Bifunctional oligonucleotide probe for universal real time multianalyte detection

Abstract

The invention relates to a mediator probe comprising a probe region and a mediator region. Furthermore, the invention relates to a system comprising a mediator probe and a detection molecule, use of that system and a method for detection of at least one target molecule.

Claims

1. A method for detection of a target nucleic acid molecule from at least one target molecule in a sample, the method comprising: providing a sample comprising [one target molecule of] the at least one target molecule that is a [DNA] nucleic acid sequence, bringing said sample into contact with one system comprising: (i) a mediator probe, the mediator probe being an oligonucleotide comprising a probe region on [a] its 3′-terminus [of the oligonucleotide], and a mediator region on [a] its 5′-terminus [of the oligonucleotide], and a chemical, biological [and/] or physical cleavage site between the probe region and the mediator region, and (ii) a detection molecule, wherein the probe region of the mediator probe [has an affinity for] is complementary to the [one] target nucleic acid molecule and comprises a locus-specific nucleotide sequence complementary to a sequence of the [one] target nucleic acid molecule, and wherein the mediator region of the mediator probe [has no affinity for the one target molecule,] does not comprise a sequence complementary to a sequence of the [one] target nucleic acid molecule, and comprises a locus-nonspecific nucleotide sequence, [binding] hybridizing the probe region of the mediator probe to [a] the sequence of the [one] target nucleic acid molecule, while the mediator region does not [bind] hybridize to the target nucleic acid molecule so that a flap structure is formed in a first hybridization complex comprising the mediator probe and the target nucleic acid molecule, amplifying the target nucleic acid molecule in the first hybridization complex using a DNA polymerase with 5′ to 3′ nuclease activity, splitting off the mediator region from the mediated probe at the cleavage site during said amplifying of the target nucleic acid molecule in the first hybridization complex by [a DNA polymerase with] 5′ to 3′ nuclease activity of the DNA polymerase, thereby producing [to produce] a cleaved mediator region, and hybridizing of the cleaved mediator region to a second region of the detection molecule, thereby forming a second hybridization complex comprising the cleaved mediator region and the detection molecule, the detection molecule being an oligonucleotide having a hairpin structure comprising: [b)] a first region on [a] its 5′-terminus, which has one fluorescence acceptor or one fluorescence donor and optionally a chemical group for binding the detection molecule to a solid phase and/or a chemical protective group, and which is hybridized with [an internal sequence segment] a third region of the detection molecule, wherein the third region [internal sequence segment] is located on 5′ [to] of the second region and forms a double-stranded stem region with the first region, and there is a loop region between the first region and the third region, [c)] the second region [adapted to bind the cleaved mediator region and] comprising a locus-nonspecific nucleotide sequence [of the detection molecule] which is complementary to the locus-nonspecific nucleotide sequence of the [cleaved] mediator region and non-complementary to the target nucleic acid molecule, wherein the second region is located on 3′ [to] of the third region [internal sequence segment] and comprises an unpaired sequence segment at the 3′ terminus of the detection molecule, and [d)] [a] the third region, which has one fluorescence donor or one fluorescence acceptor which interacts with the one fluorescence acceptor or the one fluorescence donor of the first region and optionally a chemical protective group, wherein the one fluorescence acceptor or the one fluorescence donor of the first region and the one fluorescence donor or the one fluorescence acceptor of the third region are in spatial proximity to one another such that a fluorescent signal of the one fluorescent donor of the detection molecule is suppressed, elongating the cleaved mediator region [hybridized to the second region of the detection molecule] of the second hybridization complex by a polymerase with 5′ to 3′ nuclease activity, wherein [elongation of] said elongating the cleaved mediator region [hybridized to the second region of the detection molecule] of the second hybridization complex triggers a [detectable change of the] fluorescence signal of the one fluorescent donor of the detection molecule, and detecting the [one] target nucleic acid molecule [of] from the at least one target molecule in the sample via [the change of] detecting the fluorescence signal of the one fluorescent donor of the detection molecule.

2. The method according to claim 1, wherein the probe region of the mediator probe hybridizes directly to the sequence of the target nucleic acid molecule.

3. The method according to claim 1, wherein said amplifying the target molecule in the first hybridization complex is accomplished by polymerase chain reaction (PCR).

4. The method of claim 3, wherein the PCR is real time PCR.

5. The method of claim 1, wherein the detection molecule has a chemical protective group on [the] its 3′-terminal region, which is split off from the detection molecule after the elongation step, and a OH group is generated in the 3′ terminus of the detection molecule [modified in] after the elongation step.

6. A method for detection of a target [desoxyribonucleic] deoxyribonucleic acid (DNA) sequence [of] from at least one target molecule in a sample, the method comprising: providing a sample comprising the at least one target molecule, bringing said sample into contact with one system comprising: (i) a mediator probe, the mediator probe being an oligonucleotide comprising a probe region on [a] its 3′-terminus [of the oligonucleotide], and a mediator region on [a] its 5′-terminus [of the oligonucleotide], and a chemical, biological [and/] or physical cleavage site between the probe region and the mediator region, and (ii) a detection molecule, wherein the detection molecule is an oligonucleotide comprising a hairpin structure, wherein the detection molecule comprises a first region, a second region [and], a third region, and a loop region between the first region and the third region; wherein the mediator region of the mediator probe [has an affinity] comprises a locus-nonspecific nucleotide sequence that is complementary to a locus-nonspecific nucleotide sequence of the second region [of the hairpin structure] of the detection molecule, but [has no affinity for the one target molecule,] does not comprise a sequence complementary to [a] the target DNA sequence of the at least one target molecule, [and comprises a locus-nonspecific nucleotide sequence,] and wherein the probe region of the mediator probe [has an affinity for the one target molecule and] comprises a locus-specific nucleotide sequence complementary to [a] the target DNA sequence of the at least one target molecule, [binding] hybridizing the probe region of the mediator probe to the target DNA sequence of the at least one target molecule, while the mediator region does not bind to the target DNA sequence of the at least target molecule so that a flap structure is formed in a first hybridization complex comprising the mediator probe and the target DNA sequence of the at least one target molecule, amplifying the target DNA sequence in the first hybridization complex using a DNA polymerase with 5′ to 3′ nuclease activity, cleaving off the mediator region from the mediated probe at the cleavage site during said amplifying of the target DNA sequence in the first hybridization complex via [a DNA polymerase with] 5′ to 3′ nuclease activity of the DNA polymerase, thereby producing [to produce] a cleaved off mediator region, and hybridizing of the cleaved off mediator region to the second region of the detection molecule, thereby forming a second hybridization complex comprising the cleaved off mediator region and the detection molecule, wherein: the first region on [a] 5′-terminus [of the hairpin structure] of detection molecule comprises one first fluorescence acceptor or one first fluorescence donor, the second region of the detection molecule [binds] is a single stranded region located on 3′ of the third region and hybridizes the cleaved off mediator region via the [and comprises a] locus-nonspecific nucleotide sequence of the detection molecule which is complementary to the locus-nonspecific nucleotide sequence of the [cleaved off] mediator region and non-complementary to the target DNA sequence of the at least one target molecule, and wherein the detection molecule optionally comprises a chemical group for binding the detection molecule to a solid phase and/or a chemical protective group, the third region forms a double-stranded stem region with the first region, wherein the one first fluorescence acceptor of the first region is in spatial proximity to a second fluorescence donor, located at [a] the third region located on 3′ of the first region of the detection molecule, and that is adapted to interact with the one first fluorescence acceptor, or the one first fluorescence donor of the first region is in spatial proximity to a second fluorescent acceptor, located at [a] the third region 3′ of the first region of the detection molecule, and that is adapted to interact with the one first fluorescence donor [acceptor] such that a fluorescence signal of the one first fluorescence donor or the second fluorescence donor of the detection molecule is suppressed, elongating the cleaved mediator region [hybridized to the second region of the detection molecule] of the second hybridization complex via a polymerase with 5′ to 3′ nuclease activity, wherein [elongation of] said elongating the cleaved mediator region [hybridized to the second region of the detection molecule] of the second hybridization complex triggers a [detectable change of the] fluorescence signal of the one first fluorescence donor or the second fluorescence donor of the detection molecule, and detecting the [one] target DNA sequence of the at least one target molecule in the sample via [the detectable change of] detecting the fluorescence signal of the one first fluorescence donor or the second fluorescence donor of the detection molecule.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) The invention as well as the prior art will be explained in greater detail below with reference to figures and exemplary embodiments, although it is not limited to these. They show:

(2) FIG. 1(A-D) Various solid-phase-based detection methods after invasive cleavage of an immobilized probe

(3) FIG. 2 Preferred structure of a mediator probe

(4) FIGS. 3A, B Preferred interaction of the mediator probe with the target molecule and mediator probe cleavage

(5) FIGS. 4A, B Illustration of a preferred detection molecule

(6) FIGS. 5i)-vi) Schematic diagram of a preferred elongation of an enzymatic mediator

(7) FIG. 6 Schematic diagram of a preferred position of chemical modification within the detection molecule

(8) FIGS. 7i)-v) Preferred detection of the mediator with the help of an immobilized detection molecule

(9) FIG. 8 Preferred interaction of the mediator probe and the detection molecule

(10) FIG. 9 Schematic diagram of the preferred areas of application of the mediator probe technology

(11) FIG. 10 Normalized fluorescence plot of PCR using a preferred mediator probe and in the reaction vessel of immobilized detection molecules

(12) FIG. 11(A)-(D) Schematic diagram of a preferred PCR method

(13) FIG. 12(A)-(D) Comparison of the characteristic of mediator probe PCR and hydrolysis probe PCR

(14) FIG. 13(A)-(D) Amplification of various targets with mediator probe PCR and hydrolysis probe PCR.

(15) FIG. 1(A-D) shows various solid-phase-based detection methods after invasive cleavage of an immobilized probe. (A) Direct fluorescence-based invasive cleavage detection. Possibility 1: The probe is immobilized on the substrate surface. The invader oligonucleotide (upstream oligonucleotide) and the target sequence (target) are added to the reaction solution (see FIG. 1). Possibility 2: The probe and the Invader oligonucleotide are immobilized on the surface. The target sequence is added to the reaction mix (see FIG. 2). In both cases the probe molecule is cleaved, which results in a change in the fluorescence signal. Source: Lu, M. C. et al. 2002, A surface invasive cleavage assay for highly parallel SNP analysis, Hum. Mutat., 19, 416-422.

(16) (B) Indirect cleavage reaction. A Dabcyl-modified probe is immobilized on a solid phase. After successful invasive cleavage, a biotin-labeled linker to which streptavidine-coated gold particles are bound is ligated. Source: Nie, B. et al., 2006, Quantitative detection of individual cleaved DNA molecules on surfaces using gold nanoparticles and scanning electron microscope imaging, Anal. Chem., 78, 1528-1534.

(17) (C) Indirect cleavage detection by subsequent rolling circle amplification. After invasive cleavage of an immobilized 5′-labeled probe, a ligation step is performed with subsequent rolling circle amplification. Two different strategies are represented, in which only the probe (a) is immobilized and/or the probe and the invader oligonucleotide (b) are immobilized. Source: Chen, Y. et al., 2004, Surface amplification of invasive cleavage products, J. Amer. Chem. Soc., 126, 3016-3017.

(18) (D) Indirect fluorescence-based cleavage detection. A labeled detection probe is hybridized on a fluorescence-labeled probe and the fluorescence signal is detected. After washing steps and invasive cleavage have been performed, there is an additional hybridization step with the detection probe that has been described. The subsequent fluorescence measurement allows an inference regarding the presence of the target sequence in the reaction batch. Source: Lockett, M. R. et al., 2007, Molecular beacon-style hybridization assay for quantitative analysis of surface invasive cleavage reactions, Anal. Chem., 79, 6031-6036.

(19) FIG. 2 shows a preferred design of a mediator probe. The mediator probe consists of an oligonucleotide in particular and is subdivided into two functional regions. Region 1 has an affinity for or is complementary to the original and/or target molecule, while region 2 interacts exclusively with a specific detection molecule. There is a potential cleavage site between these regions.

(20) FIG. 3 shows a preferred interaction of the mediator probe with the template molecule and/or target molecule and mediator probe cleavage. The mediator probe, auxiliary molecule 1 (here: primer) and auxiliary molecule 2 (here: enzyme with polymerization and nuclease activity (polymerase)) interact with the template molecule and/or target molecule (here: nucleic acid sequence) (A). Under suitable reaction conditions, the primer is elongated by the polymerase and the mediator probe is cleaved, whereupon a mediator region is released (B).

(21) FIGS. 4A, B show a diagram of a preferred detection molecule. Linear representation (A). Diagram of 3′-immobilized detection molecule forming the secondary structure (B). The reverse complementary sequence segments, whose interaction results in the secondary structure of the detection molecule, are represented as black regions, while the mediator hybridization sequence is represented as a diagonally striped region. Region a may be present with or without PTO modifications.

(22) In a preferred embodiment, a detection molecule consists of an oligonucleotide which is subdivided into multiple regions (cf. preferably FIG. 4).

(23) Region a (=first region) comprises the 5′-terminus of the detection molecule, which consists of a sequence segment and a fluorescence acceptor Q in a preferred embodiment. Region c is a reverse complementary sequence of region a and is separated from that by region b. Region d (=third region) separates region c and region e (=second region), which can interact specifically with a mediator molecule. Region f (=fourth region) comprises the 3′-terminal sequence region, which preferably has a chemical modification and thus permits a directed immobilization of the oligonucleotide. A fluorescence donor F is associated with a portion of region b to region f, for example, region d, in a manner with which those skilled in the art are familiar. It is preferable for the detection molecule to have a hairpin structure. Region a and region c of the detection molecule form a defined secondary structure (referred to a hairpin structure in the sense of the present invention) under reaction conditions, in which the 5′-terminus is hybridized with an internal sequence segment.

(24) FIGS. 5 i)-vi) show a schematic diagram of a preferred elongation of an enzymatic mediator. i) A detection molecule is present, immobilized on a solid phase, and assumes a defined secondary structure under reaction conditions. Two suitable fluorescence modifications F and Q interact with one another, thereby suppressing the fluorescence signal of F. ii) The mediator can interact with the detection molecule at a defined position (mediator hybridization sequence region 5), and iii-iv) is thereby enzymatically elongated by an auxiliary detection molecule (here: polymerase). In doing so, the fluorescence acceptor molecule Q is split off from the detection molecule, so that the fluorescence intensity of the fluorescent dye F is restored. vi) After splitting off from region 1, the detection molecule assumes a linear confirmation, so that there can be a further elongation of the mediator. The mechanism shows in FIG. 5 also takes place when PTO modifications are present.

(25) FIG. 6 shows a schematic diagram of a preferred position of a chemical modification within the detection molecule. Modified nucleotides which terminate a potential mediator elongation in a defined position are incorporated at suitable sequence positions within region 1 and/or region 2.

(26) FIG. 7 shows a preferred detection of the mediator with the help of an immobilized detection molecule. i) A detection molecule is immobilized on a solid phase and assumes a defined secondary structure under reaction conditions. Two suitable fluorescence modifications F and Q interact with one another, thereby suppressing the fluorescence signal of F. The 3′-terminal sequence region is unpaired and serves as a potential mediator hybridization sequence (diagonally striped region). ii) In this defined position, the mediator can interact with the detection molecule and iii-iv) is enzymatically elongated by an auxiliary detection molecule (here: polymerase). v) Then the fluorescence acceptor molecule Q is split off from the detection molecule, so that the fluorescence intensity of the fluorescent dye F is restored. After a suitable period of time, the reaction conditions are altered by heating the reaction solution so that the polymerase and the elongated mediator are dissociated away from the detection molecule.

(27) FIG. 8 shows a preferred interaction of mediator probe and detection molecule. If the uncleaved mediator probe interacts with the detection molecule, no enzymatic elongation reaction will take place even in the presence of a suitable auxiliary detection molecule because it requires a 3′-OH terminus in the mediator sequence. This prevents false-positive signals from being generated. In addition, a 3′-terminal modification may be present to suppress a nonspecific elongation.

(28) FIG. 9 shows a schematic diagram of the preferred areas of application of the mediator probe technology. The mediator probe technology can detect DNA, RNA transcribed to cDNA or protein-associated aptamers. Processing of the mediator probe may optionally be integrated into an amplification step (A) of the target molecule. This shows detection by means of an immobilized mediator-specific detection molecule. By interaction with an auxiliary molecule (here: polymerase), a change in state of the detection molecule is generated by a mediator-mediated reaction (here: change in fluorescence).

(29) FIG. 10 shows a normalized fluorescence plot of a PCR using a preferred mediator probe and detection molecules immobilized in the reaction vessel. The reagents, including target sequence-specific primers as well as the mediator probe and various Staphylococcus aureus genome equivalents, among other things, were pipetted into a suitable reaction vessel with immobilized detection molecules and sealed with a suitable sealing film. The reaction was performed in a thermocycler, so that the measurement of the fluorescence was performed in a separate instrument at the cycles indicated. In each PCR cycle, the sequence segment to be amplified was doubled, so that a mediator was derived from the cleavage of a mediator probe with each duplication step. The released mediator interacted with the detection molecule in a suitable manner, resulting in a detectable fluorescence signal. The plot shows a correlation with the quantity of DNA and the fluorescence profile. The fluorescence intensities have been standardized to the value of cycle 1 (the measured value of cycle 37 was falsified due to condensation on the cover film and therefore was not taken into account).

(30) FIG. 11 shows a schematic diagram of a preferred method. Steps A through H illustrate the amplification reaction and detection. A nucleic acid target is at the same time the target molecule and the template molecule in the case illustrated here. After denaturing (B), the mediator probe, the primers and polymerase are added (C). Step (D) illustrates the elongation of the primers as well as splitting off the mediator probe and degradation of the probe region. The mediator region is released in this step. The mediator region is then added (E) to a detection molecule (=universal reporter). In step (F), the mediator region is elongated by a polymerase. Dequenching may be performed by two methods: either by way of sequential degradation of the 5′ end of the detection molecule and release of the quencher radical (G) or by displacement of the 5′ end and unfolding of the hairpin structure (H). Then all the steps are performed in a thermocycler.

(31) FIG. 12 shows a comparison between various characteristics of mediator probe PCR and hydrolysis probe PCR in FIG. 12. Various concentrations of HAPV18DNA were amplified and controls without original DNA were used. The calculated number of copies of the mediator probe PCR were plotted on the x axis. The number of copies of hydrolysis probe PCR (B to D) are plotted on the y axis. A shows the LOD or limit of detection for HPV18 detection. The probability of successful amplification (x axis) for a certain number of input copies (y axis) was determined with probit analyses. The mediator probe resulted in the black lines, and the hydrolysis probe resulted in the gray lines. The dashed lines shown at the top and bottom indicate 95% CI. The intra-assay variance for five different DNA concentrations is given in (B); (C) shows the interassay variance for five DNA concentrations in five different PCR passes. The diagram in (D) shows the results of duplex PCR.

(32) FIG. 13 shows the results of amplification of various targets with mediator probe PCR and hydrolysis probe PCR. (A) HPV18, (B) E. coli, (C): S. aureus, (D): human beta actin.

Exemplary Embodiment i)

(33) The exemplary embodiments are also diagramed schematically in FIG. 9. A simple demonstration of preferred nucleic acid detection may be performed as follows: for a detection of bacterial DNA in a sample to be analyzed, a detection molecule is immobilized in a suitable reaction vessel. However, the detection molecule may also be present in solution. Next, the sample and the required reagents are added to the reaction vessel, and after an initial temperature holding step at 95° C., the mixture is heated and cooled in cycles. During this process, the fluorescence in the reaction vessel is detected at the defined points in time in the cycle. The exemplary embodiment is described in detail below:

(34) In “NucleoLink strips” (NUNC, Langenselbold, Germany, catalog no. 248650) 25 μL of a 100 nM solution of a detection molecule of the sequence 5′-DABCYL-CCGCA G*A*A*GATGAGATC(dTFAM)GCGGTGTTGGTC-GTAGAGCCCAGAACGAT TTTTTTTTTTTTTTTTTTTTT-[C.sub.6H.sub.2]-3′ (*=phosphothioate) (IBA, Göttingen, Deutschland) is pipetted into coupling buffer (10 mM 1-methylimidazole (1-Meim) (pH 7.0) (Sigma-Aldrich, Steinheim, Germany) and 10 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (Sigma-Aldrich, Steinheim, Germany)), sealed with ViewSEAL™ cover film (Greiner BioOne, Frickenhausen, Germany, catalog no. 676070) and incubated overnight at 50° C. The supernatant was discarded and the micro reaction vessels were then washed with 100 μL washing buffer (100 mM tris-HCl (pH 7.5), 150 mM NaCl, 0.1% Tween 20 (Carl Roth, Karlsruhe, Germany)) and incubated with 25 μL of a 1M glycine solution (Carl Roth, Karlsruhe, Germany) in coupling buffer for 1 hour at 50° C. and then washed again.

(35) The reaction vessels were filled with 25 μL PCR reaction mix (1× Finnzymes DyNamo Flash probe (Finnzymes, catalog no. F-455), primer molecules of the sequences 5′-GAGGTAGGAAACTCTGGATCAGGTAT-3′ (300 nM) (biomers.net, Ulm, Germany), 5′-TCTATTGAAAAACACTCCTATTGGAAGA-3′ (300 nM) (biomers.net, Ulm, Germany), a mediator probe of the sequence 5′-TCTGGGCTCTACGACCAAC AGGTATTCACAGTGGTAAAGG-CGGACAACAAGAGCCCAG A-[phosphate]-3′ (200 nM) (biomers.net, Ulm, Germany)) as well as various concentrations of a Staphylococcus aureus DNA containing the exfoliative toxin B locus (NCBI Accession No. M17348). Depending on the DNA concentration, four micro reaction vessels were used. The reaction vessels were sealed with ViewSEAL™ cover film and transferred to a GeneAmp® 9700 thermocycler (Perkin Elmer, Massachusetts). After an incubation phase (7 minutes at 95° C.), the cyclic temperature protocol (30 seconds at 95° C., 3 minutes at 58° C.) was performed and the reaction vessels were removed from the thermocycler after defined cycles and the fluorescein signal was measured with the help of the microtiter plate reader Victor.sup.2 1420 multi-label counter (Perkin Elmer, Massachusetts). Next, the reaction vessels were again transferred to the thermocycler. The fluorescence values of the individual micro reaction vessels were normalized to the respective value of the first cycle, so that an amplification factor could be formulated as a function of the processing cycle for each reaction vessel (see FIG. 10).

Exemplary Embodiment ii)

(36) In a second example, RNA was used as the target molecule. The RNA was transcribed to cDNA by means of a reverse transcription or by another suitable enzymatic system. This step was performed in a separate reaction vessel and one aliquot was added to a detection reaction according to exemplary embodiment i). Alternatively, reverse transcription and subsequent amplification could be performed in the same reaction vessel according to exemplary embodiment i). In this example, expression analysis of one or more genes was of primary concern as the experimental goal.

Exemplary Embodiment iii)

(37) Parallel detection of DNA and RNA in a sample can be performed by combining suitable enzyme systems. In doing so the RNA to be detected is amplified with the help of primers having a defined 5′ sequence overhang (see FIG. 9). The mediator probe used for this detection is designed so that it binds partially to the sequence overhang, to the primer and to a segment of the elongated primer. Due to this defined locus, it is certain that only cDNA generated from RNA will be detected by a specific mediator probe but the genomic locus from which the RNA was transcribed will not be detected. For detection of genomic DNA in the reaction batch, mediator probes that are exclusively complementary to this sequence are used. The cDNA was thus generated and specific segments of the genomic DNA are amplified in the amplification reaction which is then optionally performed, in which locus-specific mediator probes are cleaved and the mediator can be detected by suitable detection methods on a locally resolved immobilized detection molecule.

Exemplary Embodiment iv)

(38) Reagents which include the target molecule-specific aptamers and the sample to be analyzed are placed in a suitable reaction vessel, where the detection molecules are immobilized in a locally resolved manner (see FIG. 9) or are present in solution. The target molecule to be detected may be a protein or a peptide, for example, but is not limited to these. An aptamer binds to the target molecule and alters its structure so that after successful interaction an aptamer-specific mediator probe and primer can be annealed. By processing with a suitable enzyme system, the annealed primer can be elongated, whereupon the mediator probe is split off. The mediator thus released can be detected with the help of a specific detection molecule. The enzymatic amplification process may include but is not limited to isothermal methods.

Exemplary Embodiment v)

(39) In a special embodiment variant, DNA, RNA and peptides and/or proteins or another combination of the aforementioned substance classes is/are detected in parallel in one batch by the methods i)-iv) described here. This method includes but is not limited to isothermal amplification methods. This embodiment is illustrated in FIG. 9.

Exemplary Embodiment vi)

(40) Regardless of the type of detection, the reaction vessel may have the established and widespread microtiter plate format (96-well plate), for example, with which commercial temperature regulation and readout devices and/or devices that combine these two functions may be used. In all cases, the detection molecules are immobilized in a locally resolved form (array). A flow cell may also be regarded as a possible reaction vessel, which may optionally be cleaned and reused after the analysis has been performed. In a special embodiment, the reaction vessel may be a cartridge, in which the detection molecules may be present in immobilized form. The reaction space may also be defined by the use of a modified microscope slide and a suitable frame. This embodiment has the advantageous property that the immobilization of the detection molecules on suitable materials is described in the prior art and suitable adhesive frames (Peqlab in situ adhesive frames, Peqlab Biotechnologie, Erlangen, Germany) as well as thermally regulable processing vessels (Peqlab PeqStar in situ, Peqlab Biotechnologie, Erlangen, Germany) and reader devices (BioAnalyzer, LaVision BioTec GmbH, Bielefeld, Germany) are commercially available. The format of the cartridge is not defined and may optionally be created in accordance with the user's wishes. The cartridge can conduct an input beam of light with the help of integrated prisms for excitation of fluorophores near the surface by means of TIRF through a reading range. Furthermore, this cartridge may be used in combination with an instrument having a temperature regulating device and optical components for excitation and detection of fluorescence signals. The cartridge may optionally have microfluidic structures, for example, filling and vent ports, connections for active elements, mixing chambers, measuring chamber and aliquoting chambers, channels or structures or structures that may be used for other purposes. The system may have pumps or other actuators with the help of this the liquid can be processed. In addition, other reagents may also be used.

Exemplary Embodiment vii)

(41) A PCR is performed using a preferred mediator probe according to the invention (see also FIG. 11). For the amplification reaction, normal oligonucleotide primers and a Taq polymerase are used. The mediator probe in the sense of the invention is a bifunctional oligonucleotide, which permits real-time detection of the PCR. To compare the invention with the prior art, these experiments are conducted in parallel with a hydrolysis probe from the prior art.

(42) Sample Material

(43) DNA samples from Staphylococcus aureus (Genomic Research Laboratory; Prof. Jacques Schrenzel, Geneva, Switzerland) were used for this experiment. The samples contained the genomic locus of exfoliative toxin B (Gene Bank Accession No. AP003088). The pBR322 plasmid contains the human papilloma virus 18 (HPV18) genome and was made available by GenoID (Budapest, Hungary). Escherichia coli K12 DH5-Z1 DNA, which contains the genomic locus of the peptidoglycan-associated lipoprotein (Gene Bank Accession No. 65796) was isolated using a DNA isolation kit based on a magnetic bead. Human genomic DNA was isolated from whole blood using a QIAamp DNA Blood Mini Kit (Qiagen). For the duplex PCR reactions, commercially available human DNA was used (Roche Diagnostics). The DNA samples were diluted in 0.2× Tris-EDTA buffer, and 10 ng/μL salmon sperm DNA (Invitrogen) was added to prevent nonspecific adsorption of the DNA targets onto the reaction vessels,

(44) Oligonucleotides

(45) The following oligonucleotides were used:

(46) TABLE-US-00001 Detection molecule 01: (SEQ ID NO: 1) CCGCAG*A*A*GATGAGATC(dTFAM)GCGGTGTTGGT- CGTAGAGCCCAGAACGATTTTTTTTTTTTTTTTTTTTT Modifications: 5′: DABCYL; 3′: C.sub.6NH.sub.2 * = phosphothioate Detection molecule 02: (SEQ ID NO: 2) CCGCAG*A*A*GATGAGATC(dT-Cy5)GCGGTGTTCAC TGACCGAACTGGAGCATTTTTTTTTTTTTTTTTTTTTT Modifications: 5′: BHQ-2; 3′: C.sub.6NH.sub.2 Target: Escherichia coli K12 peptidoglycan- associated lipoprotein (pal gene), Gene Bank  Accession No. X05123 (SEQ ID NO: 3) Forward Primer: GGCAATTGCGGCATGTTCTTCC (SEQ ID NO: 4) Reverse Primer: TGTTGCATTTGCAGACGAGCCT (SEQ ID NO: 5) Hydrolysis probe: ATGCGAACGGCGGCAACGGCAACATGT Modifications: 5′: 6-FAM; 3′: BHQ-1 Mediator probe: (SEQ ID NO: 6) AAATCGTTCTGGGCTCTACGCGAACGGCGGCAACGGCAACATGT Modification: 3′: PH Target: Staphylococcus aureus exfoliative  toxin B (SEQ ID NO: 7) Forward primer: AGATGCACGTACTGCTGAAATGAG (SEQ ID NO: 8) Reverse primer: AATAAAGTACGGATCAACAGCTAAAC (SEQ ID NO: 9) Hydrolysis probe: CCGCCTACTCCTGGACCAGG Modifications: 5′: 6-FAM; 3′: BBQ Mediator probe: (SEQ ID NO: 10) AAATCGTTCTGGGCTCTACGGTATTCACAGTGGTAAAGGC- GGACAACA Modification: 3′: PH Target: HPV18 Gene Bank Accession  No. NC_001357.1 (SEQ ID NO: 11) Forward primer: GCTGGCAGCTCTAGATTATTAACTG (SEQ ID NO: 12) Reverse primer: GGTCAGGTAACTGCACCCTAA (SEQ ID NO: 13) Hydrolysis probe: GGTTCCTGCAGGTGGTGGCA Modifications: 5′: 6-FAM; 3′: BHQ-1 Mediator probe: (SEQ ID NO: 14) AAATCGTTCTGGGCTCTACGGTTCCTGCAGGTGGTGGCA Modifications: 3-PH Target: Homo sapiens ACTB Gene Bank Accession  No. AC_000068.1/HGNC: 132 (SEQ ID NO: 15) Forward primer: TCACCCACACTGTGCCCATCTACGA (SEQ ID NO: 16) Reverse primer: CAGCGGAACCGCTCATTGCCAATGG (SEQ ID NO: 17) Hydrolysis probe 01: ATGCCCTCCCCCATGCCATCCTGCGT Modifications: 5′: 6-FAM; 3′: DDQ-1 (SEQ ID NO: 18) Hydrolysis probe 02: ATGCCCTCCCCCATGCCATCCTGCGT Modifications: 5′ Cy5; 3′: DDQ-2 Mediator probe 01: (SEQ ID NO: 19) AAATCGTTCTGGGCTCTACGCCCTCCCCCATGCCATCCTGCGT Modification: 3′: PH Mediator probe 02: (SEQ ID NO: 20) ATGCTCCAGTTCGGTCAGTGCCCTCCCCCATGCCATCCTGCGT Modification: 3′: PH

(47) All the modified oligonucleotides were purified with HPLC.

(48) The mediator probes were designed in a two-step process. The probe region and the mediator region overlap with a nucleotide. The 5′ end of the probe region must therefore match the 3′ end of the mediator region. In the present experiment, a guanosine nucleotide was used for this purpose. The probe region was designed according to the guidelines for development of a hydrolysis probe: length 25-30 nucleotides, probe melting temperature 5-10° C. and greater than the primer melting point). The mediator region was designed so that this region would not have any homologies with the target. The 3′-terminus is blocked with a phosphate group to prevent elongation of the mediator probe.

(49) The design for the detection molecules was created in silico to obtain a hairpin structure with an unpaired single-stranded 3′ stock. Predictions about the secondary structure were made using RNAfold, and the melting point was calculated using VisOMP (Visual Oligonucleotide Modeling Program). For the secondary structure, the settings “no dangling end energies,” “DNA settings,” “60° C.” were selected in the “advanced folding” option. The melting point of the strain (GC content 71%) is 71.4° C., which allows refolding during the cooling step (60° C.) during each thermal cycle. The folded structure provides a FRET pair, where the pair is arranged onto two strands enclosed in spatial proximity to one another. The FRET pair comprises a 5′ terminal quencher, and an internal fluorophore is selected to achieve a high quenching efficiency. The 3′ unpaired strain comprises the binding site for the mediator region, which is the reverse complement to the mediator region. To prevent elongation of the detection molecule, the 3′-terminus was blocked with an amino group. A second detection molecule was designed for the duplex PCR experiments, wherein this has a sequence identical to that of the first detection molecule except that a modified mediator binding site and another FRET pair were used.

(50) Quenching Efficiency

(51) The selection of suitable fluorophore dyes and quencher radicals was especially important in order to permit a high quenching efficiency and analytical sensitivity for the detection of particularly small amounts of nucleic acids. To determine the quenching efficiency, the fluorescence emission was determined for each dual-labeled hydrolysis probe and detection molecule, with and without DNase I treatment. The quenching efficiency (Eq) is determined as follows:
Eq=1−(I.sub.undigested/I.sub.digested)×100
where I.sub.undigested is the fluorescence emission of undigested sample and I.sub.digested is the fluorescence emission of samples treated with DNaseI.
Mediator Probe PCR and Hydrolysis Probe PCR Experiments

(52) The mediator probe PCR reaction batch contains 1×PCR buffer (GenoID, Budapest, Hungary), 0.1 U/μL Hot StarTaq plus polymerase (Qiagen), 200 μmol/L deoxyribonucleotide (Qiagen), 300 nmol/L detection molecule (synthesized by IBA), 300 nmol/L target-specific primer pairs and 200 nmol/L mediator probe (synthesized by biomers.net). The hydrolysis probe PCR reaction batch contains the same quantities of reagents except for the mediator probe, which was replaced by the hydrolysis probe (200 nmol/L, synthesized by biomers.net). Furthermore, no detection molecules were added. Next, DNA template molecules were added to both batches (in the negative controls, the same amount of H.sub.2O was added instead). The reaction volume was 10 μL.

(53) All the real-time PCR reactions were performed in a Corbett Rotor Gene 6000 (Corbett Research Pty, now Qiagen GmbH) with the following universal thermocycling profile: initial polymerase activation: 95° C. for 5 minutes 45 cycles with denaturing at 95° C. for 15 seconds and a combined annealing and elongation step at 60° C. for 45 seconds.

(54) The fluorescence signals were performed at the end of each elongation step. Data analysis was performed using the Rotor Gene 6000 software (version 1.7.87).

(55) Statistical Analysis

(56) The limit of detection (LOD) for HPV18 detection was determined as follows:

(57) Various DNA concentrations were amplified (10.sup.4, 10.sup.3, 5×10.sup.2, 10.sup.2, 5×10.sup.1, 10.sup.1, 10.sup.0 and 10.sup.−1 copies per reaction). The amount of positive amplifications per DNA concentration was determined. Probit analyses with SPSS (Statistical Package for Social Sciences, version 19, IBM) allow a prediction of the number of copies per reaction, which leads to positive amplification results with a 95% probability.

(58) Results

(59) Quenching Efficiency

(60) Fluorescence emission of all fluorogenic molecules increased in degradation in comparison with undigested probes. The observed Eq values of the specific hydrolysis probes were between 54.5% (3.1%) [Cy5/2,3-dichloro-5,6-dicyano-1,4-benzoquinone-2 (DDQ-2)] and 92.7% (0.5%) [FAM/di-tert-butylhydroquinone-1 (BHQ-1)]. However, the quenching efficiency of the detection molecules was between 83.7% (1.4%) (Cy5/BHQ-2) and 90.9% (0.4%) (FAM/Dabcyl). These results correspond to the known Eq values for FAM/Dabcyl (80-91%), FAM/BHQ-1 (88-93%) and Cy5/BHQ-2 (91-96%) under optimized conditions.

(61) Mediator Probe PCR Vs. Hydrolysis Probe PCR

(62) In the present experiments, the mediator probe PCR was compared with the hydrolysis probe PCR. Firstly, the reaction efficiency, the LOD, the interassay variation, the intra-assay variation and the duplexing properties were analyzed. For these experiments, different concentrations of HPV18 DNA (10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5 and 10.sup.6 copies per reaction, unless otherwise described) were amplified with parallel use of both techniques. Secondly, different targets were amplified with parallel use of the two techniques.

(63) LOD (Limit of Detection)

(64) The LOD was determined as the DNA concentration resulting in a positive amplification with a 95% probability. Probit analyses revealed an analytical sensitivity of 78.3 copies per reaction (95% CI: 47.0-372.5 copies per reaction) for the mediator probe PCR and 85.1 copies per reaction (95% CI: 55.7-209.4 copies per reaction) for the hydrolysis probe PCR (FIG. 12A).

(65) Intra-Assay Variance

(66) Five concentrations of the HPV18 DNA dilution series (10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5 and 10.sup.6 copies per reaction) were amplified in eight repetitions. The R.sup.2 values 0.975 (mediator probe PCR) and 0.983 (hydrolysis probe PCR) showed excellent linearity (FIG. 12B). Percentage CVs for the amplification of 10.sup.2-10.sup.6 copies per reaction were 55.1%-9.9% (mediator probe PCR) and 38.3%-10.7% (hydrolysis probe PCR). The accuracy ranges from +21.6% to −8.1% (mediator probe PCR) and from +19.4% to −9.8% (hydrolysis probe PCR).

(67) Interassay Variance

(68) Five batches prepared separately were used for the amplification of five concentrations of HPV18 DNA dilution series (10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5 and 10.sup.6 copies per reaction). Each concentration was prepared three times. The R.sup.2 values 0.940 (mediator probe PCR) and 0.954 (hydrolysis probe PCR) showed the linearity of the amplification (FIG. 12C). The interassay variance for copy numbers of 10.sup.2-10.sup.6 per reaction was between 25% and 8.7% (mediator probe PCR) and between 34.7% and 12.7% (hydrolysis probe PCR). The accuracy ranges from +3.4% to −7% (mediator probe PCR) and from −2% to −12.4% (hydrolysis probe PCR).

(69) Duplex Amplification

(70) A fragment of a plasmid containing HPV18 DNA (10.sup.2, 10.sup.3, 10.sup.4, 10.sup.5 and 10.sup.6 original copies) was co-amplified with 300 copies of the Homo sapiens genome. The respective reactions were performed in a triple batch. The hydrolysis probe for HPV18 was labeled with FAM/BHQ-1 and the probe for actin beta (ACTB) was labeled with Cy5/DDQ-2. For the duplex PCR, the detection molecule 01 was labeled with FAM/Dabcyl and the detection molecule O.sub.2 was labeled with Cy5/BHQ-2. FIG. 12D shows the linearity of the HPV18 amplification for the different DNA concentrations for the mediator probe PCR (R.sup.2=0.998) and for the hydrolysis probe PCR (R.sup.2=0.988). Calculation of the ACTB values could not be counted because only one concentration was used in the duplex experiment.

(71) The cycle values (cycle of quantification; Cq) were determined with a threshold value of 0.02 in the red channel for mediator probe PCR and hydrolysis probe PCR. The average Cq values for co-amplified ACTB and HPV18 DNA samples were 33.0 (0.5) and 31.8 (0.4) for mediator probe PCR and hydrolysis probe PCR.

(72) Various Targets

(73) The universal nature of mediator probe PCR was illustrated by tests using four clinically relevant targets. For the comparison, the hydrolysis probe PCR was conducted in parallel for each target. The linearity between input and calculated output copy number was determined for each target and for each amplification technique (FIG. 13). The results for detection of the dilution series of the HPV18 L1 gene (mediator probe PCR R.sup.2=0.999/hydrolysis probe PCR R.sup.2=0.975), S. aureus exfoliative toxin B gene (0.991/0.988), E. coli peptidoglycan-associated lipoprotein (E. coli pal) gene (0.996/0.988) and human beta actin gene (0.991/0.993) show a high correlation between the two methods of PCR:

(74) TABLE-US-00002 Input copy Mediator probe PCR Hydrolysis probe PCR Target number, n Output, n SD % CV Output, n SD % CV HPV18 L7 1.0 × 10.sup.5 1.1 × 10.sup.5 4.2 × 10.sup.3 4.0 1.1 × 10.sup.5 4.1 × 10.sup.3 3.8 1.0 × 10.sup.4 9.1 × 10.sup.3 3.6 × 10.sup.3 4.0 1.0 × 10.sup.4 1.5 × 10.sup.3 14.6 1.0 × 10.sup.2 1.0 × 10.sup.2 5.9 × 10.sup.2 5.8 8.7 × 10.sup.2 4.4 × 10.sup.2 50.9 1.0 × 10.sup.2 1.0 × 10.sup.2 1.4 × 10.sup.1 13.2 1.3 × 10.sup.2 5.1 × 10.sup.1 39.0 E. Coli pa.sup.a 6.3 × 10.sup.4 5.5 × 10.sup.4 1.1 × 10.sup.3 1.9 6.4 × 10.sup.4 5.6 × 10.sup.3 8.9 6.3 × 10.sup.3 7.1 × 10.sup.3 5.3 × 10.sup.2 7.5 7.3 × 10.sup.3 3.2 × 10.sup.2 4.3 6.3 × 10.sup.2 6.7 × 10.sup.2 40.7 × 10.sup.1  6.1 5.9 × 10.sup.2 1.4 × 10.sup.2 23.2 6.3 × 10.sup.1 7.1 × 10.sup.1 20.7 × 10.sup.1  29.2 5.1 × 10.sup.1 20.5 × 10.sup.1  40.2 S. aureus exfB 3.0 × 10.sup.4 2.9 × 10.sup.4 2.6 × 10.sup.3 0.9 3.0 × 10.sup.4 6.8 × 10.sup.3 0.9 3.0 × 10.sup.3 4.7 × 10.sup.3 3.9 × 10.sup.3 8.4 3.8 × 10.sup.3 2.5 × 10.sup.2 6.7 3.0 × 10.sup.2 3.3 × 10.sup.2 3.1 × 10.sup.1 9.4 4.0 × 10.sup.2 20.8 × 10.sup.1  5.2 3.0 × 10.sup.1 3.8 × 10.sup.1 2.4 × 10.sup.0 6.3 4.0 × 10.sup.1 3.1 × 10.sup.0 7.8 3.0 × 10.sup.0 3.2 × 10.sup.0 2.0 × 10.sup.0 62.5 2.9 × 10.sup.0 2.6 × 10.sup.0 89.7 H. sapiens ACTB 4.0 × 10.sup.3 2.9 × 10.sup.3 1.6 × 10.sup.2 5.4 3.6 × 10.sup.3 3.4 × 10.sup.2 9.4 4.0 × 10.sup.2 4.9 × 10.sup.2 7.8 × 10.sup.1 15.8 4.8 × 10.sup.2 1.2 × 10.sup.2 25.0 4.0 × 10.sup.1 4.3 × 10.sup.1 5.2 × 10.sup.0 12.1 2.8 × 10.sup.1 1.6 × 10.sup.0 5.7 4.0 × 10.sup.0 4.1 × 10.sup.0 1.1 × 10.sup.0 26.8 4.6 × 10.sup.1 1.2 × 10.sup.0 26.1 Coamplification HPV18 L1 1.0 × 10.sup.6 1.1 × 10.sup.6 3.5 × 10.sup.4 3.4 1.0 × 10.sup.5 9.3 × 10.sup.4 9.1 1.0 × 10.sup.5 8.1 × 10.sup.4 6.3 × 10.sup.3 8.5 1.2 × 10.sup.5 2.2 × 10.sup.4 18.9 1.0 × 10.sup.4 1.2 × 10.sup.4 1.7 × 10.sup.3 15.1 7.9 × 10.sup.2 6.1 × 10.sup.2 7.8 1.0 × 10.sup.3 1.1 × 10.sup.3 7.7 × 10.sup.1 6.7 1.0 × 10.sup.2 3.1 × 10.sup.2 30.3 1.0 × 10.sup.2 9.6 × 10.sup.1 3.5 × 10.sup.1 36.8 1.2 × 10.sup.2 5.6 × 10.sup.1 45.5 H. sapiens ACTB.sup.b 3.0 × 10.sup.2 C.sub.q: 33.0 ±0.5 C.sub.q: 31.8 ±0.4 .sup.aCalculatad copy numbers (no output) of 4 targets amplified with mediator probe PCR and hydrolysis probe PCR SD and imprecision (% CV) were calculated for each target and copy number. .sup.bQuantification of copy number is not feasible. The threshold for ACTB was set to 0.00 and obtained C.sub.q values are presented.

DISCUSSION

(75) The excellent feature of the test shown here is the decoupling of amplification and fluorescence detection which makes it possible to use a standardized detection molecule. The sequences of the mediator region and of the detection molecule were designed in silico and, according to a BLAST search, do not show any correspondence with the targets. The detection molecule has a hairpin secondary structure and therefore presents optimal FRET quenching conditions [>90% (FAM/Dabcyl), >80% (Cy5/BHQ-2)]. The spatial proximity between the fluorophore and the quencher within the hairpin structure results in a high and constant quenching efficiency. In contrast with the results shown here, FAM-labeled hydrolysis probes from the prior art regularly yield quenching efficiencies of 60% to 93%, depending on the different quenching radicals and the distances between the donor and the acceptor. The Cy5/DDQ-2-labeled hydrolysis probe had a low Eq value of only 55%.

(76) Amplification of HPV18 DNA was selected as a model assay to compare the new mediator probe and the hydrolysis probe, the gold standard from the prior art, with one another.

(77) The LOD was determined for both probes using probit analyses (mediator probe: 78.3; hydrolysis probe: 85.1 copies per reaction). Interassay and intra-assay variance for 10.sup.2 to 10.sup.6 copies per reaction were of the same order of magnitude (mediator probe 25%-8.7%, 55.1%-9.9%; hydrolysis probe 34.7%-12.7%, 38.3%-10.7%).

(78) A reduction in the elongation time in various PCR tests from 50 second to 6 seconds did not have a negative effect on quantification. These results show that mediator probe PCR is suitable for rapid-cycling protocols, which can be performed with the most up-to-date real-time thermocyclers.

(79) Two different detection molecules with different hybridization sequences and FRET modification were designed. These reporter systems are capable of detecting any target gene combination, wherein these systems reduce costs and can be used as routine diagnostic tests. Thus co-amplification of different amounts of HPV18 DNA and a constant copy number of ACTB were demonstrated successfully.