COMPOSITION CONTAINING NATURAL EXTRACTS FOR ENHANCEMENT OF INNATE IMMUNITY OR ANTIVIRAL USE AGAINST INFLUENZA VIRUS OR CORONA VIRUS
20220211792 · 2022-07-07
Inventors
Cpc classification
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
International classification
Abstract
Disclosed is a composition containing natural extracts for enhancement of innate immunity or antiviral use against influenza virus (PR8) or corona virus, wherein the composition promotes interferon secretion in the innate defense immune system to induce protection from the antiviral infection and thus can be effectively used for antiviral use.
Claims
1. A method for enhancement of innate immunity, antiviral use, or alleviation, prevention, or treatment of a viral infection, the method comprising: administering to a subject a composition containing a first complex extract of Codonopsis and Rehmannia.
2. The method of claim 1, wherein the first complex extract contains 5.9-8.9 wt % of Codonopsis and 74.1-94.1 wt % of Rehmannia.
3. The method of claim 1, wherein the first complex extract further contains at least one selected from the group consisting of Ginseng and Platycodon.
4. The method of claim 3, wherein the first complex extract contains 5.4-8.2 wt % of Codonopsis, 6.4-9.6 wt % of Ginseng, and 68.2-88.2 wt % of Rehmannia.
5. The method of claim 3, wherein the first complex extract contains 5.0-7.4 wt % of Codonopsis, 62.0-82.0 wt % of Rehmannia, and 13.0-19.6 wt % of Platycodon.
6. The method of claim 3, wherein the first complex extract further contains at least one selected from the group consisting of Poria and Hawthorn fruit.
7. The method of claim 6, wherein the first complex extract contains 4.0-6.0 wt % of Codonopsis, 4.7-7.1 wt % of Ginseng, 50.2-70.2 wt % of Rehmannia, 9.7-14.5 wt % of Poria, 0.9-1.3 wt % of Hawthorn fruit, and 10.6-15.8 wt % of Platycodon.
8. The method of claim 1, wherein the composition exhibits antiviral activity against at least one selected from the group consisting of influenza virus, corona virus, vesicular stomatitis virus, and Newcastle disease virus, and activity to alleviate, prevent, or treat a viral infection caused by the at least one selected from the group.
9. A method for enhancement of innate immunity, antiviral use, or alleviation, prevention, or treatment of a viral infection, the method comprising: administering to a subject a composition containing a second complex extract of two or more selected from the group consisting of Codonopsis, Rehmannia, Ginseng, Platycodon, Poria, Hawthorn fruit, and Astragalus.
10. The method of claim 9, wherein the second complex extract contains 1.25-5.0 wt % of Codonopsis, 12.50-50.0 wt % of Rehmannia, 1.25-5.00 wt % of Ginseng, 6.85-27.0 wt % of Platycodon, 2.50-10.0 wt % of Poria, 0.65-2.50 wt % of Hawthorn fruit, and 25.0-80.0 wt % of Astragalus.
11. The method of claim 9, wherein the second complex extract contains at least one compound selected from the group consisting of chlorogenic acid, ginsenoside Rg1, calycosin, ginsenoside Rb1, ginsenoside Rd, astragaloside II, astragaloside I, and polygalacin D.
12. The method of claim 9, wherein the composition exhibits antiviral activity against at least one selected from the group consisting of influenza virus, corona virus, vesicular stomatitis virus, and Newcastle disease virus, and activity to alleviate, prevent, or treat a viral infection caused by the at least one selected from the group.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
DETAILED DESCRIPTION OF THE EXEMPLARY EMBODIMENTS
[0113] Hereinafter, the present disclosure will be described in more detail by the following examples. However, these examples are used only for illustration, and the scope of the present disclosure is not limited by these examples.
[0114] Throughout the present specification, the “%” used to express the concentration of a specific material, unless otherwise particularly stated, refers to (wt/wt) % for solid/solid, (wt/vol) % for solid/liquid, and (vol/vol) % for liquid/liquid.
[0115] As described above, conventional immunotherapy agents are drugs that suppress the immune response, and the overdose thereof may cause symptoms, such as infectious diseases, allergic responses, itchiness, injection site erythema (including bleeding, bruising, erythema, pain, and swelling), breathing difficulties, and fever, and has a risk of exposure to viral infections due to the decline in immunity or the like resulting from immunoregulatory failure.
[0116] According to the present disclosure, solutions to the above-described problems have been sought by providing a composition for enhancement of innate immunity, antiviral use, or prevention or treatment of a viral infection, the composition containing as an active ingredient a complex extract of two or more selected from the group consisting of Codonopsis, Rehmannia, Ginseng, Platycodon, Poria, Hawthorn fruit, and Astragalus. Such a composition was confirmed to have excellent effects on immunity and viral infection alleviation by promoting the interferon secretion in the innate defense immune system and thus can be greatly helpful in the enhancement of innate immunity, antiviral use, or the prevention, treatment, or alleviation of a viral infection.
Preparative Example 1: Preparation of First Complex Extract 1-1. Preparation of Example 1
[0117] To prepare a first complex extract, raw materials were prepared by 7.4 wt % of Codonopsis and 92.6 wt % Rehmannia, which were previously cut to appropriate sizes, and primary distilled water having 10 times the total weight of the raw materials was added thereto, followed by reflux extraction at 100° C. for 120 minutes. The extracted solution was primarily filtered through a 0.45-um filter bed and secondarily filtered through a 0.22 um-filter bed to remove precipitates, concentrated under reduced pressure at 45-55° C., and then freeze-dried at −80° C. and 5 mTorr to be powdered. The powdered first complex extract was dispensed at 1 g in each 1.5 ml Ep-tube and stored at −20° C., and this was designated as Example 1 and used for testing.
1-2. Preparation of Example 2
[0118] The preparation was carried out in the same manner as in Example 1, except that the raw materials were prepared by 6.8 wt % of Codonopsis, 8.0 wt % of Ginseng, and 85.2 wt % of Rehmannia and the powdered complex extract was designated as Example 2 and used for testing.
1-3. Preparation of Example 3
[0119] The preparation was carried out in the same manner as in Example 1, except that the raw materials were prepared by 6.2 wt % of Codonopsis, 77.5 wt % of Rehmannia, and 16.3 wt % of Platycodon and the powdered complex extract was designated as Example 3 and used for testing.
1-4. Preparation of Example 4
[0120] The preparation was carried out in the same manner as in Example 1, except that the raw materials were prepared by 5.0 wt % of Codonopsis, 5.9 wt % of Ginseng, 62.7 wt % of Rehmannia, 12.1 wt % of Poria, 1.1 wt % of Hawthorn fruit, and 13.2 wt % of Platycodon and the powdered complex extract was designated as Example 4 and used for testing.
Preparative Example 2: Preparation of OCD20015-V009
[0121] OCD20015-V009 was prepared by immersing 2.50 wt % of Codonopsis, 25.00 wt % of Rehmannia, 2.50 wt % of Ginseng, 13.75 wt % of Platycodon, 5.00 wt % of Poria, 1.25 wt % of Hawthorn fruit, and 50.00 wt % of Astragalus (total of 2000 g), all of which were dried, in 10 L of distilled water, followed by hot-water extraction at 115° C. for 3 hours. The resultant extract was filtered through a 150-um sieve and then freeze-dried. The yield of the second complex extract was 14.1% (283.7 g). The extract was stored in desiccators at 4° C. until further use in KM-Application Center herbarium (registration number, #OCD2020-1) of Korea Institute of Oriental Medicine (KIOM).
Test Example 1: Analysis of Antiviral Activity of First Complex Extracts in Mouse Macrophage Line
[0122] The antiviral activity of the first complex extracts on the green fluorescent protein (GFP)-labeled influenza virus (PR8-GFP) was analyzed.
[0123] Specifically, RAW 264.7 cells (macrophages) were seeded at 2×10.sup.5 cells/well in 24-well tissue culture (TC) plates and incubated in RPMI medium supplemented with 1% fetal bovine serum (FBS) for 24 hours. Thereafter, the cells were treated with a sample of each of Examples 1 to 4 prepared in Preparative Example 1 at 200 μg/ml for 18 hours.
[0124] After the sample treatment for 18 hours, the cells were infected with an inoculum containing the influenza virus (A/PR/8/34-GFP) at a multiplicity of infection (MOI) of 1.0 for 2 hours. After 2 hours of infection, the inoculum was removed and the cells were washed three times with phosphate-buffered saline (PBS). The cells were again incubated in RPMI medium for 24 hours, and then the degrees of infection with the inoculated virus were investigated. Thereafter, a fluorescence microscope and flow cytometry capable of confirming GFP expression were used to investigate the inhibition of influenza virus proliferation.
[0125] RPMI medium supplemented with 1% FBS was used as a negative control (vehicle), and a virus-infected medium treated with mouse IFN-β (1,000 units/ml) was used as a positive control (IFN). The results are shown in Table 1.
TABLE-US-00001 TABLE 1 Example Example Example Example CON Vehicle 1 2 3 4 IFN-β PR8- − + + + + + + GFP GFP 0.97 12.74 4.54 3.39 3.64 2.10 1.45
[0126] As can be confirmed in Table 1 and
Test Example 2: Analysis of Innate Immunity Enhancing Activity of First Complex Extracts in Mouse Macrophage Line
[0127] To investigate the innate immunity enhancing activity of the first complex extracts, immune cytokines were measured.
[0128] Specifically, RAW 264.7 cells were incubated at 2×10.sup.5 cells/well in 96-well TC plates, and then were treated with each of the complex extracts prepared in Examples 1 to 4 at 200 μg/ml in RPMI medium supplemented with 1% FBS. After 24 hours of the extract treatment, the supernatant was collected to measure tumor necrosis factor (TNF)-α and interleukin (IL)-6 by using sandwich ELISA. The cells treated with 200 ng/ml lipopolysaccharide (LPS) were used as a positive control.
[0129] After 24 hours of the treatment with the complex extracts of Examples 1 to 4, the immune cytokines were measured, and the results are shown in Table 2.
TABLE-US-00002 TABLE 2 Example Example Example Example CON LPS 1 2 3 4 TNF-α (pg/ml) 0 16,055 10,505 12,333 11,524 13,021 IL-6 (pg/ml) 0 26,002 12,511 13,584 15,511 16,003
[0130] As can be confirmed in Table 2 and
Preparative Example 3: Preparation of Examples 5 to 49
[0131] To investigate the solid contents at the time of extraction, first complex extracts were prepared under different conditions. The raw materials were prepared at the same ratio as in “Preparative Example 1-4” for preparing Example 4, and primary distilled water having 10 times the total weight of the raw materials was added thereto, followed by hot water extraction at 20, 30, 40, 50, 60, 70, 80, 90, and 100° C. for 1, 2, 4, 8, 12, 24, 48, 72, 96, and 120 hours. The extraction solutions were filtered through 1-um filter beds. The extraction conditions for each case are shown in Table 3 below.
TABLE-US-00003 TABLE 3 Temperature (° C.) Time (H) Example 5 40 1 Example 6 40 2 Example 7 40 4 Example 8 40 12 Example 9 40 24 Example 10 40 48 Example 11 40 72 Example 12 40 96 Example 13 40 120 Example 14 60 1 Example 15 60 2 Example 16 60 4 Example 17 60 12 Example 18 60 24 Example 19 60 48 Example 20 60 72 Example 21 60 96 Example 22 60 120 Example 23 80 1 Example 24 80 2 Example 25 80 4 Example 26 80 12 Example 27 80 24 Example 28 80 48 Example 29 80 72 Example 30 80 96 Example 31 80 120 Example 32 100 1 Example 33 100 2 Example 34 100 4 Example 35 100 12 Example 36 100 24 Example 37 100 48 Example 38 100 72 Example 39 100 96 Example 40 100 120 Example 41 120 1 Example 42 120 2 Example 43 120 4 Example 44 120 12 Example 45 120 24 Example 46 120 48 Example 47 120 72 Example 48 120 96 Example 49 120 120
Test Example 3: Setting of Extraction Conditions Through Comparison of Solid Content
[0132] The extracts of Examples 5 to 49 obtained by extraction according to Preparative Example 3 were subjected to solid content measurement and comparison. From each of the extracts, 3-4 g of a sample was taken, and then measured for solid content (%, g/g) at 105° C. by an infrared moisture analyzer model FD-720, and the results are shown in Table 4 below.
TABLE-US-00004 TABLE 4 Solid content (%) Example 5 3.6 Example 6 3.98 Example 7 4.21 Example 8 4.23 Example 9 4.25 Example 10 4.28 Example 11 4.31 Example 12 4.34 Example 13 4.34 Example 14 4.3 Example 15 4.69 Example 16 4.99 Example 17 5.01 Example 18 5.05 Example 19 5.09 Example 20 5.15 Example 21 5.19 Example 22 5.19 Example 23 4.41 Example 24 4.78 Example 25 5.09 Example 26 5.09 Example 27 5.12 Example 28 5.21 Example 29 5.27 Example 30 5.3 Example 31 5.3 Example 32 4.44 Example 33 4.81 Example 34 5.1 Example 35 5.11 Example 36 5.14 Example 37 5.24 Example 38 5.33 Example 39 5.39 Example 40 5.39 Example 41 4.45 Example 42 4.8 Example 43 5.11 Example 44 5.11 Example 45 5.15 Example 46 5.24 Example 47 5.34 Example 48 5.39 Example 49 5.39
[0133] As can be confirmed in Table 4 and
[0134] Considering the solid content according to the extraction temperature and extraction time, the extraction conditions of at least 60° C. and at least four hours are needed. To further increase the solid content, the extraction temperature needs to be increased to 100° C. and the extraction time needs to be increased to 96 hours, but no solid content change was confirmed under higher temperature and more time conditions.
[0135] It is therefore considered that the extraction temperature and extraction time may be set within appropriate conditions in consideration of consumption costs in the mass production process stage.
Test Example 4: Cytotoxicity of OCD20015-V009
[0136] RAW 264.7 (murine macrophage) and Madin-Darby canine kidney (MDCK, NBL-2) cells (American Type Culture Collection) were incubated in a medium (DMEM; Lonza, USA) containing 10% fetal bovine serum (FBS; Biotechnics Research, USA) and 1% penicillin and streptomycin (Cellgro, USA) at 37° C. in a 5% CO.sub.2 incubator, and then used.
[0137] The cytotoxicity was determined using MTT assay. The RAW 264.7 and MDCK cells were seeded 1×10.sup.5 cells/well into 24-well plates, and OCD20015-V009 was added to each of the wells at a concentration of 0-400 μg/ml. MTT solutions were added to each well 24 h after the addition, and the cells were incubated for another 30 min. Subsequently, 1 mL of DMSO was added, and the absorbance at 540 nm was measured using an Epoch microplate reader (BioTek, USA).
[0138] As can be confirmed in
Test Example 5: IAV Infection Inhibitory Effect of OCD20015-V009
[0139] The viral replication inhibition of OCD20015-V009 was assayed using Influenza A (A/Puerto Rico/8/34; A/PR/8/34) from American Type Culture Collection (ATCC, VR-95™) and GFP-tagged A/PR/8/34 virus (A/PR/8/34-GFP). A/PR/8/34-GFP was briefly constructed by fusing the GFP gene to the C-terminal end of the nonstructural protein 1 open reading frame.
[0140] Specifically, RAW 264.7 cells were seeded 1×10.sup.5 cells/well into 24-well plates, and incubated for 18 hours in DMEM alone (for the untreated or virus-only group (Vehicle)), DMEM containing 1,000 U of recombinant mouse interferon (IFN-β (Sigma-Aldrich, USA), a positive control), or DMEM containing 50 and 100 μg/ml OCD20015-V009 in each well. The cells were then infected with A/PR/8/34-GFP at a multiplicity of infection (MOI) of 10. The GFP levels were measured 24-hour post-infection (hpi) at 200× magnification under a fluorescence microscope (Nikon, Japan). Thereafter, the cells were harvested using trypsinization, followed by fluorescence detection using flow cytometry (CytoFLEX, Beckman, USA).
[0141] The antiviral activity of OCD20015-V009 was examined by detecting GFP levels in RAW 264.7 cells after the suppression of A/PR/8/34-GFP replication.
[0142] As can be confirmed in
[0143] As can be confirmed in
[0144] For plaque analysis, Raw 264.7 cells were incubated in 24-well plates (1×10.sup.5 cells/ml) for 24 hours. Then, various concentrations of OCD2015-V009 were added and incubated at 37° C. for 18 hours. Following the reaction, the cells were infected with IAV, washed with phosphate-buffered saline (PBS), and then DMEM was added to the medium for 24 hours. Then, MDCK cells were infected for 2 hours with the Raw 264.7 cell culture supernatant containing viruses. Thereafter, MDCK monolayers were coated with 1.5% agarose in 2× complete DMEM and incubated with 5% CO.sub.2 at 37° C. for 3 days. The cells were stained with a 1% crystal violet solution following incubation or infection, and plaques were counted.
[0145] As can be confirmed in
[0146] Immunofluorescence (IF) staining was performed to validate the production of IAV proteins.
[0147] Specifically, RAW 264.7 cells seeded onto cover slides at 1×10.sup.5 cells/ml were incubated at 37° C. with 5% CO.sub.2 for 24 hours. The RAW 264.7 cells were pre-treated with 25, 50, or 100 μg/ml OCD20015-V009, 1000 U/mL recombinant mouse interferon (IFN)-β, or only the medium (negative control) before viral adsorption. The cells were then incubated at 37° C. with 5% CO.sub.2 for 18 hours, and then infected with A/PuertoRico/8/34 at the MOI of 10 for 2 hours.
[0148] After viral infection, the virus and medium were removed, and the cells were washed three times with phosphate-buffered saline (PBS). Then, a complete medium was added, and the cells were incubated at 37° C. with 5% CO.sub.2. After 24 hours, the cells were washed with cold PBS, fixed with 4% paraformaldehyde at room temperature for 30 minutes, and permeabilized with 0.1% Triton-X100 in PBS for 15 minutes.
[0149] After blocking, the cells were incubated with a rabbit polyclonal antibody against M2 (1:250 in 3% BSA (Sigma-Aldrich); GeneTex, USA) at 4° C. overnight, washed three times with cold PBS, and incubated with an Alexa Fluor 568 goat anti-rabbit IgG antibody (1:500 in 3% BSA; Thermo Fisher) for 1 hour. The nuclei were visualized by staining with DAPI (0.5 μg/ml; Thermo Fisher) for 10 min. Then, the images were captured using a fluorescence microscope (Nikon).
[0150] The reduction of M2 in RAW 264.7 cells was observed by fluorescence microscopy using an M2-specific antibody. RAW 264.7 cells were stained with DAPI (blue), and the merged images represent M2 (red).
[0151] As can be confirmed in
[0152] To validate the production of IAV proteins, the levels of influenza A virus proteins HA, PA, and NP in cell lysates were analyzed by Western blots.
[0153] Specifically, the RAW 264.7 cells seeded in 6-well plates at 1×10.sup.6 cells/well were incubated with OCD20015-V009 and LPS at 37° C. with 5% CO.sub.2. Thereafter, the cells were harvested and lysed in RIPA buffer (Millipore, USA) containing protease and phosphatase inhibitors. The total protein content in the samples was normalized using Bradford's reagents. The proteins were separated using SDS-PAGE and transferred to a polyvinylidene fluoride membrane (Millipore). After blocking with 3% BSA, the blots were incubated with primary anti-STAT1, anti-TBK1, anti-phospho-STAT1, anti-phospho-TBK1 (Cell Signaling Technology, USA), anti-β-actin, M1, NA, NP, and PA antibodies (GeneTex, USA, 1:1,000 dilution) at 4° C. overnight. The level of tubulin was used as an internal control.
[0154] After the blots were washed three times in TBS-T, the blots were incubated with an HRP-conjugated secondary antibody (Cell Signaling Technology). The proteins were quantified using a ChemiDoc™ Touch Imaging System (Bio-Rad), and the relative intensities of protein bands were measured using ImageJ and quantified using the ImageJ software.
[0155] As can be confirmed in
[0156] These data imply that OCD20015-V009 pre-treatment significantly inhibits IAV infection and viral protein production in RAW 264.7 cells. Therefore, OCD20015-V009 pre-treatment likely reduces influenza H1N1 viral protein production and inhibits infection.
Test Example 6: IAV Infection Inhibition In Vivo by OCD20015-V009
[0157] The protective effects of OCD20015-V009 on IAV infection in BALB/c mice were investigated.
[0158] Five-week-old female BALB/c mice (Orient Bio Inc., Seongnam, South Korea) were acclimated for at least 1 week under standard housing conditions at the LAC of DGMIF and provided with a standard rodent chow diet and water ad libitum. For the oral inoculation of OCD20015-V009 and the IAV challenge, the mice were separated into four experimental groups of ten mice in each group and administered control, PBS, 100 or 300 mg/kg OCD20015-V009 with IAV, respectively. The group of mice without virus infection was used as a negative control.
[0159] The mice in each experimental group were orally administered PBS, 100 and 300 mg/kg OCD20015-V009 at a total volume of 200 μL once daily for 7 days before infection, respectively. The mice were infected intranasally with 20 μL of A/PR/8/34 in PBS at the 50% mouse lethal dose (LD50). The mice treated once daily with 100 or 300 mg/kg OCD20015-V009 maintained a relatively stable body weight with no significant clinical symptoms in this study.
[0160] As can be confirmed in
[0161] Survival was monitored for 10 days (dpi) at fixed time points. At 7 dpi, three mice from each group were randomly selected and sacrificed to measure lung histopathology. Sampling was conducted at 7 dpi for staining to investigate histopathological changes caused by viral infection in the lung tissue samples cut from the untreated mice or the OCD20015-V009 pre-treated mice.
[0162] Specifically, the lung tissue samples were immediately fixed in paraffin-embedded neutral buffer containing 10% formalin and sliced to 4- to 6-μm sections using a microtome. The sections were mounted on a slide, stained with hematoxylin and eosin, and then examined under an optical microscope. The remaining mice were used to measure survival at 10 dpi.
[0163] As can be confirmed in
Test Example 7: Effects of OCD20015-V009 on Pro-Inflammatory Cytokine Production and Type I IFN Signaling Pathway Activation
[0164] Pro-inflammatory cytokines and type I IFN in pathway activation in RAW 264.7 murine macrophages are important in inducing immunoregulatory activities and antiviral responses. The immunoregulatory effects of herbal medicines for the treatment of IAV infection have been widely studied. Additionally, innate immune responses through the production of pro-inflammatory cytokines and type I IFN may be responsible for the antiviral action of OCD20015-V009. The effects of OCD20015-V009 on TNF-α and IL-6 secretion were evaluated using ELISA.
[0165] RAW 264.7 cells were seeded and incubated for 18 hours. The cells were treated with 200 ng/ml LPS or OCD20015-V009 at 50 or 100 μg/ml at 37° C. for 6 or 24 hours. The supernatant from each treatment group was harvested at 6 or 24 hours and centrifuged at 15,000 g for 10 minutes at 4° C. The clarified supernatants were dispensed into the enzyme-linked immunosorbent assay plates coated with the captured antibody of murine interleukin (IL)-6 or tumor necrosis factor (TNF)-α to measure cytokine secretion. The levels of the inflammatory cytokines TNF-α and IL-6 in the culture were measured using the ELISA antibody set (#88-7324-77 and #88-7064-77, eBioscience, USA).
[0166] As can be confirmed in
[0167] In addition, the Western blots were used to investigate the TBK1 and STAT1 phosphorylation in RAW 264.7 cells pre-treated with OCD20015-V009 to determine the effects of OCD20015-V009 on the activation of type I IFN signaling molecules. Western blotting of whole-cell lysates of macrophages treated with vehicle alone, 200 ng/ml LPS, or 200 μg/ml OCD20015-V009 was performed to assess the levels of the non-phosphorylated and phosphorylated forms of TANK-binding kinase 1 (TBK1), STAT1, and β-actin over time.
[0168] As can be confirmed in
[0169] The interaction between OCD20015-V009 and IFN-stimulated genes in RAW 264.7 cells was further analyzed. The cells were treated with the vehicle alone (Con), 200 ng/ml lipopolysaccharides (LPS), or 50 or 100 μg/ml OCD20015-V009 and then incubated at 37° C. with 5% CO.sub.2. The time-dependent changes in the mRNA levels of ISG-15, 20, and 56, TNF-α, and IFN-β genes in RAW 264.7 cells after OCD20015-V009 treatment were examined.
[0170] Total RNA extraction and cDNA synthesis were conducted using the Easy-BLUE™ RNA extraction kits (iNtRON Biotech) and AccuPower® CycleScript RT PreMix (Bioneer), respectively. A total of 1 μg RNA was reverse-transcribed into cDNA, and qPCR oligonucleotide primers for macrophage cell cDNA are shown in Table 5.
TABLE-US-00005 TABLE 5 SEQ ID NO Name Sequence 1 GAPDH Forward TGACCACAGTCCATGCCATC 2 Reverse GACGGACACATTGGGGGTAG 3 ISG-15 Forward CAATGGCCTGGGACCTAAA 4 Reverse CTTCTTCAGTTCTGACACCGTCAT 5 ISG-20 Forward AGAGATCACGGACTACAGAA 6 Reverse TCTGTGGACGTGTCATAGAT 7 ISG-56 Forward AGAGAACAGCTACCACCTTT 8 Reverse TGGACCTGCTCTGAGATTCT 9 TNF-α Forward AGCAAACCACCAAGTGGAGGA 10 Reverse GCTGGCACCACTAGTTGGTTGT 11 IFN-β Forward TCCAAGAAAGGACGAACATTCG 12 Reverse TGCGGACATCTCCCACGTCAA
[0171] 10 μL of the AccuPower® 2× Greenstar qPCR master mix, 5 μL of template DNA, and 3 μL of RNase-free water. The PCR cycle was as follows: 95° C. for 10 min, 95° C. for 20 s, 60° C. (ISG-15), 53° C. (ISG-20), 60° C. (IFN-β), 56° C. (ISG-56), or 60° C. (TNF-α) for 40 s, and at each experiment end, a melting curve analysis was conducted to confirm that a single product per primer pair was amplified.
[0172] Amplification and analysis were performed using the QuantStudio 6 Flex Real-time PCR System (Thermo Fisher), and each sample was compared using the relative CT method. Fold changes in gene expression were determined relative to the blank control after normalization to GAPDH expression using the 2-ΔΔCt method.
[0173] As can be confirmed in
[0174] The transcription of the ISG-15, ISG-20, and ISG-56 genes increased by 132.9±5.2, 114.2±6.7, and 98.1±7.5-fold, respectively, in the cells pre-treated with 100 μg/ml OCD20015-V009 for 6 hours. Overall, the results indicate that OCD20015-V009 can induce an antiviral state by modulating the IFN signaling pathway and ISG expression in macrophages, thus inhibiting viral infections.
Test Example 8: Chemical Composition of OCD20015-V0009 by UPLC-MS/MS Analysis
[0175] The components of OCD20015-V009 were identified by analyzing water extracts of each of the traditionally used herbs. The UPLC-MS/MS analysis, which compared the retention time and mass fragmentation of the water extract with the authenticated standards, was performed.
[0176] A Dionex UltiMate 3000 system equipped with a Thermo Q-Exactive mass spectrometer (UHPLC-MS/MS, Thermo Fisher Scientific, USA) was used for the phytochemical analysis of OCD20015-V009. Data acquisition and processing were performed using Xcalibur v.3.0 and Tracefinder v.4.0.
[0177] Chromatographic separation was achieved with an Acquity BEH C18 column (100 mm×2.1 mm, 1.7 μm, Waters, USA), and the gradient elution consisting of 0.1% formic acid in water and acetonitrile was used. The identified compounds were compared with the retention time and mass spectrum of the authenticated standards. For the constituents that did not match the standards, corresponding m/z and the MS fragment information was found in previous reports. (* standard retention time (Rt) and mass spectrum data comparison)
TABLE-US-00006 TABLE 6 MS/MS Rt Calculated Estimated Error Fragments No (Min) (m/z) (m/z) Adducts (ppm) Formula (m/z) Identifications 1 1.92 407.120 407.118 [M + COOH].sup.− −3.13 C.sub.15H.sub.22O.sub.10 199, 166 Catalpol* 2 4.51 393.140 393.139 [M + COOH].sup.− −2.64 C.sub.15H.sub.24O.sub.9 347, 149, 127 Ajugol* 3 4.73 375.130 375.129 [M − H].sup.− −2.44 C.sub.16H.sub.24O.sub.10 213, 169, 113 Loganic acid* 4 5.14 353.088 353.087 [M − H].sup.− −2.62 C.sub.16H.sub.18O.sub.9 191 Chlorogenic Acid* 5 5.63 289.072 289.071 [M − H].sup.− −2.47 C.sub.15H.sub.14O.sub.6 289, 245, 205 Epicatechin* 6 6.64 447.129 447.127 [M + H].sup.+ −3.96 C.sub.22H.sub.22O.sub.10 283, 268 Calycosin-7-glucoside* 7 6.66 463.088 463.087 [M − H].sup.− −2.51 C.sub.21H.sub.20O.sub.12 301 Isoguercitrin* 8 7.98 827.444 827.441 [M − H].sup.− −2.92 C.sub.42H.sub.68O.sub.16 — Platy saponin A 9 8.80 991.548 991.546 [M + COOH].sup.− −2.63 C.sub.48H.sub.82O.sub.18 946, 475, 161 Ginsenoside Re* 10 8.80 845.490 845.488 [M + COOH].sup.− −2.66 C.sub.42H.sub.72O.sub.14 161, 101 Ginsenoside Rg*1 11 9.58 283.061 283.060 [M − H].sup.− −3.17 C.sub.16H.sub.12O.sub.5 268 Calycosin* 12 9.94 1385.623 1385.618 [M − H].sup.− −3.80 C.sub.63H.sub.102O.sub.33 843, 469 Platycodin D2* 13 10.03 1223.570 1223.566 [M − H].sup.− −3.82 C.sub.57H.sub.92O.sub.28 681, 541, 469 Platycodin D* 14 11.33 845.490 845.488 [M + COOH].sup.− −3.02 C.sub.42H.sub.72O.sub.14 799, 637 Ginsenoside Rf* 15 11.55 1153.601 1153.598 [M + COOH].sup.− −3.13 C.sub.54H.sub.92O.sub.23 1107, 945 Ginsenoside Rbl* 16 11.69 815.480 815.477 [M + COOH].sup.− −2.97 C.sub.41H.sub.70O.sub.13 637, 161 Notoginsenoside R2* 17 11.88 1123.591 1123.586 [M + COOH].sup.− −3.70 C.sub.53H.sub.90O.sub.22 1077, 945 Ginsenoside Rc* 18 12.10 955.491 955.487 [M − H].sup.− −3.59 C.sub.48H.sub.76O.sub.19 955, 793, 523 GinsenosideRo* 19 12.38 267.066 267.065 [M − H].sup.− −3.53 C.sub.16H.sub.12O.sub.4 252 Formononetin* 20 12.97 991.548 991.546 [M + COOH].sup.− −2.75 C.sub.48H.sub.82O.sub.18 621 Ginsenoside Rd* 21 13.71 871.470 871.467 [M + COOH].sup.− −2.81 C.sub.43H.sub.70O.sub.15 — Astragaloside II 22 14.36 871.470 871.467 [M + COOH].sup.− −3.02 C.sub.43H.sub.70O.sub.15 — Isoastragalosides II 23 14.96 871.470 871.467 [M + COOH].sup.− −3.16 C.sub.43H.sub.70O.sub.15 — Astragaloside II isomer 24 15.60 913.480 913.478 [M + COOH].sup.− −2.96 C.sub.45H.sub.72O.sub.16 — Astragaloside I 25 16.11 497.327 497.326 [M − H].sup.− −2.72 C.sub.31H.sub.46O.sub.5 419, 405, 403 6α-Hydroxypolyporenic acid C* 26 16.20 913.480 913.477 [M + COOH].sup.− −3.09 C.sub.45H.sub.72O.sub.16 — Isoastragaloside I 27 16.55 767.494 767.490 [M + H].sup.+ −4.67 C.sub.42H.sub.70O.sub.12 443, 425, 407 Ginsenoside Rg5* 28 16.84 913.480 913.477 [M + COOH].sup.− −3.16 C.sub.45H.sub.72O.sub.16 — Astragaloside I isomer 29 18.19 483.348 483.346 [M − H].sup.− −3.32 C.sub.31H.sub.48O.sub.4 437, 423, 405, 389 Dehydrotumulosic acid* 30 18.33 811.485 811.482 [M + COOH].sup.− −3.17 C.sub.42H.sub.70O.sub.12 765, 603 Ginsenoside Rk2* 31 18.57 497.327 497.326 [M − H].sup.− −3.03 C.sub.31H.sub.46O.sub.5 423, 379, 211 Poricoic acid A* 32 18.94 481.332 481.331 [M − H].sup.− −3.22 C.sub.31H.sub.46O.sub.4 435, 421, 311 Polyporenic acid C* 33 19.22 483.348 483.346 [M − H].sup.− −3.20 C.sub.31H.sub.48O.sub.4 437, 423, 337 3-Epidehydrotumulosic acid* 34 20.31 525.359 525.357 [M − H].sup.− −3.08 C.sub.33H.sub.50O.sub.5 465, 355 Dehydropachymic acid* 35 20.54 527.374 527.373 [M − H].sup.− −2.88 C.sub.33H.sub.52O.sub.5 527, 405 Pachymic acid*
[0178] As can be confirmed in Table 6 and
[0179] The antiviral effect of OCD20015-V009 on IAV may be attributed to the effects of these compounds. Next to the viral replication inhibitory effects of the components identified in OCD20015-V009, it was investigated whether eight major compounds of OCD20015-V009, that is, chlorogenic acid, ginsenoside Rg1, calycosin, ginsenoside Rb1, ginsenoside Rd, astragaloside II, astragaloside I, and polygalacin D, inhibited the influenza virus replication in RAW 264.7 cells by suppressing the production of the viral proteins.
[0180] Specifically, 12 hours after the treatment with RAW 264.7 cells alone, 10 μM eight types of compounds derived from OCD20015-V009, or 1000 U/mL recombinant mouse interferon-β, RAW 264.7 cells were infected with GFP-expressing influenza virus A/PR/8/34-GFP at the multiplicity of infection of 10 μM, and 24 hours after viral infection, the GFP levels and reduction in viral replication were analyzed through the images obtained using flow cytometry.
[0181] As can be confirmed in
[0182] The levels of the IAV proteins in RAW 264.7 cells as assayed by Western blots were analyzed using antibodies against various IAV proteins. RAW 264.7 cells were pre-treated with 10 and 20 μM chlorogenic acid or ginsenoside Rd, 1000 U/mL recombinant mouse interferon (IFN)-β, or the medium only (negative control) after viral adsorption.
[0183] Specifically, the levels of IAV proteins PA, PB1, PB2, and NA in the cell lysates were analyzed with Western blots, and the level of tubulin was used as an internal control. Western blotting of viral expressions was performed and data were quantified using the ImageJ software.
[0184] As can be confirmed in