Genetically engineered bacterium of <i>Escherichia coli </i>and method for fermentation production of L-theanine thereof

11453898 · 2022-09-27

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention belongs to the bioengineering field, and relates to a method for fermentation production of L-theanine by using an Escherichia coli genetically engineered bacterium. The engineered bacterium is obtained by serving a strain as an original strain, wherein the strain is obtained after performing a single copy of T7RNAP, a dual copy of gmas, xylR knockout, and sucCD knockout on an Escherichia coli W3110 genome, and by integrating genes xfp, pta, acs, gltA, and ppc, and knocking out ackA on the genome. The present invention has a high yield, and stable production performance; after 20-25 h, L-theanine has a titer of 75-80 g/L, and the yield is up to 52-55%. The fermentation broth is purified by membrane separation in combination with a cation-anion resin series technique. Moreover, the one-step crystallization yield is 72.3% and the L-theanine final product has a purity of 99%.

Claims

1. A genetically engineered bacterium producing L-theanine, wherein the genetically engineered bacterium is obtained by using a strain as an original strain, wherein the original strain is obtained after integrating a single copy of a RNA polymerase gene T7RNAP, a dual copy of a γ-glutamylmethylamide synthetase gene gmas, and a knockout of a xylose operon transcription factor gene xylR and a knockout of a succinyl-CoA synthetase gene sucCD on a genome of Escherichia coli W3110, and then by integrating an exogenous fructose 6-phosphate phosphoketolase gene xfp, an exogenous phosphoacetyl transferase gene pta, an exogenous acetyl-CoA synthetase gene acs, an exogenous citrate synthase gene gltA, and an exogenous phosphoenolpyruvate carboxylase gene ppc on the genome, and knocking out an acetokinase gene ackA.

2. The genetically engineered bacterium of claim 1, wherein the fructose 6-phosphate phosphoketolase gene xfp comprising the nucleotide sequence as shown in SEQ ID NO: 1; the phosphoacetyl transferase gene pta comprising the nucleotide sequence as shown in SEQ ID NO:2; the acetyl-CoA synthetase gene acs comprising the nucleotide sequence as shown in SEQ ID NO:3; the citrate synthase gene gltA comprising the nucleotide sequence as shown in SEQ ID NO:4; the phosphoenolpyruvate carboxylase gene ppc comprising the nucleotide sequence as shown in SEQ ID NO:5; and the acetokinase gene ackA comprising the nucleotide sequence as shown in SEQ ID NO:6.

3. The genetically engineered bacterium of claim 1, wherein genes xfp, pta, acs, gltA, and ppc are respectively controlled by a trc promoter.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a metabolic modification strategy diagram of a genetically engineered bacterium Escherichia coli THEE

(2) where, the gray filling gene is a modification site of the present invention.

(3) FIG. 2 is an electrophoretogram of gapC::P.sub.trc-xfp integration

(4) where, M denotes a 1 kb Maker; 1 denotes an upstream homologous arm; 2 denotes a target gene; 3 denotes a downstream homologous arm; 4 denotes an overlapped fragment; 5 denotes a PCR fragment of the original strain; and 6 denotes a PCR fragment of the target strain.

(5) FIG. 3 is an electrophoretogram of yjiT::P.sub.trc-pta integration

(6) where, M denotes a 1 kb Maker; 1 denotes an upstream homologous arm; 2 denotes a target gene; 3 denotes a downstream homologous arm; 4 denotes an overlapped fragment; 5 denotes a PCR fragment of the original strain; and 6 denotes a PCR fragment of the target strain.

(7) FIG. 4 is an electrophoretogram of yghE::P.sub.trc-acs integration

(8) where, M denotes a 1 kb Maker; 1 denotes an upstream homologous arm; 2 denotes a target gene; 3 denotes a downstream homologous arm; 4 denotes an overlapped fragment; 5 denotes a PCR fragment of the original strain; and 6 denotes a PCR fragment of the target strain.

(9) FIG. 5 is an electrophoretogram of ylbE::P.sub.trc-gltA integration

(10) where, M denotes a 1 kb Maker; 1 denotes an upstream homologous arm; 2 denotes a target gene; 3 denotes a downstream homologous arm; 4 denotes an overlapped fragment; 5 denotes a PCR fragment of the original strain; and 6 denotes a PCR fragment of the target strain.

(11) FIG. 6 is an electrophoretogram of yeeL:P.sub.trc-ppc integration

(12) where, M denotes a 1 kb Maker; 1 denotes an upstream homologous arm; 2 denotes a target gene; 3 denotes a downstream homologous arm; 4 denotes an overlapped fragment; 5 denotes a PCR fragment of the original strain; and 6 denotes a PCR fragment of the target strain.

(13) FIG. 7 is an electrophoretogram of ackA knockout

(14) where, M denotes a 1 kb Maker; 1 denotes an upstream homologous arm; 2 denotes a downstream homologous arm; 3 denotes an overlapped fragment; 4 denotes a PCR fragment of the original strain; and 5 denotes a PCR fragment of the target strain.

(15) FIG. 8 is a fermentation process curve of the genetically engineered bacterium Escherichia coli THEE in 5 L fermentation tank.

(16) FIG. 9 is a linear fitting diagram of ethylamine flow rate.

DESCRIPTION OF THE EMBODIMENTS

(17) To understand the object, technical solution and advantages more clearly, the present invention will be further described in detail with reference to detailed examples. It should be understood that detailed examples described herein are merely used to explain the present invention, but not constructed as limiting thereto.

(18) In the present invention, the genetically engineered bacterium producing L-theanine constructed via Chinese invention patent ZL 201811215068.6 (CN 109370966 B) serves as an original strain. The original strain is obtained by the following steps: integrating a single copy of a RNA polymerase gene T7RNAP which is derived from a T7 phage and has a nucleotide sequence as shown in SEQ ID NO:1 of CN 109370966 B on a site lacI-lacZ of the Escherichia coli W3110 genome and controlled by a xylose promoter P.sub.xylF, integrating a dual copy of γ-glutamylmethylamide synthetase gene gmas which is derived from Methylovorus mays and has a nucleotide sequence as shown in SEQ ID NO:2 of CN 109370966 B on sites yghX and yeeP of the W3110 genome, optimized via a codon and controlled by a T7 promoter, knocking out a xylose operon transcription factor gene xylR of the W3110, and knocking out a succinyl-CoA synthetase gene sucCD of the W3110. Detailed construction process may be referring to CN 109370966 B.

(19) The trc promoter sequence used in the present invention is as follows:

(20) TABLE-US-00001 (as shown in SEQ ID NO: 53) TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATA ACAATTTCACACAGGAAACAGACC.

(21) In examples of the present invention, sequences of the genes xfp, pta, acs, gltA, ppc and ackA involved in the construction process of the E. coli THEE are shown in the SEQ ID NO:1-6.

(22) The present invention will be further explained by detailed embodiments with reference to the accompanying drawings.

Example 1: Construction of a Genetically Engineered Bacterium E. coli THEE (Metabolic Modification Strategy is Shown in FIG. 1)

(23) 1. Gene Editing Method

(24) The present invention is implemented by using a CRISPR/Cas 9-mediated gene editing method and by reference to the literature (Metabolic Engineering, 2015, 31: 13-21), and two plasmids used in the method are respectively pGRB and pREDCas9. pREDCas9 carried a gRNA plasmid elimination system, a Red recombination system of λ phage and a Cas9 protein expression system with miramycin resistance (working concentration: 100 mg/L), and was cultured at 32° C.; a pGRB plasmid with a framework of pUC18 included a promoter J23100, a gRNA-Cas9 binding domain sequence and terminator sequence with ampicillin resistance (working concentration: 100 mg/L) was cultured at 37° C.

(25) 2. Specific Construction Process of the Strain

(26) The genetically engineered bacterium producing L-theanine constructed via Chinese invention patent ZL 201811215068.6 served as an original strain. The original strain was obtained by the following steps: performing a single copy of a RNA polymerase gene T7RNAP which was derived from a T7 phage and had a nucleotide sequence as shown in SEQ ID NO:1 of CN 109370966 B on a site lacI-lacZ of the Escherichia coli genome and controlled by a xylose promoter P.sub.xylF, performing a dual copy of γ-glutamylmethylamide synthetase gene gmas which had a nucleotide sequence as shown in SEQ ID NO:2 of CN 109370966 B on sites yghX and yeeP of the genome, optimized via a codon and controlled by a T7 promoter, knocking out a xylose operon transcription factor gene xylR, and knocking out a succinyl-CoA synthetase gene sucCD of the W3110, and modified as follows:

(27) 2.1 Integration of P.sub.trc-xfp (a Fragment Containing a trc Promoter and xfp Gene) on a Pseudogene gapC Site

(28) Using the E. coli ATCC27325 genome as a template, upstream homologous arm primers UP-gapC-S (SEQ ID NO:7), UP-gapC-A (SEQ ID NO:8) and downstream homologous arm primers DN-gapC-S (SEQ ID NO:9), DN-gapC-A (SEQ ID NO:10) were designed according to the upstream and downstream sequences of the gene gapC, the upstream and downstream homologous arms of the gene gapC were amplified; primers xfp-S (SEQ ID NO:11), xfp-A (SEQ ID NO:12) were designed according to the gene xfp, and the xfp gene fragment was amplified. The promoter P.sub.trc was designed in the reverse primer of upstream homologous arm of gapC gene and forward primer of the xfp gene. The above fragments were subjected to PCR overlapping to obtain an integrated fragment of the gene xfp (upstream homologous arm of gene gapC-P.sub.trc-xfp-downstream homologous arm of gene gapC); the DNA fragment containing a target sequence for pGRB-gapC construction was prepared by annealing primers gRNA-gapC-S (SEQ ID NO:13) and gRNA-gapC-A (SEQ ID NO:14), then the DNA fragment was recombined with a linearized pGRB vector to obtain a recombinant pGRB-gapC. The integrated fragment and pGRB-gapC were electro-transformed into competent cells of an Escherichia coli original strain containing a pREDCas9 vector, then the electro-transformed bacterial cells after being resuscitatively cultured were coated on a LB plate containing ampicillin and miramycin, and cultured overnight at 32° C., then a positive recombinant was verified by PCR, and then, the pGRB-gapC for gene editing was removed. The verification diagram was shown in FIG. 2.

(29) 2.2 Integration of P.sub.trc-pta (a Fragment Containing a trc Promoter and pta Gene) on a Pseudogene yjiT Site

(30) Using the E. coli ATCC27325 genome as a template, upstream homologous arm primers Up-yjiT-S (SEQ ID NO:15), Up-yjiT-A (SEQ ID NO:16) and downstream homologous arm primers DN-yjiT-S (SEQ ID NO:17), DN-yjiT-A (SEQ ID NO:18) were designed according to the upstream and downstream sequences of the gene yjiT, the upstream and downstream homologous arms of the gene yjiT were amplified; primers pta-S (SEQ ID NO:19), pta-A (SEQ ID NO:20) were designed according to the gene pta, and the pta gene fragment was amplified. The promoter P.sub.trc was designed in the reverse primer of upstream homologous arm of the gene yjiT and forward primer of the pta gene. The above fragments were subjected to PCR overlapping to obtain an integrated fragment of the gene pta (upstream homologous arm of gene yjiT-P.sub.trc-pta-downstream homologous arm of gene yjiT); the DNA fragment containing a target sequence for pGRB-yjiT construction was prepared by annealing primers gRNA-yjiT-S (SEQ ID NO:21) and gRNA-yjiT-A (SEQ ID NO:22), then the DNA fragment was recombined with a linearized pGRB vector to obtain a recombinant pGRB-yjiT. The integrated fragment and pGRB-yjiT were electro-transformed into competent cells of an Escherichia coli strain constructed in the last step containing a pREDCas9 vector, then the electro-transformed bacterial cells after being resuscitatively cultured were coated on a LB plate containing ampicillin and miramycin, and cultured overnight at 32° C., then a positive recombinant was verified by PCR, and then the pGRB-yjiT for gene editing was removed. The verification diagram was shown in FIG. 3.

(31) 2.3 Integration of P.sub.trc-acs (a Fragment Containing a trc Promoter and acs Gene) on a Pseudogene yghE Site

(32) Using the E. coli ATCC27325 genome as a template, upstream homologous arm primers UP-yghE-S (SEQ ID NO:23), UP-yghE-A (SEQ ID NO:24) and downstream homologous arm primers DN-yghE-S (SEQ ID NO:25), DN-yghE-A (SEQ ID NO:26) were designed according to the upstream and downstream sequences of the gene yghE, the upstream and downstream homologous arms of the gene yghE were amplified; primers acs-S (SEQ ID NO:27) and acs-A (SEQ ID NO:28) were designed according to the gene acs, and the acs gene fragment was amplified. The promoter P.sub.trc was designed in the reverse primer of upstream homologous arm of the gene yghE and forward primer of the acs gene. The above fragments were subjected to PCR overlapping to obtain an integrated fragment of the gene acs (upstream homologous arm of gene yghE-P.sub.trc-acs-downstream homologous arm of gene yghE); the DNA fragment containing a target sequence for pGRB-yghE construction was prepared by annealing primers gRNA-yghE-S (SEQ ID NO:29) and gRNA-yghE-A (SEQ ID NO:30), then the DNA fragment was recombined with a linearized pGRB vector to obtain a recombinant pGRB-yghE. The integrated fragment and pGRB-yghE were electro-transformed into competent cells of an Escherichia coli strain constructed in the last step containing a pREDCas9 vector, then the electro-transformed bacterial cells after being resuscitatively cultured were coated on a LB plate containing ampicillin and miramycin, and cultured overnight at 32° C., then a positive recombinant was verified by PCR, and then the pGRB-yghE for gene editing was removed. The verification diagram was shown in FIG. 4.

(33) 2.4 Integration of P.sub.trc-gltA (a Fragment Containing a trc Promoter and gltA Gene) on a Pseudogene ylbE Site

(34) Using the E. coli (ATCC27325) genome as a template, upstream homologous arm primers UP-ylbE-S (SEQ ID NO:31), UP-ylbE-A (SEQ ID NO:32) and downstream homologous arm primers DN-ylbE-S (SEQ ID NO:33), DN-ylbE-A (SEQ ID NO:34) were designed according to the upstream and downstream sequences of the gene ylbE, the upstream and downstream homologous arms of the gene ylbE were amplified; primers gltA-S (SEQ ID NO:35), and gltA-A (SEQ ID NO:36) were designed according to the gene gltA, and the gltA gene fragment was amplified. The promoter P.sub.trc was designed in the reverse primer of upstream homologous arm of the gene ylbE and forward primer of the gltA gene. The above fragments were subjected to PCR overlapping to obtain an integrated fragment of the gene gltA (upstream homologous arm of gene ylbE-P.sub.trc-gltA-downstream homologous arm of gene ylbE); the DNA fragment containing a target sequence for pGRB-yghE construction was prepared by annealing primers gRNA-ylbE-S (SEQ ID NO:37) and gRNA-ylbE-A (SEQ ID NO:38), then the DNA fragment was recombined with a linearized pGRB vector to obtain a recombinant pGRB-ylbE. The integrated fragment and pGRB-ylbE were electro-transformed into competent cells of an Escherichia coli strain constructed in the last step containing a pREDCas9 vector, then the electro-transformed bacterial cells after being resuscitatively cultured were coated on a LB plate containing ampicillin and miramycin, and cultured overnight at 32° C., then a positive recombinant was verified by PCR, and then the pGRB-ylbE for gene editing was removed. The verification diagram was shown in FIG. 5.

(35) 2.5 Integration of P.sub.trc-ppc (a Fragment Containing a trc Promoter and ppc Gene) on a Pseudogene yeeL Site

(36) Using the E. coli ATCC27325 genome as a template, upstream homologous arm primers UP-yeeL-S (SEQ ID NO:39), UP-yeeL-A (SEQ ID NO:40) and downstream homologous arm primers DN-yeeL-S (SEQ ID NO:41), DN-yeeL-A (SEQ ID NO:42) were designed according to the upstream and downstream sequences of the gene yeeL; the upstream and downstream homologous arms of the gene yeeL were amplified; primers ppc-S (SEQ ID NO:43), ppc-A (SEQ ID NO:44) were designed according to the gene ppc, and ppc gene fragment was amplified. The promoter P.sub.trc was designed in the reverse primer of upstream homologous arm of the gene yeeL and forward primer of the ppc gene. The above fragments were subjected to PCR overlapping to obtain an integrated fragment of the gene ppc (upstream homologous arm of gene yeeL-P.sub.trc-ppc-downstream homologous arm of gene yeeL); the DNA fragment containing a target sequence for pGRB-yeeL construction was prepared by annealing primers gRNA-yeeL-S (SEQ ID NO:45) and gRNA-yeeL-A (SEQ ID NO:46), then the DNA fragment was recombined with a linearized pGRB vector to obtain a recombinant pGRB-yeeL. The integrated fragment and pGRB-yeeL were electro-transformed into competent cells of an Escherichia coli strain constructed in the last step containing a pREDCas9 vector, then the electro-transformed bacterial cells after being resuscitatively cultured were coated on a LB plate containing ampicillin and miramycin, and cultured overnight at 32° C., then a positive recombinant was verified by PCR, and then the pGRB-yeeL for gene editing was removed. The verification diagram was shown in FIG. 6.

(37) 2.6 Knockout of the Gene ackA

(38) Upstream homologous arm primers UP-ackA-S (SEQ ID NO:47) and UP-ackA-A (SEQ ID NO:48) and downstream homologous arm primers DN-ackA-S (SEQ ID NO:49) and DN-ackA-A (SEQ ID NO:50) were designed according to the upstream and downstream sequences of the gene ackA, and the upstream/downstream homologous arm fragments were amplified by PCR; the above fragments were subjected to PCR overlapping to obtain a gene ackA-knockout fragment (ackA upstream homologous arm-ackA downstream homologous arm). Primers gRNA-ackA-S (SEQ ID NO:51) and gRNA-ackA-A (SEQ ID NO:52) were designed, and the DNA fragment containing the target sequence was amplified, and recombined with a linearized pGRB vector to obtain a recombinant pGRB-ackA. The knockout fragment and pGRB-ackA were electro-transformed into competent cells of an Escherichia coli strain constructed in the last step containing a pREDCas9 vector, then the electro-transformed bacterial cells after being resuscitatively cultured were coated on a LB plate containing ampicillin and miramycin, and cultured overnight at 32° C., then a positive recombinant was verified by PCR; and then the pGRB-ackA and pREDCas9 for gene editing was removed. The verification diagram was shown in FIG. 7.

(39) And the train E. coli THEE was obtained finally.

(40) The order of the above steps may be adjusted according to the actual condition.

(41) 3. Primers Used in the Construction Process of the Strain

(42) All the primers involved in the construction process of the strain E. coli THEE were shown in the following table:

(43) TABLE-US-00002 SEQ ID NO: Primer name Sequence (5′-3′)  7 UP-gapC-S TGGGAAGAAACCACGAAACTC  8 UP-gapC-A AATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTG TCAATGTTTCAGCAGGTAGGCGAGA  9 DN-gapC-S CTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAG GACAAATAAAACGGTCGCCTGGTACG 10 DN-gapC-A TTATCCGCCGACATTGCTG 11 xfp-S TCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGG AAACAGACCATGACCTCTCCGGTTATCGGTACCC 12 xfp-A ACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGT TTTATTTGTCATTCGTTGTCACCCGCGGT 13 gRNA-gapC-S AGTCCTAGGTATAATACTAGTTATCATTCCCCACACTACGGGTTTTAGAGCT AGAA 14 gRNA-gapC-A TTCTAGCTCTAAAACCCCCCGTAGTGTGGGGAATGACTAGTATTATACCTAG GACT 15 UP-yjiT-S AATAGTTGTTGCCGCCTGAGTAACT 16 UP-yjiT-A AATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTG TCAAGCAGCCAGTAATCTTCCATCCCTTT 17 DN-yjiT-S AAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTG AGTAGGACAAATATCGGATTCGCACCGGAAGAGA 18 DN-yjiT-A TGTCCCGTGCCAGAAGATGAGG 19 pta-S TCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAG GAAACAGACCGTGTCCCGTATTATTATGCTG 20 pta-A CACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCC TTTCGTTTTATTTGTTACTGCTGCTGTGCAGACTG 21 gRNA-yjiT-S AGTCCTAGGTATAATACTAGTAGGGATTATGAACGGCAATGGTTTTAGAGC TAGAA 22 gRNA-yjiT-A TTCTAGCTCTAAAACCATTGCCGTTCATAATCCCTACTAGTATTATACCTAGG ACT 23 UP-yghE-S GGCGATTGCTACTGCTGATGCT 24 UP-yghE-A AATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTG TCAACCCAATACTGGGCGAAGGGAGA 25 DN-yghE-S AAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTG AGTAGGACAAATCGCTGCCAAGGACTCTGAGGAT 26 DN-yghE-A TAGGGCATTGGGAGGGCGATTT 27 acs-S TCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAG GAAACAGACCATGAGCCAAATTCACAAACAC 28 acs-A CACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCC TTTCGTTTTATTTGTTACGATGGCATCGCGATAGC 29 gRNA-yghE-S AGTCCTAGGTATAATACTAGTCATTACCACTTATGGCGAACGTTTTAGAGC TAGAA 30 gRNA-yghE-A TTCTAGCTCTAAAACGTTCGCCATAAGTGGTAATGACTAGTATTATACCTAG GACT 31 UP-ylbE-S ACCCAACCTTACGCAACCAG 32 UP-ylbE-A AATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTG TCAATTGTTCGATAACCGCAGCAT 33 DN-ylbE-S AAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTG AGTAGGACAAATCGCTGGCGTGCTTTGAA 34 DN-ylbE-A GGCGTAACTCAGCAGGCAG 35 gltA-S TCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGG AAACAGACCATGGCTGATACAAAAGCAAAACTC 36 gltA-A CACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCC TTTCGTTTTATTTGTTAACGCTTGATATCGCTTTTAAAG 37 gRNA-ylbE-S AGTCCTAGGTATAATACTAGTACACTGGCTGGATGTGCAACGTTTTAGAGC TAGAA 38 gRNA-ylbE-A TTCTAGCTCTAAAACGTTGCACATCCAGCCAGTGTACTAGTATTATACCTAG GACT 39 UP-yeeL-S TTCATCGGGACGAGTGGAGA 40 UP-yeeL-A AATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTG TCAACCATAGCATCGCCAATCTGA 41 DN-yeeL-S CTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAG GACAAATACCCAAAGGTGAAGATAAAGCC 42 DN-yeeL-A CATTCCCTCTACAGAACTAGCCCT 43 ppc-S TCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGG AAACAGACCATGAACGAACAATATTCCGCAT 44 ppc-A ACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGT TTTATTTGTTAGCCGGTATTACGCATACCT 45 gRNA-yeeL-S AGTCCTAGGTATAATACTAGTAACACAGCAATACGGTACGCGTTTTAGAGC TAGAA 46 gRNA-yeeL-A TTCTAGCTCTAAAACGCGTACCGTATTGCTGTGTTACTAGTATTATACCTAG GACT 47 UP-ackA-S ACTGGTTCTGAACTGCGGTAGT 48 UP-ackA-A TGTAAGGCAGGGCGTAGAGGTA 49 DN-ackA-S AATGCCGCAATGGTTCGTGAA 50 DN-ackA-A GCCGTCGTGGTGGAAGAGTT 51 gRNA-ackA-S AGTCCTAGGTATAATACTAGTCTTCTATGTAACCCAGGAAGGTTTTAGAGCT AGAA 52 gRNA-ackA-A TTCTAGCTCTAAAACCTTCCTGGGTTACATAGAAGACTAGTATTATACCTAG GACT

Example 2: Fermentation of L-Theanine Via the Strain E. coli THEE in a 5 L Fermentation Tank

(44) The slant medium consists of: 2 g/L glucose, 6 g/L peptone, 6 g/L beef extract, 3 g/L yeast powder, 2 g/L sodium chloride, and 18 g/L agar with a pH of 7.0.

(45) The seed medium consists of: 25 g/L glucose, 6 g/L yeast extract, 15 g/L peptone, 15 g/L sodium chloride and the rest is water, wherein a pH value is 7.0.

(46) The fermentation medium consists of: 30 g/L glucose, 6 g/L yeast powder, 8 ml/L corn syrup, 1.5 g/L citric acid, 2.5 g/L monopotassium phosphate, 2.0 g/L dipotassium phosphate, 1.0 g/L magnesium sulfate, and the rest is water, wherein a pH value is 7.2.

(47) (1) Slant culture: a loop of bacterium was scratched from a bacterial tube in a −80° C. refrigerator, evenly coated on an activated slant, cultured for 14 h at 37° C., and transferred to an eggplant-shaped flask for continuous culture for 14 h;

(48) (2) seed culture: a proper amount of sterile water was taken to an eggplant-shaped flask, and a bacterial suspension was inoculated into the seed medium, a pH value was stabilized 7.0 around, and a temperature of 37° C. and dissolved oxygen were kept within 30-34%, and cells were cultured to a dry cell weight of 6 g/L;

(49) (3) fermentation cultivation: a seed solution was inoculated into a fresh fermentation medium by 12% inoculum size, wherein a pH value was controlled at 7.0 during the fermentation, a temperature was maintained at 36° C., and a dissolved oxygen was within 25-30%; 600 g/L glucose solution was added by a fed-batch way to maintain a glucose concentration in the fermentation medium less than 1 g/L after glucose in the medium was completely consumed.

(50) To compare the influences of the different feeding ways of ethylamine on the fermentation results, a control group and an experimental group were set as follows:

(51) a fed-batch way of ethylamine commonly used in the art was taken in the control group, namely, when OD.sub.600=20, 2 mol/L ethylamine solution was added with a constant speed of 30 mL/h to the end of the fermentation;

(52) an OD-linked ethylamine supplementary strategy was taken in the experimental group; the fed-batch rate of ethylamine (g.Math.L.sup.−1.Math.h.sup.−1)=0.5×OD.sub.600 nm/(volume of the fermentation broth (L)×fermentation time (h)); when OD.sub.600 nm was above 10, addition of ethylamine was started, and the fed-batch rate of ethylamine was adjusted per hour for once.

(53) After 22 h of fermentation in a 5 L fermentation tank, the titer and the yield of L-theanine were shown in the table below; the fermentation process curve of the experimental group was shown in FIG. 8 (the yield of the present invention was as follows: (titer of L-theanine/consumption of glucose)×100%):

(54) TABLE-US-00003 Titer of Maximum L-theanine OD.sub.600 nm Groups (g/L) Yield (%) value Experimental group 80 ± 2.5 55 ± 1.2 81 ± 2.6 Control group 72 ± 2.1 50 ± 1.3 53 ± 3.5

Example 3 Determination of the OD-Linked Ethylamine Supplementary Strategy

(55) L-theanine was produced by fermentation in a 5 L fermentation tank; when OD.sub.600 nm was above 10, addition of ethylamine was started; the ethylamine fed-batch speed was adjusted at different degrees per hour according to the consumption degree of glucose, thus ensuring that the sugar consumption rate was kept within 7-8 g.Math.L.sup.−1.Math.h.sup.−1. Reports of 50 fermentation batches whose L-theanine titer was up to 80 g/L were collected to calculate the average OD.sub.600 nm value, average volume of the fermentation broth and the average ethylamine fed-batch rate at different fermentation time, as shown in the table below:

(56) TABLE-US-00004 Average Average Average of the ethylamine Fermentation OD.sub.600 nm fermentation fed-batch rate time (h) value broth (L) (g .Math. L.sup.−1 .Math. h.sup.−1) 1 6.38 2 0 2 10.2 2 1.29 3 15.05 2 1.25 4 20.55 2.1 1.22 5 26.6 2.2 1.2 6 32.6 2.3 1.18 7 40.7 2.5 1.16 8 46.9 2.6 1.12 9 50 2.7 1.03 10 55.6 2.8 0.99 11 60.8 2.9 0.95 12 64.2 2.9 0.92 13 68 3 0.87 14 70.8 3 0.84 15 72.4 3 0.8 16 76 3.1 0.76 17 80.2 3.1 0.75 18 81.8 3.1 0.73 19 81.5 3.2 0.67 20 81.3 3.2 0.63 22 81 3.2 0.57

(57) ORIGIN software was used for linear fitting according to the data in the above table. Y denotes average ethylamine fed-batch rate, X denotes average OD.sub.600 nm value/(average volume of the fermentation broth (L)×fermentation time (h). The fitting result was shown in FIG. 9. An OD-linked ethylamine supplementary strategy was taken according to the fitted equation; namely, the fed-batch rate of ethylamine (g.Math.L.sup.−1.Math.h.sup.−1)=0.5×OD.sub.600 nm value/(volume of the fermentation broth (L)×fermentation time (h)).

Example 4 Separation and Extraction of L-Theanine from the Fermentation Broth

(58) (1) The fermentation broth with a total volume of 3.2 L was obtained at the end of the fermentation in Example 2, and the L-theanine content was 80 g/L, 256 g in total. The fermentation broth was heated up to 60° C. and maintained for 30 min, then cooled to 35° C. The L-theanine fermentation broth was subjected to microfiltration with a 50 nm ceramic membrane for sterilization and a filtrate was collected, and water in 0.8 times the volume of the fermentation broth was supplemented when the filtrate had a flow rate lower than 5 mL/min at pressure of 0.2 MPa, and when the L-theanine had a concentration less than 1.3 g/L in retentate solution, the microfiltration of ceramic membrane was over.

(59) (2) 5.1 L ceramic membrane filtrate (L-theanine content was 48.8 g/L) was sieved with a 001×7 cationic resin to adsorb L-theanine with an adsorbing capacity of 160 g (L-theanine)/L (resin), then 0.6% ammonia water was used for elution and collection, the obtained eluent had a volume of 4.6 L (L-theanine content was 52.9 g/L). The eluent was sieved with a D213 anion resin to adsorb pigments and 4.8 L resin effluent (L-theanine content was 49.3 g/L) was collected.

(60) (3) The resin effluent was pumped into a decoloring tank, and a pharmaceutical activated carbon (4.7 g) with 2% mass of the L-theanine was added for decolorization until a feed liquid had a light transmittance of 98%. The decoloring solution was pumped into an evaporator for concentration under reduced pressure until a volume of 600 mL (L-theanine content was 364.2 g/L), where a vacuum degree of −0.08 MPa and a temperature of 60° C. were maintained.

(61) (4) A concentrated solution was pumped into a crystallizer, and 240 mL 95% ethanol was added and cooled in vacuum and crystallized, centrifuged and separated to obtain 820 mL crystallization mother liquor; 215.0 g wet crystals were collected with a water content of 13.9%, and dried to obtain 185 g L-theanine final product with a one-step crystallization yield of 72.3%. Detected by liquid chromatography, the final product had a purity of 99%.

Example 5: Fermentation of L-Theanine Via the Strain E. coli THEE in a 5 L Fermentation Tank

(62) The slant medium consists of: 1 g/L glucose, 5 g/L peptone, 5 g/L beef extract, 1 g/L yeast powder, 1 g/L sodium chloride, and 15 g/L agar with a pH of 7.0-7.2;

(63) the seed medium consists of: 20 g/L glucose, 5 g/L yeast extract, 10 g/L peptone, 10 g/L sodium chloride and the rest is water, wherein a pH value is 7.0-7.2;

(64) the fermentation medium consists of: 10 g/L glucose, 2 g/L yeast powder, 2 ml/L corn syrup, 0.2 g/L citric acid, 0.5 g/L monopotassium phosphate, 0.5 g/L dipotassium phosphate, 0.2 g/L magnesium sulfate, and the rest is water, wherein a pH value is 7.0-7.2.

(65) (1) Slant culture: a loop of bacterium was scratched from a bacterial tube in a −80° C. refrigerator, evenly coated on an activated slant, cultured for 16 h at 37° C., and transferred to an eggplant-shaped flask for continuous culture for 16 h;

(66) (2) seed culture: a proper amount of sterile water was taken to the eggplant-shaped flask, and a bacterial suspension was inoculated into a seed medium, a pH value was stabilized 7.0 around, and a temperature of 37° C. and dissolved oxygen were kept within 25-35%, and cells were cultured to a dry cell weight of 5 g/L;

(67) (3) fermentation cultivation: a seed solution was inoculated into a fresh fermentation medium by 15% inoculum size, where a pH value was controlled within 6.7-7.2 during the fermentation, a temperature was maintained at 28° C., and a dissolved oxygen was within 10-30%; 600 g/L glucose solution was added by a fed-batch way to maintain a glucose concentration in the fermentation medium less than 1 g/L after glucose in the medium was completely consumed;

(68) an OD-linked ethylamine supplementary strategy was taken; the fed-batch rate of ethylamine (g.Math.L.sup.−1.Math.h.sup.−1)=0.5×OD.sub.600 nm/(volume of the fermentation broth (L)×fermentation time (h)); when OD.sub.600 nm was above 10, addition of ethylamine was started, and the fed-batch rate of ethylamine was adjusted per hour for once.

(69) After 20 h of fermentation in a 5 L fermentation tank, L-theanine had a titer of 75 g/L and a yield of 52%.

Example 6: Fermentative Production of L-Theanine Via the Strain E. coli THEE in a 5 L Fermentation Tank

(70) The slant medium consists of: 5 g/L glucose, 10 g/L peptone, 10 g/L beef extract, 5 g/L yeast powder, 2.5 g/L sodium chloride, and 20 g/L agar with a pH of 7.0-7.2;

(71) the seed medium consists of: 30 g/L glucose, 10 g/L yeast extract, 20 g/L peptone, 20 g/L sodium chloride and the rest is water, wherein a pH value is 7.0-7.2;

(72) the fermentation medium consists of: 40 g/L glucose, 8 g/L yeast powder, 20 ml/L corn syrup, 2.0 g/L citric acid, 3.2 g/L monopotassium phosphate, 2.4 g/L dipotassium phosphate, 1.2 g/L magnesium sulfate, and the rest is water, wherein a pH value is 7.0-7.2;

(73) (1) slant culture: a loop of bacterium was scratched from a bacterial tube in a −80° C. refrigerator, evenly coated on an activated slant, cultured for 12 h at 37° C., and transferred to an eggplant-shaped flask for continuous culture for 12 h;

(74) (2) seed culture: a proper amount of sterile water was taken to an eggplant-shaped flask, and a bacterial suspension was inoculated into the seed medium, a pH value was stabilized 7.0 around, and a temperature of 37° C. and dissolved oxygen were kept within 25-35%, and cells were cultured to a dry cell weight of 6 g/L;

(75) (3) fermentation cultivation: a seed solution was inoculated into a fresh fermentation medium by 12% inoculum size, where a pH value was controlled within 6.7-7.2 during the fermentation, a temperature was maintained at 35° C., and a dissolved oxygen was within 10-30%; 600 g/L glucose solution was added by a fed-batch way to maintain a glucose concentration in the fermentation medium less than 1 g/L after glucose in the medium was completely consumed;

(76) an OD-linked ethylamine supplementary strategy was taken; the fed-batch rate of ethylamine (g.Math.L.sup.−1.Math.h.sup.−1)=0.5×OD.sub.600 nm/(volume of the fermentation broth (L)×fermentation time (h)); when OD.sub.600 nm was above 10, addition of ethylamine was started, and the fed-batch rate of ethylamine was adjusted per hour for once.

(77) After 25 h of fermentation in a 5 L fermentation tank, L-theanine had a titer of 77 g/L and a yield of 53%.

(78) The above examples are merely used to express several embodiments of the present invention and described more specifically, but are not construed as limiting the scope of the patent. It should be indicated that a person skilled in the art may make several transformations, combinations and improvements of the above examples within the idea of the patent, and these transformations, combinations and improvements shall fall within the protection scope of the patent. Therefore, the protection scope of the patent shall be subjected to the claims.