ACTIVATABLE FUSION PROTEIN AND USE THEREOF

20220251169 · 2022-08-11

Assignee

Inventors

Cpc classification

International classification

Abstract

Disclosed herein is an activatable fusion protein that includes, in an N- to C-terminal direction, an albumin, a matrix metalloproteinase-cleavable linker, and an immunoadhesin which includes a cytotoxic T lymphocyte-associated antigen-4 (CTLA4) having an N-terminal extracellular domain and an IgG Fc region, wherein the albumin is released from the activatable fusion protein in the presence of a matrix metalloproteinase that cleaves the cleavable linker, so that the N-terminal extracellular domain of the CTLA4 binds to CD80 or CD86. Also disclosed herein is use of the activatable fusion protein for suppressing a T cell-dependent immune response.

Claims

1. An activatable fusion protein comprising, in an N- to C-terminal direction: an albumin; a matrix metalloproteinase-cleavable linker; and an immunoadhesin which includes a cytotoxic T lymphocyte-associated antigen 4 (CTLA4) having an N-terminal extracellular domain and an IgG Fc region; wherein the albumin is released from the activatable fusion protein in the presence of a matrix metalloproteinase that cleaves the matrix metalloproteinase-cleavable linker, so that the N-terminal extracellular domain of the CTLA4 binds to cluster of differentiation 80 (CD80) or cluster of differentiation 86 (CD86).

2. The activatable fusion protein according to claim 1, wherein the albumin comprises an amino acid sequence that has at least 90% sequence identity to an amino acid sequence of SEQ ID NO: 2.

3. The activatable fusion protein according to claim 1, wherein the matrix metalloproteinase is selected from the group consisting of matrix metalloproteinase 2, matrix metalloproteinase 3, matrix metalloproteinase 9, matrix metalloproteinase 13, and combinations thereof.

4. The activatable fusion protein according to claim 1, wherein the matrix metalloproteinase-cleavable linker has an amino acid sequence of CPPCPAPELLGGPA.

5. The activatable fusion protein according to claim 1, wherein the N-terminal extracellular domain comprises an amino acid sequence that has at least 90% sequence identity to an amino acid sequence of SEQ ID NO: 17.

6. A method for suppressing a T cell-dependent immune response, comprising administering to a subject in need thereof an activatable fusion protein as claimed in claim 1.

7. The method according to claim 6, wherein the activatable fusion protein is in a dosage form for parenteral administration.

8. The method according to claim 6, wherein the activatable fusion protein is in a dosage form for oral administration.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0015] The above and other objects, features and advantages of the present disclosure will become apparent with reference to the following detailed description and the exemplary embodiments taken in conjunction with the accompanying drawings, in which:

[0016] FIG. 1 shows the construct of a plasmid pLNCX-10D1.3, in which: Neo.sup.r represents a neomycin-resistance gene; SfiI and ClaI represent the restriction sites for the corresponding restriction enzymes; Igk represents a coding sequence of Igk secretion signal peptide; and 10D1.3 represents a coding sequence of antibody 10D1.3;

[0017] FIG. 2 shows the construct of a recombinant plasmid pLNCX-ALB-linker-CTLA4-Ig, in which Neo.sup.r represents a neomycin-resistance gene; SfiI, ClaI, and HindIII represent the restriction sites for the corresponding restriction enzymes; ALB represents a coding sequence of albumin; linker represents a coding sequence of a matrix metalloproteinase-cleavable linker; CTLA4-Ig represents a coding sequence of a CTLA4-Ig immunoadhesin; and 6×His represents hexahistidine tag;

[0018] FIG. 3 is a Western blot showing expression of a fusion protein ALB-linker-CTLA4-Ig from the 293T cells transfected with the recombinant plasmid pLNCX-ALB-linker-CTLA4-Ig; and

[0019] FIG. 4 shows the interleukin-2 (IL-2) level of each group described in section D of Example 3, infra.

DETAILED DESCRIPTION

[0020] It is to be understood that, if any prior art publication is referred to herein, such reference does not constitute an admission that the publication forms a part of the common general knowledge in the art, in Taiwan or any other country.

[0021] For the purpose of this specification, it will be clearly understood that the word “comprising” means “including but not limited to”, and that the word “comprises” has a corresponding meaning.

[0022] Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which the present disclosure belongs. One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present disclosure. Indeed, the present disclosure is in no way limited to the methods and materials described.

[0023] The terms “nucleic acid”, “nucleic acid sequence”, and “nucleic acid fragment” as used herein refer to a deoxyribonucleotide or ribonucleotide sequence in single-stranded or double-stranded form, and comprise naturally occurring nucleotides or artificial chemical mimics. The term “nucleic acid” as used herein is interchangeable with the terms “gene”, “cDNA”, “mRNA”, “oligo-nucleotide”, and “polynucleotide” in use.

[0024] As used herein, the term “DNA fragment” refers to a DNA polymer, in the form of a separate segment or as a component of a larger DNA construct, which has been derived either from isolated DNA or synthesized chemically or enzymatically such as by methods disclosed elsewhere.

[0025] Unless otherwise indicated, a nucleic acid sequence, in addition to the specific sequences described herein, also covers its complementary sequence, and the conservative analogs, related naturally occurring structural variants and/or synthetic non-naturally occurring analogs thereof.

[0026] Unless denoted otherwise, whenever a nucleic acid sequence is represented, it will be understood that the nucleotides are in 5′ to 3′ order from left to right and that “A” denotes deoxyadenosine or an analog thereof, “C” denotes deoxycytidine or an analog thereof, “G” denotes deoxyguanosine or an analog thereof, and “T” denotes deoxythymidine or an analog thereof.

[0027] The term “3′” refers to a region or position in a polynucleotide or oligonucleotide 3′ (i.e., downstream) from another region or position in the same polynucleotide or oligonucleotide. The term “5′” refers to a region or position in a polynucleotide or oligonucleotide 5′ (i.e., upstream) from another region or position in the same polynucleotide or oligonucleotide. The terms “3′-end” and “3′-terminus”, as used herein in reference to a nucleic acid molecule, refer to the end of the nucleic acid which contains a free hydroxyl group attached to the 3′ carbon of the terminal pentose sugar. The terms “5′-end” and “5′-terminus”, as used herein in reference to a nucleic acid molecule, refer to the end of the nucleic acid molecule which contains a free hydroxyl or phosphate group attached to the 5′ carbon of the terminal pentose sugar.

[0028] As used herein, the term “transformation” can be used interchangeably with the term “transfection” when such term is used to refer to the introduction of an exogenous nucleic acid molecule into a selected host cell. According to techniques known in the art, a nucleic acid molecule (e.g., a recombinant DNA construct or a recombinant vector) can be introduced into a selected host cell by various techniques, such as calcium phosphate- or calcium chloride-mediated transfection, electroporation, microinjection, particle bombardment, liposome-mediated transfection, transfection using bacterial bacteriaphages, transduction using retroviruses or other viruses (such as vaccinia virus or baculovirus of insect cells), protoplast fusion, Agrobacterium-mediated transformation, or other methods.

[0029] The terms “cell”, “host cell”, “transformed host cell”, and “recombinant host cell” as used herein can be interchangeably used, and not only refer to specific individual cells but also include sub-cultured offsprings or potential offsprings thereof. Sub-cultured offsprings formed in subsequent generations may include specific genetic modifications due to mutation or environmental influences and, therefore, may factually not be fully identical to the parent cells from which the sub-cultured offsprings were derived. However, sub-cultured cells still fall within the coverage of the terms used herein.

[0030] The terms “polypeptide”, “peptide”, and “protein” as used herein can be interchangeably used, and refer to a polymer formed of amino acid residues, wherein one or more amino acid residues are naturally occurring amino acids or artificial chemical mimics.

[0031] As used herein, the term “activatable” means that a protein exhibits a first level of binding to a binding partner when in a native or non-activated state (i.e., a first conformation), and a second level of binding to a binding partner in an activated state (i.e., a second conformation), wherein the second level of binding is greater than the first level of binding. In general, access of a binding partner to the functional protein is greater in the presence of an enzyme capable of activating the activatable linker than in the absence of such enzyme. Therefore, in the non-activated or uncleaved state, the protein is masked from target binding (i.e., the first conformation is such that the peptide mask inhibits access of the binding partner to the protein), and in the activated or cleaved state, the protein is unmasked to the binding partner.

[0032] As used herein, the term “immunoadhesin” can be used interchangeably with the terms “Fc fusion”, “Ig fusion”, “receptor Fc fusion”, “Ig chimera”, and “receptor globulin”, and refer to a protein wherein one or more polypeptides is operably linked to a Fc region. An immunoadhesin combines the Fc region of an immunoglobulin with a fusion partner, which in general can be any protein or small molecule that has specificity for a target protein. Thus, immunoadhesins have two principal portions (i.e., a target binding portion and a Fc portion). The target binding portion may have specificity for virtually any target or target antigen. The Fc portion may bind to one or more Fc receptors or Fc ligands. Fusion partners may be linked to any region of a Fc region, including at the N- or C-terminus, or at some residue in-between the terminus. While virtually any protein or small molecule may be linked to Fc to generate a Fc fusion, and thus target virtually any target, immunoadhesins of the present disclosure comprise a cytotoxic T lymphocyte-associated antigen 4 (CTLA4) or a variant of CTLA4 as a fusion partner. The fusion of CTLA4 with an Ig Fc region is referred to herein as a CTLA4-Ig or CTLA4-Ig protein.

[0033] The present disclosure provides an activatable fusion protein including, in an N- to C-terminal direction:

[0034] an albumin;

[0035] a matrix metalloproteinase-cleavable linker; and

[0036] an immunoadhesin which includes a CTLA4 having an N-terminal extracellular domain and an IgG Fc region;

[0037] wherein the albumin is released from the activatable fusion protein in the presence of a matrix metalloproteinase that cleaves the matrix metalloproteinase-cleavable linker, so that the N-terminal extracellular domain of the CTLA4 binds to cluster of differentiation 80 (CD80) or cluster of differentiation 86 (CD86).

[0038] According to the present disclosure, the albumin includes an amino acid sequence that has at least 90% sequence identity to an amino acid sequence of SEQ ID NO: 2.

[0039] According to the present disclosure, the IgG Fc region may be selected from the group consisting of an IgG1 Fc region, an IgG2 Fc region, an IgG3 Fc region, an IgG4 Fc region, and combinations thereof.

[0040] According to the present disclosure, the matrix metalloproteinase is selected from the group consisting of matrix metalloproteinase 2, matrix metalloproteinase 3, matrix metalloproteinase 9, matrix metalloproteinase 13, and combinations thereof.

[0041] According to the present disclosure, the matrix metalloproteinase-cleavable linker has an amino acid sequence of CPPCPAPELLGGPA.

[0042] According to the present disclosure, the N-terminal extracellular domain includes an amino acid sequence that has at least 90% sequence identity to an amino acid sequence of SEQ ID NO: 17.

[0043] The present disclosure also provides a method for suppressing a T cell-dependent immune response, which includes administering to a subject in need thereof an activatable fusion protein as described above.

[0044] As used herein, the term “administration” or “administering” means introducing, providing or delivering a pre-determined active ingredient to a subject by any suitable routes to perform its intended function.

[0045] As used herein, the term “subject” refers to any animal of interest, such as humans, monkeys, cows, sheep, horses, pigs, goats, dogs, cats, mice, and rats. In certain embodiments, the subject is a human.

[0046] According to the present disclosure, examples of the T cell-dependent immune response include, but are not limited to, autoimmune diseases (such as multiple sclerosis, rheumatoid arthritis, type 1 diabetes (T1D), myasthenia gravis, systemic lupus erythematosus, autoimmune hemolytic anemia, ulcerative colitis, Crohn's disease, and Sjögren's syndrome), graft rejection, graft versus host diseases (GVHD), allergic diseases (such as contact hypersensitivity, allergic rhinitis, food allergy, and asthma), T cell lymphoma, and benign lymphocytic angiitis.

[0047] According to the present disclosure, the activatable fusion protein may be prepared into a pharmaceutical composition in a dosage form suitable for, e.g., parenteral or oral administration, using technology well known to those skilled in the art. The suitable dosage form includes, but is not limited to, injections (e.g., sterile aqueous solutions or dispersions), sterile powder, tablets, troches, lozenges, capsules, dispersible powder, granule, solutions, suspensions, emulsions, syrup, elixirs, slurry, and the like.

[0048] According to the present disclosure, the pharmaceutical composition may be administered by parenteral routes selected from the group consisting of intraperitoneal injection, intrapleural injection, intramuscular injection, intravenous injection, intraarterial injection, intraarticular injection, intrasynovial injection, intrathecal injection, intracranial injection and sublingual administration.

[0049] The pharmaceutical composition may further include a pharmaceutically acceptable carrier widely employed in the art of drug-manufacturing. For instance, the pharmaceutically acceptable carrier may include one or more of the following agents: solvents, buffers, emulsifiers, suspending agents, decomposers, disintegrating agents, dispersing agents, binding agents, excipients, stabilizing agents, chelating agents, diluents, gelling agents, preservatives, fillers, wetting agents, lubricants, absorption delaying agents, liposomes, and the like. The choice and amount of the aforesaid agents are within the expertise and routine skills of those skilled in the art.

[0050] The dosage and the frequency of administration of the pharmaceutical composition may vary depending on the following factors: the severity of the disease to be treated, the route of administration, and the weight, age, physical condition and response of the subject to be treated. The daily dosage of the pharmaceutical composition may be administered in a single dose or in several doses.

[0051] The disclosure will be further described by way of the following examples. However, it should be understood that the following examples are solely intended for the purpose of illustration and should not be construed as limiting the disclosure in practice.

EXAMPLES

General Experimental Materials:

[0052] 1. The following experimental materials were purchased from New England Biolabs, Inc.: restriction enzyme SfiI (Cat. No. R0123S), restriction enzyme ClaI (Cat. No. R0197S), restriction enzyme HindIII (Cat. No. R3104S), Phusion® High-Fidelity DNA polymerase (Cat. No. M0530S), and Quick Ligation™ Kit (Cat. No. M2200S). [0053] 2. The following experimental materials were purchased from Geneaid: GenepHlow™ Gel/PCR Kit (Cat. No. DFH100) and Presto™ Mini Plasmid Kit (Cat. No. PDH100). [0054] 3. The primers for polymerase chain reaction (PCR) as used in the examples were synthesized by Genomics Inc. [0055] 4. Vectors used in the following examples are described as follows: [0056] (1) Plasmid pDNR-LIB-ALB (6,031 bps) was prepared by GenDiscovey Biotechnology Inc. Plasmid pDNR-LIB-ALB carries an ALB gene (SEQ ID NO: 1). [0057] (2) Plasmid pUC57-linker-CTLA4E-IgG1H (3,253 bps) was prepared by Genomics Inc. Plasmid pUC57-linker-CTLA4E-IgG1H carries a linker-CTLA4E-IgG1H DNA fragment (SEQ ID NO: 3) encoding a fusion protein that includes a matrix metalloproteinase-cleavable linker, an N-terminal extracellular domain of cytotoxic T lymphocyte-associated antigen 4 (CTLA4), a hinge region of IgG1, and a partial CH2 domain of IgG1. [0058] (3) Plasmid pD5-IgG1Fc (4,393 bps) was kindly provided by Professor Kuang-Wen Liao (National Yang Ming Chiao Tung University, Taiwan). Plasmid pD5-IgG1Fc carries an IgG1CH2-CH3 DNA fragment (SEQ ID NO: 4) encoding a fusion protein that includes a partial CH2 domain of IgG1 and complete CH3 domains of IgG1. [0059] (4) Plasmid pLNCX-10D1.3 (8,889 bps, see SEQ ID NO: 5 and FIG. 1) was kindly provided by Professor Tian-Lu Cheng (Kaohsiung Medical University, Taiwan). Plasmid pLNCX-10D1.3 carries a cytomegalovirus (CMV) promoter, a coding sequence of Igk secretion signal peptide (SEQ ID NO: 6), a coding sequence of antibody 10D1.3, a neomycin-resistance gene (Neo.sup.r), and restriction sites for SfiI and ClaI. [0060] (5) Plasmid pLNCX-CD80 (7494 bps) was prepared by GenDiscovey Biotechnology Inc. Plasmid pLNCX-CD80 carries a CMV promoter, a coding sequence of cluster of differentiation 80 (CD80), and a neomycin-resistance gene (Neo.sup.r),

General Procedures:

[0061] 1. The experimental procedures related to DNA cloning as employed in the examples of the present disclosure, such as extraction of genomic DNA, DNA cleavage reactions by restriction enzymes, agarose gel electrophoresis, PCR, DNA ligation with T4 DNA ligase, sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), Western blotting, plasmid transformation, etc., were performed by virtue of techniques well known to those skilled in the art or in accordance with the manufacturer's instructions.

[0062] 2. Preparation of Competent E. coli Cells:

[0063] Escherichia coli DH5a (Yeastern Biotech Co., Ltd., Cat. No. FYE607-10VL) was inoculated into LB broth and cultivated at 37° C. with shaking (225 rpm) for 14 hours. Thereafter, 4 mL of the cell culture thus obtained was inoculated into 100 mL of fresh LB broth and cultivated at 37° C. with shaking (225 rpm). Upon reaching a cell density of about 0.2˜0.4 (OD.sub.600), the resultant culture was transferred into a sterile centrifuge tube, followed by centrifugation (4° C., 2,000×g, 15 minutes). After removal of the supernatant, 1 mL of an ice cold CaCl.sub.2) solution (0.1 M) was added into the centrifuge tube to thoroughly suspend the bacterial cells, followed by adding 13 mL of an ice cold CaCl.sub.2) solution (0.1 M), so as to obtain a bacterial cell suspension. The resultant bacterial cell suspension was allowed to stand on ice for 15 minutes, followed by centrifugation (4° C., 2,000×g, 15 minutes). After removal of the supernatant, 1 mL of an ice cold CaCl.sub.2) solution (0.1 M, containing 20% glycerol) was added into the centrifuge tube to thoroughly suspend the bacterial cells, followed by adding 9 mL of an ice cold CaCl.sub.2) solution (0.1 M, containing 20% glycerol), so that a suspension of CaCl.sub.2)-treated competent E. coli cells was obtained. The competent E. coli cell suspension was then aliquoted into microcentrifuge tubes (300 μL per tube) and stored at −80° C. until use.

[0064] 3. Source and Cultivation of Cell Lines:

[0065] Human embryonic kidney cell line HEK-293, human embryonic kidney cell line 293T, human acute T-cell leukemia cell line Jurkat, and human B-lymphocyte cell line Raji were all purchased from American Type Culture Collection (ATCC, Manassas, Va., USA).

[0066] Each of the cell lines was cultivated using a corresponding medium shown in Table 1 and a 6-cm Petri dish in an incubator (37° C. and 5% CO.sub.2). Medium change was performed every two days. Cell passage was performed when the cultured cells reached 70% of confluence.

TABLE-US-00001 TABLE 1 Cell line Medium HEK-293 Dulbecco's Modified Eagle's Medium (ATCC ® CRL- (DMEM)(MyClone) supplemented with 1573 ™) 10% fetal bovine serum 293T (FBS)(MyClone) and 50 μg/mL (ATCC ® CRL- gentamicin (Cyrusbio Inc) 3216 ™) Jurkat RPMI 1640 medium (Gibco) (ATCC ® TIB-152 ™) supplemented with 10% FBS 100 U/mL Raji penicillin, and 100 μg/mL (ATCC ® CCL-86 ™) streptomycin (Gibco)

Example 1. Construction of Recombinant Plasmid pLNCX-ALB-Linker-CTLA4-Ig

A. Cloning of ALB Gene, Linker-CTLA4E-IgG1H DNA Fragment, and IgG1CH2-CH3 DNA Fragment

[0067] A respective one of the plasmid pDNR-LIB-ALB, plasmid pUC57-linker-CTLA4E-IgG1H, and plasmid pD5-IgG1Fc described in section 4 of “General Experimental Materials” was used as a template and subjected to a PCR process using a corresponding one of the primer pairs 1-3 described in Table 2, respectively. The PCR conditions are shown in Tables 3-4.

TABLE-US-00002 TABLE 2 Size of PCR Primer Target DNA product pair Primer Nucleotide sequence (5′ .fwdarw. 3′) fragment (bp) 1 Forward primer F1 [00001]embedded image ALB gene (SEQ ID NO: 1) 1,783 Reverse cacggtgggcataagcctaaggcagctt primer R1 gac (SEQ ID NO: 8) 2 Forward cttaggcttatgcccaccgtg Linker-CTLA4E- 543 primer F2 (SEQ ID NO: 9) IgG1H DNA Reverse gagatcatgagggtgtccttg fragment primer R2 (SEQ ID NO: 10) (SEQ ID NO: 3) 3 Forward caaggacaccctcatgatctc IgG1CH2-CH3 633 primer F3 (SEQ ID NO: 11) DNA fragment (SEQ ID NO: 4) Reverse primer R3 [00002]embedded image Note: The underlined nucleotides represent the recognition site of the restriction enzyme indicated thereabove, and the nucleotides shown in the boxes represent the 6xHis-tag.

TABLE-US-00003 TABLE 3 Volume Contents (μL) Plasmid DNA (10 ng/μL) 1 Forward primer (20 μm) 1.6 Reverse primer (20 μm) 1.6 dNTPs (10 mM) 0.5 Phusion ® High-Fidelity DNA polymerase 0.25 (0.5 U/μL) 5× Phusion HF buffer 5 Nuclease-free water 15.05

TABLE-US-00004 TABLE 4 Primer pair Operation conditions 1 Denaturation at 98° C. for 30 seconds, followed by 2 30 cycles of the following reactions: denaturation at 98° C. for 10 seconds, primer annealing at 61° C. for 20 seconds, and elongation at 72° C. for 23 seconds; and finally extra extension at 72° C. for 5 minutes. 3 Denaturation at 98° C. for 30 seconds, followed by 30 cycles of the following reactions: denaturation at 98° C. for 10 seconds, primer annealing at 67° C. for 20 seconds, and elongation at 72° C. for 23 seconds; and finally extra extension at 72° C. for 5 minutes.

[0068] Consequently, a PCR product A1 containing an ALB gene (1,783 bps), a PCR product A2 containing a linker-CTLA4E-IgG1H DNA fragment (543 bps), and a PCR product A3 containing an IgG1CH2-CH3 DNA fragment (633 bps) were obtained.

[0069] The resultant PCR products were subjected to a 1% agarose gel electrophoresis analysis for molecular weight verification, followed by recovery and purification using the GenepHlow™ Gel/PCR Kit.

B. Synthesis of ALB-Linker-CTLA4-Ig DNA Fragment

[0070] A respective one of the PCR product A1 and PCR product A2 obtained in section A of this example was dissolved in nuclease-free water, followed by conducting overlapping PCR using the forward primer F1 and reverse primer R2 described in Table 2. The overlapping PCR conditions are shown in Table 5.

TABLE-US-00005 TABLE 5 Volume Contents (μL) PCR product A1 1 PCR product A2 1 Forward primer F1 (20 μm) 1.6 Reverse primer R2 (20 μm) 1.6 dNTP (10 mM) 0.5 Phusion ® High-Fidelity DNA polymerase 0.25 (0.5 U/μL) 5× Phusion HF buffer 5 Nuclease-free water 15.05 Operation conditions: denaturation at 98° C. for 30 seconds, followed by 30 cycles of the following reactions: denaturation at 98° C. for 10 seconds, primer annealing at 67° C. for 20 seconds, and elongation at 72° C. for 23 seconds; and finally extra extension at 72° C. for 5 minutes.

[0071] Consequently, a PCR product A4 having a size of about 2,305 bps (see SEQ ID NO: 13) was obtained. The resultant PCR product A4 was subjected to a 1% agarose gel electrophoresis analysis for molecular weight verification, followed by recovery and purification using the GenepHlow™ Gel/PCR Kit.

[0072] Thereafter, a respective one of the PCR product A3 obtained in section A of this example and PCR product A4 obtained above was dissolved in nuclease-free water, followed by conducting overlapping PCR using the forward primer F1 and reverse primer R3 described in Table 2. The overlapping PCR conditions are shown in Table 6.

TABLE-US-00006 TABLE 6 Volume Contents (μL) PCR product A3 1 PCR product A4 1 Forward primer F1 (20 μm) 1.6 Reverse primer R3 (20 μm) 1.6 dNTPs (10 mM) 0.5 Phusion ® High-Fidelity DNA polymerase 0.25 (0.5 U/μL) 5× Phusion HF buffer 5 Nuclease-free water 15.05 Operation conditions: denaturation at 98° C. for 30 seconds, followed by 30 cycle of the following reactions: denaturation at 98° C. for 10 seconds, primer annealing at 72° C. for 20 seconds, and elongation at 72° C. for 23 seconds; and finally extra extension at 72° C. for 5 minutes.

[0073] Consequently, a PCR product A5 containing an ALB-linker-CTLA4-Ig DNA fragment (2,917 bps, see SEQ ID NO: 14) was obtained. The resultant PCR product A5 was subjected to a 1% agarose gel electrophoresis analysis for molecular weight verification, followed by recovery and purification using the GenepHlow™ Gel/PCR Kit.

[0074] Regarding the ALB-linker-CTLA4-Ig DNA fragment, which encodes an activatable fusion protein having an amino acid sequence as shown in SEQ ID NO: 15, wherein the 1.sup.st-585.sup.th amino acid residues from the N-terminus constitute an albumin (SEQ ID NO: 2), the 586.sup.th-599.sup.th amino acid residues from the N-terminus constitute a matrix metalloproteinase-cleavable linker (SEQ ID NO: 16), the 600.sup.th-724.sup.th amino acid residues from the N-terminus constitute an N-terminal extracellular domain of CTLA4 (SEQ ID NO: 17), and the 725.sup.th-956.sup.th amino acid residues from the N-terminus constitute an IgG1 Fc region (SEQ ID NO: 18).

C. Construction of Recombinant Plasmid pLNCX-ALB-Linker-CTLA4-Ig

[0075] A DNA fragment having a size of 6,710 bps (i.e., a carrier DNA) was excised from Plasmid pLNCX-10D1.3 using restriction enzymes SfiI/ClaI. In addition, a DNA fragment having a size of 2,908 bps and possessing the ALB-linker-CTLA4-Ig DNA fragment (i.e., an insert DNA) was excised from the PCR product A5 obtained in section B of this example using restriction enzymes SfiI/ClaI. Subsequently, the carrier DNA and the insert DNA were subjected to ligation in a molar ratio of 1 to 3 using the Quick Ligation™ Kit, thereby forming a recombinant plasmid pLNCX-ALB-linker-CTLA4-Ig having a nucleotide sequence as shown in SEQ ID NO: 19 (9,618 bps, see FIG. 2).

[0076] Subsequently, a microcentrifuge tube containing a competent E. coli cell suspension as prepared in section 2 of “General Procedures” was removed from −80° C.-storage and allowed to stand on ice for at least 15 minutes, so that the competent E. coli cell suspension stored therein was thawed. 100 μL of the thawed competent E. coli cell suspension was then evenly admixed with 5 μL of the recombinant plasmid pLNCX-ALB-linker-CTLA4-Ig, followed by standing on ice for 30 minutes.

[0077] The resulting mixture was then placed in a 42° C. water bath for 30 seconds, followed by standing on ice for 5 minutes. After evenly admixing with 900 μL SOC medium (Cyrusbio Inc), the resulting mixture was cultivated at 37° C. with shaking (225 rpm) for 1 hour. The bacterial culture thus obtained was plated on a LB agar plate containing 100 μg/mL ampicillin and cultivated at 37° C. for 14 hours.

[0078] The resultant culture was harvested and the recombinant plasmid pLNCX-ALB-linker-CTLA4-Ig contained therein was extracted using the Presto™ Mini Plasmid Kit, followed by cleavage using restriction enzymes HindIII/ClaI. The resultant cleavage products were subjected to agarose gel electrophoresis, so as to verify the molecular weight of the recombinant plasmid pLNCX-ALB-linker-CTLA4-Ig. The verified recombinant plasmid pLNCX-ALB-linker-CTLA4-Ig was subjected to a sequencing analysis conducted by Genomics Inc.

Example 2. Production of Fusion Protein ALB-Linker-CTLA4-Ig

[0079] A. Transfection of 293T Cells with Recombinant Plasmid pLNCX-ALB-Linker-CTLA4-Ig

[0080] 10 μg of the recombinant plasmid pLNCX-ALB-linker-CTLA4-Ig obtained in Example 1, 1 mL of 0.3 M CaCl.sub.2), and 1 mL of 2× HEPES buffered saline (HBS) were mixed, so as obtain a transfection mixture.

[0081] 293T cells were incubated in a 10-cm petri dish containing DMEM (3.5×10.sup.6 cells/5 mL of DMEM), followed by cultivation in an incubator (37° C., 5% CO.sub.2). After cell attachment, the liquid in the petri dish was removed, and the transfection mixture was subsequently added, followed by cultivation for 6 hours. Afterwards, 10 mL of DMEM supplemented with 10% FBS was added to the petri dish, followed by cultivation for 24 hours. After removal of the liquid, 15 mL of DMEM supplemented with 10% FBS was added to the petri dish, followed by cultivation for 24 hours and subsequent collection of the liquid culture. This step was repeated thrice, so as to obtain 60 mL of the liquid culture.

B. First Purification of Fusion Protein ALB-Linker-CTLA4-Ig

[0082] The liquid culture obtained in section A of this example was subjected to centrifugation at 1,000×g for 5 minutes to obtain a supernatant, and the supernatant was subsequently added with 1% tween-20 and 30 mM imidazole, so as to obtain a protein sample. The protein sample was then subjected to an immobilized metal ion affinity chromatography (IMAC) analysis using HisTrap™ HP column (Cat. No. 17-5248-02, GE healthcare) in accordance with the manufacturer's instructions.

[0083] Briefly, the protein sample was applied to a HisTrap™ HP column at a flow rate of 2 mL/min. Thereafter, Tris binding buffer, Tris IEX buffer, Tris glycerol buffer, and Tris DF buffer (these four buffers were all purchased from Cyrusbio Inc) were used to wash out the unbound protein in sequence, and then the bound proteins were eluted with an eluent (Cyrusbio Inc). Each fraction obtained consisted of 6 mL of an eluate. Afterwards, the eluate of each fraction was collected and then subjected to dialysis using a dialysis membrane having a molecular weight cut-off of 10 kDa and Tris-buffered saline (TBS), so as to obtain a first purified product.

[0084] Subsequently, 4 μL of the first purified product was evenly mixed with 6 μL of deionized water and 3.5 μL of a 4× sample buffer, followed by heating in a boiling water bath for 5 minutes. The resultant protein sample was allowed to cool down to room temperature, and was then subjected to SDS-PAGE and Western blot analyses. The apparatus and chemicals used are described as follows: [0085] (1) A two-layered polyacrylamide gel consisting of a 10% SDS-PAGE separating gel and a 4% SDS-PAGE stacking gel on top of said separating gel and an electrophoresis system (Bio-Rad Inc) were used for the SDS-PAGE analysis. [0086] (2) Protein transfer was conducted using a wet tank transfer (Bio-Rad Inc) and a nitrocellulose membrane (Pall Corporation, Cat. No. T50036). [0087] (3) A HRP-conjugated anti-human IgG Fcγ antibody (Jackson ImmunoResearch Inc., Cat. No. 109-035-098) (diluted 20,000-fold with TBST containing 0.5% skim milk) was used for Western blot. [0088] (4) Chemiluminescence staining was performed using an enhanced chemiluminescence (ECL) detection kit (GE Life Sciences, Cat. No. PRN2106) and a luminescence imaging system (Hansor luminescence image system, model: G595).

[0089] Referring to FIG. 3, the fusion protein ALB-linker-CTLA4-Ig (130 kDa) was detected by HRP-conjugated anti-human IgG Fc.sub.5μ antibody, indicating that the 293T cells transfected with the recombinant plasmid pLNCX-ALB-linker-CTLA4-Ig can effectively express the fusion protein ALB-linker-CTLA4-Ig.

C. Second Purification of Fusion Protein ALB-Linker-CTLA4-Ig

[0090] 3920 μL of the first purified product obtained in section B of this example, 80 μL of 500 mM EDTA, and 4000 μL of 20 mM Tris-HCl buffer were mixed, followed by filtration. The filtrate thus obtained was subjected to anion exchange chromatography using HiTrap® Q Fast Flow (GE Healthcare, Cat. No. 17-5156-01). The operation conditions used are described as follows: a flow rate of 2 mL/min; a wash buffer which was 20 mM Tris-HCl buffer; and an elution buffer which was a 2 M NaCl solution, and a gradient elution ranging from 2% to 25%. Each fraction obtained consisted of 5 mL of an eluate. Afterwards, the eluate of each fraction was collected and then subjected to dialysis using a dialysis membrane having a molecular weight cut-off of 10 kDa and TBS, so as to obtain a purified fusion protein ALB-linker-CTLA4-Ig. The purified fusion protein ALB-linker-CTLA4-Ig was then subjected to SDS-PAGE analysis described in section B of this example, followed by Coomassie blue staining.

[0091] The experimental results reveal that the purity value of the purified fusion protein ALB-linker-CTLA4-Ig is greater than 95%.

Example 3. Evaluation for the Effect of Fusion Protein ALB-Linker-CTLA4-Ig According to this Disclosure on Immune Regulation

A. Preparation of Mixture Containing CTLA4-Ig

[0092] 64 μg of the purified fusion protein ALB-linker-CTLA4-Ig obtained in Example 2, 63.4 μL of 5 mg/mL collagenase type IV (Sigma-Aldrich, Cat. No. C5138) (which had the activities of matrix metalloproteinase 2 (MMP2) and MMP9), 320.7 μL of 0.1% bovine serum albumin (BSA), and 320.7 μL of 1×TCNB buffer (containing 0.5% Brij-35, 0.1 M CaCl.sub.2, 1.5 M NaCl, and 0.5 M Tris, pH 7.5) were mixed, followed by conducting enzymatic digestion at 30° C. for 1 hour. Afterwards, the resultant mixture was subjected to IMAC analysis and dialysis according to the method described in section B of Example 2, so as to obtain a mixture containing CTLA4-Ig.

B. Preparation of CD80-Expressing HEK-293 Cells

[0093] The plasmid pLNCX-CD80 was transfected into competent HEK-293 cells using TransIT X2@ Dynamic Delivery system (Mirus Bio Inc., Cat. No. MIR6000) according to the manufacturer's instructions. Afterward, the thus obtained CD80-expressing HEK-293 cells were subjected to flow cytometry analysis using PE anti-human CD80 antibody (BioLegend, Inc., Cat. No. 305207), so as to confirm that CD80 was successfully expressed on the HEK-293 cells.

C. Analysis of CD80-Binding Capacity

[0094] The purified fusion protein ALB-linker-CTLA4-Ig obtained in Example 2, the mixture containing CTLA4-Ig obtained in section A of this example, and a commercially available CTLA4-Ig (BioLegend Inc., Cat. No. 591902) were each subjected to serial dilution with phosphate-buffered saline (PBS), so as to obtain three test solutions having different concentrations (10.sup.−4 to 10.sup.4 nM).

[0095] A respective well of a 96-well culture plate was added with 50 μL of 100 μg/mL poly-lysine solution (Sigma-Aldrich, Cat. No. P6282-5MG), followed by incubation at room temperature for 5 minutes. Subsequently, the liquid in each well was removed, followed by air drying for 2 hours. Afterwards, the CD80-expressing HEK-293 cells obtained in section B of this example were divided into 3 groups, including one comparative group and two experimental groups (i.e., experimental groups 1 to 2). Each group of the CD80-expressing HEK-293 cells was incubated in a respective well of the 96-well culture plate at 1×10.sup.5 cells/well, followed by cultivation in an incubator (37° C., 5% CO.sub.2) for 14 hours. Thereafter, the liquid in each well was removed, and the cultured cells were fixed with a 4% paraformaldehyde solution (in PBS) at room temperature for 1 hour.

[0096] After removal of the liquid, the cell culture in each well was washed with PBS with Tween 20 (PBST) (99.5% PBS, 0.05% Tween-20) thrice, followed by adding 200 μL of a blocking solution containing 5% skim milk in PBST. After incubation at room temperature for 1 hour, the liquid in each well was removed, followed by washing with 1×PBST thrice. Subsequently, the cell culture of the comparative group was treated with 50 μL of the test solution containing the commercially available CTLA4-Ig, the cell culture of the experimental group 1 was treated with 50 μL of the test solution containing the purified fusion protein ALB-linker-CTLA4-Ig, and the cell culture of the experimental group 2 was treated with 50 μL of the test solution containing the mixture containing CTLA4-Ig. Each group was cultivated at room temperature for 1 hour. The liquid in each well was removed, followed by washing with 1×PBST thrice. Thereafter, 100 μL of HRP-conjugated anti-human IgG Fcγ antibody (diluted 10,000-fold with PBST containing 0.5% skim milk) was added to each well, followed by incubation at room temperature for 1 hour. The liquid in each well was removed, followed by washing with 1×PBST thrice. Afterwards, 100 μL of TMB peroxidase substrate (eBioscience, Cat. No. 00-4201-56) was added to each well, followed by incubation at room temperature for 15 minutes. The respective resultant cell culture was added with 100 μL of 1M H.sub.3PO.sub.4, followed by subjecting the mixture thus obtained to determination of absorbance at a wavelength of 450 nm (OD.sub.450) by a SpectraMax 190 Microplate reader (Molecular Devices). The 50% effective concentration (EC.sub.50) was determined using GraphPad Prism software (GraphPad Software, San Diego, Calif.).

[0097] As shown in Table 7 below, the EC.sub.50 values determined in the experimental group 2 and comparative group were significantly lower than that determined in the experimental group 1, indicating that: when the fusion protein ALB-linker-CTLA4-Ig is in an uncleaved state (i.e., inactivated state), the albumin retains the ability to effectively mask the N-terminal extracellular domain of the CTLA4 and hence can inhibit binding of the N-terminal extracellular domain to CD80; and when the albumin is released from the fusion protein ALB-linker-CTLA4-Ig by the action of MMP2 or MMP9 on the linker of the fusion protein ALB-linker-CTLA4-Ig, the N-terminal extracellular domain of the CTLA4 can bind to CD80.

TABLE-US-00007 TABLE 7 Group EC.sub.50 value Experimental group 1 >4 Experimental group 2 0.022 Comparative group 0.016

D. Analysis of Iumunosuppressive Activity

[0098] Raji cells were divided into 3 groups, including one comparative group and two experimental groups (i.e., experimental groups 1 to 2). Each group of the Raji cells was incubated in a respective well of a 96-well culture plate at 3.2×10.sup.4 cells/well, followed by treatment with a respective one of the three test solutions having different concentrations (i.e., 0.032 nM, 0.081 nM, 0.204 nM, 0.512 nM, 1.28 nM, 3.2 nM, 8 nM, and 20 nM) obtained in section C of this example as follows. The cell culture of the comparative group was treated with 240 μL of the test solution containing the commercially available CTLA4-Ig, the cell culture of the experimental group 1 was treated with 240 μL of the test solution containing the purified fusion protein ALB-linker-CTLA4-Ig, and the cell culture of the experimental group 2 was treated with 240 μL of the test solution containing the mixture containing CTLA4-Ig. Afterwards, each group was cultivated at 37° C. for 15 minutes.

[0099] In addition, 10.395 mL of Jurkat cells (1×10.sup.6 cells/mL) and 105 μL of 5000 ng/mL anti-human CD3 antibody (BioLegend, Inc., Cat. No. 317303) were added into a microcentrifuge tube, followed by incubation at 37° C. for 15 minutes. Subsequently, 100 μL of the resultant cell culture was added to each of the cell cultures of the experimental groups 1 to 2 and comparative group, followed by cultivation in an incubator (37° C., 5% CO.sub.2) for 24 hours. Thereafter, each of the cell cultures was collected, and the interleukin-2 (IL-2) level of each group was determined using Human IL-2 ELISA MAX™ Standard kit (BioLegend, Inc., Cat. No. 431801) according to the manufacturer's instructions.

[0100] Referring to FIG. 4, the IL-2 levels determined in the experimental group 2 and comparative group were significantly lower than that determined in the experimental group 1, indicating that when the fusion protein ALB-linker-CTLA4-Ig is in an activated state (i.e., the albumin is released from the fusion protein ALB-linker-CTLA4-Ig), it has an ability to bind CD80, and hence can inhibit or suppress the T cell-dependent immune response.

[0101] All patents and references cited in this specification are incorporated herein in their entirety as reference. Where there is conflict, the descriptions in this case, including the definitions, shall prevail.

[0102] While the disclosure has been described in connection with what are considered the exemplary embodiments, it is understood that this disclosure is not limited to the disclosed embodiments but is intended to cover various arrangements included within the spirit and scope of the broadest interpretation so as to encompass all such modifications and equivalent arrangements.