COMPOSITIONS FOR TARGETING RECEPTOR FOR ADVANCED GLYCATION END-PRODUCTS (RAGE) IN A CHRONIC INFLAMMATORY CONDITION

Abstract

The invention discloses compositions and methods comprising enriched Bisdemethoxycurcumin (BDMC) present not less than 20% w/w for use in inhibiting Receptor for Advanced Glycation End-Products (RAGE) expression in a subject with chronic-inflammatory condition. The composition further comprises β-amyrin palmitate (BAP). The invention also includes disclose the use of the above composition in the management of chronic inflammatory condition in a subject

Claims

1. A method for inhibiting Receptor for Advanced Glycation End products (RAGE) expression in a subject with chronic inflammatory condition, comprising: (a) identifying said subject with the chronic inflammatory condition; b) administering to said subject with a composition comprising enriched Bisdemethoxycurcumin (BDMC) present not less than 20% w/w.

2. The method as claimed in claim 1, wherein the composition comprises of 20-50% w/w BDMC, 10-25% w/w demethoxycurcumin (DMC) and 30-50% w/w curcumin, with the total curcuminoids in the composition are in the range of 20-95% w/w.

3. The method as claimed in claim 1, wherein the composition further comprises s-amyrin palmitate (BAP).

4. The method as claimed in claim 1, wherein inhibition RAGE expression results in decreasing expression of inflammatory markers, decreasing oxidative stress, and moderating glycation levels.

5. The method as claimed in claim 1, wherein inhibition of RAGE expression is brought about by curcuminoids, BAP, or their combination selected from the range of 1-10 μg/mL.

6. The method as claimed in claim 1, wherein inhibition of RAGE expression is brought about by treating with curcuminoids, BAP, or their combination selected from the range of 50 μg/kg-100 mg/kg resulting in decreased RAGE expression levels.

7. The method as claimed in claim 4, wherein the inflammatory marker is selected from the group consisting of TNF-α, IL-6, and IL-1β, wherein the decrease of the inflammatory marker expression is brought about by treating with curcuminoids, BAP, or combination selected from the group consisting of 50 μg/kg-100 mg/kg.

8. The method as claimed in claim 4, wherein the oxidative stress is decreased in the subject by treating with curcuminoids, BAP, or combination selected from the range of 50 μg/kg-100 mg/kg.

9. The method as claimed in claim 4, wherein moderating glycan levels is brought about by treating with curcuminoids, BAP, or combination selected from the range of 50 μg/kg-100 mg/kg.

10. The method as claimed in claim 1, wherein chronic inflammatory condition is selected from the group consisting of type II diabetes mellitus, cardiovascular diseases Alzheimer's disease, cancer, peripheral neuropathy, sensory losses and blindness.

11. The method as claimed in claim 1, wherein the subject is a mammal.

12. The method as claimed in claim 1, wherein the composition further comprises of stabilizing agents, bioavailability enhancers and antioxidants, pharmaceutically or nutraceutically or cosmeceutically accepted excipients and enhancers and administered orally in the form of tablets, capsules, syrups, gummies, powders, suspensions, emulsions, chewables, candies or eatables.

13. A method of treating chronic inflammatory condition in a subject, comprising: (a) identifying said subject, b) administering said subject with a composition comprising enriched Bisdemethoxycurcumin (BDMC) present not less than 20% w/w.

14. The method as claimed in claim 13, wherein the composition comprises of 20-50% w/w BDMC, 10-25% w/w demethoxycurcumin (DMC) and 30-50% w/w curcumin, with the total curcuminoids in the composition are in the range of 20-95% w/w.

15. The method as claimed in claim 13, wherein the composition further comprises β-amyrin palmitate (BAP).

16. The method as claimed in claim 13, wherein treating chronic inflammatory condition in the subject is brought about by inhibiting RAGE, moderating RAGE expression, decreasing expression of inflammatory markers, decreasing oxidative stress, and moderating glycation levels.

17. The method as claimed in claim 16, wherein the inhibition of RAGE is brought about by curcuminoids, BAP, or their combination selected from the range of 1-10 μg/mL.

18. The method as claimed in claim 16, wherein moderating RAGE expression is brought about by treating with curcuminoids, BAP, or their combination selected from the range of 50 μg/kg-100 mg/kg resulting in decreased RAGE expression levels.

19. The method as claimed in claim 16, wherein the inflammatory marker is selected from the group consisting of TNF-α, IL-6, and IL-1β, wherein the decrease of the inflammatory marker expression is brought about by treating with curcuminoids, BAP, or combination selected from the range of 50 μg/kg to 100 mg/kg.

20. The method as claimed in claim 16, wherein the oxidative stress is decreased in the subject by treating with curcuminoids, BAP, or combination selected from the range of 50 μg/kg-100 mg/kg.

21. The method as claimed in claim 16, wherein moderating glycan levels is brought about by treating with curcuminoids, BAP, or combination selected from the range of 50 μg/kg-100 mg/kg.

22. The method as claimed in claim 13, wherein chronic inflammatory condition is selected from the group consisting of type II diabetes mellitus, cardiovascular diseases Alzheimer's disease, cancer, peripheral neuropathy, sensory losses and blindness.

23. The method as claimed in claim 13, wherein the subject is a mammal.

24. The method as claimed in claim 13, wherein the composition further comprises of stabilizing agents, bioavailability enhancers and antioxidants, pharmaceutically or nutraceutically or cosmeceutically accepted excipients and enhancers and administered orally in the form of tablets, capsules, syrups, gummies, powders, suspensions, emulsions, chewables, candies or eatables.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0014] FIG. 1 shows effect of AC3, BAP, and their combinations on the expression of RAGE in pancreas. *P<0.05.

[0015] FIG. 2 shows effect of AC3, BAP, and their combinations on the effect of anti-glycation in pancreas. *P<0.05.

DESCRIPTION OF PREFERRED EMBODIMENTS

Selected Definitions

[0016] All the terms used in this application carry ordinary meaning as known in the prior art unless otherwise specified. Few other specific definitions used in this invention are explained below, which applies throughout this specification. Claims provide broader definition unless and otherwise specified.

[0017] In this application, any reference to sample refers to either one or combination of the following agents, which brings about the disclosed therapeutic effect. The agents include, enriched BDMC composition refers to curcuminoids composition comprising at least 20% w/w of BDMC. More specifically, AC3 is the preferred curcuminoids used in the invention and any reference to curcuminoids is AC3, which is 20-50% w/w bisdemethoxycurcumin, 10-25% w/w demethoxycurcumin and 30-50% w/w curcumin, and BAP refers to β-amyrin palmitate. Any reference to C3 complex, which is 75-81% curcumin, 15-19% demethoxycurcumin, and 2.2-6.5% bisdemethoxycurcumin. Also, curcuminoids refer to either BDMC, DMC, or AC3 depending on the example disclosed.

[0018] Therapeutically managing or management refers to a condition of effectively ameliorating conditions disclosed in the invention. Any reference to control in this specification refers to diabetic control, untreated control, Metformin control on the experiment and examples covered.

[0019] The invention in general covers a method and composition for use in inhibiting RAGE expression in a subject with a chronic inflammatory condition, with a composition comprising enriched Bisdemethoxycurcumin (BDMC) present not less than 20% w/w. The invention also covers a composition for use in therapeutically managing chronic inflammatory condition in a subject, with a composition comprising enriched Bisdemethoxycurcumin (BDMC) present not less than 20% w/w. Further, it also covers a method for treating chronic inflammatory condition in a subject, administering said subject with a composition comprising enriched Bisdemethoxycurcumin (BDMC) present not less than 20% w/w. Wherein the composition comprises of 20-50% w/w BDMC, 10-25% w/w demethoxycurcumin (DMC) and 30-50% w/w curcumin, with the total curcuminoids in the composition are in the range of 20-95% w/w The composition further comprises β-amyrin palmitate (BAP). In a related aspect, the subject is a mammal.

[0020] In the most preferred embodiment, the invention discloses a composition for use in inhibiting RAGE expression in a subject with chronic inflammatory condition, wherein the composition comprises enriched Bisdemethoxycurcumin (BDMC) present not less than 20% w/w. In another aspect of this embodiment, the composition comprises of 20-50% w/w BDMC, 10-25% w/w demethoxycurcumin (DMC) and 30-50% w/w curcumin, with the total curcuminoids in the composition are in the range of 20-95% w/w. In a related aspect of this embodiment, the composition further comprises β-amyrin palmitate (BAP). In a related aspect, the subject is a mammal.

[0021] In another most preferred embodiment of the invention, the invention discloses a composition for use in therapeutically managing chronic inflammatory condition in a subject, wherein the composition comprises enriched Bisdemethoxycurcumin (BDMC) present not less than 20% w/w. In another aspect of this embodiment, the composition comprises of 20-50% w/w BDMC, 10-25% w/w demethoxycurcumin (DMC) and 30-50% w/w curcumin, with the total curcuminoids in the composition are in the range of 20-95% w/w. In a related aspect of this embodiment, the composition further comprises β-amyrin palmitate (BAP). In a related aspect, the subject is a mammal.

[0022] In another most preferred embodiment of the invention, the invention discloses a method for inhibiting RAGE expression in a subject with chronic inflammatory condition, comprising (a) identifying said subject with chronic inflammatory condition; b) administering said subject with a composition comprising enriched Bisdemethoxycurcumin (BDMC) present not less than 20% w/w. In another aspect of this embodiment, the composition comprises of 20-50% w/w BDMC, 10-25% w/w demethoxycurcumin (DMC) and 30-50% w/w curcumin, with the total curcuminoids in the composition are in the range of 20-95% w/w. In a related aspect of this embodiment, the composition further comprises β-amyrin palmitate (BAP). In a related aspect, the subject is a mammal.

[0023] In yet another most preferred embodiment of the invention, the invention discloses a method treating chronic inflammatory condition in a subject, comprising (a) identifying said subject with chronic inflammatory condition; b) administering said subject with a composition comprising enriched Bisdemethoxycurcumin (BDMC) present not less than 20% w/w. In another aspect of this embodiment, the composition comprises of 20-50% w/w BDMC, 10-25% w/w demethoxycurcumin (DMC) and 30-50% w/w curcumin, with the total curcuminoids in the composition are in the range of 20-95% w/w. In a related aspect of this embodiment, the composition further comprises β-amyrin palmitate (BAP). In a related aspect, the subject is a mammal.

[0024] In related embodiments of the invention, inhibiting RAGE expression in a subject with chronic inflammatory condition is brought about by decreasing expression of inflammatory markers, decreasing oxidative stress, and moderating glycation levels. Further aspect of this embodiment, the inhibition of RAGE is brought about by curcuminoids, BAP, or their combination selected from the range of 1-10 μg/mL or preferably from 2-8 μg/mL, or preferably 4-6 μg/mL (Example 1, Tables 1-3). In another related aspect of this embodiment, wherein moderation of RAGE expression is brought about by curcuminoids, BAP, or their combination resulting in decrease of RAGE expression. RAGE expression was increased in diabetic rats. BAP had no effect on pancreatic RAGE expression AC3 reduced the expression by 30.3%. The combination reduced expression by 44.6 and 76.7% respectively While metformin was effective in reducing by 6.9 (FIG. 1, Example 3). In related aspect of this embodiment of the invention, decrease of the inflammatory marker (TNF-α, IL6, IL-1β) expression is brought about by treating with curcuminoids, BAP, or combination. The combinations showed 20-50-fold decrease compared to diabetic control, and the effect was more pronounced when 100 mg/kg of curcuminoids and 200 μg/kg of BAP was used compared to the individual treatment (Table 6, Example 3). In another aspect of this embodiment of the invention, oxidative stress is decreased in the subject, and brought about by curcuminoids, BAP, or their combination. The combinations had a better effect with 3-4 fold decrease compared to the BAP with 2 fold decrease from the diabetic control (Table 7, Example 4). In another aspect of this embodiment of the invention, moderation of glycan levels is brought about by treating with curcuminoids, BAP, or combination. The effect of Protein carbonylation was inhibited between 6 to 10-fold when either curcuminoids or BAP are used individually, and the combination provided 20 fold change from the hyperglycemic control (FIG. 2, Example 5). In a related aspect, the subject is a mammal.

[0025] In related embodiments of the invention therapeutic effects in a subject are brought about by treating with curcuminoids, BAP from the range of 50 μg/kg to 100 mg/kg. More preferably curcuminoids between 1-100 mg/kg, or more preferably between 50-100 mg/kg or most preferably 100 mg/kg. BAP is selected from the range of 50-200 μg/kg, or more preferably 50 μg/kg or most preferably at either 50 μg/kg or 200 μg/kg. The combination of curcuminoids and BAP are selected from the range of 50 μg/kg to 100 mg/kg, or more preferably BAP either at 50 μg/kg or 200 μg/kg and curcuminoids at 100 mg/kg. In related embodiments of the invention chronic inflammatory condition is selected from the group consisting of type II diabetes mellitus, cardiovascular diseases Alzheimer's disease, cancer, peripheral neuropathy, sensory losses and blindness. In a related aspect, the subject is a mammal.

[0026] In another related embodiment of the invention, wherein the composition further comprises of stabilizing agents, bioavailability enhancers and antioxidants, pharmaceutically or nutraceutically or cosmeceutically accepted excipients and enhancers and suitably formulated to be administered orally in the form of tablets, capsules, syrups, gummies, powders, suspensions, emulsions, chewables, candies or eatables (Example 7). It is well within the scope of a person skilled in the art to come up with a suitable formulation for administration

[0027] In another embodiment of the invention discloses inhibition of DPP4 (Dipeptidyl-peptidase 4), α-glucosidase, and anti-glycation using AC3, C3, or individual curcuminoids composition (Tables 8-11).

[0028] Other modifications and variations of the invention will be apparent to those skilled in the art from the foregoing disclosure and teachings. Thus, while only certain embodiments of the invention have been specifically described herein, it will be apparent that numerous modifications may be made thereto without departing from the spirit and scope of the invention.

EXAMPLES

Example 1: Antiglycation—A Measure of Preventing Advanced Glycation End Products In Vitro

[0029] Glycation is the non-enzymatic glycosylation reaction involving amino groups of proteins, lipids, or nucleic acids with sugar aldehyde or keto groups resulting in the formation of advanced glycosylation end-products (AGE) (Yamagishi et al. Pathologic role of dietary advanced glycation end products in cardiometabolic disorders, and therapeutic intervention, Nutrition, 32(2), 157-65 (2016)). The reactive carbonyls of sugars combine with amino groups of a protein, lipid or nucleic acid generating Schiff bases, which rearrange to Amadori products. In a series of slow reactions, the Amadori reactions, Schiff base and Maillard reactions, ultimately form AGE. Although glycation is slow in vivo, the glycation products have long-lasting effects. The effect of test substances on preventing the formation of AGE was evaluated in vitro

[0030] Anti-glycation activity was evaluated as described earlier (Sero et al. Tuning a 96-Well Microtiter Plate Fluorescence-Based Assay to Identify AGE Inhibitors in Crude Plant Extracts) Briefly, 10 μl of various sample concentrations were added to 40 μl of 25 mg/m bovine serum albumin and 50 μl of 150 mg/ml D-Ribose in a 96 well black microplate. D-Ribose with buffer served as control. The plate containing the mixture was incubated for 24 h at 37° C. The advanced glycation product was detected by measuring the fluorescence intensity at Ex/Em of 390/460 nm by using BMG FLUOstar Optima Microplate reader. The formation of AGE (non enzymatic reaction between protein (BSA) and sugar (ribose)) was inhibited by AC3 in a concentration dependent manner (Table 2). BAP was a poor inhibitor of AGE formation (Table 1). Combination of AC3 and BAP could synergistically increase the inhibition of glycation in vitro (Table 3).

[0031] Tables 1 & 2: Concentration Dependent Inhibition of BAP and AC3

TABLE-US-00001 Conc. BAP Percentage (μg/mL) Inhibition 1 0 2 11.92 4 9.67

TABLE-US-00002 Conc. AC3 Percentage (μg/mL) Inhibition 4 11.10 6 17.91 8 16.48

TABLE-US-00003 TABLE 3 Concentration dependent inhibition of AC3 BAP combination Conc. Percentage AC3:BAP(μg/mL) Inhibition 4:1 21.04 4:2 16.71 4:4 22.37

Example 2: Inhibition of Age and RAGE in Physiological Conditions Taking the Example of Diabetes

[0032] To study the effect of AGE and RAGE interaction and their pathological consequences, diet induced diabetes was used as a model.

[0033] Wistar Rats (150 g) were given High fat and fructose diet (HFFD) to induced type 2 diabetes (T2D)). HFFD induces the development of diabetes associated with long term metabolic disorders including Fasting hyperglycemia, pre- and post-prandial hyperinsulinemia, Insulin resistance, Glucose intolerance and Dyslipidemia. Animals in HFFD show complications associated with T2D such as hepatic steatosis complicated by fibrosis, inflammation, hyperleptinemia and endothelial dysfunction.

[0034] Rats were co administered with AC3 (100 mg/kg), BAP (200 μg/kg) BAP+AC3 (200 μg+100 mg/kg) BAP+AC3 (50 μg+100 mg/kg) and Metformin as positive control at 100 mg/kg along with HFFD for 90 days (Table 4) The organs were collected at the end of the experiment to evaluate the effect of the supplements on RAGE expression, oxidative stress and inflammation.

TABLE-US-00004 TABLE 4 Study Group Animals (Rats) No. of Group No Treatment group Dose animals 1 Control — 6 2 HFFD control High fat and fructose induced 6 hyperglycaemia 3 BAP 200 μg/kg 6 4 AC3 100 mg/kg 6 5 AC3 + BAP 100 mg/kg + 50 μg/kg 6 6 AC3 + BAP 100 mg/kg + 200 μg/kg 6 7 Metformin 100 mg/kg 6 Positive control

Example 3: RAGE Expression in Pancreas

[0035] DNA was extracted from pancreas sample using the trizol method. The pancreas tissues were homogenized in liquid nitrogen followed by trizol extraction and DNAse to remove any traces of DNA. First-strand cDNA was prepared from RNA samples using oligo dT primers and Superscript III reverse transcriptase (cDNA synthesis kit, Invitrogen™). Quantitative real-time PCR (qRT-PCR) was performed with SYBR Green I fluorescent dye using Light cycler 96 according to the manufacturer's instructions (Light Cycler® FastStart DNA Master SYBR Green I, Roche). The primers used for the analysis are provided in Table 5. The beta actin gene was used as the housekeeping gene. The gene expression of the target gene in each test sample was determined by relative quantification using the comparative Ct (ΔΔCt) method.

[0036] RAGE expression was increased in diabetic rats. BAP had no effect on pancreatic RAGE expression AC3 reduced the expression by 30.3%. The combination reduced expression by 44.6 and 76.7% respectively While metformin was effective in reducing by 6.9% (FIG. 1)

TABLE-US-00005 TABLE 5 List of Primers for the marker expression Si No Oligo Name Sequence 5′ to 3′ 1 R RAGE F ACAGAAACCGGTGATGAA GG Seq ID-1 R RAGE R CTCTCCTCGAGTCTGGGTTG Seq ID-2 2 R Beta actin F CCCGCGAGTACAACCTTCT Seq ID-3 R Beta actin R CGTCATCCATGGCGAACT Seq ID-4 3 R TNF alpha F ACTGAACTTCGGGGTGATTG Seq ID-5 R TNF alpha R GCTTGGTGGTTTGCTACGAC Seq ID-6 4 R IL-6 F CTCTCCGCAAGAGACTTCCAG Seq ID-7 R IL-6 R TTCTGACAGTGCATCATCGCT Seq ID-8 5 R IL-1beta F CACCTTCTTTTCCTTCATCTTTG Seq ID-9 R IL-1beta R GTCGTTGCTTGTCTCTCCTTGTA Seq ID-10

TABLE-US-00006 TABLE 6 Expression levels of Markers AC3 + BAP AC3 + BAP AC3 (100 mg/kg + (100 mg/kg + Marker Normal Diabetic BAP 200 μg/kg (100 mg/kg) 50 μg/kg) 200 μg/kg) Met TNF-α 1 1.73 ± 0.34 2.01 ± 0.31 1.60 ± 0.36 1.33 ± 0.01 0.91 ± 0.06 0.91 ± 0.22 IL-6 1 1.60 ± 0.09 2.09 ± 0.08 1.47 ± 0.14 1.25 ± 0.20 0.89 ± 0.14 1.04 ± 0.12 IL-1β 1 1.66 ± 0.04 1.62 ± 0.11 1.47 ± 0.18 0.73 ± 0.04 0.70 ± 0.12 0.89 ± 0.05

[0037] The expression of inflammatory cytokines showed an increase in diabetic rats compared to control. BAP at 200 ug/kg was not effective in reducing the cytokine expression in pancreas, while AC3 was minimally active. The combination was highly effective in reducing the expression levels of inflammatory cytokines (Table 6) (p<0.05).

Example 4: Estimation of Oxidative Stress

[0038] The level of oxidative stress in tissue was estimated by using 20,70-dichlorofluorescin diacetate (DCFDA), a fluorogenic dye that measures hydroxyl, peroxyl, and other reactive oxygen species (ROS) activity. Briefly, an aliquot of the tissue homogenates (10 μL) were mixed with 150 μL ethanol solution of DCFDA to the final concentration of 10 mM. After incubation for 30 min at room temperature in dark, the fluorescence was measured with the excitation and emission wavelengths of 488 and 520 nm. Higher the fluorescence, higher is the oxidative stress. oxidative stress is decreased in the subject, and brought about by curcuminoids, BAP, or their combination. The combinations had a better effect with 3-4 fold decrease compared to the BAP with 2 fold decrease from the diabetic control (Table 7).

TABLE-US-00007 TABLE 7 Relative Fluorescence Intensity Measuring Oxidative Stress Relative Fluorescence Intensity Sample Average Std deviation Normal 6.5 4.2 Diabetic 23.8 3.9 BAP (200 μg/kg) 11.5 1.4 AC3 + BAP (100 mg/kg + 50 μg/kg) 8.5 2.1 AC3 + BAP (100 mg/kg + 200 μg/kg) 20.8 1.8 Met 28.94 1.1

Example 5: Protein Carbonylation and AGE-Protein Carbonylation in Pancreas

[0039] Protein carbonylation is defined as an introduction of reactive carbonyl moiety, such as an aldehyde, ketone, or lactam, in a protein via oxidative stress-related reactions. Therefore, the term “carbonyl stress” has been suggested to describe the unusual accumulation of reactive carbonyl species due to disturbance of their production or cellular metabolism. Compared to other oxidative modifications, protein carbonyls have unique stability, can circulate in blood for a longer period and a wide range of downstream functional consequences. Chronic diseases like diabetes, lung disease, renal failure, and Alzheimer's disease are some of the consequences of carbonylated proteins. Apart from AGE, hyperglycemia can increase protein carbonylation. In diabetes, increased level of reactive oxygen species (ROS) in combination with hyperglycemia, lead to the formation of reactive carbonyl-containing intermediates such as glyoxal and methylglyoxal (MG) derived from the oxidation of glucose. Thus lowering the Protein carbonyl compounds is being pursued as a novel mechanism for managing chronic diseases.

[0040] Fluorimetric NBDH (7-hydrazino-4-nitrobenzo-2,1,3-oxadiazole) Assay of Protein Carbonyls (PCs)

[0041] This assay is based on the reaction of NBDH with carbonyls via hydrazone formation to form highly fluorescent products (Vidal et al., 2014). All protein-containing or biological samples were diluted 2-fold in PBS. The 100 μL of diluted protein samples was placed in a black 96-well micro plate. To that 100 μL of NBDH solution (200 μM NBDH in PBS (pH 7.4) with 1 M HCl) was added and incubated at 37° C. for 20 minutes with mild shaking. The fluorescence was measured at 560 nm, exciting at 480 nm. effect of Protein carbonylation was inhibited between 6 to 10-fold when either curcuminoids or BAP are used individually, and the combination provided 20-fold change from the hyperglycemic control (FIG. 2). The combination of AC3 and BAP showed considerable effect than the individual treatment.

Example 6: Activities Against DPP4, α-Glucosidase, and Glycation

[0042] The bisdemethoxycurcumin (AC3) composition exhibiting control on hyperglycemia by inhibiting DPP4 enzyme (Table 8), α-glucosidase enzyme (Table 9), and effect of individual curcuminoids, C3 complex, AC3 complex on anti-glycation and DPP4 in a dose dependent manner. AC3 complex was better inhibitor for anti-glycation than individual curcuminoids (Table 10), and curcumin was as effective as AC3 against DPP4 (Table 11)

TABLE-US-00008 TABLE 8 Inhibition of DPP4 AC3 Concentration Inhibition (μg/ml) (%) 250 85.04 125 72.87 62.5 56.43 31.25 39.63 15.625 17.73 IC50 43.38 ug/mL

TABLE-US-00009 TABLE 9 Inhibition of Alpha glucosidase activity AC3 Concentration Inhibition (μg/mL) (%) 30 34.52 15 11.41 7.5 8.65

TABLE-US-00010 TABLE 10 Anti-Glycation activity of Curcuminoids at 24 and 72 hrs Conc AC3 (mg/mL) Curcumin BDMC DMC C3 Complex Complex 24 hrs (320/405) 0.625 35.90 77.84 84.98 74.18 98.90 0.3125 29.67 62.64 73.81 61.36 92.54 72 hrs (320/405) 0.625 44.42 42.42 57.71 47.38 92.39

TABLE-US-00011 TABLE 11 Anti-DPP4 activity of curcuminoids Conc C3 AC3 (mg/mL) Curcumin BDMC DMC Complex Complex 50 70.29 58.55 62.60 74.58 73.61 25 48.88 56.07 39.86 56.04 57.90 12.5 14.11 43.58 23.56 38.27 39.99

Example 7: Formulations Containing AC3 and β-Amyrin Palmitate

[0043] The composition is formulated along with pharmaceutically/nutraceutically acceptable excipients, adjuvants, diluents, stabilizing agents, dispersible gums, bioavailability enhancers or carriers and administered orally in the form of tablets, capsules, syrups, gummies, powders, suspensions, emulsions, chewables, candies or eatables.

[0044] In a related aspect the bioavailability enhancer is selected from the group of piperine (BioPerine®), quercetin, garlic extract, ginger extract, and naringin. In another related aspect, the stabilizing agent is selected from the group consisting rosmarinic acid, butylated hydroxyanisole, butylated hydroxytoluene, sodium metabisulfite, propyl gallate, cysteine, ascorbic acid and tocopherols. In yet another related aspect, the dispersible gums are selected from the group consisting of Agar, Alginate, Carrageenan, Gum Arabic, Guar Gum, Locust Bean Gum, Konjac Gum, Xanthan Gum and Pectin.

[0045] Tables 12-16 provide illustrative examples of nutraceutical formulations containing bisdemethoxycurcumin

TABLE-US-00012 TABLE 12 Tablet Active Ingredients AC3, β-Amyrin Palmitate Excipients Microcrystalline cellulose, Colloidal silicon dioxide, Magnesium stearate, BioPerine ®, Polyvinylpyrrolidone/starch/Hydroxy propyl methyl cellulose, Hydroxy propyl cellulose

TABLE-US-00013 TABLE 13 Capsule Active Ingredients AC3, β-Amyrin Palmitate Excipients Microcrystalline cellulose, BioPerine ®

TABLE-US-00014 TABLE 14 Powder Active Ingredients AC3, β-Amyrin Palmitate Excipients BioPerine ®,

TABLE-US-00015 TABLE 15 Gummy formulation Active Ingredients AC3, β-Amyrin Palmitate Excipients BioPerine ®, Gelatin (270 Bloom Mesh 10), Refined Sugar, Glucose Corn Syrup, Citric Acid, Lactic Acid, Water, Natural Mango Flavor M38630, Tartaric Acid, Refined Sugar

TABLE-US-00016 TABLE 16 Candy formulation Active Ingredients AC3, β-Amyrin Palmitate Excipients BioPerine ®, Sucrose, Liquid Glucose, Flavoring agent, Menthol, Acidulants (Citric acid/Tartaric Acid/Maleic Acid), Purified water

[0046] The above formulations are merely illustrative examples, any formulation containing the above active ingredient intended for the said purpose will be considered equivalent.

[0047] Other modifications and variations of the invention will be apparent to those skilled in the art from the foregoing disclosure and teachings. Thus, while only certain embodiments of the invention have been specifically described herein, it will be apparent that numerous modifications may be made thereto without departing from the spirit and scope of the invention and is to be interpreted only in conjunction with the appended claims.