METHOD FOR PROVIDING INFORMATION NECESSARY FOR DIAGNOSING CANCER PATIENT'S RESISTANCE TO ANTI-CANCER AGENT AND/OR RADIATION

Abstract

The present invention relates to a method of selecting a cancer organoid having resistance to an anticancer agent and/or radiation from a subject with cancer, and using the same.

Claims

1. A method of providing information necessary for diagnosis of resistance to an anticancer agent and/or radiation of a subject with cancer, the method including: isolating a cancer tissue from a subject with cancer; culturing the cancer tissue into a cancer organoid in a 3D cell culture plate: treating the cultured cancer organoid with an anticancer agent and/or radiation; and selecting the cancer organoid treated with the anticancer agent and/or radiation as a cancer organoid having resistance to an anticancer agent and/or radiation when the cancer organoid treated with the anticancer agent and/or radiation has a viability equal to or more than that before the treatment with the anticancer agent and/or radiation, wherein in the culturing of the organoid, the 3D cell culture plate comprises 0 to 2 vol % of an extracellular matrix-based hydrogel, and wherein the 3D cell culture plate comprises: a well plate comprising a plurality of main wells and a plurality of sub wells formed at lower portions of the main wells to be injected with a cell culture solution and comprising recessed parts on a bottom surface thereof; and a connector for large-capacity and high-speed high content screening (HCS), which supports the well plate, and the connector for high content screening (HCS) comprises a base equipped with a fixing means so as to be attached to and detached from a lower end of the well plate and a cover positioned on an upper portion of the well plate to be coupled to the base, the main well has a step formed so as to be tapered at a predetermined site, and the step has an inclination angle (θ) ranging from 10 to 60° with respect to a wall of the main well.

2. The method of claim 1, wherein in the selecting of the cancer organoid treated with the anticancer agent and/or radiation as a cancer organoid having resistance to an anticancer agent and/or radiation, the cancer organoid is selected as a cancer organoid having resistance to an anticancer agent and/or radiation when the cancer organoid treated with the anticancer agent and/or radiation has a viability ranging from 100 to 70% compared to an organoid before treatment with an anticancer agent and/or radiation.

3. The method of claim 1, wherein in the selecting of the cancer organoid treated with the anticancer agent and/or radiation as a cancer organoid having resistance to an anticancer agent and/or radiation, the cancer organoid is selected as a cancer organoid having resistance to an anticancer agent and/or radiation when the cancer organoid treated with the anticancer agent and/or radiation has a size which is not reduced by 30% to 60% or more compared to an organoid before treatment with an anticancer agent and/or radiation.

4. The method of claim 1, wherein the extracellular matrix-based hydrogel is Matrigel.

5. The method of claim 1, wherein a size of the cancer organoids is 300 to 500 μm in diameter.

6. The method of claim 1, wherein the cancer is colorectal cancer, lung cancer, gastric cancer, skin cancer, prostate cancer, breast cancer, cervical cancer, thyroid cancer, fibrosarcoma, uterine sarcoma, or hematological cancer.

7. The method of claim 1, wherein the anticancer agent is one or more anticancer agents selected from the group consisting of a cytotoxic anticancer agent, an immune anticancer agent, a targeted anticancer therapeutic, a metabolic anticancer agent, and a new anticancer therapeutic.

8. The method of claim 1, wherein the sub well has an inclined surface formed so as to taper toward the recessed part, the sub wells have an upper end diameter ranging from 30 to 45 mm, the recessed parts have an upper end diameter ranging from 0.45 to 15 mm, an inclined surface (θ.sub.2) between the sub well and the recessed part ranges from 40 to 50°, and a length ratio of the diameter of the sub wells to the diameter of the recessed parts ranges from 1:0.1 to 0.5.

9. The method of claim 1, wherein the main well has an individual volume ranging from 100 to 300 μl, the recessed part has an individual volume ranging from 20 to 50 μl, and an individual volume ratio of the main well to the recessed part is 1:0.1 to 0.5 on average.

10. The method of claim 1, wherein the main well comprises a space part between the step and the sub well, the space part has a height (a.sub.h) ranging from 2.0 to 3.0 mm on average, the sub well has a height (b.sub.h) ranging from 1.0 to 2.0 mm on average, and a height ratio (a.sub.h:b.sub.h) of the space part to the sub well ranges from 1:0.3 to 1.

11. A method of screening a drug which alleviates the drug resistance of cancer cells, the method comprising: isolating a cancer tissue from a subject with cancer; culturing the cancer tissue into a cancer organoid in a 3D cell culture plate: treating the cultured cancer organoid with an anticancer agent and/or radiation; and selecting the cancer organoid treated with the anticancer agent and/or radiation as a cancer organoid having resistance to an anticancer agent and/or radiation when the cancer organoid treated with the anticancer agent and/or radiation has a viability equal to or more than that before the treatment with the anticancer agent and/or radiation treating the organoid selected as the cancer organoid having resistance to the anticancer agent and/or radiation with a candidate material which alleviates the drug resistance of cancer cells along with a cancer resistance drug; comparing a cancer organoid viability of a group treated with the candidate material with a cancer organoid viability of a control untreated with the candidate material; and determining the candidate material as a drug for alleviating the drug resistance of cancer cells when the cancer organoid viability of the group treated with the candidate material is lower than the viability of the control, wherein in the culturing of the organoid, the 3D cell culture plate comprises 0 to 2 vol % of an extracellular matrix-based hydrogel, and wherein the 3D cell culture plate comprises: a well plate comprising a plurality of main wells and a plurality of sub wells formed at lower portions of the main wells to be injected with a cell culture solution and comprising recessed parts on a bottom surface thereof; and a connector for large-capacity and high-speed high content screening (HCS), which supports the well plate, and the connector for high content screening (HCS) comprises a base equipped with a fixing means so as to be attached to and detached from a lower end of the well plate and a cover positioned on an upper portion of the well plate to be coupled to the base, the main well has a step formed so as to be tapered at a predetermined site, and the step has an inclination angle (θ) ranging from 10 to 60° with respect to a wall of the main well.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0102] FIG 1A is a front view of a cell culture plate according to an exemplary embodiment of the present invention, and FIG. 1B is a cross-sectional view of the cell culture plate according to an exemplary embodiment of the present invention.

[0103] FIG. 2 is a view illustrating, in detail, a main well formed in the cell culture plate according to an exemplary embodiment of the present invention.

[0104] FIG. 3 is a view illustrating a well plate, a base, and a cover of the cell culture plate according to an exemplary embodiment of the present invention ((A) a cover, (B) a base, and (C) a fixing means of a microplate and a base).

[0105] FIG. 4 is a view illustrating the high-speed mass imaging results of Example 1 and Comparative Example 1 ((A) Example 1, (B) Comparative Example 1).

[0106] FIG. 5 illustrates the results of culturing organoids in which Matrigel is included at 2 vol % according to an exemplary embodiment of the present invention and in which Matrigel is not used.

[0107] FIG. 6 illustrates the results of immunofluorescence staining of organoids including Matrigel at 2 vol % according to an exemplary embodiment of the present invention and in which Matrigel is not used.

[0108] FIG. 7A is a set of photographs illustrating the high-speed mass imaging results of Example 1, and FIG. 7B is a graph illustrating the area of the organoids cultured in Example 1.

[0109] FIG. 8A is a set of photographs illustrating the high-speed mass imaging results of Comparative Example 1, and FIG. 7B is a graph illustrating the area of the organoids cultured in Comparative Example 1.

[0110] FIG. 9 illustrates imaging results (left) and an organoid size distribution (right) when colorectal cancer cells according to an exemplary embodiment of the present invention are cultured for 14 days.

[0111] FIG. 10 is a set of results of selecting cancer organoids having resistance to an anticancer agent and radiation after culturing the cancer organoids according to an exemplary embodiment of the present invention.

[0112] FIG. 11 is a set of live/dead images after treating cancer organoids with an anticancer agent and radiation according to an exemplary embodiment of the present invention.

[0113] FIG. 12 is a set of results of measuring the viability and gene expression of organoids of cancer organoids having resistance to an anticancer agent and radiation, selected according to an exemplary embodiment of the present invention.

[0114] FIG. 13 illustrates the change in size of the organoid after radiation and drug treatment according to the present invention, and illustrates the ratio of the area of each group to the control.

[0115] FIG. 14 schematically illustrates that mutations of each cancer organoid are confirmed after treatment with an anticancer agent and radiation, and an effective therapeutic effect is predicted through categorization and grouping.

MODES OF THE INVENTION

[0116] Since the present invention may be modified into various forms and include various exemplary embodiments, specific exemplary embodiments will be illustrated in the drawings and described in detail in the Detailed Description. However, the description is not intended to limit the present invention to the specific exemplary embodiments, and it is to be understood that all the changes, equivalents, and substitutions belonging to the spirit and technical scope of the present invention are included in the present invention. When it is determined that the detailed description of the related publicly known art in describing the present invention may obscure the gist of the present invention, the detailed description thereof will be omitted.

EXAMPLES

Example A: Confirmation of Production of Standard-Type Organoid

[0117] 1. Production of Standard-Type Organoid

[0118] After an existing colorectal cancer organoid was put into a 15-ml tube along with 5 ml of a culture medium and the tube was centrifuged at 200 rpm for 3 minutes, the supernatant was thoroughly removed, and the organoid was completely isolated in to single cells by performing treatment with Accutase for 7 minutes. These single cells were seeded in sub wells of a cell culture plate at about 100 cells/well, and an organoid was produced by culturing the single cells for a total of 14 days. In this case, the culture solution is a DMEM/F12-based culture solution, and B27, N2, GlutaMAX, penicillin streptomycin, nicotinamide, N-acetyl, gastrin, A-83-01, EGF, noggin, R-spondin1, and WNT3A are included in the corresponding culture solution, and organoids were produced under culture conditions in which Matrigel was not contained or 2 vol % of Matrigel was contained.

[0119] A standard-type organoid was produced by the aforementioned method. Organoids were produced under a condition in which a 2 vol % of Matrigel was contained in the culture solution (Example 1-1) and under a condition in which Matrigel was not contained (Example 1-2).

[0120] Cells were cultured in the same manner as in Example 1-1, except that the cells were seeded in sub wells at about 200 cells/well (Example 2).

[0121] Cells were cultured in the same manner as in Example 1-1, except that the cells were seeded in sub wells at about 300 cells/well (Example 3).

[0122] Cells were cultured in the same manner as in Example 1-1, and high-speed mass imaging was performed. However, in the Comparative Example, a “96-well plate in the form of the letter ‘U’, which is a typically used cell culture plate, was used, and an organoid was produced by seeding cells on Matrigel (Comparative Example 1).

[0123] 2: Measurement of Size and Number of Organoids

[0124] The ImageJ program was used for the size analysis of the organoids. Specifically, by selecting a region of interest in a phase image and applying a threshold in the ImageJ program, a part, which was not needed, was overwritten and a part, which was not properly drawn, was drawn with black. An area to which the threshold was applied was calculated using an outer periphery.

[0125] 3. Immunofluorescence Staining Method

[0126] LGR5, which is an organoid stem cell, was stained and confirmed through immunofluorescence staining. First, a standard-type organoid according to the present invention was stored in a 4% paraformaldehyde solution at room temperature for 1 hour, and then stained with PBS. Then, after the standard-type organoid was refrigerated in 15% sucrose for one day and in 30% sucrose for one day, a cryo-block was manufactured using liquid nitrogen. Using the manufactured cryo-block, the block was cut to a thickness of 10 μm, and the cut cross-section was attached to a slide glass. The slide glass was treated with 0.1% TritonX for 10 minutes, and then washed twice with PBS. After the slide glass was stored in 3% BSA at room temperature for 1 hour, immunostaining was performed using LGR5 after washing twice with PBS2, and then measurement was performed under a fluorescence microscope by adding a mounting solution thereto.

[0127] In the case of FIG. 10, the cultured standard-type organoid was taken out, and Live/Dead fluorescence staining was performed. In the case of fluorescent staining, 1 mM calcein and 2 mM EtdH-1 were respectively stored at 2 μl per 1 ml and 1 μl per 1 ml in an incubator for 30 to 60 minutes, and then measurement was performed under a fluorescence microscope.

[0128] 4. Analysis of Organoid Images

[0129] The cells cultured in Example 1-1 and Comparative Example 1 were photographed, and the sizes of cell spheres were compared. Spheroids were subjected to imaging by an automated plate device, and in this case, the device was allowed to perform imaging by automatically focusing. Image size analysis was performed using a macro program of the ImageJ program.

[0130] Moreover, the results are illustrated in FIG. 4. FIG. 4 is a view illustrating the high-speed mass imaging results of Example 1-1 and Comparative Example 1 ((A) Example 1-1, (B) Comparative Example 1).

[0131] Referring to FIG. 4, it was confirmed that in the case of Example 1-1, the diameters of the cells cultured on the cell culture plate of the present invention were almost uniform. Specifically, when cells were seeded in each sub well at 100 cells/well on average, a uniform organoid that could be comparatively analyzed could be manufactured. In this case, the error range for the organoid size was around 20 μm. Through this, it can be seen that a standard organoid can be produced using the organoid culture method according to the present invention.

[0132] In contrast, it could be confirmed that in the case of Comparative Example 1 using a well plate in the related art, cell spheres having different sizes were formed. The error range of the size of organoids generated due to the growth of multiple cells in the dome morphology of one Matrigel appeared with a deviation of 150 μm or more, and the cells were grown while overlapping, such that it was impossible to perform uniform high-speed mass imaging and experiments.

[0133] The base and well plate of the present invention include a convex part and a concave part to fix each other, respectively, and the convex part and the concave part may be connected to each other for the base to firmly fix the well plate, showing that an image in the well plate can be uniformly captured.

[0134] In contrast, it can be seen that the size and shape of the organoids cultured in Comparative Example 1 are not uniform. This seems to make image analysis difficult because the focal deviation of the imaging is increased in the absence of a plate base.

[0135] Further, referring to FIG. 5, it was confirmed that when the cell culture plate of the present invention was used even without containing Matrigel, organoids were formed well.

[0136] FIG. 6 confirms the expression level by staining LGR5, which is the most important marker for the formation of colorectal cancer organoids in order to confirm whether the cultured organoids were successfully formed. In addition, the presence of a colon-specific structure in the colorectal cancer organoids of a low-concentration Matrigel group or a group in which Matrigel was not used, formed through F-actin staining, was confirmed.

[0137] 6. Production of Standard-Type Organoid

[0138] The cells cultured in Example 1-1 and Comparative Example 1 were subjected to high-speed mass imaging.

[0139] The organoids produced in Example 1-1 and Comparative Example 1 were subjected to imaging by an automated plate device, and in this case, the device was allowed to perform imaging by automatically focusing. Image size analysis was performed using a macro program of the ImageJ program.

[0140] Moreover, the results are illustrated in FIGS. 7 and 8.

[0141] FIG. 7A is a set of photographs illustrating the high-speed mass imaging results of Example 1-1, FIG. 7B is a graph illustrating the area of the organoids cultured for a certain period of time in Example 1, FIG. 8A is a set of photographs illustrating the high-speed mass imaging results of Comparative Example 1, and FIG. 8B is a graph illustrating the area of the organoids cultured for a certain period of time in Comparative Example 1.

[0142] Referring to FIG. 7, it can be confirmed that when the organoid prepared in Example 1-1 was subjected to automatic imaging, imaging can be performed without a large error because an imaging height is uniform, and due to this fact, an error range is very small when the actual area is measured.

[0143] In particular, when the organoid is cultured using the cell culture plate of the present invention, the organoid is cultured in a uniform size. That is, standardization is possible. As a result of standardization, the focus was automatically determined during image measurement, and a deviation for the measured height was minimized by a connector structure. Accordingly, when the screening image is measured, a deviation of around 20 μm is exhibited, which is very small.

[0144] Referring to FIG. 8, it can be confirmed that in the case of Comparative Example 1, the organoids grow while overlapping each other, and it can be seen that the size and distribution position of the organoids are different, and thus cannot be standardized. Therefore, during the measurement of the screening image, a deviation of up to 150 μm is exhibited, which is large.

[0145] The results as described above are because when organoids are cultured by methods in the related art, since the organoids are grown randomly in Matrigel, it is difficult to uniformly culture a desired organoid, and a measured height is also variable, and thus, there is a limit in which it is difficult to apply the measured height to organoid screening imaging. Therefore, when the area of the organoid cultured for a certain period of time is analyzed, the deviation appears to be very large.

[0146] In the case of FIG. 9, in the standard-type organoids produced as a whole, the diameter of each organoid was measured using the Image J program. A total of 864 wells were subjected to high-speed mass imaging, it was confirmed that a uniform diameter was obtained by analyzing each of the images by ImageJ.

[0147] FIG. 9 illustrates the imaging results and the size of the organoid when the colorectal cancer cells of Example 1-1 were cultured for 14 days. It can be seen that it is possible to manufacture a standard organoid because the size of the organoids is uniform at 300 to 50 μm.

Example B: Selection of Cancer Organoid Having Resistance to Anticancer Agent and Radiation

[0148] 1. Construction of Colorectal Cancer Organoid

[0149] As previously shown, it was confirmed that the standard-type cancer organoid could be mass-produced using the cell culture plate of the present invention. Based on this, a cancer organoid having resistance to an anticancer agent and radiation was selected from a patient with cancer. Specifically, a human colorectal sample was obtained with the approval of the Institutional Review Board (IRB) of ASAN Medical Center, Seoul, Korea. This colorectal cancer tissue was made into cells and isolated into single cells, and then 10 types of uniform and standardized colorectal cancer organoids were constructed by including 2 vol % of Matrigel using the cell culture plate of the present invention (No. 1:F59, No. 2:M60, No. 3: F48, No. 4: F49, No. 5: F55, No. 6: F77, No. 7: M75, No. 8: M68, No. 9: M76, No. 10: M62).

[0150] 2 Immunofluorescence Staining Method of Cancer Organoids

[0151] Cultured organoids were washed once with PBS, treated with a culture solution including 2 μM calcein AM, 2 μM EthD-1, and 2 drops/1 ml of Hoechst33342, and then treated in an incubator (37° C., CO.sub.2 5%) for 60 to 90 minutes. After the treatment, the culture solution was replaced with a culture solution which does not include a staining kit, and then the expression of cell nuclei, live cells, and dead cells was confirmed under a fluorescence microscope.

[0152] 3. Measurement of Viability of Cancer Organoid

[0153] Based on the expression images of cell nuclei, live cells, and dead cells measured by the method in FIG. 11, measurement was performed by ImageJ. After the image was processed with a threshold, an area ratio was measured. A viability of the organoid was obtained using the measured area ratio to calculate the ratio of live cells to total cells.

[0154] 3: Selection of Cancer Organoid Having Resistance to Anticancer Agent and Radiation

[0155] The above 10 types of colorectal cancer organoids were each independently treated with an anticancer agent (5-FU) and radiation. The colorectal cancer organoids were treated with the anticancer agent and radiation at a concentration of 1, 5, 10 and 15 μM and a concentration of 2, 2+2+2 and 6 Gy, respectively. A group untreated with the anticancer agent and the radiation was used as a control. As a result, as illustrated in FIG. 10, No. 4, No. 6 and No. 9 were primarily selected. Referring to FIG. 11, the size of the No. 9 cancer organoid among Nos. 4, 6 and 9 did not decrease significantly when treated with the anticancer agent and radiation. Therefore, the No. 9 cancer organoid was selected as an organoid having resistance to an anticancer agent and radiation.

[0156] 4. Confirmation of Resistance Characteristics of Selected Organoids Having Resistance to Radiation and Anticancer Agent

[0157] In FIG. 12, PCR was performed to confirm the changes in gene units of organoids after drug treatment and irradiation with radiation. The organoids were transferred to a 1.5-ml tube and washed with PBS, and then RNA was extracted using an RNA extraction kit manufactured by Qiagen. The concentration of RNA was measured by NanoDrop, and based on this, RNA was converted into cDNA using a cDNA conversion kit manufactured by Applied Biosystems. In order to confirm the effects of drugs and radiation, primers capable of confirming the expression of caspase3 (CASP3) and BAD, which are representative genes related to cell death, and Ki67, which is related to cell proliferation were manufactured (Table 1), and gene expression of the organoids treated with the drug and radiation was confirmed by PCR based on primers and cDNA. Through this, it could be confirmed that in the case of organoids showing resistance to drugs and radiation, the expression of cell death was relatively low and the expression of cell proliferation was relatively high. Referring to FIG. 12, it can be seen that in the case of the No. 9 cancer organoid, the expression of the cell proliferation gene is relatively higher than that of the cell death gene.

TABLE-US-00001 TABLE 1 Genes Primer sequences (5′-3′) Caspase3 forward ggcgaaattcaaaggatggc reverse aacccgggtaagaatgtgca BAD forward tttgaggaccttcgaccagc reverse aggtcttcagagtgagccca Ki67 forward agctgactctgccactaagc reverse gtccagctgtagtgcccaat

[0158] FIG. 13 quantitatively illustrates the changes in size of organoids after drug and radiation treatment. The size of the organoid was measured using ImageJ based on an organoid phase photograph on each date. The corresponding graph shows the results of quantifying the organoid size of the entire experimental group by the method of standardizing the organoid size of the control to 1. It could be confirmed that in the case of the No. 9 organoid, the resistance to the anticancer agent and radiation was higher than those of the Nos. 4 and 6 organoids. Through this, it was confirmed that an organoid having resistance to a drug and radiation could be selected by only culturing the standard-type cancer organoid according to the present invention and measuring the size of the cultured cancer organoid.

[0159] Through FIG. 13, a cancer organoid having resistance to radiation and an anticancer agent may be selected through its viability and size.

[0160] Specifically, referring to the data of No. 9, which is a group having resistance to radiation, the case of being irradiated with radiation at a low concentration and a low concentration of radiation several times (this case is similar to a general protocol/clinical trial) and the case of being irradiated with excessive radiation were compared with each other. In the case of a No. 9 patient (KRAS mutation patient/resistant to radiation and an anticancer agent), it can be seen that when a change in size for 7 days of being irradiated with radiation is observed, the size is maintained at an almost 70% to 100% level, the viability itself was not changed, and it can be seen that for 7 days of treatment, the size of cells is changed by an approximate 30% level. It can be confirmed that the cells proliferate and increase in size rapidly without treatment after 7 days.

[0161] It could be seen that a No. 9 patent (KRAS mutation patient/resistant to radiation and an anticancer agent), which is a group having resistance to an anticancer agent did not exhibit any response to a drug at a low concentration, the viability ranges from 100% to 70%, and the morphology of cells was not reduced. In addition, while the KI67 gene increased rapidly even after the drug was removed, a pattern showing the appearance of suppressing cell death was exhibited. These results are a phenomenon typical of a patient having resistance to an anticancer agent, where viability is desired to be maintained within a range of 70%, and it could be confirmed that while the cell proliferation rate became more uniform than the cell death rate, the cells rapidly recovered in the future. Furthermore, it was confirmed that even in the change in size, when the size of the period during which the drug was administered for the initial 7 days was confirmed, the case where the size is not reduced by 60% or more showed a pattern in which cells recovered again.

[0162] FIG. 14 summarizes standard-type cancer organoids produced according to the present invention by main mutation characteristics by categorizing the cancer organoids by each mutation and grouping the cancer organoids by characteristics of cells.

[0163] As an experimental method, the organoids were transferred to a 1.5-ml tube and washed with PBS, and then RNA was extracted using an RNA extraction kit manufactured by Qiagen. Genetic information on RNA was confirmed based on a TruSeq RNA Access library provided by Illumina.

[0164] Referring to FIG. 14, it could be confirmed that as a result of genomic tests of specimens selected after drug and irradiation with radiation, complex oncotarget mutagenesis such as TP53, APC, PIK3CA and KRAS was exacerbated in specimens showing resistance. In particular, it could be confirmed that in the case of the No. 9 organoid, all of TP53, APC, PIK3CA and KRAS were expressed. Through this, it can be seen that when the cancer organoid having resistance to an anticancer agent and/or radiation selected by the present invention is used, a patient having resistance to an anticancer agent and/or radiation can be diagnosed without a separate genomic test.

[0165] A drug which alleviates the drug resistance of cancer cells can be screened by treating the thus selected organoid having resistance to an anticancer agent and/or radiation with a candidate material which alleviates the drug resistance of cancer cells along with a cancer resistance drug. Specifically, when a candidate drug which alleviates the drug resistance of cancer cells is effective, the viability of the organoid having resistance to an anticancer agent and/or radiation selected by the present invention will be lower than that of the control (group untreated with the candidate drug which alleviates the drug resistance of cancer cells).

[0166] Further, when the present invention is used, a cancer tissue is isolated from a patient with cancer and cultured in the 3D cell culture plate mentioned in the present invention to produce a standard-type cancer organoid, and then it can be easily diagnosed whether the cancer organoid has resistance to an anticancer agent and radiation. Moreover, if the patient is diagnosed with a cancer patient having resistance to an anticancer agent and/or radiation, a drug which alleviates the resistance of cancer cells can be screened by treating this cancer organoid with a material which alleviates the drug resistance of cancer cells. That is, patient-customized drug screening is possible.

[0167] As described above, through the standard-type organoid production method of the present invention, an organoid having resistance to an anticancer agent and/or radiation is selected and confirmed only with the steps of culturing the organoid and treating the organoid with an anticancer agent and/or a drug without a complex genomic test by culturing a cancer tissue obtained from a patient with cancer into organoids, and through this, it can be diagnosed whether the patient with cancer has resistance to an anticancer agent and/or radiation.

[0168] Although a specific part of the present invention has been described in detail, it will be obvious to those skilled in the art that such a specific description is just a preferred embodiment and the scope of the present invention is not limited thereby. Accordingly, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

DESCRIPTION OF REFERENCE NUMERALS AND SYMBOLS

[0169] 100: Well plate

[0170] 101: Step

[0171] 110: Main well

[0172] 120: Sub well

[0173] 121: Recessed part

[0174] 130: Space part

[0175] 140: Concave part

[0176] 200: Connector for large-capacity and high-speed HCS

[0177] 210: Base

[0178] 220: Cover

[0179] 240: Convex part