KIT FOR AFLATOXIN B1 (AFB1) MONITORING

20220213545 · 2022-07-07

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention displays aflatoxin B.sub.1 (AFB.sub.1) detection kit and AFB.sub.1 detection method. The invention belongs to the technical field of detecting harmful substances. The AFB.sub.1 detection kit was fabricated with DNA walker structure, endonuclease, hairpin H1 and H2. The AFB.sub.1 detection kit has benefits of high sensitivity and short detection time based on signal amplification strategy of DNA Walker structure and hyperbranched fluorescent nanotrees. The present invention can realize high sensitive and rapid detection of AFB.sub.1.

    Claims

    1. A detection kit for AFB.sub.1, which contains DNA walker structure, endonuclease, hairpin structure H1 and hairpin structure H2, wherein the DNA Walker structure is gold nanoparticles (AuNPs) modified with WA double strand and DNA tetrahedrons (DTNs), wherein the WA is a double stranded structure composed of aptamer A of AFB.sub.1 and its partially complementary nucleic acid sequence W, wherein the sequence E1 on the W chain and the sequence E2 on the S1 chain can form the recognition site of endonuclease by base complementary pairing, there is a 4-15 base sequence E1 in wherein the nucleic acid sequence W and A are not complementary, the nucleic acid sequence at the junction of DTNs and gold nanoparticles contains a 4-15 base sequence E2, the sequence E1 on the W chain and the sequence E2 on the S1 chain can form the recognition site of endonuclease by base complementary pairing, both ends of wherein the hairpin structure H1 are respectively modified with a fluorescent group and a fluorescence quenching group, wherein the DTNs are self-assembled by four DNA single strands through base complementary, the nucleic acid sequence of DTNs pivot is complementary to the partial sequence of the hairpin structure H1, which is used to open the hairpin structure of H1, the hairpin structure H1 is complementary to the partial sequence base of the hairpin structure H2, which is used to open the hairpin structure of H2.

    2. A detection kit for AFB.sub.1 according to claim 1, the cutting endonuclease is Nt.BsmAI.

    3. A detection kit for AFB.sub.1 according to claim 1, the sequence of aptamer A of AFB.sub.1 is shown in SEQ ID NO: 1.

    4. A detection kit for AFB.sub.1 according to claim 1, the nucleic acid sequence of W is shown in sequence ID NO:2, the 5′ end of W is modified by sulfhydryl group.

    5. A detection kit for AFB.sub.1 according to claim 1, the four DNA single stranded sequences of the DTNs are shown in the sequence of SEQ ID NO:3-6, the 5′ end of the sequence ID NO:3 is modified by sulfhydryl group.

    6. A detection kit for AFB.sub.1 according to claim 1, the nucleic acid sequence of the H1 is shown in SEQ ID NO:7.

    7. A detection kit for AFB.sub.1 according to claim 6, the fluorescent group in the H1 is FAM fluorescent group, and the fluorescence quenching group is Dabcyl.

    8. A detection kit for AFB.sub.1 according to claim 1, the nucleic acid sequence of the H2 is shown in SEQ ID NO:8.

    9. A detection kit for AFB.sub.1 according to claim 1, DNA Walker structure is prepared in the following steps: thiol groups of WA and DTNs were reduced by TCEP for 30 min, the activated WA and DTNs were mixed in a molar ratio of 1:4, and then 0.1% AuNPs solution was added to the mixture at 4° C. overnight, next, 1M sodium chloride solution was added to the above solution every 1 h for a total of 5 times to ensure that the final concentration of sodium chloride is 0.15 M, after each addition of sodium chloride, the solution needs to be sonicated for 10 s, finally, the uncoupled WA and DTNs were removed by centrifugation to obtain the DNA walker structure.

    10. The steps for using the kit according to claim 9 to detect AFB.sub.1 are as follows: step 1: the test sample solution and DNA walker solution were mixed at 37° C. and incubated for 0.5 h, then the cutting endonuclease Nt.BsmAI was added under 37° C. for 0.5 h. then the mixture was kept at 65° C. for 20 min, step 2: adding sodium chloride solution to the solution after reaction in step (1), the AuNPs was precipitated in the salt solution to retain the supernatant, step 3: H1 and H2 were added to above solution (2) for the reaction at 37° C. for 15 min, the molar ratio of H1 and H2 was 1:1, step 4: the fluorescence intensity of the solution after reaction in step (3) was detected at 490 nm excitation wavelength, the measured fluorescence intensity was introduced into the standard curve.

    Description

    BRIEF DESCRIPTION OF DRAWINGS

    [0035] FIG. 1: Schematic diagram of detection principle of the method of the invention.

    [0036] FIG. 2: The sensitivity detection of the detection kit.

    [0037] FIG. 3: The specificity detection of the detection kit.

    DETAILED DESCRIPTION OF THE INVENTION

    [0038] Unless otherwise specified, the terms used in the description of the invention typically have the meanings commonly appreciated by those ordinarily skilled in the art.

    [0039] The invention is further detailed below in combination with embodiments and reference data. The following embodiments are only used for illustratively explaining the invention, and are not intended to limit the scope of the invention in any form.

    Embodiment 1

    [0040] The detection principle of the invention is as follows:

    [0041] DTNs are formed by complementary self-assembly of S1, S2, S3 and S4. There is a single strand extension sequence at the four vertices of DTNs. WA double stranded structure composed of aptamer A of AFB.sub.1 and its partially complementary nucleic acid sequence W. The 5 ′end of S1 and W chain were modified by sulfhydryl group. After thiol reduction by TCEP reductant, DTNs and WA were modified on the surface of AuNPs to form DNA Walker structure.

    [0042] In the presence of AFB.sub.1, aptamer A combined with AFB.sub.1 and dissociated from AuNPs with DNA Walker structure. Subsequently, the W chain was in a single chain state and began to swim on the surface of AuNPs driven by base complementation. The binding of E1 on W chain with E2 on S1 forms the recognition site of endonuclease, which triggers the cleavage of S1 chain by endonuclease and makes DTN dissociate from the surface of AuNPs. W would swim to the next binding site until the DTNs are cut down to complete the first amplification of the signal.

    [0043] The nucleic acid sequence of DTNs is complementary to the partial sequence of hairpin H1, resulting in the opening of hairpin H1. The extended sequence of H1 is complementary to the partial sequence of H2, resulting in the opening of the hairpin structure of H2. These processes lead to chain reaction and further construct hyperbranched nanostructures. Both ends of the hairpin structure H1 are respectively modified with a fluorescent group and a fluorescence quenching group. In the open H1, the fluorescence group and the fluorescence quenching group are separated, so that the fluorescence is restored. With the continuous opening of H1 and H2, the fluorescence signal brought by FAM is also expanding, completing the second signal amplification. AFB.sub.1 was determined by fluorescence intensity.

    [0044] A detection kit for AFB.sub.1, which contains DNA walker structure, endonuclease, hairpin H1 and H2.

    [0045] The DNA walker structure is prepared by the following method:

    [0046] (1) Self-Assembly of DTNs

    [0047] The four ssDNAs were mixed equivalently in buffer (10 mM Tris-HCl, 2.5 mM MgCl2, 100 mM NaCl pH 8.0), and the mixture was heated at 95° C. for 5 min, 45° C. for 30 min. Finally, the assembled DTNs were purified by 3% agarose gel electrophoresis.

    [0048] (2) Hybridization Between W and A

    [0049] The W and A were mixed equivalently, and the mixture was heated at 95° C. for 5 min and then slowly cooled to 25° C.

    [0050] (3) Assembly of DNA Walker Structure

    [0051] Thiol groups of WA and DTNs were reduced by TCEP for 30 min. The activated WA and DTNs were mixed in a molar ratio of 1:4, and then 0.1% AuNPs solution was added to the mixture at 4° C. overnight. Next, 1M sodium chloride solution was added to the above solution every 1 h for a total of 5 times to ensure that the final concentration of sodium chloride is 0.15 M. After each addition of sodium chloride, the solution needs to be sonicated for 10 s. Finally, the uncoupled WA and DTNs are removed by centrifugation to obtain the DNA walker structure.

    [0052] The above sequence is shown in the following table:

    TABLE-US-00001 Name Sequence (5′-3′) Number A GTTGGGCACGTGTTGTCTCTCTGTGTCTCG SEQ ID TGCCCTTCGCTAGGCCC NO: 1 W SH-TTTTTTTTTTTTTTTTTTTTTAGACAA SEQ ID CACGTGCCCAACGGAGAC NO: 2 S1 SH-GTCTCC*GTTTCAAGCGCAGCACTTAC SEQ ID CTGTATCCTTTCCGAGTTACGTCTGTCCCT NO: 3 AGAGTTTTCCTACTTACAAGAGCCGGATAC GC S2 TCAGTCTAGGATTCGGCGTGGGTTTTTGGA SEQ ID TACAGGTAAGTGCTGCGCTTGTTTAATGGA NO: 4 ACTTGAGATGTTAGGGAGTTTTCTTAGCTA GGTGTGATACATTAC S3 TCAGTCTAGGATTCGGCGTGGGTTTTTTAT SEQ ID CACCAGGCAGTTGACAGTGTATTTCTCCCT NO: 5 AACATCTCAAGTTCCATTTTTGCGTATCCG GCTCTTGTAAGTAGG S4 TCAGTCTAGGATTCGGCGTGGGTTTTTTAC SEQ ID ACTGTCAACTGCCTGGTGATATTTACTCTA NO: 6 GGGACAGACGTAACTCGGTTTGTAATGTAT CACACCTAGCTAAGA H1 FAM-GCGTGGGTTGCGCTGATCAAGACTCC SEQ ID ATGAAACCCACGCCGAATCCTAGACTGAGC NO: 7 GCTG-Dabcyl H2 TCATGGAGTCTTGATCAGCGCAACCCACGA SEQ ID CAGCGCTCAGTCTAGGATTCGGCGTGGGTT NO: 8

    [0053] The sequence of single underline in the above table is the complementary sequence of A and W. The double underlined sequences are S2, S3, S4 and the complementary sequences of H1 and H2. The bold sequence represents E1 on the w Chain and E2 on the S1 chain. * is the cleavage site of endonuclease.

    Embodiment 2

    [0054] Method for detecting AFB.sub.1 using the kit of embodiment 1:

    [0055] (1) The sample solution was filtered and diluted 10 times. The 10 μL test sample solution and DNA walker solution were mixed at 37° C. and incubated for 0.5 h. Then the cutting endonuclease Nt.BsmAI was added under 37° C. for 0.5 h. The mixture was kept at 65° C. for 20 min.

    [0056] (2) Adding sodium chloride solution to the solution after reaction in step (1), the AuNPs is precipitated in the salt solution to retain the supernatant.

    [0057] (3) H1 and H2 were added to above solution (2) for the reaction at 37° C. for 15 min. The molar ratio of H1 and H2 was 1:1.

    [0058] (4) The fluorescence intensity of the solution after reaction in step (3) was detected at 490 nm excitation wavelength. The measured fluorescence intensity was introduced into the standard curve.

    Sensitivity of the Kit of Embodiment 1

    [0059] Different concentrations of AFB.sub.1 were used to test the sensitivity of the test kit in embodiment 1 of the present invention by the test method in embodiment 2. The AFB.sub.1 of different concentration gradients were 1, 2, 5, 10, 20, 50, 100, 200, 500 pg/mL. As shown in FIG. 2, the relationship between AFB.sub.1 concentration and fluorescence intensity was y=253.4 ln(x)−67.007, R.sup.2=0.9912. The detection range of embodiment 1 kit was 1-500 pg/mL, and the detection limit was 0.5 pg/mL.

    The Specificity Detection of the Kit of Embodiment 1

    [0060] The specificity of the kit was further checked using other possible interfering mycotoxins, such as aflatoxin M1 (AFM.sub.1), zearalenone (ZEN) and ochratoxin A (OTA). The concentration of each toxin was 100 pg/mL. The specific results are shown in FIG. 3. The value of AFB.sub.1 is significantly higher than that of other mycotoxins. Therefore, the kit of embodiment 1 of the invention has high specificity for AFB.sub.1.

    [0061] The embodiments are only preferred ones of the invention, and are not intended to limit the invention in any form. Any skilled in the art can transform or modify the technical contents disclosed below to obtain equivalent embodiments. Any simple modifications or equivalent transformations to the following embodiments according to the technical essence of the invention without deviating from the contents of the technical solutions of the invention should also fall within the protection scope of the technical solutions of the invention.