammal (e.g., a human) can be identified as having a chronic liver disease (e.g., non-alcoholic fatty liver disease such as NASH). Any appropriate method can be used to identify a mammal as having a chronic liver disease. For example, blood tests (e.g., complete blood counts, liver enzyme and liver function tests, tests for chronic viral hepatitis, celiac disease screening tests, fasting blood sugar tests, hemoglobin A1C tests, and lipid profile tests), imaging procedures (e.g., ultrasound, computerized tomography (CT) scanning, or magnetic resonance imaging (MRI), transient elastography, and magnetic resonance elastography), and/or liver tissue examination (e.g., to look for signs of inflammation and scarring) can be used to identify a mammal as having a chronic liver disease such as a fatty liver disease.
[0046] Once identified as having a chronic liver disease, a mammal can be administered one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide.
[0047] In some cases, one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide can be administered to a mammal having a chronic liver disease to reduce or eliminate one or more symptoms of chronic liver disease. Examples of symptoms of chronic liver disease that can be reduced or eliminated as described herein include, without limitation, enlarged liver, fatigue, pain in the upper right abdomen, abdominal swelling (ascites), enlarged blood vessels just beneath the skin's surface, enlarged breasts in men, enlarged spleen, red palms, and yellowing of the skin and eyes (jaundice).
[0048] In some cases, one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide can be administered to a mammal having a chronic liver disease to reduce or eliminate liver inflammation in the mammal. Any appropriate method can be used to determine whether or not liver tissue has a reduced or eliminated level of inflammation. For example, a reduced level of monocyte-derived macrophages (MoMFs), a reduced level of one or more pro-inflammatory polypeptides (e.g., Cd68 polypeptides and Tnf-α polypeptides), and/or an increased level of one or more anti-inflammatory polypeptides (e.g., CD206 polypeptides, Lgals polypeptides, MERTK polypeptides, and F4/80 polypeptides) can be used to determine whether or not liver tissue contains a reduced or eliminated level of inflammation. A reduced level of MoMFs and/or a pro-inflammatory polypeptide can be any level that is lower than a level of that polypeptide that was observed prior to administration of one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide. An increased level of an anti-inflammatory polypeptide can be any level that is higher than a level of that polypeptide that was observed prior to administration of one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide. For example, one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide can be effective to reduce inflammation in liver tissue (e.g., liver tissue in a mammal such as a human) by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent.
[0049] In some cases, one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide can be administered to a mammal having a chronic liver disease to reduce or eliminate liver fibrosis in the mammal. Any appropriate method can be used to determine whether or not liver tissue has a reduced or eliminated level of fibrosis. For example, reduced levels of one or more polypeptides involved in fibrosis (e.g., collagen 1a1 polypeptides and osteopontin polypeptides) can be used to determine whether or not liver tissue contains a reduced or eliminated level of fibrosis. A reduced level of a polypeptide involved in fibrosis can be any levels of a polypeptide involved in fibrosis that is lower than a level of that polypeptide that was observed prior to administration of one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide. For example, one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide can be effective to reduce fibrosis in liver tissue (e.g., liver tissue in a mammal such as a human) by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent.
[0050] An inhibitor of an ITGβ1 polypeptide can be any appropriate inhibitor of an ITGβ1 polypeptide. An inhibitor of an ITGβ1 polypeptide can be an inhibitor of ITGβ1 polypeptide activity or an inhibitor of ITGβ1 polypeptide expression. In some cases, an inhibitor of an ITGβ1 polypeptide can cause an integrin heterodimer including an ITGα9β1 heterodimer to adopt a closed conformation (e.g., a formation that has a low affinity for ligand). Examples of compounds that can reduce ITGβ1 polypeptide activity include, without limitation, antibodies (e.g., neutralizing antibodies) and small molecules (e.g., a pharmaceutically acceptable salt of a small molecule). Examples of neutralizing anti-ITGβ1 polypeptide antibodies that can be used as described herein include, without limitation, those antibodies listed in Table 1. Examples of small molecule inhibitors of ITGβ1 polypeptide activity include, without limitation, BOP (R&D Cat. No. 6047), and R-BC154 (R&D Cat. No. 6048).
TABLE-US-00001 TABLE 1 Exemplary neutralizing anti- ITGβ1 polypeptide antibodies. Antibody Name Source/Supplier/Reference Ab52971 Sigma MAB13 BD Pharmingen 552828 9EG7 BD Pharmingen 553715 Hmb1-1 eBioscience
Examples of compounds that can reduce ITGβ1 polypeptide expression and be used as described herein include, without limitation, nucleic acid molecules designed to induce RNA interference against ITGβ1 polypeptide expression (e.g., a siRNA molecule or a shRNA molecule), antisense molecules against ITGβ1 polypeptide expression, and miRNAs against ITGβ1 polypeptide expression. Examples of nucleic acid molecules designed to induce RNA interference against ITGβ1 polypeptide expression that can be used as described herein include, without limitation, shRNA including the nucleic acid sequence CCGGGCCTTGCA-TTACTGCTGATATCTCGAGATATCAGCAGTAATGCAAGGCTTTTTG (SEQ ID NO:1). In some cases, an inhibitor of an ITGβ1 polypeptide can reduce or prevent formation of an integrin heterodimer including ITGβ1 and an ITG α subunit (e.g., ITGα9). In some cases, an inhibitor of an ITGβ1 polypeptide can reduce or eliminated binding (e.g., covalently binding) between an ITGα9β1 heterodimer and an ITGα9β1 heterodimer binding partner (e.g., an ITGα9β1 heterodimer ligand such as VCAM-1).
[0051] An inhibitor of an ITGα9 polypeptide can be any appropriate inhibitor of an ITGα9 polypeptide. An inhibitor of an ITGα9 polypeptide can be an inhibitor of ITGα9 polypeptide activity or an inhibitor of ITGα9 polypeptide expression. In some cases, an inhibitor of an ITGα9 polypeptide can cause an ITGα9β1 heterodimer to adopt a closed conformation (e.g., a formation that has a low affinity for ligand). Examples of compounds that can reduce ITGα9 polypeptide activity include, without limitation, antibodies (e.g., neutralizing antibodies) and small molecules (e.g., a pharmaceutically acceptable salt of a small molecule). Examples of neutralizing anti-ITGα9 polypeptide antibodies that can be used as described herein include, without limitation, those antibodies listed in Table 2. Examples of small molecule inhibitors of ITGα9 polypeptide activity include, without limitation, BOP (R&D Cat. No. 6047), and R-BC154 (R&D Cat. No. 6048).
TABLE-US-00002 TABLE 2 Exemplary neutralizing anti-ITGα9 polypeptide antibodies. Antibody Name Source/Supplier/Reference MAB4574 R&D
Examples of compounds that can reduce ITGα9 polypeptide expression and be used as described herein include, without limitation, nucleic acid molecules designed to induce RNA interference against ITGα9 polypeptide expression (e.g., a siRNA molecule or a shRNA molecule), antisense molecules against ITGα9 polypeptide expression, and miRNAs against ITGα9 polypeptide expression. In some cases, an inhibitor of an ITGα9 polypeptide can reduce or prevent formation of an ITGα9β1 heterodimer. In some cases, an inhibitor of an ITGα9 polypeptide can reduce or eliminated binding (e.g., covalently binding) between an ITGα9β1 heterodimer and an ITGα9β1 heterodimer binding partner (e.g., an ITGα9β1 heterodimer ligand such as VCAM-1).
[0052] An inhibitor of a VCAM-1 polypeptide can be any appropriate inhibitor of a VCAM-1 polypeptide. An inhibitor of a VCAM-1 polypeptide can be an inhibitor of VCAM-1 polypeptide activity or an inhibitor of VCAM-1 polypeptide expression. Examples of compounds that can reduce VCAM-1 polypeptide activity include, without limitation, antibodies (e.g., neutralizing antibodies) and small molecules (e.g., a pharmaceutically acceptable salt of a small molecule). Examples of neutralizing anti-VCAM-1 polypeptide antibodies that can be used as described herein include, without limitation, those antibodies listed in Table 3, those antibodies described in U.S. Pat. No. 7,449,186, those antibodies described in WO 2013/160676, and those antibodies described in WO 2013/026878. Examples of small molecule inhibitors of VCAM-1 polypeptide activity include, without limitation, AGI-1067, BAY 11-7082, IkappaBalpha kinase inhibitor, and a delta-tocotrienol form of vitamin E.
TABLE-US-00003 TABLE 3 Exemplary neutralizing anti-VCAM-1 polypeptide antibodies. Antibody Name Source/Supplier/Reference BBA5 R&D AF809 R&D AF643 R&D 6G10 hybridoma ATTC No. HB 10519
Examples of compounds that can reduce VCAM-1 polypeptide expression and be used as described herein include, without limitation, nucleic acid molecules designed to induce RNA interference against VCAM-1 polypeptide expression (e.g., a siRNA molecule or a shRNA molecule), antisense molecules against VCAM-1 polypeptide expression, and miRNAs against VCAM-1 polypeptide expression. In some cases, an inhibitor of a VCAM-1 polypeptide can reduce or eliminated binding (e.g., covalently binding) between a VCAM-1 polypeptide and a VCAM-1 polypeptide binding partner (e.g., an ITGβ1 polypeptide).
[0053] One or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide can be administered to a mammal having a chronic liver disease (e.g., non-alcoholic fatty liver disease such as NASH) at the same time or independently. When one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide are administered at the same time, one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide can be administered as separate compositions administered at the same time or can be present in a single composition.
[0054] In some cases, one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide can be administered to a mammal having a chronic liver disease (e.g., non-alcoholic fatty liver disease such as NASH) as the sole active ingredient(s) used to treat the chronic liver disease. For example, in some cases, when using a composition containing an inhibitor of an ITGβ1 polypeptide, that inhibitor of an ITGβ1 polypeptide can be the sole active ingredient that treats the chronic liver disease.
[0055] In some cases, one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide can be administered to a mammal having a chronic liver disease (e.g., non-alcoholic fatty liver disease such as NASH) as a combination therapy with one or more additional treatments used to treat a chronic liver disease. For example, a combination therapy used to treat chronic liver disease can include administering to the mammal (e.g., a human) one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide as described herein and one or more chronic liver disease treatments such as anti-inflammatory drugs (e.g., pentoxifylline such as Trental® and obeticholic acid such as Ocaliva®), antioxidants (e.g., vitamin E), thiazolidinediones (e.g., pioglitazone), and/or obeticholic acid. In cases where one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide described herein are used in combination with one or more additional chronic liver disease treatments, the one or more additional chronic liver disease treatments can be administered at the same time or independently. For example, one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide described herein can be administered first, and the one or more additional chronic liver disease treatments can be administered second, or vice versa.
[0056] In some cases, one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide can be formulated into a composition (e.g., pharmaceutically acceptable composition) for administration to a mammal having a chronic liver disease (e.g., non-alcoholic fatty liver disease such as NASH). For example, a therapeutically effective amount of one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide can be formulated together with one or more pharmaceutically acceptable carriers (additives) and/or diluents. A pharmaceutical composition can be formulated for administration in any appropriate dosage form. Examples of dosage forms that can be used as described herein include, without limitation, solid and liquid forms such as gums, capsules, tablets (e.g., chewable tablets, and enteric coated tablets), suppository, liquid, enemas, suspensions, solutions (e.g., sterile solutions), sustained-release formulations, delayed-release formulations, pills, powders, gels, creams, ointments, and granules. Pharmaceutically acceptable carriers, fillers, and vehicles that may be used in a pharmaceutical composition described herein include, without limitation, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, ascorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol such as Vitamin E TPGS, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, and wool fat.
[0057] A composition (e.g., a pharmaceutical composition) containing one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide can be designed for oral or parenteral (including subcutaneous, intramuscular, intratumoral, intravenous, topical, and intradermal) administration. When being administered orally, a pharmaceutical composition containing one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide can be in the form of a pill, syrup, gel, liquid, flavored drink, tablet, or capsule. Compositions suitable for parenteral administration include, without limitation, aqueous and non-aqueous sterile injection solutions that can contain anti-oxidants, buffers, bacteriostats, and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations can be presented in unit-dose or multi-dose containers, for example, sealed ampules and vials, and may be stored in a freeze dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, and tablets.
[0058] A composition (e.g., a pharmaceutical composition) containing one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide can be administered locally or systemically. For example, a composition containing one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide can be administered systemically by an oral administration or by injection to a mammal (e.g., a human).
[0059] Effective doses of one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide can vary depending on the severity of the chronic liver disease (e.g., non-alcoholic fatty liver disease such as NASH), the route of administration, the age and general health condition of the subject, excipient usage, the possibility of co-usage with other therapeutic treatments such as use of other agents, the specific inhibitor being used, and/or the judgment of the treating physician.
[0060] An effective amount of a composition containing one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide can be any amount that can treat the chronic liver disease (e.g., non-alcoholic fatty liver disease such as NASH) without producing significant toxicity to the mammal. An effective amount of an inhibitor of an inhibitor of an ITGβ1 polypeptide, an inhibitor of an ITGα9 polypeptide, and/or an inhibitor of a VCAM-1 polypeptide can be any appropriate amount. In some cases, an effective amount of an inhibitor of an ITGβ1 polypeptide such as a neutralizing antibody (e.g., an ITGβ1 neutralizing antibody) can be from about 1 mg/kg body weight of a mammal to about 10 mg/kg body weight of a mammal (e.g., from about 1 mg/kg body to about 8 mg/kg, from about 1 mg/kg body to about 5 mg/kg, from about 1 mg/kg body to about 4 mg/kg, from about 1 mg/kg body to about 3 mg/kg, from about 1 mg/kg body to about 2 mg/kg, from about 2 mg/kg body to about 10 mg/kg, from about 3 mg/kg body to about 10 mg/kg, from about 5 mg/kg body to about 10 mg/kg, from about 7 mg/kg body to about 10 mg/kg, from about 2 mg/kg body to about 8 mg/kg, from about 3 mg/kg body to about 5 mg/kg, or about 1 mg/kg body weight of a mammal). The effective amount can remain constant or can be adjusted as a sliding scale or variable dose depending on the mammal's response to treatment. Various factors can influence the actual effective amount used for a particular application. For example, the frequency of administration, duration of treatment, use of multiple treatment agents, route of administration, and/or severity of the chronic liver disease (e.g., non-alcoholic fatty liver disease such as NASH) may require an increase or decrease in the actual effective amount administered.
[0061] The frequency of administration of a composition containing one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide can be any frequency that can treat the chronic liver disease (e.g., non-alcoholic fatty liver disease such as NASH) without producing significant toxicity to the mammal. For example, the frequency of administration can be from about three times a day to about once a week, from about twice a day to about twice a week, or from about once a day to about twice a week. The frequency of administration can remain constant or can be variable during the duration of treatment. A course of treatment with a composition containing one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide can include rest periods. For example, a composition containing one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide can be administered daily over a two-week period followed by a two-week rest period, and such a regimen can be repeated multiple times. As with the effective amount, various factors can influence the actual frequency of administration used for a particular application. For example, the effective amount, duration of treatment, use of multiple treatment agents, route of administration, and/or severity of the chronic liver disease (e.g., non-alcoholic fatty liver disease such as NASH) may require an increase or decrease in administration frequency.
[0062] An effective duration for administering a composition containing one or more inhibitors of an ITGβ1 polypeptide, one or more inhibitors of an ITGα9 polypeptide, and/or one or more inhibitors of a VCAM-1 polypeptide can be any duration that treat the chronic liver disease (e.g., non-alcoholic fatty liver disease such as NASH) without producing significant toxicity to the mammal. For example, the effective duration can vary from several days to several weeks, months, or years. In some cases, the effective duration for the treatment of chronic liver disease can range in duration from about one month to about 10 years. Multiple factors can influence the actual effective duration used for a particular treatment. For example, an effective duration can vary with the frequency of administration, effective amount, use of multiple treatment agents, route of administration, and/or severity of the condition being treated.
[0063] In some cases, the materials and methods described herein also can be used to treat other diseases or disorders that are characterized by aberrant signaling from an integrin receptor including α9 and β1 subunits interacting with a VCAM-1 ligand.
[0064] This document also provides non-human animal models (e.g., a mouse model) of chronic liver disease (e.g., non-alcoholic fatty liver disease such as NASH). As described herein, ITGα9β1 heterodimers are released from hepatocytes under lipotoxic stress as a cargo of EVs (also see, e.g., Ibrahim et al., Hepatology. 63(3):731-44 (2016); and Hirsova et al., Gastroenterology, 150(4):956-67 (2016)). Non-human animal models for chronic liver disease described herein can be non-human animals in which circulating EVs of hepatocyte origin can be tracked. In some cases, a non-human animal model for chronic liver disease described herein (e.g., in which circulating EVs of hepatocyte origin can be tracked) can be generated using a non-human animal engineered to have a cell membrane-targeted, dual (e.g., a two-color fluorescent) Cre-reporter allele and a Cre recombinase. A cell membrane-targeted, dual reporter allele can be used to detect a cellular membranous structures such as the cytoplasmic membrane, and can allow labelling of membrane-derived structures such as exosomes and EVs. In the absence of a Cre recombinase (e.g., prior to any Cre recombination), a non-human animal engineered to have a cell membrane-targeted, dual (e.g., a two-color fluorescent) Cre-reporter allele expresses a first cell membrane-localized label (e.g., a first fluorescent label), and in the presence of a Cre recombinase (e.g., following Cre recombination), a non-human animal engineered to have a cell membrane-targeted, dual (e.g., a two-color fluorescent) Cre-reporter allele can switch to expressing a second cell membrane-localized label (e.g., a second fluorescent label). For example, a non-human animal engineered to have a cell membrane-targeted, two-color fluorescent Cre-reporter allele can include, prior to any Cre recombination, a cell membrane-localized first fluorescent label (e.g., a red fluorescent protein such as tdTomato), and can include, following Cre recombination, a cell membrane-localized second fluorescent label (e.g., a green fluorescent protein (GFP) such as enhanced GFP (EGFP)). In some cases, a non-human animal model for chronic liver disease in which circulating EVs of hepatocyte origin can be tracked can be as described in Example 1. In some cases, a non-human animal model for chronic liver disease in which circulating EVs of hepatocyte origin can be tracked can be as shown in
[0065] Any appropriate non-human animal engineered to have a cell membrane-targeted, dual (e.g., a two-color fluorescent) Cre-reporter allele can be used to generate a non-human animal model for chronic liver disease described herein (e.g., a non-human animal model having labelled hepatocyte-derived EVs). In some cases, a non-human animal engineered to have a cell membrane-targeted, dual (e.g., a two-color fluorescent) Cre-reporter allele can be as described in Example 1. In some cases, a non-human animal engineered to have a cell membrane-targeted, dual (e.g., a two-color fluorescent) Cre-reporter allele can be as described elsewhere (see, e.g., The Jackson Laboratory Strain No. 007676; The Jackson Laboratory Strain No. 007576; and Muzumdar et al., Genesis 45(9):593-605 (2007)).
[0066] Any appropriate Cre recombinase can be used to generate a non-human animal model for chronic liver disease described herein (e.g., a non-human animal model having labelled hepatocyte-derived EVs). A Cre recombinase can be provided using any appropriate method. In some cases, a Cre recombinase can be provided by administering a Cre recombinase to a non-human animal engineered to have a cell membrane-targeted, two-color fluorescent Cre-reporter allele. In some cases, a Cre recombinase can be provided by administering a nucleic acid encoding a Cre recombinase to a non-human animal engineered to have a cell membrane-targeted, two-color fluorescent Cre-reporter allele. In cases where a nucleic acid encoding a Cre recombinase is administered to a non-human animal engineered to have a cell membrane-targeted, dual Cre-reporter allele, the nucleic acid can be any appropriate type of nucleic acid. For example, an expression vector or a viral vector such as an adeno-associate viral (AAV) vector (e.g., AAV8) encoding a Cre recombinase can be used to administer a Cre recombinase to a non-human animal engineered to have a cell membrane-targeted, dual Cre-reporter allele. In cases where a nucleic acid encoding a Cre recombinase is a viral vector, the viral vector can be derived from a virus having hepatotropism (e.g., AAV8). To generate labelled (e.g., fluorescently labelled) EVs of hepatocyte origin, Cre recombination can be provided in hepatocytes (e.g., but not in other cell types). For example, in cases where a nucleic acid encoding a Cre recombinase is administered to a non-human animal engineered to have a cell membrane-targeted, dual Cre-reporter allele, the nucleic acid encoding a Cre recombinase can be under the control of a hepatocyte specific promoter. Examples of hepatocyte specific promoters include, without limitation, a thyroxine binding globulin (TBG) promoter.
[0067] A non-human animal model for chronic liver disease can be a model for any appropriate type of chronic liver disease (e.g., non-alcoholic fatty liver disease such as NASH). In some cases, a non-human animal model for chronic liver disease can be a model for diet-induced NASH. In some cases, a non-human animal model for chronic liver disease can exhibit one or more symptoms of chronic liver disease. Examples of symptoms of chronic liver disease include, without limitation, enlarged liver, fatigue, pain in the upper right abdomen, abdominal swelling (ascites), enlarged blood vessels just beneath the skin's surface, enlarged breasts in males, enlarged spleen, red palms, and yellowing of the skin and eyes (jaundice).
[0068] The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
EXAMPLES
Example 1: Integrin β.SUB.1.-Enriched Extracellular Vesicles Mediate Monocyte Adhesion and Promote Liver Inflammation in Murine NASH
[0069] Hepatic recruitment of monocyte-derived macrophages (MoMF) contributes to the inflammatory response in nonalcoholic steatohepatitis (NASH). However, how hepatocyte lipotoxicity promotes MoMF inflammation is unclear. This Example demonstrates that lipotoxic hepatocyte-derived extracellular vesicles (EVs) are enriched with active integrin β.sub.1 (ITGβ.sub.1), which promotes monocyte adhesion and liver inflammation in murine NASH.
Materials and Methods
Materials
[0070] LPC (Sigma, St. Louis, Mo.) was dissolved as described elsewhere (see, e.g., Kakisaka et al., Am J Physiol Gastrointest Liver Physiol, 302(1):G77-84 (2012)). Primary antisera employed for the studies include: anti-integrin beta 1 (ITGβ.sub.1) (Ab52971), anti-ITGα.sub.5 (Ab150361), anti-ITGα.sub.V (Ab179475), anti-ITGα.sub.4 (ab81280), anti-TSG101 (Ab125011), and anti-alpha smooth muscle actin (α-SMA) (ab5694 or ab124964) antibodies from Abcam (Cambridge, Mass.), anti-ITGα.sub.9 (MAB4574) from R&D (Minneapolis, Minn.), anti-talin-1 (4021), anti-Rab7 (9367), anti-LAMP1 (9091) from Cell Signaling Technology (Danvers, Mass.), anti-GAPDH (MAB374) from Millipore Sigma (St. Louis, Mo., USA), anti-β-actin (sc-47778) from Santa Cruz Biotechnologies (Santa Cruz, Calif.), anti-ITGβ.sub.1 MAB13 (552828), anti-ITGβ.sub.1 9EG7 (553715), and isotype IgG control antibody (553927), anti-EEA1 (610456) from BD Pharmingen, (San Diego, Calif.), and anti-CD63 (MA1-19602), anti-Mac-2 (14530181) from Thermo Fisher Scientific (Waltham, Mass.), anti-ITGα9 antibody (MAB2078Z) from Millipore Sigma (St. Louis, Mo., USA), and anti-VCAM1 antibody (BBAS) from R&D (Minneapolis, Minn.).
Cells
[0071] The human hepatoma cell line Huh7 originating from a well differentiated hepatocellular carcinoma in a 57-year-old male patient, the murine hepatocyte cell line AML12 derived from a male mouse transgenic for transforming growth factor-α, and the human monocyte cell line THP1 derived from a 1-year-old boy with acute monocytic leukemia were purchased form ATCC (Rockville, Md.). Huh7 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, and primocin (100 mg/ml) (InvivoGen, San Diego, Calif.). AML12 cells were cultured in DMEM/F12 medium supplemented with 10% fetal bovine serum, 1% Insulin-Transferrin-Selenium (ITS; Gibco, Grand Island, N.Y.), dexamethasone (40 ng/mL), and primocin (100 mg/ml). Primary mouse hepatocytes (PMHs) were isolated by collagenase perfusion and purified by Percoll (Sigma-Aldrich, St. Louis, Mo.) gradient centrifugation as described elsewhere (see, e.g., Hirsova et al., PLoS One, 8(7):e70599 (2013)). THP1 cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum. Mouse primary monocytes were isolated from mouse bone marrow using EasySep mouse monocyte isolation kit (StemCell Technologies, Vancouver, BC, Canada) and cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum and primocin (100 mg/ml). The human liver sinusoidal endothelial cells (LSECs) were purchased from ScienCell Research Laboratories (San Diego, Calif.), and cultured in Endothelial Cell Growth Medium (ECM, ScienCell Research Laboratories) consisting of 5% FBS, 1% endothelial cells growth supplement, and 1% penicillin/streptomycin solution. Primary mouse LSECs were isolated from collagenase perfused liver using CD146 (LSEC) MicroBeads (Miltenyi Biotec, Bergisch Gladbach, Germany) following the manufacture's instruction and cultured in the above Endothelial Cell Growth Medium. All the cell cultures were maintained at 37° C. in a humidified atmosphere of 5% CO2.
ITGβ.sub.1 shRNA Knockdown Cell Line
[0072] TRC2 pLKO.5-Puro ITGβ.sub.1 shRNA-CCGGGCCTTGCATTACTGCTGATATCTCGAGATATCAGCAGTAATGCAAGGCT TTTTG (SEQ ID NO:1) was introduced to pack lentivirus by co-transfecting HEK293T cells with packaging vectors psPAX2 (viral proteins Gag and Rev under the SV40 promoter; Addgene plasmid #12260, a gift from D. Trono, École Polytechnique Federate de Lausanne, Lausanne, Switzerland) and pMD2.G (viral protein VSV-G expressed under the CMV promoter; Addgene plasmid #12259). Virus was harvested at 48 and 72 hours after transfection and filtered with a 0.45 μm filter. Huh7 cells were transduced by incubating with viral supernatant (diluted 1:2) in the presence of 8 μg/mL polybrene (Sigma) for 24 hours. Infected cells were selected by treating with 2 μg/mL puromycin (InvivoGen). The efficiency of shRNA mediated gene knockdown was examined by immunoblot analysis.
Extracellular Vesicles Isolation, Labeling and Quantification
[0073] EVs were isolated from cell culture medium by differential ultracentrifugation as described elsewhere (see, e.g., Ibrahim et al., Hepatology, 63(3):731-44 (2016); and Hirsova et al., Gastroenterology, 150(4):956-67 (2016)). Collected medium was depleted of cells and cell debris initially by low-speed centrifugations (2,000 g for 20 minutes and 20,000 g, for 30 minutes). The supernatants were collected and centrifuged for 90 minutes at 100,000 g at 4° C. For labeling EVs, DiO dye (Thermo Fisher) was added to the pellet, which was re-suspended in PBS and ultracentrifuged for 90 minutes at 100,000 g at 4° C., twice. For functional and characterization studies pellets from the first ultracentrifugation step were washed in PBS, and centrifuged again for 90 minutes at 100,000 g at 4° C. The obtained pellets were lysed in lysis buffer, or re-suspended in PBS solution or RPMI-1640 medium, depending on the subsequent experiments. EVs used for monocyte treatment were sterile filtered through 0.22 μm syringe filter. For the functional assay, EVs were isolated using ultrafiltration and size-exclusion chromatography (UF-SEC). Briefly, conditioned media were harvested and centrifuged for 15 minutes at 5,000 g to remove cells and cell debris. Next, media were filtered through a 0.22 μm filter. For UF-SEC, media were loaded onto Amicon Ultra-15 Centrifugal Filter Units with Ultracel-10 membrane (MWCO=10 kDa; Millipore, Billerica, Mass.) and concentrated by repeated centrifugation at 4000×g. After sample volume was adjusted to 500 μl, the concentrate media was applied to a 10 ml sepharose CL-4B column (GE Healthcare) and 20 fractions of 0.5 ml were collected using PBS as an eluent. The EV rich fractions were collected from fractions 5-12 then concentrated to 250 μl on an Amicon Ultra-4 Centrifugal Filter Unit with Ultracel-10 membrane (MWCO=10 kDa; Millipore) by centrifugation at 4,000 g and stored at 80° C. Concentration and size distribution of isolated EVs were assessed by nanoparticle-tracking analysis (NTA) using NanoSight NS300 instrument (NanoSight Ltd., Amesbury, UK). Briefly, EV samples were diluted with PBS. Each sample was continuously run through a flow-cell top-plate using a syringe pump at a rate of 25 μL/minute. At least three videos of 30 seconds documenting Brownian motion of nanoparticles were recorded, and at least 1000 completed tracks were analyzed by the NanoSight software.
Mass Spectrometry
[0074] Pulled-down immunocomplex from PMH protein samples, or EV lysate prepared as described above were run on a 4%-20% SDS-PAGE gel and fixed for 15 minutes with 50% methanol/10% acetic acid solution. The gel was subsequently washed for five minutes, stained with Coomassie blue (Bio-Rad) for one hour, washed for one hour, and then sectioned into six separate slices according to molecular weight. The gel pieces were destained in 50% acetonitrile/50 mM Tris pH 8.2 until clear, and the proteins reduced with 50 mM TCEP/50 mM Tris pH 8.2 at 60° C. for 30 minutes, followed with alkylation using 25 mM iodoacetamide/50 mM Tris pH 8.2 at room temperature for 30 minutes in the dark. Proteins were digested in-situ with 0.125 μg trypsin (Promega Corporation, Madison Wis.) in 25 mM Tris pH 8.2/0.0002% Zwittergent 3-16, at 37° C. overnight, followed by peptide extraction with 2% trifluoroacetic acid and acetonitrile. The pooled extracts were concentrated and the proteins were identified by nano-flow liquid chromatography electrospray tandem mass spectrometry (nanoLC-ESI-MS/MS) using a Thermo Scientific Q-Exactive Mass Spectrometer (Thermo Fisher Scientific, Bremen, Germany) coupled to a Thermo Ultimate 3000 RSLCnano HPLC system. The digest peptide mixture was loaded onto a Halo C18 2.7 μm EXP stem trap (Optimize Technologies, Oregon City, Oreg.) and chromatography was performed using 0.2% formic acid in both the A solvent (98% water/2% acetonitrile) and B solvent (80% acetonitrile/10% isopropanol/10% water), with a 5% B to 40% B gradient over 70 minutes at 400 nL/minute through a PicoFrit (New Objective, Woburn, Mass.) 100 μm×35 cm column handpacked with Agilent Poroshell 120 EC C18 packing. The Q-Exactive mass spectrometer experiment was a data dependent set up with a MS1 survey scan from 340-1500 m/z at resolution 70,000 (at 200 m/z), followed by HCD MS/MS scans on the top 15 ions having a charge state of +2, +3, or +4, at resolution 17,500. The ions selected for MS/MS were placed on an exclusion list for 30 seconds. The MS1 AGC target was set to 1e6 and the MS2 target was set to 1e5 with max ion inject times of 50 ms for both.
Database Searching
[0075] Tandem mass spectra were extracted by msconvert version 3.0.9134. Charge state deconvolution and deisotoping was not performed. All MS/MS samples were analyzed using Mascot (Matrix Science, London, UK; version 2.4.0) and X! Tandem (The GPM, thegpm.org; version X! Tandem Sledgehammer (2013.09.01.1)). Mascot and X! Tandem were set up to search a current Swissprot mouse database with reverse decoy (33922 entries) assuming the digestion enzyme strict trypsin and with a fragment ion mass tolerance of 0.020 Da and a parent ion tolerance of 10.0 PPM. Glu->pyro-Glu of the n-terminus, ammonia-loss of the n-terminus, gln->pyro-Glu of the n-terminus, oxidation of methionine, phosphorylation of tyrosine were specified in X! Tandem as variable modifications and carbamidomethyl of cysteine was specified as a fixed modification. Oxidation of methionine and phosphorylation of tyrosine were specified in Mascot as variable modifications with carbamidomethyl of cysteine as fixed modifications.
Criteria for Protein Identification
[0076] Scaffold (version Scaffold_4.8.3, Proteome Software Inc., Portland, Oreg.) was used to validate MS/MS based peptide and protein identifications. Peptide identifications were accepted if they could be established at greater than 95.0% probability by the Scaffold Local FDR algorithm. Protein identifications were accepted if they can be established at greater than 95.0% probability and contain at least two identified peptides. Protein probabilities were assigned by the Protein Prophet algorithm (Nesvizhskii et al. Anal. Chem., 75(17):4646-58 (2003)). The false discovery rate was less than 2%. Proteins that contained similar peptides and cannot be differentiated based on MS/MS analysis alone were grouped to satisfy the principles of parsimony. Proteins sharing significant peptide evidence were grouped into clusters. Protein comparisons were made with ratios of total spectral counts and considering total unique peptide counts.
Immunoblot Analysis
[0077] Huh7 cells, AML12 cells, PMHs, and EVs were lysed using RIPA buffer (50 mM Tris-HCl, pH 7.4; 1% Nonidet P-40; 0.25% sodium deoxycholate; 150 mM NaCl; 1 mM EDTA with protease inhibitors) followed by centrifugation at 15,000 g for 15 minutes at 4° C. Protein concentrations of the lysates were measured by the Bradford assay method (Sigma-Aldrich). Equal amount of protein were loaded onto Sodium dodecyl sulfate (SDS)-Polyacrylamide gel electrophoresis (PAGE) gels, transferred to nitrocellulose membrane (Bio-Rad, Hercules, Calif.) and incubated overnight with the primary antibody of interest. All primary antibodies were used at a dilution of 1:1,000 unless otherwise recommended by the manufacturer. Horseradish peroxidase-conjugated secondary antibodies against rabbit (Alpha Diagnostic International, San Antonio, Tex.) or mouse (Southern Biotech, Birmingham, Ala.) were used at a dilution of 1:5,000 and incubated for 1 hour at room temperature. Proteins were detected using enhanced chemiluminescence reagents (GE Healthcare, Chicago, Ill.). β-actin and GAPDH protein levels, and EV markers CD81, CD63 and TSG101 protein levels were used as loading controls of whole cell lysates and EVs, respectively.
Electron Microscopy and Immunogold Staining
[0078] The isolated EVs were fixed in 4% paraformaldehyde in 0.1 M phosphate buffer overnight at 4° C. The samples were then placed on a formvar-carbon-coated grid and air dried for 20 minutes. After being rinsed with PBS, grids were transferred to 1% glutaraldehyde for 5 minutes and washed with distilled water. The grids were first contrasted and embedded in a mixture of 4% uranyl acetate and 2% methylcellulose (1:9 ratio). For immunogold staining, grids were blocked with 10% FBS for 20 min followed by overnight incubation at 4° C. with a primary (anti-ITGβ.sub.1 (9EG7) antibody diluted in 1:10 ratio in blocking solution). Next, grids were incubated with anti-rat IgG conjugated with 12 nm gold particles for 1 hour, rinsed with PBS, fixed in 1% glutaraldehyde for 5 minutes and washed with distilled water. The grids were then contrasted and embedded in a mixture of 4% uranyl acetate and 2% methylcellulose in 1:9 ratio. The grids were examined with a JEOL 1400 electron microscope (JEOL USA, Peabody, Mass.) at 80 kV.
Immunoprecipitation and Pulldown Assays
[0079] Whole cell lysates (WCL) were obtained using immuno-precipitate (IP) buffer (50 mM Tris-HCl, pH 7.4; 1% Nonidet P-40; 150 mM NaCl) with protease inhibitor and phosphatase inhibitor followed by centrifugation at 15,000 g for 15 minutes at 4° C. Protein concentrations of the lysates were measured by the Bradford assay method (Sigma-Aldrich). In pull-down experiments, aliquots containing 1 mg of protein were incubated with either anti-ITGβ1 (MAB13), anti-ITGβ1 (9EG7) antibody or isotype IgG control antibody for 1 hour at 4° C., then incubated overnight with protein G sepharose beads (GE Healthcare) under rotary agitation. Pelleted proteins were washed with IP buffer for seven times, solubilized in SDS sample buffer, boiled for 10 minutes, and then subjected to SDS-PAGE and immunoblot analysis.
Nanoscale Flow Cytometry
[0080] Cell culture medium from Huh7 or PMH, treated with vehicle or LPC 20 μM for 4 hours were collected and centrifuged at 2,000 g for 20 minutes to remove the cell debris. Supernatants were concentrated using ultrafiltration filter (Amicon Ultra-15, Millipore Sigma, USA) at 4,000 g for 30 minutes. Anti-ITGβ.sub.1 (9EG7) was conjugated with Alexa Fluro-647 using conjugation kit (A20186, Thermo Fisher Scientific). To quantify ITGβ.sub.1+ EVs in each condition, 50 μL of concentrated culture media were incubated with anti-ITGβ.sub.1 (9EG7)-AF647 at 10 μg/mL for 30 minutes at room temperature in the dark. To control for non-specific binding and autofluorescence, samples were also incubated with rat IgG2a-APC isotype antibody. After incubation, the samples were then further diluted with PBS and analyzed using nanoscale flow cytometry. Active conformation sensitive ITGβ.sub.1 antibody 9EG7-labeled EVs from Huh7 and PMH conditioned culture media were analyzed using the A50-Micro Plus nanoscale flow cytometry (Apogee FlowSystems Inc.), calibration was done using Silica nanoparticles of various sizes. Sample flow rate of 1.5 μL/minute was used for all measurements and the time of acquisition was held constant for all samples at 60 seconds to yield enough events. Data were analyzed using FlowJo v10.5 software. Detection settings were defined with isotype-matched controls to minimize unspecific signal and background noise. Antibody-labeled samples were run using same settings.
Immunocytochemistry and Confocal Microscopy
[0081] Huh7 cells were seeded on fibronectin-coated coverslips and fixed with 4% paraformaldehyde following LPC treatment. After permeabilization using 0.2% TritonX-100, the cells were blocked using blocking buffer (5% bovine serum albumin, 0.1% glycine in PBS) for one hour at room temperature, and then incubated with the primary antibody of interest overnight at 4° C. Antibodies were diluted in PBS containing 5% bovine serum albumin at a dilution of 1:200. After washing, slides were incubated with corresponding secondary antibodies in the dark for one hour at room temperature. Slides were mounted using Prolong Gold Anti-fade reagent (Thermo Fisher Scientific), and then examined by fluorescent confocal microscopy equipped with an ultraviolet laser (LSM 780; Zeiss, Jena, Germany). ZEN 2.3 lite software (ZEISS) was used for acquiring images. ImageJ software (National Institute of Health, Bethesda, USA) was used to analyze images. Pearson's correlation coefficient of co-localization was employed to quantify the degree of colocalization between fluorophores. Ten to 20 random fields in each group were selected for quantification and statistical analysis.
RNA Sequencing and Bioinformatics Analysis
[0082] RNA sequencing was performed on primary mouse monocytes stimulated with EVs derived from LPC or vehicle-treated PMH at the Mayo Clinic Genotyping Shared Resource facility. RNA libraries were prepared using 200 ng of total RNA according to manufacturer's instructions for the TruSeq RNA Sample Prep Kit v2 (Illumina, San Diego, Calif.). The concentration and size distribution of the completed libraries was determined using an Agilent Bioanalyzer DNA 1000 chip (Santa Clara, Calif.) and Qubit fluorometry (Invitrogen, Carlsbad, Calif.). Libraries were sequenced at 53 million to 90 million reads per sample following Illumina's standard protocol using the Illumina cBot and HiSeq 3000/4000 PE Cluster Kit. The flow cells were sequenced as 100×2 paired end reads on an Illumina HiSeq 4000 using HiSeq 3000/4000 sequencing kit and HCS v3.3.20 collection software. Base calling was performed using Illumina's RTA version 2.5.2. Ingenuity Pathway Analysis (IPA) software was used to analyze the data.
Adhesion Assay
[0083] A flow-based shear stress adhesion assay was used to assess adhesion of monocytes to sinusoidal endothelial cells. Briefly, microfluidic chambers were sterilized, coated with collagen solution (0.2 mg/mL) for 4 hours at 37° C., washed with PBS, and then filled with culture media. For sinusoidal endothelial cells to form a monolayer prior to the adhesion assay, the cells were seeded in the chamber channel three days prior to the assay at a density of 10.sup.7 cell/mL, and cultured at 37° C. in a humidified atmosphere of 5% CO2. Primary mouse monocytes or THP-1 cells at a density of 1×10.sup.6/mL were incubated overnight with EVs derived from LPC or vehicle-treated hepatocytes, and then incubated with or without ITGβ1 neutralizing antibody (Hmb1-1, eBioscience, San Diego, Calif.) (30 μg/mL) or ITGα.sub.9 neutralizing antibody (Y9A2, Millipore Sigma) (10 μg/ml) for 30 minutes, re-suspended in serum-free RPMI-1640. To block the ITG β.sub.1 ligand on the endothelial cells, primary human LSEC were incubated with VCAM-1 neutralizing antibody (R&D) (50 μg/mL) for 60 minutes. After infusing endothelial basal medium in the microfluidic chamber to remove any debris, 400 μL of the monocytes suspension were infused through the chamber at a constant shear stress of 0.01 Pa for 5 minutes. Then a video of 20 seconds was taken using a Lionheart FX automated live cell microscope (Bio Tek, Winooski, Vt.). To remove non-adherent monocytes, the chamber was infused with endothelial basal medium for 5 minutes. Images of 4-6 random fields were taken with 4×/10× objective magnification. Adherent monocytes were quantified using ImageJ software.
Animals
[0084] Study protocols were conducted as approved by the Institutional Animal Care and Use Committee (IACUC) of Mayo Clinic. The methods employed in the current study were carried out in accordance with IACUC guidelines for the use of anesthetics in experimental mice. C57BL/6J male mice were purchased from Jackson Laboratory (Bar Harbor, Me.). Mice were housed and bred in a temperature-controlled 12:12-hour light-dark cycle facility with free access to diet. The mice were fed either a chow diet (5053 PicoLab Rodent Diet 20, LabDiet, St. Louis, Mo.) or a diet rich in fat, fructose, and cholesterol (FFC) at 8-weeks old for 24 weeks. FFC diet consists of 40% energy as fat (12% saturated fatty acid, 0.2% cholesterol) (AIN-76A Western Diet, TestDiet, St Louis, Mo.), with fructose (23.1 g/L) and glucose (18.9 g/L) in the drinking water. The FFC diet induces steatohepatitis with pronounced hepatocellular ballooning, lipoapoptosis, and progressive fibrosis with a high fidelity to the human NASH histology and metabolic profile (see, e.g., Charlton et al., Am J Physiol Gastrointest Liver Physiol, 301(5):G825-34 (2011); Ibrahim et al., Dig Dis Sci, 61(5):1325-36 (2016); Krishnan et al., Am J Physiol Gastrointest Liver Physiol, 312(6):G666-G680 (2017); and Idrissova et al., Journal of Hepatology, 62(5):1156-1163 (2015)). At 20 weeks on the diet, the mice were randomized to receive either anti-ITGβ.sub.1 neutralization antibody (Hmb1-1) (16-0291-85, eBioscience) or IgG isotype antibody (14-4888-85, eBioscience). Mice were injected with 1 μg/g body weight of either of the antibodies intraperitoneally, twice per week for 4 weeks. At third week of antibody treatment, metabolic parameters, including food intake, oxygen consumption, carbon dioxide production, and locomotor activity, were measured using a Comprehensive Lab Animal Monitoring System (CLAMS, Columbus Instruments, OH). Blood glucose levels and plasma insulin levels were measured using Assure 4 (Arkray, Edina, Minn.) and Ultra-Sensitive Mouse Insulin enzyme-linked immunosorbent assay (ELISA) kit (Crystal Chem Inc., Downers Grove, Ill.), respectively. Homeostasis model assessment of insulin resistance (HOMA-IR) was calculated by using the following formula: HOMA-IR=26× fasting insulin level (ng/mL)×fasting glucose level (mg/dL)/405. Mice were sacrificed under general anesthesia induced by a ketamine/xylazine cocktail (83 mg/kg ketamine, 16 mg/kg xylazine, intraperitoneal). All interventions, including sacrifice, were made during the light cycle. Blood, and liver samples were collected for further study.
Mouse Model to Track EVs of Hepatocyte Origin
[0085] Gt(ROSA)26Sor.sup.tm4(ACTB-tdTomato,-EGFP)Luo/j mice (Jackson Lab, cat #007676) have a cell membrane targeted two-color fluorescent Cre-reporter allele that highlights the cytoplasmic membrane and other cellular membranous structures, allowing the fluorescent labelling of both exosomes and microvesicles. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence. These mice are referred to as red-green mice (
Liver Triglyceride and Alanine Aminotransferase Measurement
[0086] Liver triglyceride levels were measured in mouse liver homogenates. Fifty milligrams of liver tissue was homogenized in a 5% NP-40 solution. EnzyChrom Triglyceride Kit (BioAssay System, CA) was used for the assay according to the manufacturer's instruction. Photometric absorbance was read at 570 nm using a Synergy H1 microplate reader (BioTek). Serum alanine aminotransferase (ALT) levels were measured by VetScan2 (Abaxis Veterinary Diagnostics, Union City, Calif.).
Histology, Immunohistochemistry, and Digital Image Analysis
[0087] Liver histology was performed using tissue fixed in 10% formalin, dehydrated, and embedded in paraffin. Hematoxylin and eosin (H&E) staining and Sirius red staining were performed. Histology was assessed using nonalcoholic fatty liver disease (NAFLD) activity score (NAS), a semi-quantitative score that accounts for steatosis, ballooned hepatocytes, and lobular inflammation. Terminal deoxynucleotidyl transferase deoxyuridine triphosphate nick-end labeling (TUNEL) assay was performed using the ApopTag Peroxidase In Situ Apoptosis Detection Kit (Millipore Sigma, St. Louis, Mo.); diaminobenzidine (DAB) was used as a peroxidase substrate (Vector Laboratories, Burlingame, Calif.); 0.5% methyl green was used for the counterstain. In the immunohistochemistry studies, formalin-fixed paraffin-embedded liver tissue sections were deparaffinized, hydrated, and stained with antibody against ITCβ1 (1:1000), Mac-2 (1:250), or alpha smooth muscle actin (α-SMA) (1:1000). Bound antibodies were detected using a Vectastain ABC kit (Vector Laboratories) and DAB substrate (Vector Laboratories) according to the manufacturer's instructions; the tissue sections were counterstained with hematoxylin. Sirius red-positive, ITCβ1, Mac-2, or α-SMA-positive areas were quantified by digital image analysis of 10 random fields per slide per animal using the ImageJ software. TUNEL-positive cells were quantified by counting positive nuclei in 10 random fields per slide per animal.
Quantitative Real-Time PCR
[0088] Total RNA was isolated with the RNeasy Mini Kit (Qiagen, Valencia, Calif.) and was reverse transcribed with moloney murine leukemia virus reverse transcriptase and oligo-dT random primers (both from Invitrogen, CA, USA). Quantification of gene expression was performed by real-time PCR using SYBR green fluorescence on a LightCycler 480 instrument (Roche Applied, IN, USA) (Primers are listed in Table 4). Target gene expression was calculated using the ΔΔCt method and was normalized to 18s rRNA expression levels, which were stable across experimental groups.
TABLE-US-00004 TABLE 4 Primers used for qRT-PCR Forward SEQ Reverse SEQ Primer ID Primer ID Gene (5′-3′) NO: (5′-3′) NO: Cd68 TGTCTGATCT 2 GAGAGTAACGG 3 TGCTAGGACG CCTTTTTGTGA Ccr2 ATCCACGGCA 4 CAAGGCTCACC 5 TACTATCAAC ATCATCGTAG ATC Tnf-α CCCTCACACT 6 GCTACGACGTG 7 CAGATCATCT GGCTACAG TCT Collagen1α1 GCTCCTCTTA 8 CCACGTCTCAC 9 GGGGCCACT CATTGGGG Osteopontin CTCCATCGTC 10 TGCACCCAGAT 11 ATCATCATCG CCTATAGCC 18s CGCTTCCTTA 12 GAGCGACCAAA 13 CCTGGTTGAT GGAACCATA
Flow Cytometry
[0089] One gram of liver tissue was dissociated using mouse liver dissociation kit (Miltenyi Biotec, Bergisch Gladbach, Germany) according to the manufacturer's instruction. Intrahepatic leukocytes were purified by Percoll (Sigma-Aldrich) gradient centrifugation. Cells were stained with the following antibodies for 20 minutes at room temperature in the dark: anti-CD45-Vio-green (130-110-665, Miltenyi Biotec), anti-CD11b-PerCp-vio700 (130-109-289, Miltenyi Biotec), anti-F4/80-APC-Cy7 (123117, Biolegend, San Diego, Calif.), anti-CCR2-PE (130-108-724, Miltenyi Biotec), anti-CLEC4F (370901, R&D) conjugated with Alexa Fluro-647 using conjugation kit (A20186, Thermo Fisher Scientific). Stained cells were analyzed on MACSQuant Analyzer 16 Flow Cytometer (Miltenyi Biotec). Data were analyzed using FlowJo v10.5 software.
Mass Cytometry by Time-of-Flight (CyTOF) Analysis
[0090] Intrahepatic mouse leukocytes were isolated using liver dissociation kit and Percoll gradient centrifugation as described above. Cells were suspended in Maxpar Cell Staining Buffer (CSB, Fluidigm, San Francisco, Calif.) and labelled with 0.5 μM cisplatin (Fluidigm) solution. After centrifugation, cells were resuspended in CSB prior to addition of the antibody cocktail (composition shown in Table 5) in an equal volume of CSB. Cells were incubated with gentle agitation at room temperature for 45 minutes. Following wash, cells were fixed overnight with 2% paraformaldehyde with gentle agitation at 4° C. DNA intercalation was performed by adding 1:10000 diluted 125 μM of Cell-ID™ Intercalator-Ir (Fluidigm) with gentle agitation in 4° C. for 30 minutes. Cells were resuspended in 1:10 dilution of EQ beads (EQ Four Element Calibration Beads, Fluidigm), and then loaded onto Helios sample loader for data acquisition. Mass cytometry was performed in the Immune Monitoring Core at Mayo Clinic, and employed antibodies conjugated to stable heavy-metal isotopes to detect cellular antigens by mass cytometry time-of-flight (CyTOF) and enables comprehensive profiling of the phenotype and function of the intrahepatic leukocytes. After data acquisition, fcs files were normalized using CyTOF Software (version 6.7.1014). Cleanup of cell debris, removal of doublets and dead cells was performed using FlowJo software version 10.5.3 (Ashland, Oreg.). Cleaned fcs files were analyzed by the R-based tool Cytofkit version 3.8. Clustering and dimensionality reduction to 20,000 events per file was performed using the Rphenograph algorhithm that included all 24 markers in the panel (Table 5). Visualization of clusters was mapped onto a tSNE map. Relative marker intensities and cluster abundances per sample were visualized by heatmap.
TABLE-US-00005 TABLE 5 CyTOF Panel. Species Specificity Label Target Clone Mouse 150Nd I-A/I-E M5/114.15.2 Mouse 143Nd TCRb H57-597 Mouse 144Nd MHC Class I 28-14-8 Mouse 152Sm CD3e 145-2C11 Mouse 161Dy Ly6G 1A8 Mouse 164Dy CX3CR1 SA011F11 Mouse 168Er CD8a 53-6.7 Mouse 172Yb CD11b (Mac-1) M1/70 Mouse 175Lu Ly6C HK1.4 Mouse 089Y CD45 30-F11 Mouse 166Er CD19 6D5 Mouse 142Nd CD11c N418 Mouse 154Sm TER-119 TER-119 Mouse 156Gd CCR2 475301 Mouse 159Tb F4/80 BM8 Mouse 170Er CD161 (NK1.1) PK136 Mouse 174Yb CD115/CSF1R AFS98 Mouse 176Yb CD45R (B220) RA3-6B2 Mouse 141Pr Lgals3 202213 Mouse 151Eu CD206 (MMR) C068C2 Mouse 155Gd MERTK 108928 Mouse 160Gd CD64 290322 Mouse 165Ho CD14 Sa14-2 Mouse 149Sm Tim4 370901
Immunostaining of EVs from Patient Serum
[0091] De-identified archived serum samples from 8 patients with simple steatosis and 17 patients with stage I-II NASH were acquired through a human study that was approved by the Institutional Review Board of the Mayo Clinic and previously published. All subjects provided written informed consent. The diagnosis of NASH was based on histologic categorization according to established NASH criteria as assessed by experienced pathologist. Subjects with secondary causes of steatohepatitis (drugs, and prior gastric surgery for obesity) and other chronic liver diseases (cholestatic liver disease, hemochromatosis, excessive alcohol consumption, viral hepatitis (B, C), Wilson disease, drug-induced liver disease, and alpha-1-antitrypsin deficiency) were excluded. Sera were pre-cleared by centrifuging at 2,500 g for 15 minutes, twice, prior to nanoscale flow cytometry staining; 10 μL serum was co-stained with anti-CD29-APC and ASGR1-PE or isotype antibodies at 10 μg/mL for 30 minutes at room temperature in the dark. After incubation, the samples were then further diluted with PBS and analyzed using nanoscale flow cytometry as described above.
Statistical Analysis
[0092] Data are expressed as the means±SEM. Differences between multiple groups were compared using one-way analysis of variance followed by Bonferroni's multiple comparisons test or Student t test when comparing two groups. *, **, ***, **** indicate statistical significance with p<0.05, p<0.01, p<0.001 and p<0.0001 respectively. Statistically non-significant results were labelled as ns where appropriate. All analyses were performed using GraphPad Prism 8 software (CA, USA).
Results
[0093] Lipotoxic Hepatocyte-Derived EVs are Enriched with Integrins
[0094] A non-biased approach was adopted to identify and characterize the key proteins on lipotoxic hepatocyte-derived extracellular vesicles (EVs). To this end, proteomics analysis was performed by mass spectrometry (MS) on the EVs derived from primary mouse hepatocytes (PMH) treated with vehicle (Veh) and the toxic lipid mediator lysophosphatidylcholine (LPC). LPC was employed since the toxicity of the saturated free fatty acid palmitate is dependent upon its metabolism to LPC. Unbiased Ingenuity pathway analysis (IPA) of the proteomics data identified ITG signaling among the top represented canonical pathways, particularly in EVs from LPC-treated hepatocytes when compared to EVs from vehicle-treated hepatocytes (
Hepatocyte Lipotoxic Treatment Induces ITGβ.SUB.1 .Activation and Endocytic Trafficking
[0095] The activation and endocytic trafficking of ITGβ.sub.1 in hepatocytes under lipotoxic stress was examined (
Lipotoxic Hepatocytes Release EVs in the Circulation
[0096] A mouse model to track circulating EVs of hepatocyte origin was developed (
Lipotoxic Hepatocyte-Derived EVs Promote Monocytes Adhesion to LSECs Via an ITGβ.SUB.1.-Dependent Mechanism
[0097] To understand the biological functions exerted by lipotoxic hepatocyte-derived EVs on monocytes, RNA sequencing (RNAseq) was performed on primary mouse monocytes incubated with EVs from LPC (LPC-EVs)- or vehicle (Veh-EVs)-treated PMH. Ingenuity pathway analysis of RNAseq data showed that leukocyte adhesion and diapedesis-related signaling among the top overrepresented canonical pathways in monocytes stimulated with LPC-EVs, suggesting the involvement of LPC-EVs in monocyte adhesion to LSECs (
[0098] To examine the interaction between lipotoxic EVs-stimulated monocytes and LSECs, the human monocyte cell line, THP1, was co-cultured with EVs derived from equal number of hepatocytes treated with either vehicle or LPC. EVs were labelled with a fluorescent lipophilic dye DiO. Confocal microscopy revealed that monocytes incubated with LPC-EVs were more likely to adhere to LSECs (
Anti-ITGβ.sub.1 Antibody Treatment does not Alter the Metabolic Phenotype or the Steatosis in FFC Diet-Fed Mice
[0099] Based on the in vitro findings supporting a key role of lipotoxic EV ITGβ.sub.1 in monocyte adhesion to LSECs and potentially in liver inflammation; the potential beneficial effect of ITGβ.sub.1 neutralizing antibody in a mouse model of diet-induced NASH was examined. Eight-week-old C57BL/6J wild-type mice were fed either chow or a diet high in saturated fat, fructose, and cholesterol (FFC) for 24 weeks. At 20 weeks of the diet mice were treated with either anti-ITGβ.sub.1 neutralizing antibody (ITGβ.sub.1Ab) or control IgG isotype antibody (IgG) twice per week for 4 weeks. The metabolic status of each group of mice was assessed. Comprehensive Laboratory Animal Monitoring System (CLAMS) study showed that total daily caloric intake (
Anti-ITGβ.SUB.1 .Antibody Treatment in FFC-Fed Mice Attenuates Hepatic Inflammation
[0100] Given the key role of ITGβ.sub.1 in monocyte adhesion to LSECs (
Anti-ITGβ.SUB.1 .Antibody Treatment in FFC-Fed Mice Reduces the Pro-Inflammatory Monocyte Hepatic Infiltration
[0101] Macrophages are characterized using a variety of criteria, including ontogeny (yolk sac- vs. bone marrow-derived), and function (pro-inflammatory vs. restorative). Liver macrophages are also frequently classified as resident macrophages (Kupffer cells) or recruited macrophages (i.e., circulating bone marrow-derived monocytes differentiating into macrophages). Functionally, macrophages exist as a continuum, with tissue damaging or pro-inflammatory at one end of the spectrum (M1-like), and restorative macrophages involved in tissue repair and healing at the other end (M2-like).
[0102] While MoMFs play a crucial role in NASH pathogenesis and progression, various other immune cells including neutrophils, dendritic cells, and lymphocytes are involved in NASH pathogenesis. To determine the contribution of the different subset of macrophages, and other immune cells in ITGβ.sub.1Ab protective effect in NASH, B lymphocytes, T lymphocytes, natural killer cells, NKT cells, dendritic cells and neutrophils in addition to monocytes and macrophages were profiled using the state of the art technology mass cytometry by time-of-flight (CyTOF). Twenty eight clusters were obtained (
TABLE-US-00006 TABLE 6 Predominant immune cell markers for the differentially expressed clusters between the study groups. Cluster Phenotype Predominant Cell Type 5 Ly6c+ CD11b+ CD45+ MHC I+ CCR2+ Infiltrating proinflammatory MoMF 9 Ly6c+ CD11b+ CD45+ MHC I+ MHC II+ CCR2+ Infiltrating proinflammatory MoMF 7 CD11b+ CD45+ MHC I+ CD11c+ F4/80+ Infiltrating MoMF 17 MHC II+ CD45+ CD11c+ MHC I+ CD11b+ Infiltrating MoMF 1 CD206+ MHC I+ Lgals+ MertK+ Restorative macrophage 2 CD206+ MHC I+ Lgals+ MertK+ Restorative macrophage 28 MHC I+ CD206+ Lgals+ Restorative macrophage 10 MHC II+ MHC I+ F4/80+ CD45+ CD64+ Resident macrophage 8 MHC II+ CD45+ MHC I+ CD11b+ CD19+ B cell-like 15 Ly6G+ CD11b+ Ly6c+ CD45+ MHC I+ Neutrophil-like 19 CD45+ CD11c+ MHC I+ CD11b+ Ly6c+ Dendritic cell-like 16 CD45+ CD8a+ Ly6c+ TCRb+ CD3e+ T lymphocyte 21 CD45+ MHC I+ Ly6c+ CD3e+ TCRb+ T lymphocyte Out of 28 clusters obtained by CyTOF, 13 clusters were differentially expressed between the study groups and categorized into distinct leukocyte subpopulations based on the intensities of individual cell surface markers.
Anti-ITGβ.SUB.1 .Antibody Treatment Reduces FFC Diet-Induced Liver Injury and Fibrosis in Murine NASH
[0103] To determine if reduced hepatic inflammation through ITGβ.sub.1 blockade may protect against NASH progression and liver fibrosis, liver injury and fibrosis were examined. FFC-fed, ITGβ.sub.1Ab-treated mice were relatively protected against hepatocyte apoptosis compared to control IgG-treated mice, as demonstrated by reduced TUNEL-positive cells (
[0104] Taken together, these results demonstrate that ITGβ.sub.1 neutralizing antibody can reduce pro-inflammatory monocyte hepatic infiltration and expand the restorative macrophage population, and that blocking ITGβ.sub.1 can attenuate liver injury, inflammation and fibrosis.
Example 2: Anti-VCAM-1 Antibody Treatment Reduces FFC Diet-Induced Liver Fibrosis in Murine NASH
Materials and Methods
Materials
[0105] Palmitate (PA) (P0500) was obtained from Sigma-Aldrich (St. Louis, Mo.). AGI-1067 (216167-82-7) was from MedChemExpress (Princeton, N.J.). URMC-099 was kindly provided by Dr. Harris A. Gelbard (University of Rochester Medical Center, Rochester, N.Y.). SB203580 (559389) was from Millipore Sigma (St. Louis, Mo., USA). Primary antisera employed for the studies include: anti-alpha smooth muscle actin (α-SMA) (ab124964), and anti-human VCAM-1 (ab134047) antibody from Abcam (Cambridge, Mass.), anti-p-p38 (9211), anti-p38 (9212), anti-p-MKK3/MKK6 (12280), anti-MKK3 (8535), p-JNK (9255), JNK (9252), and mouse VCAM-1 (32653) from Cell Signaling Technology (Danvers, Mass.), anti-GAPDH (MAB374) from Millipore Sigma, anti-β-actin (sc-47778) from Santa Cruz Biotechnologies (Santa Cruz, Calif.), and anti-Galectin-3 (14530181) from Thermo Fisher Scientific (Waltham, Mass.). Neutralizing anti-VCAM-1 antibody (GTX14360) and IgG isotype control (BE0088) were obtained from GeneTex and InVivoMab, respectively.
Human Liver Samples
[0106] De-identified archived liver specimens obtained by liver biopsy or surgical hepatic resection from patients with normal liver, isolated steatosis, or NASH were acquired through a human study. Histological diagnosis was based on established NASH criteria as assessed by experienced pathologist. Subjects with other chronic liver diseases (cholestatic liver disease, hemochromatosis, excessive alcohol consumption, viral hepatitis, Wilson disease, drug-induced liver disease, and alpha-1-antitrypsin deficiency) were excluded.
Cells
[0107] Transformed mouse liver sinusoidal endothelial cells (TSEC) were obtained. Primary human liver sinusoidal endothelial cells (LSEC) were purchased from ScienCell Research Laboratories (San Diego, Calif.). To yield primary mouse LSECs, cell suspensions obtained with liver collagenase perfusion were centrifuged at 50 g for 2 minutes to remove hepatocytes. The supernatant which includes non-parenchymal cells was subjected to LSEC isolation using CD146 MicroBeads (Miltenyi Biotec, Bergisch Gladbach, Germany) following the manufacture's instruction. TSEC, primary human LSEC, and primary mouse LSEC were cultured in Endothelial Cell Growth Medium (ECM, ScienCell Research Laboratories) consisting of 5% FBS, 1% endothelial cells growth supplement, and 1% primocin (InVivoGen, San Diego, Calif.) solution. All the cell cultures were maintained at 37° C. in a humidified atmosphere of 5% CO2.
PA Treatment of Cells
[0108] PA was dissolved in isopropanol at a concentration of 80 mM as a stock solution. The PA stock solution was added to Endothelial Cell Growth Medium containing 1% fatty acid free low endotoxin BSA; the final experimental concentrations of PA 500 or 800 μM were used for the treatment of cells. For the negative control non-treated (vehicle-treated) cells, the same concentration of isopropanol was added to Endothelial Cell Growth Medium containing 1% BSA.
Immunoblot Analysis
[0109] Cells were lysed using RIPA buffer (50 mM Tris-HCl, pH 7.4; 1% Nonidet P-40; 0.25% sodium deoxycholate; 150 mM NaCl; 1 mM EDTA with protease inhibitors) followed by centrifugation at 15,000 g for 15 minutes at 4° C. Protein concentrations of the lysates were measured by the Bradford assay method (Sigma-Aldrich). Equal amount of protein were loaded onto Sodium dodecyl sulfate (SDS)-Polyacrylamide gel electrophoresis (PAGE) gels, transferred to nitrocellulose membrane (Bio-Rad, Hercules, Calif.) and incubated overnight with the primary antibody of interest. All primary antibodies were used at a dilution of 1:1,000 unless otherwise recommended by the manufacturer. Horseradish peroxidase-conjugated secondary antibodies against rabbit (Alpha Diagnostic International, San Antonio, Tex.) or mouse (Southern Biotech, Birmingham, Ala.) were used at a dilution of 1:5,000 and incubated for 1 hour at room temperature. Proteins were detected using enhanced chemiluminescence reagents (GE Healthcare, Chicago, Ill.). β-actin and GAPDH protein levels were used as loading controls.
Animals
[0110] C57BL/6J male mice were purchased from Jackson Laboratory (Bar Harbor, Me.). Mice were housed and bred in a temperature-controlled 12:12-hour light-dark cycle facility with free access to diet. The mice were fed either a chow diet (5053 PicoLab Rodent Diet 20, LabDiet, St Louis, Mo.) or a diet rich in fat, fructose, and cholesterol (FFC) at 8-weeks old for 24 weeks. FFC diet consists of 40% energy as fat (12% saturated fatty acid, 0.2% cholesterol) (AIN-76A Western Diet, TestDiet, St Louis, Mo.), with fructose (23.1 g/L) and glucose (18.9 g/L) in the drinking water. The FFC diet induces steatohepatitis with pronounced hepatocellular ballooning, lipoapoptosis, and progressive fibrosis with a high fidelity to the human NASH histology and metabolic profile. At 20 weeks on the diet, the mice were randomized to receive either anti-VCAM-1 neutralizing antibody (M/K-2.7), (Genetex, GTX14360) or IgG isotype antibody (BE0088, InVivoMAb). Mice were injected with 10 mg/kg body weight of either of the antibodies intraperitoneally, twice per week for 4 weeks. Another cohort of Chow or FFC diet-fed mice was randomized to receive either vehicle or VCAM-1 inhibitor succinobucol (AGI-1067). Mice were injected with either vehicle or 25 mg/kg body weight of AGI-1067 intraperitoneally, daily for 15 days. Total caloric intake at the 3rd week of VCAM-1 antibody treatment and the first week of AGI-1067 treatment was calculated based on the weight of food and drinking water consumption. At the third week of anti-VCAM-1 neutralizing antibody treatment, metabolic parameters, including oxygen consumption, carbon dioxide production, and locomotor activity, were measured using a Comprehensive Lab Animal Monitoring System (CLAMS, Columbus Instruments, OH). Anti-VCAM-1 antibody from Bio Xcell (West Lebanon, N.H.), (BE0027) was used for the CLAMS study. Blood glucose levels and plasma insulin levels were measured using Assure 4 (Arkray, Edina, Minn.) and Ultra-Sensitive Mouse Insulin enzyme-linked immunosorbent assay (ELISA) kit (Crystal Chem Inc., Downers Grove, Ill.), respectively. Homeostasis model assessment of insulin resistance (HOMA-IR) was calculated by using the following formula: HOMA-IR=26×fasting insulin level (ng/mL)×fasting glucose level (mg/dL)/405. Mice were sacrificed under general anesthesia induced by a ketamine/xylazine cocktail (83 mg/kg ketamine, 16 mg/kg xylazine, intraperitoneal injection). All interventions were made during the light cycle. Blood and liver samples were collected for further study.
RNA Sequencing and Bioinformatics Analysis
[0111] RNA sequencing was performed on whole liver from both Chow and FFC diet-fed mice. Three mice per group were included for the study. RNA libraries were prepared using 200 ng of total RNA according to manufacturer's instructions for the TruSeq RNA Sample Prep Kit v2 (Illumina, San Diego, Calif.). The concentration and size distribution of the completed libraries was determined using an Agilent Bioanalyzer DNA 1000 chip (Santa Clara, Calif.) and Qubit fluorometry (Invitrogen, Carlsbad, Calif.). Libraries were sequenced at 53 million to 90 million reads per sample following Illumina's standard protocol using the Illumina cBot and HiSeq 3000/4000 PE Cluster Kit. The flow cells were sequenced as 100×2 paired end reads on an Illumina HiSeq 4000 using HiSeq 3000/4000 sequencing kit and HCS v3.3.20 collection software. Base calling was performed using Illumina's RTA version 2.5.2. Genes with Log 2 fold change (Log FC) more than 1.5 and p-value less than 0.05 were considered differentially expressed. Ingenuity Pathway Analysis (IPA) software was used to analyze the data.
Liver Triglyceride and Alanine Aminotransferase Measurement
[0112] Liver triglyceride levels were measured in mouse liver homogenates. Fifty milligrams of liver tissue was homogenized in a 5% NP-40 solution. EnzyChrom Triglyceride Kit (BioAssay System, CA) was used for the assay according to the manufacturer's instruction. Photometric absorbance was read at 570 nm using a Synergy H1 microplate reader (BioTek). Serum alanine aminotransferase (ALT) levels were measured by VetScan2 (Abaxis Veterinary Diagnostics, Union City, Calif.).
Histology, Immunohistochemistry, and Digital Image Analysis
[0113] Liver histology was performed using tissue fixed in 10% formalin, dehydrated, and embedded in paraffin. Hematoxylin and eosin (H&E) staining and Sirius red staining were performed. Severity of NASH was assessed using nonalcoholic fatty liver disease (NAFLD) activity score (NAS), a semi-quantitative score that accounts for steatosis, ballooned hepatocytes, and lobular inflammation. Terminal deoxynucleotidyl transferase deoxyuridine triphosphate nick-end labeling (TUNEL) assay was performed using the ApopTag Peroxidase In Situ Apoptosis Detection Kit (Millipore Sigma, St. Louis, Mo.); diaminobenzidine (DAB) was used as a peroxidase substrate (Vector Laboratories, Burlingame, Calif.); 0.5% methyl green was used for the counterstain. For the immunohistochemistry studies, formalin-fixed paraffin-embedded liver tissue sections were deparaffinized, hydrated, and stained with antibody against VCAM-1 (1:200), Galectin-3 (1:250) or alpha smooth muscle actin (α-SMA) (1:1000) for mouse tissues, and VCAM-1 (1:500) for human tissues. Bound antibodies derived from mouse or rabbit were detected using a Vectastain ABC kit (Vector Laboratories) or EnVision System HRP (Dako), respectively, and DAB substrate (Vector Laboratories) according to the manufacturer's instructions; the tissue sections were counterstained with hematoxylin. Sirius red-positive, VCAM-1, Galectin-3, or α-SMA-positive areas were quantified by digital image analysis of 10 random fields per slide per animal using the ImageJ software. TUNEL-positive cells were quantified by counting positive nuclei in 10 random fields per slide per animal.
Quantitative Real-Time PCR
[0114] Total RNA was isolated with the RNeasy Mini Kit (Qiagen, Valencia, Calif.) and was reverse transcribed with moloney murine leukemia virus reverse transcriptase and oligo-dT random primers (both from Invitrogen, CA, USA). Quantification of gene expression was performed by real-time PCR using SYBR green fluorescence on a LightCycler 480 instrument (Roche Applied, IN, USA). Target gene expression was calculated using the ΔΔCt method and was normalized to 18s rRNA expression levels, which were stable across experimental groups.
Mass Cytometry by Time-of-Flight (CyTOF) Analysis
[0115] Intrahepatic mouse leukocytes were isolated using liver dissociation kit and Percoll gradient centrifugation. Cells were suspended in Maxpar Cell Staining Buffer (CSB, Fluidigm, San Francisco, Calif.) and labelled with 0.5 μM cisplatin (Fluidigm) solution. After centrifugation, cells were resuspended in CSB prior to addition of the antibody cocktail (composition shown in Table 5) in an equal volume of CSB. Cells were incubated with gentle agitation at room temperature for 45 minutes. Following wash, cells were fixed overnight with 2% paraformaldehyde with gentle agitation at 4° C. DNA intercalation was performed by adding 1:10000 diluted 125 μM of Cell-ID™ Intercalator-Ir (Fluidigm) with gentle agitation in 4° C. for 30 minutes. Cells were resuspended in 1:10 dilution of EQ beads (EQ Four Element Calibration Beads, Fluidigm), and then loaded onto Helios sample loader for data acquisition. Mass cytometry was performed in the Immune Monitoring Core at Mayo Clinic, and employed antibodies conjugated to stable heavy-metal isotopes to detect cellular antigens by mass cytometry time-of-flight (CyTOF) and enables comprehensive profiling of the phenotype and function of the intrahepatic leukocytes. After data acquisition, fcs files were normalized using CyTOF Software (version 6.7.1014). Cleanup of cell debris, removal of doublets and dead cells was performed using FlowJo software version 10.5.3 (Ashland, Oreg.). Cleaned fcs files were analyzed by the R-based tool Cytofkit version 3.8. Clustering and dimensionality reduction to 20,000 events per file was performed using the Rphenograph algorithm that included all 30 markers in the panel (Table 5). Visualization of clusters was mapped onto a tSNE map. Relative marker intensities and cluster abundances per sample were visualized by heatmap.
B Cell Purification and Cell Viability Assay
[0116] B cells were obtained by magnetic isolation from mouse spleen according to manufacturer's instruction. In brief, mouse spleen was dissociated using Spleen Dissociation Kit (Miltenyi, 130-095-926), cell suspension was subjected to B cell purification using negative selection with Dynabeads mouse CD43 (Invitrogen, 11422D). Flow cytometric analysis confirmed that the purity of B cells was >98% as assessed by the ratio of CD45+ CD19+ cells out of whole isolated cells. Cells were grown in 96-well flat bottom plate (5×10.sup.5 cells per well). Cell viability was assessed using CellTiter-Glo luminescent cell viability assay (Promega, Madison, Wis.) (G7570) after 4 hour treatment with either vehicle or 20 μM of lysophosphatidylcholine (LPC), a toxic lipid mediator.
Statistical Analysis
[0117] Data are expressed as the means±SEM. Differences between multiple groups were compared using one-way analysis of variance followed by Bonferroni's multiple comparisons test or Student t test when comparing 2 groups. *, **, ***, **** indicate statistical significance with p<0.05, p<0.01, p<0.001 and p<0.0001 respectively. Statistically non-significant results were labelled as ns where appropriate. All analyses were performed using GraphPad Prism 8 software (CA, USA).
Results
Adhesion Molecule VCAM-1 is Upregulated in Murine NASH
[0118] To gain a comprehensive insight into the pathophysiology of NASH, unbiased transcriptomic analysis using RNA sequencing (RNA-seq) was performed on whole livers from a diet-induced NASH mouse model; mice were fed either the FFC diet, or normal chow-fed control mice. Out of 13733 coding transcripts detected in the RNA-seq, 986 genes were differentially upregulated in FFC mice livers. These upregulated gene sets were subjected to Ingenuity Pathway Analysis (IPA), and it was found that among the top 10 ranked over-represented canonical pathways, 6 pathways were profoundly involved in leukocyte adhesion and differentiation (
VCAM-1 is Upregulated in LSEC Under Lipotoxic Conditions Via a MAPK Pathway and an NF-κB Dependent Mechanism
[0119] To examine whether VCAM-1 is upregulated in LSEC by lipotoxic stress in vitro, three different types of LSEC, namely transformed sinusoidal endothelial cell line (TSEC), primary LSEC isolated from wild-type mice, and human primary LSEC were used. These cells were treated with palmitate (PA), one of the most common saturated free fatty acids in plasma in NASH patients. It was confirmed that PA treatment increased mRNA expression levels of Vcam-1 in all these cell types (
Neither the Metabolic Phenotype, Nor the Steatosis was Altered by Anti-VCAM-1 Antibody Treatment in FFC Diet-Fed Mice.
[0120] Based on the findings that VCAM-1 is upregulated under lipotoxic conditions both in vitro and in vivo, the therapeutic effect of VCAM-1 neutralizing antibody in the diet-induced murine NASH model was examined. Wild-type mice were fed either chow or the FFC diet for 24 weeks. At 20 weeks of the diet, mice were treated with either anti-VCAM-1 neutralizing antibody (VCAM1 Ab) or control IgG isotype antibody (IgG) twice per week for 4 weeks. Body weight and liver to body weight ratio at the time of sacrifice (
Anti-VCAM-1 Antibody Treatment in FFC-Fed Mice Attenuates Hepatic Injury and Inflammation.
[0121] Next, whether VCAM-1 neutralizing antibody reduces liver injury was tested in the dietary mouse model of NASH. FFC-fed, VCAM1 Ab-treated mice showed less TUNEL-positive cells in the liver (
VCAM-1 Antibody Treatment in FFC-Fed Mice Reduces the Pro-Inflammatory Monocyte Hepatic Infiltration
[0122] To examine the contribution of the different immune cells in the protective effect of VCAM1 Ab in NASH, mass cytometry by time-of-flight (CyTOF), which allows comprehensive profiling of the intrahepatic leukocyte subpopulations based on multiple cell surface markers, was utilized. Thirty-one clusters were obtained (
Anti-VCAM-1 Antibody Treatment Reduces FFC Diet-Induced Liver Injury and Fibrosis in Murine NASH
[0123] It was next examined whether reduced hepatic inflammation through VCAM-1 blockade may protect against stellate cell activation and liver fibrosis in a diet-induced NASH mouse model. Sirius red staining (
AGI-1067 Treatment in FFC-Fed Mice Attenuates Hepatic Injury, Inflammation and Fibrosis.
[0124] AGI-1067, also called succinobucol, has anti-oxidative and anti-inflammatory properties, with known VCAM-1 inhibitory function, and has been employed in clinical trials for atherosclerosis and type 2 diabetes. Thus, the effect of AGI-1067 was examined in a NASH mouse model. First, it was confirmed in vitro that AGI-1067 inhibits palmitate-induced VCAM-1 expression both at the mRNA and the protein levels (
OTHER EMBODIMENTS
[0125] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.