Methods for regulating nitrogen metabolism during the production of ethanol from corn by metabolically engineered yeast strains
11274319 · 2022-03-15
Assignee
Inventors
Cpc classification
Y02E50/10
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12Y101/01002
CHEMISTRY; METALLURGY
C12Y104/01004
CHEMISTRY; METALLURGY
C12N9/50
CHEMISTRY; METALLURGY
C12N9/0008
CHEMISTRY; METALLURGY
C12Y302/01003
CHEMISTRY; METALLURGY
C12N9/2428
CHEMISTRY; METALLURGY
C12N9/1029
CHEMISTRY; METALLURGY
C12Y203/01054
CHEMISTRY; METALLURGY
C12Y197/01004
CHEMISTRY; METALLURGY
C12Y102/0101
CHEMISTRY; METALLURGY
International classification
C12N9/50
CHEMISTRY; METALLURGY
C12N9/00
CHEMISTRY; METALLURGY
Abstract
The present invention provides for a mechanism to reduce glycerol production and increase nitrogen utilization and ethanol production of recombinant microorganisms. One aspect of this invention relates to strains of S. cerevisiae with reduced glycerol productivity that get a kinetic benefit from higher nitrogen concentration without sacrificing ethanol yield. A second aspect of the invention relates to metabolic modifications resulting in altered transport and/or intracellular metabolism of nitrogen sources present in corn mash.
Claims
1. A method of producing a fermentation product comprising: a) providing a recombinant yeast comprising: (i) at least one engineered genetic modification that leads to the up-regulation of one or more native and/or heterologous enzymes that function in one or more ethanol production pathways; (ii) and, at least one engineered genetic modification that leads to the down-regulation of an enzyme in a glycerol-production pathway; and, (iii) at least one engineered genetic modification that leads to the up-regulation or down-regulation of an enzyme in a nitrogen-assimilation pathway; wherein the upregulated enzyme that acts in the ethanol production pathway is selected from the group consisting of pyruvate formate lyase (EC 2.3.1.54), pyruvate formate lyase activating enzyme (EC 1.91.1.4), bifunctional acetaldehyde-alcohol dehydrogenase selected from a group of enzymes having both of the following Enzyme Commission Numbers: EC 1.2.1.10 and 1.111; and an NADPH-dependent bifunctional acetaldehyde-alcohol dehydrogenase selected from a group of enzymes having both of the following Enzyme Commission Numbers: EC 1.2.1.10 and 1.1.1.2; wherein the down-regulated enzyme in the glycerol-production pathway is selected from the group consisting of glycerol-3-phosphate dehydrogenase 1 polynucleotide (GPD1) (EC 1.1.1.8), glycerol-3-phosphate dehydrogenase 1 polypeptide (Gpd1) (EC 1.1.1.8), glycerol-3-phosphate dehydrogenase 2 polynucleotide (GPD2) (EC 1.1.1.8), glycerol-3-phosphate dehydrogenase 2 polypeptide (Gpd2) (EC 1.1.1.8), glycerol-3-phosphate phosphatase 1 polynucleotide (GPP1) (EC 3.1.3.21), a glycerol-3-phosphate phosphatase polypeptide 1 (Gpp1) (EC 3.1.3.21), a glycerol-3-phosphate phosphatase 2 polynucleotide (GPP2) (EC 3.1.3.21), and glycerol-3-phosphate phosphatase polypeptide 2 (Gpp2) (EC 3.1.3.21); and wherein the down-regulated enzyme in the nitrogen-assimilation pathway is glutamate dehydrogenase (Gdh) (EC 1.4.1.4); or wherein the up-regulated enzyme in the nitrogen-assimilation pathway is at least one enzyme selected from the group consisting of glutamate dehydrogenase (Gdh) (EC 1.4.1.2), glutamate synthase (Glt) (EC 1.4.1.14), and glutamine synthase (Gln) (EC 6.3.1.2); an ammonium transporter; a urea-amido lyase (EC 6.3.4.6); and a urea transporter; b) contacting the composition with a carbon containing feedstock, wherein the recombinant yeast is capable of fermenting the carbon containing feedstock to yield the fermentation product; and, c) optionally recovering the fermentation production.
2. The method of claim 1, wherein the fermentation product is ethanol.
3. The method of claim 1, wherein the recombinant yeast produces glycerol at a lower yield than an otherwise identical yeast lacking the genetic modifications.
4. The method of claim 1, wherein the up-regulated enzyme in the nitrogen-assimilation pathway is a Gdh7 isolated from an organism from a genus selected from the group consisting of Saccharomyces and Neurospora (Gdh2); a Glt1 isolated from an organism from the genus Saccharomyces (Glt1); a Gln1 isolated from an organism from the genus Saccharomyces (Gln1′); a MEP protein selected from the group consisting of; Mep1, Mep2, and Mep3 and isolated from an organism from a genus selected from the genus Saccharomyces; a urea-amido lyase isolated from an organism from the germs Saccharomyces; a Dur3 or a Dur4 isolated from an organism from the genus Saccharomyces; or a Gln 3 isolated from the genus Saccharomyces.
5. The method of claim 1, wherein the down-regulated enzyme in the nitrogen-assimilation pathway is encoded by a polypeptide sequence at least 80%, 90%, 95%, or 100% identical to a polypeptide sequence selected from the group consisting of: SEQ ID NOs: 25 and 31 (S. cerevisiae Gdh1 and Gdh3).
6. The method of claim 1, wherein the up-regulated enzyme in the nitrogen-assimilation pathway is encoded by a polypeptide sequence at least 80%, 90%, 95% or 100% identical to a polypeptide sequence selected from the group consisting of: SEQ ID NOs: 27 and 29 (Gdh2); a polypeptide sequence at least 80%, 90%, 95% or 100% identical to a polypeptide sequence encoded by SEQ ID NO: 33 (Glt1); a polypeptide sequence at least 80%, 90%, 95% or 100% identical to a polypeptide sequence encoded by SEQ ID NO: 35 (Gln1); a polypeptide sequence at least 80%, 90%, 95% or 100% identical to a polypeptide sequence encoded by SEQ ID NO: 19 (Mep1); a polypeptide sequence at least 80%, 90%, 95% or 100% identical to a polypeptide sequence encoded by SEQ ID NO: 21 (Mep2); a polypeptide sequence at least 80%, 90%, 95% or 100% identical to a polypeptide sequence encoded by SEQ ID NO: 23 (Mep3); a polypeptide sequence at least 80%, 90%, 95% or 100% identical to a polypeptide sequence encoded by SEQ ID NO: 37 (Dur1/2); a polypeptide sequence at least 80%, 90%, 95% or 100% identical to a polypeptide sequence encoded by: SEQ ID NO: 39 (Dur3); or a polypeptide sequence at least 80%, 90%, 95% or 100% identical to a polypeptide sequence encoded by SEQ ID NO: 156 (Gln3).
7. The method of claim 1, wherein the enzyme in the glycerol production pathway is encoded by a polypeptide sequence at least 80%, 90%, 95% or 100% identical to the polypeptide sequence encoded by: SEQ ID NO: 5 (Gpd1); a polypeptide sequence at least 80%, 90%, 95% or 100% identical to the polypeptide sequence encoded by: SEQ ID NO: 7 (Gpd2); a polypeptide sequence at least 80%, 90%, 95% or 100% identical to the polypeptide sequence encoded by: SEQ ID NO: 159 (Gpp1); or a polypeptide sequence at least 80%, 90%, 95% or 100% identical to the polypeptide sequence encoded by: SEQ ID NO: 161 (Gpp2).
8. The method of claim 1, wherein the enzyme that acts in the ethanol production pathway is encoded by a polypeptide sequence at least 80%, 90%, 95% or 100% identical to the polypeptide sequence encoded by SEQ ID NO: 9 (B. adolescentis Pf1); encoded by a polypeptide sequence at least 80%, 90%, 95% or 100% identical to the polypeptide sequence encoded by SEQ ID NO: 11 (B. adolescentis Pf1-activating enzyme); encoded by a polypeptide sequence at least 80%, 90%, 95% or 100% identical to the polypeptide sequence encoded by SEQ ID NO: 13 (B. adolescentis AdhE); or encoded by a polypeptide sequence at least 80%, 90%, 95% or 100% identical to a polypeptide sequence selected from a group consisting of SEQ ID NOs: 15 and 17.
9. The method of claim 1, wherein the recombinant yeast further comprises a down-regulation in one or more native enzymes encoded by a formate dehydrogenase enzyme selected from the group consisting of: EC 1.2.1.43 and EC 1.2.1.2; and/or a heterologous GPD1 polynucleotide operably linked to a native GPD2 promoter; and/or a heterologous GPD2 polynucleotide operably linked to a native GPD1 promoter; and/or an up-regulation or down-regulation of a regulatory element.
10. The method of claim 1, wherein the down-regulated enzyme is encoded by a polypeptide sequence at least 80%, 90%, 95% or 100% identical to a polypeptide sequence encoded by SEQ ID NO: 2 (Fdh1); or a polypeptide sequence at least 80%, 90%, 95% or 100% identical to a polypeptide sequence encoded by the polynucleotide sequence of SEQ ID NO: 3 (Fdh2).
11. The method of claim 9, wherein the regulatory element is selected from the group consisting of Ure2 and Aua1.
12. The method of claim 1, wherein the recombinant yeast further comprises at least one additional up-regulated enzyme, wherein the at least one additional up-regulated enzyme is a glucoamylase enzyme with an EC number 3.2.1.3; a permease; or a protease with EC number: 3.4.23.41.
13. The method of claim 12, wherein the up-regulated enzyme is encoded by a polypeptide sequence at least 80%, 90%, 95% or 100% identical to a polypeptide sequence encoded by SEQ ID NO: 163 (glucoamylase); a polypeptide sequence at least 80%, 90%, 95% or 100% identical to a polypeptide sequence encoded by SEQ ID NO: 53 (Gap); or a polypeptide sequence at least 80%, 90%, 95% or 100% identical to a polypeptide sequence selected from a group consisting of SEQ ID NOs: 41, 43, 45, 47, 49, and 51 (protease).
14. The method of claim 1, wherein the up-regulated enzymes are under the control of a heterologous promoter.
15. The method of claim 1, wherein the recombinant yeast produces ethanol at a higher yield than an otherwise identical yeast lacking the genetic modifications, or the recombinant yeast produces an ethanol titer from about 1% to about 10% more than an otherwise identical yeast lacking the genetic modifications, or the recombinant yeast produces an ethanol titer of at least 125 g/L, or the recombinant yeast produces a glycerol titer of from about 10 to about 100% less than an otherwise identical microorganism lacking the genetic modification.
16. The method of claim 11, wherein the regulatory element is encoded by polypeptide sequence at least 80%, 90%, 95% or 100% identical to a polypeptide sequence encoded by a polynucleotide, sequence of SEQ ID NO: 55 (Ure2) or a polypeptide sequence at least 80%, 90%, 95% or 100% identical to a polypeptide sequence encoded by a polynucleotide sequence of SEQ ID NO: 57 (Aua1).
17. The method of claim 12, wherein the at least one additional up-regulated enzyme is a glucoamylase enzyme with an EC number 3.2.1.3 isolated from the genus Saccharomycopsis; a permease isolated from the genus Saccharomyces (permease); or a protease with EC number: 3.4.23.41 isolated from a genus selected from the group consisting of: Zea, Neurospora, Podospora and Magnaporthe.
18. The method of claim 14, wherein the heterologous promoter is selected from a group consisting of: TEF2 (SEQ ID NO: 58), HXT7 (SEQ ID NO: 59), ADH1 (SEQ ID NO: 60), and TP1 (SEQ ID NO: 61).
19. The method of claim 1, wherein nitrogen is added to the culture containing the recombinant yeast and the carbon-containing feedstock.
20. The method of claim 1, wherein the carbon-containing feedstock is selected from the group, consisting of woody biomass, grasses, sugar-processing residues, municipal waste, agricultural wastes, wood pulp fiber, sawdust, hardwood, softwood, rice straw, rice hulls, barley straw, corn cobs, cereal straw, wheat straw, canola straw, oaf straw, oat hulls, corn fiber, stover, succulents, agave, cane bagasse, switchgrass, miscanthus, paper sludge, or any combination thereof.
21. The method of claim 1, wherein the carbon-containing feedstock is from corn.
Description
BRIEF DESCRIPTION OF THE DRAWINGS/FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)
(48)
(49)
(50)
(51)
(52)
(53)
(54)
(55)
(56)
(57)
(58)
(59)
(60)
(61)
(62)
(63)
(64)
(65)
(66)
(67)
(68)
(69)
(70)
(71)
(72)
(73)
DETAILED DESCRIPTION OF THE INVENTION
(74) Definitions
(75) Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art of microbial metabolic engineering. Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, exemplary methods, devices and materials are described herein.
(76) The embodiments described, and references in the specification to “one embodiment”, “an embodiment”, “an example embodiment”, etc., indicate that the embodiments described can include a particular feature, structure, or characteristic, but every embodiment does not necessarily include the particular feature, structure, or characteristic. Moreover, such phrases ace not necessarily referring to the same embodiment. Further, when a particular feature, structure, or characteristic is described in connection with an embodiment, it is understood that it is within the knowledge of one skilled in the art to effect such feature, structure, or characteristic in connection with other embodiments whether or not explicitly described.
(77) The description of “a” or “an” item herein may refer to a single item or multiple items. It is understood that wherever embodiments are described herein with the language “comprising,” otherwise analogous embodiments described in terms of “consisting or” and/or “consisting essentially of” are also provided. Thus, for example, reference to “a polynucleotide” includes a plurality of such poly-nucleotides and reference to “the microorganism” includes reference to one or more microorganisms, and so forth.
(78) The term “heterologous” is used in reference to a polynucleotide or a gene not normally found in the host organism, “Heterologous” includes up-regulated or down-regulated endogenous genes. “Heterologous” also includes a native coding region, or portion thereof, that is reintroduced into the source organism in a form that is different from the corresponding native gene, e.g., not in its natural location in the organism's genome. “Heterologous” also includes any gene that has been modified and placed into an organism. A heterologous gene may include a native coding region that is a portion of a chimeric gene including a non-native regulatory region that is reintroduced into the native host or modifications to the native regulatory sequences that affect the expression level of the gene. Foreign genes can comprise native genes inserted into a non-native organism, or chimeric genes. A heterologous polynucleotide, gene, polypeptide, or an enzyme may be derived or isolated from any source, eukaryotes, prokaryotes, viruses, or synthetic polynucleotide fragments, and includes up-regulated endogenous genes.
(79) The terms “gene(s)” or “polynucleolide” or “nucleic acid” or “polynucleotide sequence(s)” are intended to include nucleic acid molecules, e.g., polynucleotides which include an open reading frame encoding a polypeptide, and can further include non-coding regulatory sequences, and introns. In addition, the terms are intended to include one or more genes that map to a functional locus. Also, the terms are intended to include a specific gene for a selected purpose. The gene may be endogenous to the host cell or may be recombinantly introduced into the host cell, e.g., as a plasmid maintained episomally or a plasmid (or fragment thereof) that is stably integrated into the genome. In addition to the plasmid form, a gene may, for example, be in the form of linear DNA or RNA. The ter “gene” is also intended to cover multiple copies of a particular gene, e.g., all of the DNA sequences in a cell encoding a particular gene product. A “gene” refers to an assembly of nucleotides that encode a polypeptide, and includes cDNA and genomic DNA nucleic acids. “Gene” also refers to a nucleic acid fragment that expresses a specific protein, including intervening sequences (introns) between individual coding segments (exons), as well as regulatory sequences preceding (5′ non-coding sequences) and following (3′ non-coding sequences) the coding sequence. “Native” or “endogenous” refers to a gene as found in nature with its own regulatory sequences.
(80) A “nucleic acid,” “polynucleotide,” or “nucleic acid molecule” is a polymeric compound comprised of covalently linked subunits called nucleotides. Nucleic acid includes polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), both of which may be single-stranded or double-stranded. DNA includes cDNA, genomic DNA, synthetic DNA, and semi-synthetic DNA.
(81) An “isolated nucleic acid molecule” or “isolated nucleic acid fragment” refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; “RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; “DNA molecules”), or any phosphoester analogs thereof, such as phosphorothioates and thioesters in either single stranded form, or a double-stranded helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The term nucleic acid molecule, and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5′ to 3′ direction along the non-transcribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA).
(82) The term “expression” is intended to include the expression of a gene at least at the level of mRNA production, generally subsequently translated into a protein product. The term “expression,” refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid fragment of the invention. Expression may also refer to translation of mRNA into a polypeptide.
(83) As used herein, an “expression vector” is a vector capable of directing the expression of genes to which it is operably linked.
(84) A “vector,” e.g., a “plasmid” or “YAC” (yeast artificial chromosome) refers to an extrachromosomal element often carrying one or more genes that are not part of the central metabolism of the cell, and is usually in the form of a circular double-stranded DNA molecule. Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear, circular, or supercoiled, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3′ untranslated sequence into a cell. Preferably, the plasmids or vectors of the present invention are stable and self-replicating.
(85) The term “integrated” as used herein refers to genetic elements that are placed, through molecular biology techniques, into a chromosome of a host cell. For example, genetic elements can be placed into the chromosomes of the host cell as opposed to in a vector such as a plasmid carried by the host cell. Methods for integrating genetic elements into the genome of a host cell are well known in the art and include homologous recombination.
(86) The term “domain” as used herein refers to a part of a molecule or structure that shares common physical or chemical features, for example hydrophobic, polar, globular, helical domains or properties, e.g., a DNA binding domain or an ATP binding domain. Domains can be identified by their homology to conserved structural or functional motifs. Examples of cellobiohydrolase (CBH) domains include the catalytic domain (CD) and the cellulose binding domain (CBD).
(87) A nucleic acid molecule is “hybridizable” to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength. Hybridization and washing conditions are well known and exemplified, e.g., in Sambrook, J., Fritsch, E. F. and Maniatis, T. MOLECULAR CLONING: A LABORATORY MANUAL, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (1989), particularly Chapter 11 and Table 11.1 therein (hereinafter “Maniatis”, entirely incorporated herein by reference). The conditions of temperature and ionic strength determine the “stringency” of the hybridization. Stringency conditions can be adjusted to screen for moderately similar fragments, such as homologous sequences from distantly related organisms, to highly similar fragments, such as genes that duplicate functional enzymes from closely related organisms. Post-hybridization washes determine stringency conditions. One set of conditions uses a series of washes starting with 6×SSC, 0.5% SDS at room temperature for 15 min, then repeated with 2×SSC, 0.5% SDS at 45%, for 30 min, and then repeated twice with 0.2×SSC, 0.5% SDS at 50° C. for 30 min. For more stringent conditions, washes are performed at higher temperatures in which the washes are identical to those above except for the temperature of the final two 30 min washes in 0.2×SSC, 0.5% SDS are increased to 60° C. Another set of highly stringent conditions uses two final washes in 0.1×SSC, 0.1% SDS at 65° C. An additional set of highly stringent conditions are defined by hybridization at 0.1×SSC, 0.1% SDS, 65° C. and washed with 2×SSC, 0.1% SDS followed by 0.1×SSC, 0.1% SDS.
(88) Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible. The appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of Tm for hybrids of nucleic acids having those sequences. The relative stability (corresponding to higher Tm) of nucleic acid hybridizations decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA. For hybrids of greater than 100 nucleotides in length, equations tsar calculating Tm have been derived (see, e.g Maniatis at 9.50-9.51). For hybridizations with shorter nucleic acids, oligonucleotides, the position of mismatches becomes more important, and the length of the oligonucleotide determines its specificity (see, e.g., Maniatis, at 11.7-11.81. In one embodiment the length for a hybridizable nucleic acid is at least about 10 nucleotides. Preferably a minimum length for a hybridizable nucleic acid is at least about 15 nucleotides; more preferably at least about 20 nucleotides; and most preferably the length is at least 30 nucleotides. Furthermore, the skilled artisan will recognize that the temperature and wash solution salt concentration may be adjusted as necessary according to factors such as length of the probe.
(89) The term “percent identity”, as known in the an, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. In the art, “identity” also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences.
(90) As known in the art, “similarity” between two polypeptides is determined by comparing the amino acid sequence and conserved amino acid substitutes thereto of the polypeptide to the sequence of a second polypeptide.
(91) “Identity” and “similarity” can be readily calculated by known methods, including but not limited to those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, NY (1988); Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic Press, NY (1993); Computer Analysis of Sequence Data, Part I (Griffin. A. M. and Griffin, H. G., eds.) Humana Press, NJ (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press. NY (1991). Preferred methods to determine identity are designed to give the best match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Sequence alignments and percent identity calculations may be performed using the Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison. Wis.). Multiple alignments of the sequences disclosed herein were performed using the Clustal method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments using the Clustal method were KTUPLE 1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5.
(92) Suitable nucleic acid sequences or fragments thereof (isolated polynucleotides of the present invention) encode polypeptides that are at least about 70% to about 75% identical to the amino acid sequences reported herein, at least about 80%, about 85%, or about 90% identical to the amino acid sequences reported herein, or at least about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical to the amino acid sequences reported herein. Suitable nucleic acid fragments are at least about 70%, about 75%, or about 80% identical to the nucleic acid sequences reported herein, at least about 80%, about 85%, or about 90% identical to the nucleic acid sequences reported herein, or at least about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical to the nucleic acid sequences reported herein. Suitable nucleic acid fragments not only have the above identities/similarities but typically encode a polypeptide having at least 50 amino acids, at least 100 amino acids, at least 150 amino acids, at least 200 amino acids, or at least 250 amino acids.
(93) A DNA or RNA “coding region” is a DNA or RNA molecule which is transcribed and/or translated into a polypeptide in a cell in vitro or in vivo when placed under the control of appropriate regulatory sequences. “Suitable regulatory regions” refer to nucleic acid regions located upstream (5′ non-coding sequences), within, or downstream (3′ non-coding sequences) of a coding region, and which influence the transcription, RNA processing or stability, or translation of the associated coding region. Regulatory regions may include promoters, translation leader sequences. RNA processing site, effector binding site and stem-loop structure. The boundaries of the coding region are determined by a start codon at the 5′ (amino) terminus and a translation stop codon at the 3′ (carboxyl) terminus. A coding region can include, but is not limited to, prokaryotic regions, cDNA from mRNA, genomic DNA molecules, synthetic DNA molecules, or RNA molecules. If the coding region is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3′ to the coding region.
(94) An “isoform” is a protein that has the same function as another protein but which is encoded by a different gene and may have small differences in its sequence.
(95) A “paralogue” is a protein encoded by a gene related by duplication within a genome.
(96) An “orthologue” is gene from a different species that has evolved from a common ancestral gene by specification. Normally, orthologues retain the same function in the course of evolution as the ancestral gene.
(97) “Open reading frame” is abbreviated ORF and means a length of nucleic acid, either DNA, cDNA or RNA, that comprises a translation start signal or initiation codon, such as an ATG or AUG, and a termination codon and can be potentially translated into a polypeptide sequence.
(98) “Promoter” refers to a DNA fragment capable of controlling the expression of a coding sequence or functional RNA. In general, a coding region is located 3′ to a promoter. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of cellular development, or in response to different environmental or physiological conditions. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters”. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths may have identical promoter activity. A promoter is generally bounded at its 3′ terminus by the transcription initiation site and extends upstream (5′ direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter will be found a transcription initiation site (conveniently defined for example, by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
(99) A coding region is “under the control” of transcriptional and translational control elements in a cell when RNA polymerase transcribes the coding region into mRNA, which is then trans-RNA spliced (if the coding region contains in irons) and translated into the protein encoded by the coding region.
(100) “Transcriptional and translational control regions” are DNA regulatory regions, such as promoters, enhancers, terminators, and the like, that provide for the expression of a coding region in a host cell. In eukaryotic cells, polyadenylation signals are control regions.
(101) The term “operably associated” refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter is operably associated with a coding region when it is capable of affecting the expression of that coding region (i.e., that the coding region is under the transcriptional control of the promoter). Coding regions can be operably associated to regulatory regions in sense or antisense orientation.
(102) As used herein, the term “anaerobic” refers to an organism, biochemical reaction or process that is active or occurs under conditions of an absence of gaseous O.sub.2.
(103) “Anaerobic conditions” are defined as conditions under which the oxygen concentration in the fermentation medium is too low for the microorganism to use as a terminal electron acceptor. Anaerobic conditions may be achieved by sparging a fermentation medium with an inert gas such as nitrogen until oxygen is no longer available to the microorganism as a terminal electron acceptor. Alternatively, anaerobic conditions may be achieved by the microorganism consuming the available oxygen of fermentation until oxygen is unavailable to the microorganism as a terminal electron acceptor.
(104) “Aerobic metabolism” refers to a biochemical process in which oxygen is used as a terminal electron acceptor to convert energy, typically in the form of ATP, from carbohydrates. Aerobic metabolism typically occurs, for example, via the electron transport chain in mitochondria in eukaryotes, wherein a single glucose molecule is metabolized completely into carbon dioxide in the presence of oxygen.
(105) In contrast, “anaerobic metabolism” refers to a biochemical process in which oxygen is not the final acceptor of electrons generated. An aerobic metabolism can be divided into anaerobic respiration, in which compounds other than oxygen serve as the terminal electron acceptor, and substrate level phosphorylation, in which no exogenous electron acceptor is used and products of an intermediate oxidation state are generated via a “fermentative pathway.”
(106) “fermentative pathways”, the amount of NAD(P)H generated by glycolysis is balanced by the consumption of the same amount of NAD(P)H in subsequent steps. For example, in one of the fermentative pathways of certain yeast strains, NAD(P)H generated through glycolysis donates its electrons to acetaldehyde, yielding ethanol. Fermentative pathways are usually active under anaerobic conditions but may also occur under aerobic conditions, under conditions where NADH is not fully oxidized via the respiratory chain.
(107) As used herein, the term “end-product” refers to a chemical compound that is not or cannot be used by a cell, and so is excreted or allowed to diffuse into the extracellular environment. Common examples of end-products from anaerobic fermentation include, but are not limited to, ethanol, acetic acid, formic acid, lactic acid, hydrogen and carbon dioxide.
(108) As used herein, “cofactors” are compounds involved in biochemical reactions that are recycled within the cells and remain at approximately steady state levels. Common examples of cofactors involved in anaerobic fermentation include, but are not limited to, NAD.sup.+ and NADP.sup.+. In metabolism, a cofactor can act in oxidation-reduction reactions to accept or donate electrons. When organic compounds are broken down by oxidation in metabolism, their energy can be transferred to NAD.sup.+ by its reduction to NADH, to NADP.sup.+ by its reduction to NADPH, or to another cofactor, FAD.sup.+, by its reduction to FADH.sub.2. The reduced cofactors can then be used as a substrate for a reductase.
(109) As used herein, a “pathway” is a group of biochemical reactions that together can convert one compound into another compound in a step-wise process. A product of the first step in a pathway may be a substrate for the second step, and a product of the second step may be a substrate for the third, and so on. Pathways of the present invention include, but are not limited to, the pyruvate metabolism pathway the lactate production pathway, the ethanol production pathway, the glycerol-production pathway, the nitrogen assimilation pathway, and the ammonium assimilation pathway.
(110) The term “recombination” or “recombinant” refers to the physical exchange of DNA between two identical (homologous), or nearly identical, DNA molecules. Recombination can be used for targeted gene deletion or to modify the sequence of a gene. The term “recombinant microorganism” and “recombinant host cell” are used interchangeably herein and refer to microorganisms that have been genetically modified to express or over-express endogenous polynucleotides, or to express heterologous polynucleotides, such as those included in a vector, or which have a modification in expression of an endogenous gene.
(111) By “expression modification” it is meant that the expression of the gene, or level of a RNA molecule or equivalent RNA molecules encoding one or more polypeptides polypeptide subunits, or activity of one or more polypeptides or polypeptide, subunits is up regulated or down-regulated, such that expression, level, or activity, is greater than or less than that observed in the absence of the modification.
(112) In one aspect of the invention, genes or particular polynucleotide sequences are partially, substantially, or completely deleted, silenced, inactivated, or down-regulated in order to inactivate the enzymatic activity they encode. Complete deletions provide maximum stability because there is no opportunity for a reverse mutation to restore function. Alternatively, genes can be partially, substantially, or completely deleted, silenced, inactivated, or down regulated by insertion, deletion, removal or substitution of nucleic acid sequences that disrupt the function and/or expression of the gene.
(113) As used herein, the term “down-regulate” includes the deletion or mutation of a genetic sequence, or insertion of a disrupting genetic element, coding or non-coding, such that the production of a gene product is lessened by the deletion, mutation, or insertion it includes a decrease in the expression level (i.e., molecular quantity) of an mRNA car protein. “Delete” or “deletion” as used herein refers to a removal of a genetic element such that a corresponding gene is completely prevented from being expressed. In some embodiments, deletion refers to a complete gene deletion. Down-regulation can also occur by engineering the repression of genetic elements by chemical or other environmental means, for example by engineering a chemically-responsive promoter element for other type of conditional promoter) to control the expression of a desired gene product. Down-regulation can also occur through use of a weak promoter.
(114) As used herein, the term “up-regulate” includes the insertion, reintroduction, mutation, or increased expression of a genetic sequence, such that the production of a gene product is increased by the insertion, reintroduction, or mutation. It includes an increase in the expression level (i.e., molecular quantity) of an mRNA or protein. “Insert” or “insertion” as used herein refers to an introduction of a genetic element such that a corresponding gene is expressed. Up-regulation can also occur by causing the increased expression of genetic elements through an alteration of the associated regulatory sequence. Up-regulation can occur by engineering the expression of genetic elements by chemical or oilier environmental means, for example by engineering a chemically-responsive promoter element (or other type of conditional promoter) to control the expression of a desired gene product. Up-regulation can also occur through use of a strong promoter.
(115) As used herein, the term “glycerol-production pathway” refers to the collection of biochemical pathways that produce glycerol from DHAP. Components of the pathway consist of all substrates, cofactors, byproducts, intermediates, end-products, and enzymes in the pathway.
(116) As used herein, the term “ethanol production pathway” refers the collection of biochemical pathways that produce ethanol from a carbohydrate source. Components of the pathway consist of all substrates, cofactors, byproducts, intermediates, end-products, and enzymes in the pathway.
(117) As used herein, the term “nitrogen assimilation pathway” refers to the collection of biochemical pathways that result in the formation of organic nitrogen containing compounds from inorganic nitrogen compounds. Components of the pathway consist of ail substrates, cofactors, byproducts, intermediates, end-products, and enzymes in the pathway.
(118) As used herein, the term “ammonium assimilation pathway” refers to the collection of biochemical pathways that assimilate ammonia or ammonium (NH.sub.4.sup.+) into glutamate and/or glutamine. The ammonium assimilation pathway is part of the larger nitrogen assimilation pathway. Components of the pathway consist of all substrates, cofactors, byproducts, intermediates, end-products, and enzymes in the pathway.
(119) As used herein, the term “glycolysis” or “glycolytic pathway” refers to the canonical pathway of basic metabolism in which a sugar such as glucose is broken down into more oxidized products, converting energy and compounds required for cell growth. Components of the pathway consist of all substrates, cofactors, byproducts, intermediates end-products, and enzymes in the pathway.
(120) As used herein, the term “alcohol dehydrogenase” or “ADH” is intended to include the enzymes that catalyze the conversion of ethanol into acetylaldehyde. Very commonly, the same enzyme catalyzes the reverse reaction from acetaldehyde to ethanol, which is the direction more relevant to fermentation. Alcohol dehydrogenase includes those enzymes that correspond to EC 1.1.1.1 and 1.1.1.2 and exemplified by the enzymes disclosed in GenBank Accession No. U49975.
(121) As used herein, the term “aldehyde dehydrogenase”, “ALD” or “ALDH” is intended to include the enzymes that catalyze the oxidation of aldehydes. Aldehyde dehydrogenase enzymes include “acetaldehyde dehydrogenase”, which catalyzes the conversion of acetaldehyde into acetyl-CoA. Very commonly, the same enzyme catalyzes the reverse reaction from acetyl-CoA to acetaldehyde, which is the direction more relevant to fermentation. Aldehyde dehydrogenase includes those enzymes that correspond to EC 1.2.1.3, 1.2.1.4 and 1.2.1.10.
(122) As used herein, the term “glycerol-3-phosphate dehydrogenase” or “GPD” is intended to include those enzymes capable of converting dihydroxyacetone phosphate to glycerol-3-phosphate. GPD includes those enzymes that correspond to EC 1.1.1.8. In some embodiments, the GPD is GPD1 and/or GPD2 from S. cerevisiae (GDP1: SEQ ID NO. 4 and 5, GDP2: SEQ ID NO: 6 and 7).
(123) As used herein, the term “glycerol-3-phosphate phosphatase” or “GPP” is intended to include those enzymes capable of converting glycerol-1-phosphate to glycerol. Glycerol-3-phosphate is intended to include those enzymes that correspond to EC 3.1.3.21. (GPP1: SEQ ID NO: 158 and 159, GPP2: SEQ ID NO 160 and 161)
(124) As used herein, the term “formate dehydrogenase” or “FDH” is intended to include those enzymes capable of converting formate to bicarbonate (carbon dioxide). Formate dehydrogenase includes those enzymes that correspond to EC 1.2.1.43 and EC 1.2.1.2. In some embodiments, the FDH is from S. cerevisiae (FDH1: SEQ ID NO: 1 and 2, FDH2: SEQ ID NO: 3).
(125) As used herein, the term “bifunctional” is intended to include enzymes that catalyze more than one biochemical reaction step. A specific example of a bifunctional enzyme used herein is an enzyme (adhE) that catalyzes both the alcohol dehydrogenase and acetaldehyde dehydrogenase reactions, and includes those enzymes that correspond to EC 1.2.1.10 and 1.1.1.1. In some embodiments, the bifunctional acetaldehyde-alcohol dehydrogenase is from B. adolescentis (adhE: SEQ ID NO: 12, and 13). In some embodiments, the bifunctional enzyme is a NADPH specific bifunctional acetaldehyde-alcohol dehydrogenase, and includes those enzymes that correspond to EC L2.1.10 and 1.1.1.2. In some embodiments, the NADPH specific bifunctional acetaldehyde-alcohol dehydrogenase is from L. mesenteroides (SEQ ID NO: 14 and 15) or O. oenii (SEQ NO: 16 and 17).
(126) As used herein, the term “pyruvate formate lyase” or “PFL” is intended to include the enzymes capable of converting pyruvate to formate and acetyl-CoA. PFL includes those enzymes that correspond to EC 2.3.1.54 and exemplified by SEQ ID NO: 8 and 9.
(127) As used herein, the term “PFL-activating enzymes” is intended to include those enzymes capable of aiding in the activation of PFL. PFL-activating enzymes include those enzymes that correspond to EC 1.97.1.4 and are exemplified by SEQ ID NO: 10 and 11.
(128) As used herein, the term “glutamate dehydrogenase”, “GDH”, or “GLDH” is intended to include those enzymes that convert glutamate to α-ketoglutarate, as well as those enzymes that catalyze the reverse reaction. The glutamate dehydrogenase can be NADPH-dependent (e.g. GDH1 or GDH3 in S. cerevisiae). The glutamate dehydrogenase can be NADH-dependent (e.g. GDH2 in S. cerevisiae). Glutamate dehydrogenases include those enzymes that correspond to EC 1.4.1.2 and EC 1.4.1.4. Glutamate dehydrogenases include those enzymes that correspond to accession numbers: M10590, S66436, S66039.1, U12980, NP_015020, NP_010066, S66039.1 and AAC04972. In some embodiments, the glutamate dehydrogenase is from S. cerevisiae (GDH1: SEQ ID NOs. 25 and 25; GDH2: SEQ ID NOs 26 and 27; GDH3: SEQ ID NOs. 30 and 31.) or N. crassa (GDH2: SEQ ID NOs: 28 29).
(129) As used herein, the term “glutamate synthase” or “GLT” is intended to include those enzymes that convert L-glutamine and 2-oxoglutarate to L-glutamate, as well as those enzymes that catalyze the reverse reaction. Glutamate synthases include those enzymes that correspond to EC 1.4.1.14 and EC 1.4.1.13. In some embodiments, the glutamate synthase is GLT1 from S. cerevisiae (SEQ ID NOs: 32 and 33; accession numbers: X89221 and NP_010110.1).
(130) As used herein, the term “glutamine synthase”, “glutamine synthetase”, or “GLN” is intended to include those enzymes that convert glutamate to glutamine. Glutamine synthases include those enzymes that correspond to EC 6.3.1.2. In some embodiments, the glutamine synthase is GLN1 from S. cerevisiae (SEQ ID NOs. 34 and 35; accession numbers: M65157 and NP_015360.2).
(131) As used herein, the term “urea-amido lyase” is intended to include those enzymes that convert urea to urea-1-carboxylate. Urea-amido lyases include those enzymes that correspond to EC 6.3.4.6. In some embodiments, the urea-amido lyase is DUR1/2 (DUR1,2) from S. cerevisiae (SEQ ID NOs: 36 and 37; accession numbers: M64926 and NP_009767.1)
(132) As used herein, the term “urea transporter” is a membrane protein that transports urea across a cellular membrane. In some embodiments, the urea transporter is Dur3 or Dur4 from S. cerevisiae (DUR3: SEQ ID NOs. 38 and 39; accession numbers: AY693170 and NP_011847.1).
(133) As used herein, the term “protease” is any enzyme that hydrolyzes the peptide bonds between amino acids together in a protein. An exoprotease is a protease that breaks the peptide bonds of terminal amino acids in a protein. An endoprotease is a protease that breaks the peptide bonds of non-terminal amino acids in a protein. Proteases include those enzymes that correspond to EC 3.4.23.41. Proteases include those enzymes that correspond to accession numbers: NP_001151278, NP_001150196, NP_001148706, NCU00338, XP_001908191, XP_369812, EU9700941, NM_001156724, NM_001155234.1, XP_957809.2, XM_001908156.1, and XM_003717209.1. In some embodiments, the protease is from Z. mays (SEQ ID NOs: 40-45), N. crassa (SEQ ID NOs: 46-47), P. anserine (SEQ ID NOs: 48-49), or M. oryzae (SEQ ID NOs: 50-51).
(134) As used herein, the term “glucoamylase” or “γ-amylase” refers to an amylase that acts on α-1,6-glycosidic bonds. Glucoamylases include those enzymes that correspond to EC 3.2.1.3. In some embodiments, the glucoamylase is S. fibuligera glucoamylase (glu-0111-CO) (SEQ ID NO: 162 and 163).
(135) As used herein, the term “permease” refers to a membrane transport protein that facilitates the diffusion of a molecule through the use of passive transport in or out of a cell. In some embodiments, the permease is the amino acid permease GAP1 from S. cerevisiae. (SEQ ID NO: 52 and 53).
(136) As used herein, the term “ammonium transporter” refers to permeases, and is intended to include the enzymes that are involved in the transport of ammonium and ammonia, and are exemplified by the S. cerevisiae MFP1, MEP2 and MEP3 enzymes (MEP 1: SEQ ID NOs: 18 and 19; MFP2 SEQ ID NOs: 20 and 21; MFP3 SEQ ID NOs: 22 and 23). Ammonium transporters include those enzymes that correspond to accession numbers: X77608, X83608, AY69277S, NP_011636.3, NP_014257.1, and NP_015464.1.
(137) As used herein, the term “URE2” refers to transcription factor known in the an by that name that represses the nitrogen catabolism of glutamate by controlling the transcription factor. URE2 is a regulator of GLN3. In some embodiments, the URF2 is from S. cerevisiae (SEQ ID NOs: 54 and 55).
(138) As used herein, “AUA1” refers to a transcription factor known in the art by that name which is required for the negative regulation of Gap1. In some embodiments, the AUA1 is from S. cerevisiae (SEQ ID NOs: 56 and 57).
(139) As used herein, “GLN3” refers to a transcription factor known in the art by that name that activates genes that are regulated by nitrogen catabolite metabolism. In some embodiments, the GLN3 is from S. cerevisiae (SEQ ID NOs. 156 and 157). The term “feedstock” is defined as a raw material or mixture of raw materials supplied to a microorganism or fermentation process from which other products can be made. F or example, a carbon source, such as biomass or the carbon compounds derived from biomass are a feedstock for a microorganism that produces a product in a fermentation process. A feedstock can contain nutrients other than a carbon source.
(140) Biomass can include any type of biomass known in the art or described herein. The terms “lignocellulosic material,” “lignocellulosic substrate” and “cellulosic biomass” mean any type of carbon containing feed stock including woody biomass, such as recycled wood pulp fiber, sawdust, hardwood, softwood, grasses, sugar-processing residues, agricultural wastes, such as, but not limited to, rice straw, rice hulls, barley-straw, corn cobs, cereal straw, wheat straw, canola straw, oat straw, oat hulls, corn fiber, stover, succulents, agave, or any combination thereof.
(141) The term “yield” is defined as the amount of product obtained per unit weight of raw material and may be expressed as gram product per gram substrate (g/g). Yield may be expressed as a percentage of the theoretical yield. “Theoretical yield” is defined as the maximum amount of product that can be generated per a given amount of substrate as dictated by the stoichemistry of the metabolic pathway used to make the product. For example, the theoretical yield for one typical conversion of glucose to ethanol is 0.51 g EtOH per 1 g, glucose. As such, a yield of 4.8 g ethanol from 10 g of glucose would be expressed as 94% of theoretical or 94% theoretical yield.
(142) The term “titer” is defined as the strength of a solution or the concentration of a substance in solution. For example, the titer of a product in a fermentation broth is described as gram of product in solution per liter of fermentation broth or as g/kg broth.
(143) As used herein, the term “flux” is the rate of flow of molecules through a metabolic pathway, akin to the flow of material in a process.
(144) “Bacteria”, or “eubacteria”, refers to a domain of prokaryotic organisms. Bacteria include gram-positive (gram+) bacteria and gram-negative (gram−) bacteria.
(145) “Yeast” refers to a domain of eukaryotic organisms that are unicellular fungi.
(146) The terms “derivative” and “analog” refer to a polypeptide differing from the enzymes of the invention, but retaining essential properties thereof. Generally, derivatives and analogs are overall closely similar, and, in many regions, identical to the enzymes of the invention. The terms “derived from”, “derivative” and “analog” when referring to enzymes of the invention include any polypeptides which retain at least some of the activity of the corresponding native polypeptide or the activity of its catalytic domain.
(147) Derivatives of enzymes disclosed herein are polypeptides which may have been altered so as to exhibit features not found on the native polypeptide. Derivatives can be covalently modified by substitution (e.g. amino acid substitution), chemical, enzymatic, or other appropriate means with a moiety other than a naturally occurring amino acid (e.g., a detectable moiety such as an enzyme or radioisotope). Examples of derivatives include fusion proteins, or proteins which are based on a naturally occurring protein sequence, but which have been altered. F or example, proteins can be designed by knowledge of a particular amino acid sequence, and/or a particular secondary, tertiary, and quaternary structure. Derivatives include proteins that are modified based on the knowledge of a previous sequence, natural or synthetic, which is then optionally modified often, but not necessarily to confer some improved function. These sequences, or proteins, are then said to be derived from a particular protein or amino acid sequence. In some embodiments of the invention, a derivative must retain at least about 50% identity, at least about 60% identity, at least about 70% identity, at least about 80% identity, at least about 90% identity, at least about 95% identity, at least about 97% identity, or at least about 99% identity to the sequence the derivative is “derived from.” In some embodiments of the invention, an enzyme is said to be derived from an enzyme naturally found in a particular species if, using molecular genetic techniques, the DNA sequence for part or all of the enzyme is amplified and placed into a new host cell.
(148) “Isolated” from, as used herein, refers to a process whereby, using molecular biology techniques, genetic material is harvested from a particular organism often with the end goal of putting the general material into a non-native environment.
(149) The term “percent identity”, as known in the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. In the art, “identity” also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences.
(150) As known in the art, “similarity” between two polypeptides is determined by comparing the amino acid sequence and conserved amino acid substitutes thereto of the polypeptide to the sequence of a second polypeptide.
(151) “Identity” and “similarity” can be readily calculated b known methods, including but not limited to those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press NY (1988); Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic Press, NY (1993); Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., eds.) Humana Press, NJ (1994), Sequence Analysis in Molecular Biology (von Heinje, G., ed,) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press, NY (1991). Preferred methods to determine identity are designed to give the best match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Sequence alignments and percent identity calculations may be performed using the Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.). Multiple alignments of the sequences disclosed herein were performed using the Clustal method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments using the Clustal method were KTUPLE 1, GAP PENALTY=3. WINDOW=5 and DIAGONALS SAVED=5.
(152) Suitable nucleic acid sequences or fragments thereof (isolated polynucleotides of the present invention) encode polypeptides that are at least about 70% to 75% identical to the amino acid sequences disclosed herein, at least about 80% at least about 85%, or at least about 90% identical to the amino acid sequences disclosed herein, or at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% identical to the amino acid sequences disclosed herein. Suitable nucleic acid fragments are at least about 70%, at least about 75%, or at least about 80% identical to the nucleic acid sequences disclosed herein, at least about 80%, at least about 85%, or at least about 90% identical to the nucleic acid sequences disclosed herein, or at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% identical to the nucleic acid sequences disclosed herein. Suitable nucleic acid fragments not only have the above identities/similarities but typically encode a polypeptide having at least about 50 amino acids, at least about 100 amino acids, at least about 150 amino acids, at least about 200 amino acids, or at least about 250 amino acids.
(153) Codon Optimization
(154) In some embodiments of the present invention, exogenous genes may be codon-optimized in order to express the polypeptide they encode most efficiently in the host cell. Methods of codon optimization are well known in the art. (See, e.g. Welch et al. “Designing genes for successful protein expression.” Methods Enzymol. 2011, 498:43-66.)
(155) In general, highly expressed genes in an organism are biased towards codons that are recognized by the most abundant tRNA species in that organism. One measure of this bias is the “codon adaptation index” or “CAI,” which measures the extent to which the codons used to encode each amino acid in a particular gene are those which occur most frequently in a reference set of highly expressed genes from an organism. The Codon Adaptation Index is described in more detail in Sharp et al., “The Codon Adaptation Index, a Measure of Directional Synonymous Codon Usage Bias, and Its Potential Applications.” Nucleic Acids Research (1987) 15: 1281-1295, which is incorporated by reference herein in its entirety.
(156) A codon optimized sequence may be further modified for expression in a particular organism, depending on that organism's biological constraints. For example, large runs of “As” or “Ts” (e.g., runs greater than 3, 4, 5, 6, 7, 8, 9, or 10 consecutive bases) can effect transcription negatively. Therefore, it can be useful to remove a run by, for example, replacing at least one nucleotide in the run with another nucleotide. Furthermore, specific restriction enzyme sites may be removed for molecular cloning purposes by replacing at least one nucleotide in the restriction site with another nucleotide. Examples of such restriction enzyme sites include PasI, AscI, BamHI, BglII, ExoRI and XhoI. Additionally, the DNA sequence can be checked for direct repeals, inverted repeats and mirror repeats with lengths of about 5, 6, 7, 8, 9 or 10 bases or longer. Runs of “As” or “Ts”, restriction sites and/or repeats can be modified by replacing at least one codon within the sequence with the “second best” codons, i.e. the codon that occurs at the second highest frequency for a particular amino acid within the particular organism for which the sequence is being optimized.
(157) Deviations in the nucleotide sequence that comprise the codons encoding the amino acids of any polypeptide chain allow for variations in tire sequence coding for the gene. Since each codon consists of three nucleotides, and the nucleotides comprising DNA are restricted to four specific bases, there are 64 possible combinations of nucleotides, 61 of which encode amino acids (the remaining three codons encode signals ending translation). The “genetic code” which shows which codons encode which amino acids is reproduced herein as Table 1. As a result, many amino acids are designated by more than one codon. For example, the amino acids alanine and proline are coded for by four triplets, serine and arginine by six triplets each, whereas tryptophan and methionine are coded for by just one triplet. This degeneracy allows for DNA base composition to vary over a wide range without altering the amino acid sequence of the proteins encoded by the DNA.
(158) TABLE-US-00001 TABLE 1 The Standard Genetic Code T C A G T TTT Phe(F) TCT Ser(S) TAT Tyr (Y) TGT Cys(C) TTC″ TCC″ TAC″ TGC TTA Leu(L) TCA″ TAA Ter TGA Ter TTG″ TCG″ TAG Ter TGG Trp(W) C CTT Leu(L) CCT Pro(P) CAT His(H) CGT Arg(R) CTC″ CCC″ CAC″ CGC″ CTA″ CCA″ CAA Gln(Q) CGA″ CTG″ CCG″ CAG″ CGG″ A ATT Ile(I) ACT Thr(T) AAT Asn(N) AGT Ser(S) ATC″ ACC″ AAC″ AGC″ ATA″ ACA″ AAA Lys(K) AGA Arg(R) ATG Met ACG″ AAG″ AGG″ (M) G GTT Val(V) GCT Ala(A) GAT Asp(D) GGT Gly(G) GTC″ GCC″ GAC″ GGC″ GTA″ GCA″ GAA Glu(E) GGA″ GTG″ GCG″ GAG″ GGG″
(159) Many organisms display a bias for use of particular codons to code for insertion of a particular amino acid in a growing peptide chain. Codon preference or codon bias, differences in codon usage between organisms, is afforded by degeneracy of the genetic code, and is well documented among many organisms. Codon bias often correlates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be dependent on, inter alia, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization.
(160) Host Cells
(161) In some embodiments of the invention, the host cell is a eukaryotic microorganism. In some embodiments, the host cell is a yeast. In some embodiments, the host cell is able to digest and ferment cellulose. In some embodiments, the host cell is from the genus Saccharomyces In some embodiments, the host cell is Saccharomyces cerevisiae.
(162) In some embodiments, the host cells of the invention are cultured at a temperature above about 20° C., above about 25° C., above about 27° C., above about 30° C., above about 33° C., above about 35′C, above about 37° C., above about 40° C., above about 43° C., above about 45° C., or above about 47° C. In some embodiments, the host cells of the invention contain genetic constructs that lead to the down-regulation of one or more genes encoding a polypeptide at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to one or more of the polypeptides encoded. SEQ ID NOs: 2, 5, 7, 25, 31, 55, 57, 159 and 161, and the polynucleotide sequence encoded by SEQ ID NO: 3. In some embodiments, the host cells of the invention contain genetic constructs that lead to the expression or up-regulation of a polypeptide encoding the activity associated with EC Nos.: 1.1.1.8, 3.1.3.21, 1.2.1.43, 1.2.1.2, 1.4.1.2, and 1.4.1.4.
(163) In some embodiments, the host cells of the invention contain genetic constructs that lead to the expression or up-regulation of one or more genes encoding a polypeptide at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to one or more of the polypeptides encoded by SEQ ID NOs: 9, 11, 13, 15, 17, 19, 21, 23, 27, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 157, and 163. In some embodiments, the host cells of the invention contain genetic constructs that lead to the expression or up-regulation of a polypeptide encoding the activity associated with EC Nos.: 1.1.1.1, 1.1.1.2, 1.2.1.3, 1.2.1.4, 1.2.1.10, 2.3.1.54, 1.97.1.4, 1.4.1.2, 1.4.1.4, 1.1.1.14, 1.4.1.13, 6.3.1.2, 6.3.4.6, and 3.2.1.3.
(164) In some embodiments, bifunctional acetaldehyde-alcohol dehydrogenase is un-regulated. In some embodiments, the up-regulated bifunctional acetaldehyde-alcohol dehydrogenase is from an enzyme that corresponds to an EC number selected from the group consisting of: EC 1.2.1.0 and 1.1.1.1. In some embodiments, the bifunctional acetaldehyde-alcohol dehydrogenase is a NADPH dependent bifunctional acetaldehyde-alcohol dehydrogenase selected from a group of enzymes having the following Enzyme Commission Numbers: EC 1.2.1.10 and 1.1.1.2. In some embodiments, the bifunctional acetaldehyde-alcohol dehydrogenase corresponds to a polypeptide selected from the group consisting of SEQ ID NOs: 13, 15, and 17. In some embodiments, the bifunctional acetaldehyde-alcohol dehydrogenase is adhE.
(165) In some embodiments, pyruvate formate lyase is up-regulated. In some embodiments, the up-regulated pyruvate formate lyase is from an enzyme that corresponds to EC 2.3.1.54. In some embodiments, the pyruvate formate lyase corresponds to a polypeptide encoded by SEQ ID NO: 2. In some embodiments, pyruvate formate lyase activating enzyme is up-regulated. In some embodiments, the up-regulated pyruvate formate lyase activating enzyme is from an enzyme that corresponds to EC 1.97.1.4. In some embodiments, the pyruvate formate lyase activating enzyme corresponds to a polynucleotide encoded by SEQ ID NO: 3.
(166) In some embodiments, glutamate dehydrogenase is up-regulated, in some embodiments, the glutamate dehydrogenase that is up-regulated is NADH-dependent. In some embodiments, the up-regulated glutamate dehydrogenase corresponds to EC 1.4.1.2. In some embodiments, glutamate dehydrogenase from S. cerevisiae is up-regulated. In some embodiments, the glutamate dehydrogenase that is up-regulated is from S. cerevisiae is GDH2 and corresponds to a polypeptide corresponding to SEQ ID NO: 29. In some embodiments, glutamate synthase is up-regulated. In some embodiments, the up-regulated glutamate synthase corresponds to EC 1.4.1.14. In some embodiments, glutamate synthase from S. cerevisiae is up-regulated. In some embodiments, the glutamate dehydrogenase that is up-regulated is from S. cerevisiae is GLT1 and corresponds to a polypeptide corresponding to SEQ ID NO: 33. In some embodiments, glutamine synthase is up-regulated. In some embodiments, the up-regulated glutamine synthase corresponds to EC 6.3.1.2. In some embodiments, glutamine synthase from S. cerevisiae is up-regulated. In some embodiments, the glutamine dehydrogenase that is up-regulated is from S. cerevisiae is GLN1 and corresponds to a polypeptide corresponding to SEQ ID NO: 35.
(167) In some embodiments, a urea-amido lyase is up-regulated. In some embodiments, the up-regulated urea-amido lyase corresponds to EC 6.3.4.6. In some embodiments, urea-amido lyase from S. cerevisiae is up-regulated. In some embodiments, the urea-amido lyase that is up-regulated is from S. cerevisiae is DUR1/2 and corresponds to a polypeptide corresponding to SEQ ID NO: 37.
(168) In some embodiments, a protease is up-regulated. In some embodiments, the up-regulated protease corresponds to EC 3.4.23.41. In some embodiments, the protease is an endoprotease. In some embodiments, the protease is an exoprotease. In some embodiments, a protease from Z. mays, N. crassa, P. anserine, or M. oryzae is up-regulated. In some embodiments, the protease that is up-regulated corresponds to a polypeptide corresponding to SEQ ID NOs: 41, 43, 45, 47, 49 or 51. In some embodiments, a permease is up-regulated. In some embodiments, a permease from S. cerevisiae is up-regulated. In some embodiments, the permease that is up-regulated is GAP1 and corresponds to a polypeptide corresponding to SEQ ID NO: 53.
(169) In some embodiments, a glucoamylase is up-regulated. In some embodiments, the up-regulated glucoamylase corresponds to EC 3.2.1.3. In some embodiments, a glucoamylase from S. fibuligera is up-regulated. In some embodiments, the glucoamylase from S. fibuligera that is up-regulated corresponds to a polypeptide corresponding to SEQ ID NO: 163.
(170) In some embodiments, an ammonium transporter is up-regulated. In some embodiments, an ammonium transporter from S. cerevisiae is up-regulated. In some embodiments, the ammonium transporter that is up-regulated is MEP1, MEP2, or MEP3 from S. cerevisiae and corresponds to a polypeptide corresponding to SEQ ID NOs: 19, 21, and 23. In some embodiments, a urea transporter is up-regulated. In some embodiments, a urea transporter from is from S. cerevisiae. In some embodiments, the urea transporter that is up-regulated is DUR3 or DUR4 from S. cerevisiae and corresponds to a polypeptide corresponding to SEQ ID NOs: 39.
(171) In some embodiments, glycerol-3-phosphate dehydrogenase is down-regulated. In some embodiments, the down-regulated Gpd is from an enzyme that corresponds to EC 1.1.1.8. In some embodiments, the glycerol-3-phosphate dehydrogenase is selected from the group consisting of glycerol-3-phosphate dehydrogenase 1 (“Gpd1”), glycerol-3-phosphate dehydrogenase 2 (“Gpd2”), and combinations thereof. In some embodiments, the Gpd1 is from S. cerevisiae and corresponds to a polypeptide encoded by SEQ ID NO: 5. In some embodiments, the Gpd2 is from S. cerevisiae and corresponds to a polypeptide encoded by SEQ ID NO: 7. In some embodiments, formate dehydrogenase is down-regulated. In some embodiments, the down-regulated formate dehydrogenase corresponds to an EC number selected from the group consisting of: EC 1.2.1.43 and EC 1.2.1.2. In some embodiments, formate dehydrogenase from S. cerevisiae is down-regulated. In some embodiments, the formate dehydrogenase from S. cerevisiae corresponds to a polypeptide corresponding to SEQ ID NO: 2 or a polynucleotide corresponding to SEQ ID NO: 3. In some embodiments, glycerol-3-phosphate phosphatase is down-regulated. In some embodiments, the down-regulated glycerol-3-phosphate phosphatase corresponds to EC 3.1.3.21. In some embodiments, the down-regulated glycerol-3-phosphate phosphatase corresponds to a polynucleotide corresponding to SEQ ID NOs 158 or 160 or a polypeptide corresponding to SEQ ID NOs 159 or 161.
(172) In some embodiments, glutamate dehydrogenase is down-regulated. In some embodiments, the glutamate dehydrogenase that is down-regulated is NADPH-dependent. In some embodiments, the down-regulated glutamate dehydrogenase corresponds to EC 1.4.1.4. In some embodiments, glutamate dehydrogenase that is down-regulated is from S. cerevisiae. In some embodiments, the glutamate dehydrogenase is from S. cerevisiae is GDH1 and corresponds to a polypeptide corresponding to SEQ ID NO. 25.
(173) In some embodiments, a regulatory element is down-regulated. In some embodiments, the regulatory element that is down-regulated is from S. cerevisiae. In some embodiments, the regulatory element from S. cerevisiae is Ure2 and corresponds to a polypeptide corresponding to SEQ ID NO: 55. In some embodiments, the regulatory element from S. cerevisiae is Aua1 and corresponds to a polypeptide corresponding to SEQ ID NO: 57.
(174) In some embodiments, bifunctional acetaldehyde-alcohol dehydrogenase (AdhE), B. adolescentis pyruvate formate lyase, and B. adolescentis pyruvate formate lyase activating enzyme are up-regulated, and Gpd1 and Gpd1 are down-regulated. In some embodiments, AdhE, B. adolescentis pyruvate formate lyase, and B. adolescentis pyruvate formate lyase activating enzyme are up-regulated, and Gpd1, Gpd2, Fdh1 and Fdh2 are down-regulated. In some embodiments. AdhE, B. adolescentis pyruvate formate lyase, and B. adolescentis pyruvate formate lyase activating enzyme are up-regulated. Gpd1, Gpd2, Fdh1 and Fdh2 are down-regulated, GPD1 is expressed under the control of the GPD2 promoter, and GPD2 is expressed under the control of the GPD1 promoter. In some embodiments, AdhE, B. adolescentis pyruvate formate lyase, and B. adolescentis pyruvate formate lyase activating enzyme are up-regulated, Gpd1, Gpd2, Fdh1, Fdh2, Gdh1 are down-regulated, GPD1 is expressed under the control of the GPD2 promoter, and GPD2 is expressed under the control of the GPD1 promoter. In some embodiments, AdhE, B. adolescentis pyruvate formate lyase, and B. adolescentis pyruvate formate lyase activating enzyme, and Glt1 are up-regulated. Gpd1, Gpd2, Fdh1, Fdh2, Gdh1 are down-regulated. GPD1 is expressed under the control of the GPD2 promoter, and GPD2 is expressed under the control of the GPD1 promoter. In some embodiments, AdhE, B. adolescenlis pyruvate formate lyase, and B. adolescentis pyruvate formate lyase activating enzyme, and Gln1 are up-regulated, Gpd1, Gpd2, Fdh1, Pdh2, Gdh1 are down-regulated, GPD1 is expressed under tire control of the GPD2 promoter, and GPD2 is expressed under the control of the GPD1 promoter. In some embodiments. AdhE, B. adolescentis pyruvate formate lyase, and B. adolescentis pyruvate formate lyase activating enzyme. Gln1 and Glt1 are up-regulated, Gpd1, Gpd2, Fdh1, Fdh2, Gdh1 are down-regulated, GPD1 is expressed under the control of the GPD2 promoter, and GPD2 is expressed under the control of the GPD1 promoter. In some embodiments, the regulatory element Ure2 is down-regulated. In some embodiments, the regulatory element Aua1 is down-regulated. In some embodiments, Gln3 is up-regulated.
(175) In some embodiments, AdhE, B. adolescentis pyruvate formate lyase, and B. adolescentis pyruvate formate lyase activating enzyme are up-regulated, and Gpd2, Fdh1, and Fdh2 are down-regulated. In some embodiments, AdhE, B. adolescentis pyruvate formate lyase, and B. adolescenlis pyruvate formate lyase activating enzyme are up-regulated, and Gpd2, Fdh1, Fdh2, and Gdh1 are down-regulated. In some embodiments, AdhE, B. adolescentis pyruvate formate lyase, and B. adolescentis pyruvate formate lyase activating enzyme are up-regulated, and Gpd1, Fdh1, and Fdh2 are down-regulated. In some embodiments, AdhE, B. adolescentis pyruvate formate lyase, and B. adolescentis pyruvate formate lyase activating enzyme are up-regulated, and Gpd1, Fdh1, Fdh2, and Gdh1 are down-regulated. In some embodiments. Dur1/2 is additionally expressed. In some embodiments, Dur1/2 is expressed from the TEF2 promoter. In some embodiments, Dur1/2 is expressed from the HXT7 promoter. In some embodiments, Dur1/2 is expressed from the GPM1 promoter. In some embodiments. Dur1/2 is expressed from the ADH1 promoter. In some embodiments, Dur1/2 is expressed from the HXT7/TEF2 promoters. In some embodiments, Gln3 is up-regulated. In some embodiments, GPD1 is expressed from the GPD2 promoter, in some embodiments, GPD2 is expressed from a GPD1 promoter.
(176) Ethanol Production
(177) For a microorganism to produce ethanol most economically, it is desired to produce a high yield. In one embodiment, the only product produced is ethanol. Extra products lead to a reduction in product yield and an increase in capital and operating costs, particularly if the extra products have little or no value. Extra products also require additional capital and operating costs to separate these products from ethanol.
(178) Ethanol production can be measured using any method known in the art. For example, the quantity of ethanol in fermentation samples can be assessed using HPLC analysis. Additionally, many ethanol assay kits are commercially available, for example, alcohol oxidase enzyme based assays. Methods of determining ethanol production are within the scope of those skilled in the art from the teachings herein.
(179) In some embodiments of the invention where redirected carbon flux generates increased ethanol production, the ethanol output can be improved by growth-coupled selection. For example, continuous culture or serial dilution cultures can be performed to select for cells that grow faster and/or produce ethanol (or any desired product) more efficiently on a desired feedstock.
(180) One embodiment of the present invention relates to a method of producing ethanol using a microorganism described herein wherein the microorganism is cultured in the presence of a carbon containing feedstock for sufficient time to produce ethanol and, optionally, extracting the ethanol. In some embodiments, nitrogen is added to the culture containing the recombinant microorganism and the feedstock.
(181) Ethanol may be extracted by methods known in the art. (See, e.g., U.S. Appl. Pub. No. 2011/0171709, which is incorporated herein by reference in its entirety.)
(182) Another embodiment of the present invention relates to a method of producing ethanol using a co-culture composed of at least two microorganisms in which at least one of the organisms is an organism described herein, and at least one of the organisms is a genetically distinct microorganism. In some embodiments, the genetically distinct microorganism is a yeast or bacterium. In some embodiments the genetically distinct microorganism is any organism from the genus Issatchenkia, Pichia, Clavispora, Candida, Hansenula, Kluyveromyces, Saccharomyces, Trichoderma, Thermoascus, Escherichia, Clostridium, Caldicellulosiruptor, Thermoanaerobacter and Thermoanaerobacterium.
(183) In some embodiments, the recombinant microorganism produces about 2% to about 3% higher ethanol titer than a wildtype, non-recombinant organism; at least about 1% to at least about 2% higher ethanol titer than a wildtype, non-recombinant organism; at least about 1% to at least about 5% higher ethanol titer than a wildtype, non-recombinant organism; at least about 1% to at least about 7% higher ethanol titer than a wildtype, non-recombinant organism; at least about 1% to at least about 10% higher ethanol titer than a wildtype, non-recombinant organism; at least about 1% to at least about 15% higher ethanol titer than a wildtype, non-recombinant organism; at least about 1% to at least about 20% higher ethanol titer than a wildtype, non-recombinant organism; at least about 1% to at least about 30% higher ethanol titer than a wildtype, non-recombinant organism; at least about 1% to at least about 50% higher ethanol titer than a wildtype, non-recombinant organism; at least about 1% to at least about 75% higher ethanol titer than a wildtype, non-recombinant organism; at least about 1% to at least about 100% higher ethanol titer than a wildtype, non-recombinant organism. In some embodiments, the recombinant microorganism produces at least about 0.5 g/L ethanol to at least about 2 g/L ethanol, at least about 0.5 g/L ethanol to at least about 3 g/L, ethanol, at least about 0.5 g/L ethanol to at least about 5 g/L ethanol, at least about 0.5 g/L ethanol to at least about 7 g/L ethanol, at least about 0.5 g/L ethanol to at least about 10 g/L ethanol, at least about 0.5 g/L ethanol to at least about 15 g/L ethanol, at least about 0.5 g/L ethanol to at least about 20 g/L ethanol, at least about 0.5 g/L ethanol to at least about 30 g/L ethanol, at least about 0.5 g/L ethanol to at least about 40 g/L ethanol, at least about 0.5 g/L ethanol to at least about 50 g/L ethanol, at least about 0.5 g/L ethanol to at least about 75 g/L ethanol, at least about 0.5 g/L ethanol to at least about 99 g/L ethanol, at least about 0.5 g/L ethanol to at least about 125 g/L ethanol, or at least about 0.5 g/L to at least about 150 g/L ethanol per at least about 24 hour, at least about 48 hour, or at least about 72 hour incubation on a carbon-containing feed stock, such as corn mash.
(184) In some embodiments, the recombinant microorganism produces ethanol at least about 55% to at least about 75% of theoretical yield, at least about 50% to at least about 80% of theoretical yield, at least about 45% to at least about 85% of theoretical yield, at least about 40% to at least about 90% of theoretical yield, at least about 35% to at least about 95% of theoretical yield, at least about 30% to at least about 99% of theoretical yield, or at least about 25% to at least about 99% of theoretical yield. In some embodiments, methods of producing ethanol can comprise contacting a biomass feedstock with a host cell or co-culture of the invention and additionally contacting the biomass feedstock with externally produced saccharolytic enzymes. In some embodiments, the host cells are genetically engineered transduced, transformed, or transfected) with the polynucleotides encoding saccharolytic enzymes.
(185) An “amylolytic enzyme” can be any enzyme involved in amylase digestion, metabolism and/or hydrolysis. The term “amylase” refers to an enzyme that breaks starch down into sugar. Amylase is present in human saliva, where it begins the chemical process of digestion. Foods that contain much starch but little sugar, such as rice and potato, taste slightly sweet as they are chewed because amylase turns some of their starch into sugar in the mouth. The pancreas also makes amylase (α-amylase) to hydrolyse dietary starch into disaccharides and trisaccharides which are converted by other enzymes to glucose to supply the body with energy. Plants and some bacteria also produce amylase. All amylases are glycoside hydrolases and act on α-1,41-glycosidic bonds. Some amylases, such as γ-amylase (glucoamylase), also act on α-1,6-glycosidic bonds. Amylase enzymes include α-amylase (EC 3.2.1.1), β-amylase (EC 3.2.1.2), and γ-amylase (EC 3.2.1.3). The α-amylases are calcium metalloenzymes, unable to function in the absence of calcium. By acting at random locations along the starch chain, α-amylase breaks down long-chain carbohydrates, ultimately yielding maltotriose and maltose from amylose, or maltose, glucose and “limit dextrin” from amylopectin. Because it can act anywhere on the substrate, α-amylase tends to be faster-acting than β-amylase, in animals, it is a major digestive enzyme and its optimum pH is about 6.7-7.0. Another form of amylase, β-amylase is also synthesized by bacteria, fungi, and plants. Working from the non-reducing end, β-amylase catalyzes the hydrolysis of the second α-1,4 glycosidic bond, cleaving off two glucose units (maltose) at a time. Many microbes produce amylase to degrade extracellular starches. In addition to cleaving the last α(1-4) glycosidic linkages at the nonreducing end of amylose and amylopectin, yielding glucose, γ-amylase will cleave α(1-6) glycosidic linkages. Another amylolytic enzyme is alpha-glucosidase that acts on maltose and other short malto-oligosaccharides produced by alpha-, beta-, and gamma-amylases, converting them to glucose. Another amylolytic enzyme is pullulanase. Pullulanase is a specific kind of glucanase, an amylolytic exoenzyme, that degrades pullulan. Pullulan is regarded as a chain of maltotriose units linked by alpha-1,6-glycosidic bonds. Pullulanase (EC 3.2.1.41) is also known as pullulan-6-glucanohydrolase (debranching enzyme). Another amylolytic enzyme, isopullulanase, hydrolyses pullulan to isopanose (6-alpha-maltosylglucose). Isopullulanase (EC 3.2.1.57) is also known as pullulan 4-glucanohydrolase. An “amylase” can be any enzyme involved in amylase digestion, metabolism and/or hydrolysis, including α-amylase, β-amylase, glucoamylase, pullulanase, isopullulanase, and alpha-glucosidase.
(186) In some embodiments, the recombinant microorganisms of the invention further comprise one or more native and/or heterologous enzymes which encodes a saccharolytic enzyme, including amylases, celluloses, hemicellulases, cellulolytic and amylolytic accessory enzymes, inulinases, levanases, and pentose sugar utilizing enzymes. In one aspect, the saccharolytic enzyme is an amylase, where the amylase is selected from H. grisea, T. aurantiacus, T. emersonii, T. reesci, C. lacteus, C. formasamus, N. takasagoensis, C. acinaciformis, M. darwinensis, N. walkeri, S. fibuligera, C. luckowense R. speratus, Thermobfida fusca, Clostridum thermocellum, Clostridium cellulolyticum, Clostridum josui, Bacillus pumilis, Cellulomonas fimi, Saccharophagus degradans, Piromyces equii, Neocallimastix particarum or Arabidopsis thaliana. In another aspect, the saccharolytic enzyme is a glucoamylase (glu-0111-CO) from S. fibuligera.
(187) The term “xylanolytic activity” is intended to include the ability to hydrolyze glycosidic linkages in oligopentoses and polypentoses. The term “xylanase” is the name given to a class of enzymes which degrade the linear polysaccharide beta-1,4-xylan into xylose, thus breaking down hemicellulose, one of the major components of plant cell walls. As such, it plays a major role in micro-organisms thriving on plant sources (mammals, conversely, do not produce xylanase). Additionally, xylanases are present in fungi for the degradation of plant matter into usable nutrients. Xylanases include those enzymes that correspond to E.C. Number 3.2.1.8. A “xylose metabolizing enzyme” can be any enzyme involved in xylose digestion, metabolism and/or hydrolysis, including a xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and a xylose transaldolase protein.
(188) The term “pectinase” is a general term fir enzymes, such as pectolyase, pectozyme and polygalacturonase, commonly referred to in brewing as pectic enzymes. These enzymes break down pectin, a polysaccharide substrate that is found in the cell walls of plants. One of the most studied and widely used commercial pectinases is polygalacturonase. Pectinases are commonly used in processes involving the degradation of plant materials, such as speeding up the extraction of fruit juice from fruit, including apples and sapota. Pectinases have also been used in wine production since the 1960s.
(189) A “saccharolytic enzyme” can be any enzyme involved in carbohydrate digestion, metabolism and/or hydrolysis, including amylases, cellulases, hemicellulases, cellulolytic and amylolytic accessory enzymes, inulinases, levanases, and pentose sugar utilizing enzymes.
(190) “pentose sugar utilizing enzyme” can be any enzyme involved in pentose sugar digestion, metabolism and/or hydrolysis, including xylanase, arabinase, arabinoxylanase, arabinosidase, arabinofuranosidase, arabinoxylanase arabinosidase, and arabinofuranosidase, arabinose isomerase, ribulose-5-phosphate 4-epimerase, xylose isomerase, xylulokinase, xylose reductase, xylose dehydrogenase, xylitol dehydrogenase, xylonate dehydratase, xylose transketolase, and/or xylose transaldolase.
(191) Glycerol Production
(192) In some embodiments of the invention where redirected carbon flux generates increased ethanol production, the glycerol output can be decreased by growth-coupled selection. For example, continuous culture or serial dilution cultures can be performed to select for cells that produce less glycerol on a desired feedstock. Glycerol can be measured, for example, by HPLC analysis of metabolite concentrations.
(193) In some embodiments, the recombinant microorganism produces at least about 20% to at least about 30% less glycerol than a wildtype, non-recombinant organism; at least about 30% to at least about 50% less glycerol than a wildtype, non-recombinant organism; at least about 40% to at least about 60% less glycerol than a wildtype, non-recombinant organism; at least about 50% to at least about 70% less glycerol than a wildtype, non-recombinant organism; at least about 60% to at least about 80% less glycerol than a wildtype, non-recombinant organism; at least about 70% to at least about 90% less glycerol than a wildtype, non-recombinant organism; at least about 75% to at least about 95% less glycerol than a wildtype, non-recombinant organism; at least about 70% to at least about 99% less glycerol than a wildtype, non-recombinant organism; at least about 15% to at least about 30% less glycerol than a wildtype, non-recombinant organism; at least about 10% to at least about 40% less glycerol than a wildtype, non-recombinant organism; at least about 10% to at least about 50% less glycerol than a wildtype, non-recombinant organism; at least about 10% to at least about 60% less glycerol than a wildtype, non-recombinant organism: at least about 10% to at least about 70% less glycerol than a wildtype, non-recombinant organism, at least about 10% to at least about 80% less glycerol than a wildtype, non-recombinant organism; at least about 10% to at least about 90% less glycerol than a wildtype, non-recombinant organism; at least about 10% to at least about 99% less glycerol than a wildtype, non-recombinant organism: at least about 10% to at least about 100% less glycerol than a wildtype, non-recombinant organism; at least about 5% to at least about 100% less glycerol than a wildtype, non-recombinant organism; a t least about 1% to at least about 100% less glycerol than, a wildtype, non-recombinant organism. In some embodiments, the recombinant microorganism produces no glycerol. In some embodiments, the recombinant microorganism has a growth rate at least about ½ to at least about equal to the growth rate of a wildtype, non-recombinant organism, at least about ¼ to at least about equal to the growth rate of a wildtype, non-recombinant organism, at least about ⅛ to at least about equal to the growth rate of a wildtype, non-recombinant organism, at least about 1/10 to at least about equal to the growth rate of a wildtype, non-recombinant organism, at least about 1/25 to at least about equal to the growth rate of a wildtype, non-recombinant organism, at least about 1/50 to at least about equal to the growth rate of a wildtype, non-recombinant organism or at least about 1/100th to at least about equal to the growth rate of a wildtype, non-recombinant organism.
(194) A wildtype-non-recombinant organism produces glycerol at a rate of at least about 8-11 mM glycerol per gram dry cell weight (DCW) during anaerobic growth. In some embodiments, glycerol production is reduced to a rate of between 1-10 mM glycerol per gram dry cell weight during anaerobic growth.
EXAMPLES
(195) Strains used in the follow ing examples were created using Mascoma Assemblies (“MAs”). Schematic diagrams of the MAs can be seen in
(196) TABLE-US-00002 TABLE 2 Plasmids used to make the MAs. Plasmid ID Description pMU2873 AGTEF pro-KAN-AGTEF ter/HXT2 pro-TDK-ACT1 ter pMU2819 AGTEF pro-cloNAT-AGTEF ter/HXT2 pro-TDK-ACT1 ter pMU2908 PGK1 pro-S. cerevisiae GDH2-ENO1 ter pMU2909 ADH1 pro-S. cerevisiae GDH2-PDC1 ter pMU2911 ADH1 pro-GLN1-PDC1 ter pMU2913 PGK1 pro-GLT1-ENO1 ter pMU3409 TEF2 pro-DUR1,2-ADH3 ter pMU3410 HXT7 pro-DUR1,2-PMA1t pMU3411 ADH1 pro-DUR1,2-PDC1 ter pMU3459 ADH1 pro-DUR3-PDC1 ter pMU3460 ADH1 pro-MEP1-PDC1 ter pMU3461 ADH1 pro-MEP2-PDC1 ter pMU3463 ADH1 pro-GAP1-PDC1 ter pMU3464 TEF2 pro-DUR3-ADH3 ter pMU3465 TEF2 pro-MEP1-ADH3 ter pMU3466 TEF2 pro-MEP2-ADH3 ter pMU2468 TEF2 pro-GAP1-ADH3 ter pMU3471 TPI pro-DUR3-FBA1 ter PMU3472 TPI pro-MEP1-FBA1 ter pMU3473 TPI pro-MEP2-FBA1 ter pMU3475 TPI pro-GAP1-FBA1 ter pMU3597 ADH1 pro-N. crassa GDH2-PDC1 ter pMU2605 ADH1 pro-MEP3-PDC1 ter pMU3606 TEF2 pro-MEP3-ADH3ter pMU3607 TPI1 pro-MEP3-FBA1 ter
(197) TABLE-US-00003 TABLE 3 Primers used to create MAs. SEQ ID Primer Sequence 5′ to 3′ Description 66 X14961 gcagttaccttttagcacccaac 5′ GDH1 5′ flank 67 X14966 ggtgtaggtaagcagaatgaggag 3′ GDH1 3′ flank 68 X15464 GTCCATGTAAAATGATTGCTCCAATGATTGAAAGAGGTTTAGACATTGGCTCTTCATTG ENOt + PDC1t 69 X15465 ctaagctcaatgaagagccaatgtctaaacctctttcaatcattggagcaatcatttta PDC1t + ENOt 70 X18846 gtccatgtaaaatgattgctccaatgattgaaaagcacgcagcacgctgtatttacgtat FCY3′ PDC1t 71 X18847 AATTAAATACGTAAATACAGCGTGCTGCGTGCTTTTCAATCATTGGAGCAATCATTTTA PDC1t + FCY3′ 72 X18858 agccagcttaaagagttaaaaatttcatagctactacttattcccttcgagattatatct pTP1 + FCY5′ 73 X18859 GTTCCTAGATATAATCTCGAAGGGAATAAGTAGTAGCTATGAAATTTTTAACTCTTTAA FCY5′ + pTP1 74 X18860 acatcatcttttaacttgaatttattctctagcagcacgcagcacgctgtatttacgtat FCY3′ + FBA1t 75 X18861 AATTAAATACGTAAATACAGCGTGCTGCGTGCTGCTAGAGAATAAATTCAAGTTAAAAG FBA1t + FCY3′ 76 X18869 AGATCCTGTGGTAGTGCTGTCTGAACAGAA FCY3′ for 2kb 77 X18955 ataaaattaaatacgtaaatacagcgtgctgcgtgctcgatttttttctaaaccgtgga pADH1 + FCY3′ rev 78 X19513 acttggtgcggtccatgtaaaatgattgctccaatgattgaaaatgaggaagaaatccaa ADH3t + PDC1t 79 X19514 TGAAGGTCATTAGGATTTGGATTTCTTCCTCATTTTCAATCATTGGAGCAATCATTTTAC PDC1t + ADH3t 80 X19551 agccagcttaaagagttaaaaatttcatagctagggcgccataaccaaggtatctatag pTEF2 + FCY5′ 81 X19552 TGGCGGTCTATAGATACCTTGGTTATGGCGCCCTAGCTATGAAATTTTTAACTCTTTAAG FCY5′ + pTEF2 82 X19721 aaagaaatgtcagagccagaatttcaacaagctaagctttctaactgatctatccaaaa pPGK + GDH15′ 83 X19722 TTTTCAGTTTTGGATAGATCAGTTAGAAAGCTTAGCTTGTTGAAATTCTGGCTCTGACAT GDH15′ + pPGK 84 X19726 atccgaaatattccacggtttagaaaaaaatcggatgctatgtttgaccaaggtgatgta GDH13′ + pADH1 85 X19727 TTAAAATACATCACCTTGGTCAAACATAGCATCCGATTTTTTTCTAAACCGTGGAATATT pADH1 + GDH13′ 86 X19948 aaagaaatgtcagagccagaatttcaacaagctgatgctatgtttgaccaaggtgatgta GDH13′ + GDH15′ for deletion 87 x19949 TTAAAATACATCACCTTGGTCAAACATAGCATCAGCTTGTTGAAATTCTGGCTCTGACAT GDH15′ + GDH13′ for deletion 88 X19950 atccgaaatattccacggtttagaaaaaaatcgagcacgcagcacgctgtatttacgtat FCY3′ + pADH1 89 X19967 tgaaggtcattaggatttggatttcttcctcataaattagtgtgtgtgcattatatatat PMA1t + ADH3t 90 X19968 TTTTTAATATATATAATGCACACACACTAATTTATGAGGAAGAAATCCAAATCCTAATGA ADH3t + PMA1t 91 X19969 AATTAAATACGTAAATACAGCGTGCTGCGTGCTCCAGAAAGGCAACGCAAAATTTTTTT pHXT7 + FCY3′ 92 X19970 ccctggaaaaaaaattttgcgttgcctttctggagcacgcagcacgctgtatttacgtat FCY3′ + pHXT7 93 X20022 aggtagacgctacagtcacaggtgtcacaact URE2 5′ flank 94 X20023 GGACGAGGCAAGCTAAACAGATCTCTAGACCTATTGGTGTACAACTTAATTTGCAGCTTA URE2 5′ flank 95 X20024 ccgtttcttttctttggactatcatgtagtctcaggctgctttaaaaacaagaaagaaag URE2 3′ flank 96 X20025 GAGTGGGATGCGCATATAGTGCATGAACCTAT URE2 3′ flank 97 X20026 ttgttttaagctgcaaattaagttgtacaccaaaggctgctttaaaaacaagaaagaaag URE2 3′ + 5′ for deletion 98 X20027 CTTCTTCTTTCTTTCTTGTTTTTAAAGCAGCCTTTGGTGTACAACTTAATTTGCAGCTTA URE2 5′ + 3′ for deletion 99 X20028 ttgttttaagctgcaaattaagttgtacaccaataggtctagagatctgtttagcttgcc pAGTEF + URE2 5′ 100 X20029 CTTCTTCTTTCTTTCTTGTTTTTAAAGCAGCCTGAGACTACATGATAGTCCAAAGAAAAG pHXT2rc + URE2 3′ 101 X20043 ATAAAATTAAATACGTAAATACAGCGTGCTGCGTGCTATGAGGAAGAAATCCAAATCCT ADH3 t tails for FCY1 3′ flank 102 X20044 tgaaggtcattaggatttggatttcttcctcatagcacgcagcacgctgtatttacgta FCY 3′ flank tails for ADH3t 103 X20282 agccagcttaaagagttaaaaatttcatagctaccagaaaggcaacgcaaaatttttttt pHXT7 + FCY5′ 104 X20283 CCCTGGAAAAAAAATTTTGCGTTGCCTTTCTGGTAGCTATGAAATTTTTAACTCTTTAAG FCY5′ + pHXT7 105 X20284 tttttaatatatataatgcacacacactaatttagcacgcagcacgctgtatttacgtat FCY3′ + PMA1t 106 X20285 AATTAAATACGTAAATACAGCGTGCTGCGTGCTAAATTAGTGTGTGTGCATTATATATAT PMA1t + FCY3′ 107 X20286 agccagcttaaagagttaaaaatttcatagctatgtggtagaattcaaaagactatgtga pGPM1 + FCY5′ 108 X20287 ATGGCATCACATAGTCTTTTGAATTCTACCACATAGCTATGAAATTTTTAACTCTTTAAG FCY5′ + pGPM1 109 X20288 ttttaatattgcttttcaattactgttattaaaagcacgcagcacgctgtatttacgtat FCY3′ + TPIt 110 X20289 AATTAAATACGTAAATACAGCGTGCTGCGTGCTTTTAATAACAGTAATTGAAAAGCAATA TPIt + FCY3′ 111 X20620 ggtgattggaatggttatggttccggaatcgc AUA1 5′ Flank 112 X20621 GGACGAGGCAAGCTAAACAGATCTCTAGACCTATATACTACATAGAAAGCAATTAAAAGA AUA15′ + pAGTEF 113 X20622 ccgtttcttttctttggactatcatgtagtctcctccacctaacaaacccgcaccaacac AUA13′ + pHXT2rc 114 X20623 GTCATATGGCCTCTTAACGTGGTCCTTTGTGG AUA1 3′ Flank 115 X20630 tttttatcttttaattgctttctatgtagtatataggtctagagatctgtttagcttgcc pAGTEF + AUA1 5′ 116 X20631 TACTTGGTGTTGGTGCGGGTTTGTTAGGTGGAGGAGACTACATGATAGTCCAAAGAAAAG pHXT2rc + AUA13′ 117 X20632 tttttatcttttaattgctttctatgtagtatactccacctaacaaacccgcaccaacac AUA13′ + AUA15′ 118 x20633 TACTTGGTGTTGGTGCGGGTTTGTTAGGTGGAGTATACTACATAGAAAGCAATTAAAAGA AUA15′ + AUA13′ 119 X21123 gcgacatgtgatgagattgcatgcacctccacagaa GDH2 5′ Flank 120 X21124 GGACGAGGCAAGCTAAACAGATCTCTAGACCTATCTTTATTCTTTTTATTGTTGTGAATT GDH2 5′ Flank + pAGTEF 121 X21125 ccgtttcttttctttggactatcatgtagtctcgcttcaataaaattgttttgtataaat GDH2 3′ Flank + pHXT2rc 122 X21126 GGCAGCTATCTCTACTATCCCGTTTAGTACTATCC GDH2 3′ Flank 123 X21127 atattaaattcacaacaataaaaagaataaagataggtctagagatctgtttagcttgcc pAGTEF + GDH2 5′ 124 X21128 GAACTAATTTATACAAAACAATTTTATTGAAGCGAGACTACATGATAGTCCAAAGAAAAG pHXT2rc + GDH2 3′ 125 X21133 atattaaattcacaacaataaaaagaataaagagcttcaataaaattgttttgtataaa GDH2 3′ + GDH2 5′ for deletion 126 X21135 gcattgattgtctatcagagcatatcaaggtggt GDH3 5′ Flank 127 X21136 GGACGAGGCAAGCTAAACAGATCTCTAGACCTACGGTGACTGTTGCTACTTCCCTATATA GDH3 5′ Flank + pAGTEF 128 X21137 ccgtttcttttctttggactatcatgtagtctcccgtaagcgctattttctttttgttcg GDH3 3′ Flank + pHXT2rc 129 X21138 GGCTAGGACCCCGTAAGGAGGAAAGAATAGGCAAG GDH3 3′ Flank 130 X21139 tatatatatatagggaagtagcaacagtcaccgtaggtctagagatctgtttagcttgcc pAGTEF + GDH3 5′ 131 X21140 TAGTTACGAACAAAAAGAAAATAGCGCTTACGGGAGACTACATGATAGTCCAAAGAAAAG pHXT2rc + GDH3 3′ 132 X21147 tatatatatatagggaagtagcaacagtcaccgccgtaagcgctattttctttttgttcg GDH3 3′ + GDH3 5′ 133 X21148 TAGTTACGAACAAAAAGAAAATAGCGCTTACGGCGGTGACTGTTGCTACTTCCCTATATA GDH3 5′ + GDH3 3′ 134 X21179 ttgttttaagctgcaaattaagttgtacaccaagggcgccataaccaaggtatctataga pTEF2 + URE2 5′ 135 X21180 TGGCGGTCTATAGATACCTTGGTTATGGCGCCCTTGGTGTACAACTTAATTTGCAGCTTA URE2 5′ + pTEF2 136 X21181 CTTCTTCTTTCTTTCTTGTTTTTAAAGCAGCCTCGATTTTTTTCTAAACCGTGGAATATT pADH1rc + URE2 3′ 137 X21182 atccgaaatattccacggtttagaaaaaaatcgaggctgctttaaaaacaagaaagaaag URE2 3′ + pADH1rc 138 X21289 aaagaaatgtcagagccagaatttcaacaagctaggtctagagatctgtttagcttgcct pAGTEF + GDH1 5′ 139 X21290 TTAAAATACATCACCTTGGTCAAACATAGCATCGAGACTACATGATAGTCCAAAGAAAAG pHXT2rc + GDH1 3′ 140 X21291 GGGACGAGGCAAGCTAAACAGATCTCTAGACCTAGCTTGTTGAAATTCTGGCTCTGACAT GDH1 5′ + pAGTEF 141 X21292 ccgtttcttttctttggactatcatgtagtctcgatgctatgtttgaccaaggtgatgt GDH1 3′ + pHXT2rc 142 X21319 ttgttttaagctgcaaattaagttgtacaccaacgatttttttctaaaccgtggaatatt pADH1 + URE2 5′ 143 X21320 ATCCGAAATATTCCACGGTTTAGAAAAAAATCGTTGGTGTACAACTTAATTTGCAGCTTA URE2 5′ pADH1 144 X21321 ttttcagttttggatagatcagttagaaagcttaggctgctttaaaaacaagaaagaaag URE2 3′ + PGKprc 145 X21322 CTTCTTCTTTCTTTCTTGTTTTTAAAGCAGCCTAAGCTTTCTAACTGATCTATCCAAAAC PGKprc + URE2 3′ 146 X21507 GAACTAATTTATACAAAACAATTTTATTGAAGCTCTTTATTCTTTTTATTGTTGTGAATT GDH25′ + GDH23′ for deletion 147 X21735 agccagcttaaagagttaaaaatttcatagctacgatttttttctaaaccgtggaatatt pADH1 + FCY5′ 148 X21736 ATCCGAAATATTCCACGGTTTAGAAAAAAATCGTAGCTATGAAATTTTTAACTCTTTAAG FCY5′ + pADH1 149 X21754 gccaaagtggattctcctactcaagctttgc FCY5′ Flank 150 X23319 aaagaaatgtcagagccagaatttcaacaagctcgatttttttctaaaccgtggaatatt pADH1 + GDH15′ 151 X23320 ATCCGAAATATTCCACGGTTTAGAAAAAAATCGAGCTTGTTGAAATTCTGGCTCTGACAT GDH1 5′ + pADH1 152 X23321 gtccatgtaaaatgattgctccaatgattgaaagatgctatgtttgaccaaggtgatgta GDH1 3′ + PDC1t 153 X23322 TTAAAATACATCACCTTGGTCAAACATAGCATCTTTCAATCATTGGAGCAATCATTTTAC PDC1t + GDH13′ 154 X23408 TTTTCAGTTTTGGATAGATCAGTTAGAAAGCTTTAGCTATGAAATTTTTAACTCTTTAAG FCY5′ + pPGK 155 X23409 agccagcttaaagagttaaaaatttcatagctaaagctttctaactgatctatccaaaac pPGK + PCY5′
(198) TABLE-US-00004 TABLE 4 Strain genotypes. Strain Description Genotype Associated MA Cassette(s) M2390 Type Strain WT M3465 Glycerol Reduction Δfdh1::MA0608Δfdh2::MA0280Δgpd2::MA0289 MA0280, MA0289, MA0608 Strain M3467 Glycerol Reduction Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290 MA0280, MA0290, MA0608 Strain M3469 Glycerol Reduction Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0293 MA0280, MA0608, MA0293 Strain M3624 Glycerol Reduction Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286 MA0286, MA0280, MA0290, MA0608 Strain M4076 GDH1 marked deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286Δgd MA0286, MA0280, MA0290, MA0608, h1::MA0631 MA0631 M4117 S. cerevisiae GDH2 Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286Δgd MA0286, MA0280, MA0290, MA0608, over expression h1::MA0425 MA0425 M4118 S. cerevisiae Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286Δgd MA0286, MA0280, MA0290, MA0608, GLN1/GLT1 over h1::MA0426 MA0426 expression M4312 URE2 marked deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286Δure MA0286, MA0280, MA0290, MA0608, 2::MA0622 MA0622 M4373 GDH1 marked deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd2::MA0289Δgdh1::MA0631 MA0280, MA0289, MA0608, MA0631 M4375 GDH1 marked deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgdh1::MA0631 MA0280, MA0290, MA0608, MA0631 M4377 GDH1 marked deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0293Δgdh1::MA0631 MA0280, MA0608, MA0293, MA0631 M4400 GDH1 clean deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd2::MA0289Δgdh1::MA0888 MA0280, MA0289, MA0608, MA0888 M4401 GDH1 clean deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgdh1::MA0888 MA0280, MA0290, MA0608, MA0888 M4402 GDH1 clean deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0293Δgdh1::MA0888 MA0280, MA0608, MA0293, MA0888 M4406 URE2 clean deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286Δure MA0286, MA0280, MA0290, MA0608, 2::MA0622.1 MA0622.1 M4427 DUR1,2 over Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δfcy1::MA0464.1 MA0280, MA0290, MA0608, MA0464.1 expression M4428 DUR1,2 over Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δfcy1::MA0465.1 MA0280, MA0290, MA0608, MA0465.1 expression M4429 DUR1,2 over Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δfcy1::MA0467.1 MA0280, MA0290, MA0608, MA0467.1 expression M4430 DUR1,2 over Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δfcy1::MA0454.14 MA0280, MA0290, MA0608, MA0454.14 expression M4431 DUR1,2 over Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0293Δfcy1::MA0464.1 MA0280, MA0293, MA0608, MA0464.1 expression M4432 DUR1,2 over Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0293Δfcy1::MA0465.1 MA0280, MA0293, MA0608, MA0465.1 expression M4433 DUR1,2 over Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0293Δfcy1::MA0467.1 MA0280, MA0290, MA0608, MA0467.1 expression M4434 DUR1,2 over Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0293Δfcy1::MA0454.14 MA0280, MA0290, MA0608, MA0454.14 expression M4469 S. cerevisiae GDH2 Δfdh1::MA0608Δfdh2::MA0280Δgpd2::MA0289Δgdh1::MA0425 MA0280, MA0289, MA0608, MA0425 over expression M4471 S. cerevisiae GDH2 Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0293Δgdh1::MA0425 MA0280, MA0608, MA0293, MA0425 over expression Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286Δau MA0286, MA0280, MA0290, MA0608, M4507 AUA1 marked deletion a1::MA0617 MA0617 M4538 GDH1 marked deletion Δgdh1::MA0631 MA0631 M4540 AUA1 marked deletion Δaua1::MA0617 MA0617 M4542 URE2 marked deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0293Δure2::MA0622 MA0280, MA0608, MA0293, MA0622 M4571 AUA1 clean deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286Δau MA0286, MA0280, MA0290, MA0608, a1::MA0617.1 MA0617.1 M4573 GDH1 clean deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286Δgd MA0286, MA0280, MA0290, MA0608, h1::MA0888 MA0888 M4590 GDH1 clean deletion Δgdh1::MA0888 MA0888 M4591 AUA1 clean deletion Δaua1::MA0617.1 MA0617.1 M4592 URE2 clean deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0293Δure2::MA0622.1 MA0280, MA0608, MA0293, MA0622.1 M4614 URE2 marked deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286Δgd MA0286, MA0280, MA0290, MA0608, h1::MA0425Δure2::MA0622 MA0425, MA0622 M4615 URE2 marked deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286Δgd MA0286, MA0280, MA0290, MA0608, h1::MA0426Δure2::MA0622 MA0426, MA0622 M4616 URE2 marked deletion Δure2::MA0622 MA0622 M4622 S. cerevisiae GDH2 Δgdh1::MA0425 MA0425 over expression M4623 S. cerevisiae Δgdh1::MA0426 MA0426 GLN1/GLT1 over expression M4624 S. cerevisiae Δgdh1::MA0426 MA0426 GLN1/GLT1 over expression M4625 S. cerevisiae Δfdh1::MA0608Δfdh2::MA0280Δgpd2::MA0289Δgpd1::MA0426 MA0280, MA0289, MA0608, MA0426 GLN1/GLT1 over expression M4625 S. cerevisiae Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0293Δgpd1::MA0426 MA0280, MA0608, MA0293, MA0426 GLN1/GLT1 over expression M4626 S. cerevisiae Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0293Δgpd1::MA0426 MA0280, MA0608, MA0293, MA0426 GLN1/GLT1 over expression M4654 GDH3 marked deletion Δgdh3::MA0615 MA0615 M4655 GDH2 marked deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286Δgd MA0286, MA0280, MA0290, MA0608, h1::MA0426Δgdh2::MA0616 MA0426, MA0616 M4656 GDH3 marked deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286Δgd MA0286, MA0280, MA0290, MA0608, h1::MA0426Δgdh3::MA0615 MA0426, MA0615 M4657 GDH3 marked deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286Δgd MA0286, MA0280, MA0290, MA0608, h1::MA0425Δgdh3::MA0615 MA0425, MA0615 M4674 URE2 clean deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286Δgd MA0286, MA0280, MA0290, MA0608, h1::MA0425Δure2::MA0622.1 MA0425, MA0622.1 M4675 URE2 clean deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286Δgd MA0286, MA0280, MA0290, MA0608, h1::MA0426Δure2::MA0622.1 MA0426, MA0622.1 M4676 URE2 clean deletion Δure2::MA0622.1 MA0622.1 M4677 GDH2 marked deletion Δgdh2::MA0616 MA0616 M4690 GDH3 clean deletion Δgdh3::MA0615.1 MA0615.1 M4691 GDH2 clean deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286Δgd MA0286, MA0280, MA0290, MA0608, h1::MA0426Δgdh2::MA0616.1 MA0426, MA0616.1 M4692 GDH3 clean deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286Δgd MA0286, MA0280, MA0290, MA0608, h1::MA0426Δgdh3::MA0615.1 MA0426, MA0615.1 M4693 GDH3 clean deletion Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286Δgd MA0286, MA0280, MA0290, MA0608, h1::MA0425Δgdh3::MA0615.1 MA0425, MA0615.1 M4694 GDH2 clean deletion Δgdh2::MA0616.1 MA0616.1 M4748 DUR3 over expression Δfcy1::MA0464 MA0464 M4749 GAP1 over expression Δfcy1::MA0464.4 MA0464.4 M4750 MEP1 over expression Δfcy1::MA0464.2 MA0464.2 M4751 DUR1,2 over Δfcy1::MA0465.1 MA0465.1 expression M4752 MEP1 over expression Δfcy1::MA0434.2 MA0434.2 M4753 MEP2 over expression Δfcy1::MA0434.3 MA0434.3 M4754 DUR3 over expression Δfcy1::MA0434 MA0434 M4755 GAP1 over expression Δfcy1::MA0434.4 MA0434.4 M4756 MEP2 over expression Δfcy1::MA0464.2 MA0464.2 M4810 DUR3 over expression Δfcy1::MA0467 MA0467 M4811 DUR3 over expression Δfcy1::MA0467 MA0467 M4812 MEP1 over expression Δfcy1::MA0467.2 MA0467.2 M4813 MEP1 over expression Δfcy1::MA0467.2 MA0467.2 M4814 GAP1 over expression Δfcy1::MA0467.4 MA0467.4 M4815 GAP1 over expression Δfcy1::MA0467.4 MA0467.4 M5841 N. crassa GDH2 over Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286Δgd MA0280, MA0608, MA0286, MA0290, expression h1::MA0837 MA0837 M5842 N. crassa GDH2 over Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286Δgd MA0280, MA0608, MA0286, MA0290, expression h1::MA0837 MA0837 M5843 N. crassa GDH2 over Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286Δgd MA0280, MA0608, MA0286, MA0290, expression h1::MA0837 MA0837 M5844 N. crassa GDH2 over Δfdh1::MA0608Δfdh2::MA0280Δgpd1::MA0290Δgpd2::MA0286Δgd MA0280, MA0608, MA0286, MA0290, expression h1::MA0837 MA0837
Example 1
Deletion of GDH1 and Overexpression of GDH2 or GLT1/GLN1
(199) M3624 (Δgpd1::GPD2-B. adolescentispf1A/pF1B/adhEΔgpd2::GPD1 B. adolescentispf1A/pf1B/adhEΔfdh1Δfdh2::B. adolescentispf1A/pf1B/adhE) has an approximately 85% reduction in glycerol formation when grown on >30% solids corn mash. However, the strain is unable to complete the fermentation even after extended incubation periods. Two modifications of the ammonium assimilation pathway were constructed in M3624 and evaluated for fermentation performance. The modifications were a deletion of GDH1 and over-expression of Gdh2, resulting in strain M4117 (M3634 Gdh2; Δgdh1). The second modification was a deletion of GDH1 and overexpression of GLT1 and GLN1, resulting in strain M4118 (M3634 Glt1: Gln1; Δgdh1). These strains were compared to M3624 and the conventional yeast control (M2390 (a wild type unmodified strain isolated from industrial sources)) following fermentation of 31% solids corn mash.
(200) An industrial corn mash was prepared to a final solids concentration of 31% supplemented with penicillin (0.006 mg/mL) and urea (0.5 g/l). Glucoamylase was added at a concentration of 0.6 AGU/gTS. Fermentation was stopped by addition of each strain to an final starting concentration of 0.1 g/l. Vials were capped with a rubber stopper and sealed. A 23-gauge needle was inserted through die stopper to vent and for the safety of the experiment. Vials were incubated at 35° C. with shaking at 125 rpm. At the termination of the experiment samples were prepared for HPLC analysis of ethanol and residual sugars.
(201) The results in
Example 2
Deletion of GDH1
(202) As shown in
Example 3
Overexpression of DUR1/2
(203) Four different DUR1/2 expression cassettes were constructed in both M3467 Δfdh1Δfdh2::PFK-pro-adhE-HX7-ter ENO1-pro-pf1B-ENO1-ter ADH1-pro-adhE-PDC10-ter TPI-pro-pf1A-FBA-ter Δgpd1::GPD2::PFK-pro-adhE-HXT-ter ENO1-pro-pf1B-ENO1-ter ADH1-pro-adhE-PDC10-ter TPI-pro-pf1A-FBA-ter) and M3469 (Δgpd1::B. adolescentis pf1A/pf1B/adhE fdh1Δfdh2Δ::B. adolescentispf1A/pf1B/adhE) resulting in strains M4427-M3343 (Table 5). These strains were compared to their parent strain and the conventional yeast control (M2390) following fermentation of 31% solids corn mash (The fermentation was performed as described in Example 1). As shown in
(204) TABLE-US-00005 TABLE 5 Description of constructions and strain designations containing over-expression of DUR1/2 Parent Strain strain desinnation Genetic modification M3467 M4427 MA0464.1: expression of DUR1,2 from the TEF2 promoter M3467 M4428 MA0405.1: expression of DUR1,2 from the HXT7 promoter M3467 M4429 MA467.1: expression of DUR1,2 from the ADH1 promoter M3467 M4430 MA454.14: expression of DUR1,2 from the HXT7/TEF2 promoters M3469 M4431 MA0464.1: expression of DUR1,2 from the TEF2 promoter M3469 M4432 MA0465.1: expression of DUR1,2 from the HXT7 promoter M3469 M4433 MA4671: expression of DUR1,2 from the ADH1 promoter M3469 M4434 MA454.14: expression of DUR1,2 from the HXT7/TEF2 promoters
Example 4
Deletion of URE2
(205) To evaluate an alteration in the S. cerevisiae nitrogen catabolite repression system in glycerol reduction backgrounds, a deletion of URE2 was constructed in M3624 (Example 1), creating strain M4406 (M3624 Δure2). This strain was compared to M3624 and the conventional yeast control (M2390) following fermentation of 31% solids corn mash (The fermentation teas performed as described in Example 1). As shown in
Example 5
Regulation of Nitrogen Utilization
(206) Preferred nitrogen sources generally repress transcription of genes required to utilize non-preferred nitrogen sources. Urea is added as a supplemental nitrogen source in corn mash fermentation; however, there are significant quantities of amino acids and ammonia, both of which are preferred nitrogen sources over urea. Expression of the urea transporter (Dur3) and the urea:amido lyase responsible for intracellular degradation (Dur1/2) may be repressed in the presence amino acids and ammonia as part of a phenomenon referred to as Nitrogen Catabolite Repression (NCR). This repression could slow the rate of urea uptake or require larger quantities to be added. It would be an economic benefit to a corn ethanol producer if constitutive expression of Dur3 and Dur1,2 allowed them to either reduce the amount of urea needed or accelerate fermentation rate.
(207) The NCR is controlled by Ure2 and four transcription factors known as Gln3, Gat1, Dal80, and Gzf3. Ure2 participates in repressing gene expression in the presence of non-preferred nitrogen source. It has been observed that deletion of URE2 activates the expression of genes involved in the uptake of non-preferred nitrogen sources inactivation of Ure2 results in dephosphorylation and nuclear localization of the transcription factor Gln3.
Example 5A
Deletion of URE2 Deletion of URE2 Results in Nuclear Localization of GLN3 and Activation of NCR Sensitive Genes
(208) To evaluate an alteration in the S. cerevisiae nitrogen catabolite repression system in glycerol reduction backgrounds, a deletion of Ure2 is constructed as in Example 4. A deletion of URE2 will be constructed in M3624 (Example 1). Strains in which URE2 is deleted show a nuclear localization of Gln3, and an activation of NCR sensitive genes, including; Dur3 and Dur1/2.
Example 5B
Overexpression GLN3 Results in Activation of NCR Sensitive Genes
(209) To evaluate an alteration in the S. cerevisiae nitrogen catabolite repression system in glycerol reduction backgrounds, Gln3 (SEQ ID NOs: 156 and 157) is overexpressed. Strains in which Gln3 is overexpressed show an activation of NCR sensitive genes, including Dur3 and Dur1/2.
Example 6
Deletion of GDH1 and Expression of S. cerevisiae GDH2
(210) The results show that strain M3624 (Example 1) was able to reach a slightly higher titer than strain M2390 (WT), producing 1.5 g/l more ethanol (
Example 7
Deletion of GDH1 and Expression of N. crassa GDH2
(211) To create strains M5841-M5844, the GDH1 gene was deleted and replaced with 4 copies of the N. crassa GDH2 gene expression cassette in
(212) TABLE-US-00006 TABLE 6 Glycerol deletion strains which further comprise a deletion of gdh1 and an expression of Gdh2. Strain Genotype M2390 WT M3624 Δfdh1Δfdh2::4a2pΔgpd1::gpd24a2pΔgpd2::gpd14a2p M4117 Δfdh1Δfdh2::4a2pΔgpd1::gpd24a2pΔgpd2::gpd14a2pΔScgdh1::4gdh2 M5841 Δfdh1Δfdh2::4a2pΔgpd1::gpd24a2pΔgpd2::gpd14a2pΔNcrassagdh1::4gdh2 M5842 Δfdh1Δfdh2::4a2pΔgpd1::gpd24a2pΔgpd2::gpd14a2pΔNcrassagdh1::4gdh2 M5843 Δfdh1Δfdh2::4a2pΔgpd1::gpd24a2pΔgpd2::gpd14a2pΔNcrassagdh1::4gdh2 M5844 Δfdh1Δfdh2::4a2pΔgpd1::gpd24a2pΔgpd2::gpd14a2pΔNcrassagdh1::4gdh2
(213) The strains in Table 6 were inoculated in vials containing 4 ml industrial corn mash (mini-vials). The fermentation was allowed to proceed for 68 hrs and samples were run on an HPLC to obtain ethanol and glycerol values.
(214) All documents cited herein, including journal articles or abstracts, published or corresponding U.S. or foreign patent applications, issued or foreign patents, or any other documents, are each entirely incorporated by reference herein, including all data, tables, figures, and text presented in the cited documents.
(215) Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.
(216) The strains shown in examples are M2390, M3465, M3467, M3469, M3624, M4117, M4118, M4400, M4401, M4402, M4406, M4427, M4428, M4429, M4430, M4431, M4432, M4433 and M4434. The details of the aforesaid strains such as description, genotype and associated MA cassettes are listed in Table 4.