Use of self-assembling polypeptides as tissue adhesives

Abstract

The present invention relates to a self-assembling polypeptide, such as a spider silk polypeptide, for use as a coating material to form a uniform coating around an implant for the purpose of reducing or preventing capsular fibrosis associated with the use of such an implant in the human body.

Claims

1. A method for reducing or preventing capsular fibrosis comprising the steps of: (i) providing a composition consisting essentially of a spider silk polypeptide and a solvent, (ii) uniformly coating an implant with the composition by dipping the implant in the composition or spray-coating the implant with the composition, and (iii) implanting the implant into human body, thereby reducing or preventing capsular fibrosis.

2. The method of claim 1, wherein the implant is a breast implant.

3. The method of claim 1, wherein the implant is a soft tissue implant.

4. The method of claim 1, wherein the uniform coating has a thickness of between 1 nm and 50 μm.

5. The method of claim 1, wherein the spider silk polypeptide is C.sub.16.

6. A method for reducing or preventing capsular fibrosis comprising the steps of: (i) providing an implant uniformly coated with a spider silk polypeptide by dipping the implant in a composition consisting essentially of the spider silk polypeptide and a solvent or spray-coating the implant with the composition, and (ii) implanting the implant into human body, thereby reducing or preventing capsular fibrosis.

7. The method of claim 6, wherein the implant is a breast implant.

8. The method of claim 6, wherein the implant is a soft tissue implant.

9. The method of claim 6, wherein the uniform coating has a thickness of between 1 nm and 50 μm.

10. The method of claim 6, wherein the spider silk polypeptide is C.sub.16.

Description

FIGURE LEGEND

(1) FIG. 1: Production of C.sub.16spRGD and ntag.sup.CysC.sub.16-c(RGDfK). (A) Chemical structure of the synthetic cyclic RGD peptide c(RGDfK)-spacer moiety-part of SMCC employed for chemical modification of ntag.sup.CysC.sub.16. (B) eADF4 (C.sub.16), the RGD-containing variant ntag.sup.CysC.sub.16-c(RGDfK) (chemically modified) and C.sub.16spRGD (genetically modified). For ntag.sup.CysC.sub.16-c(RGDfK), c(RGDfK)-spacer moiety-part of SMCC was covalently coupled to the thiol-group of a cysteine residue of ntag.sup.CysC.sub.16. C.sub.16spRGD was modified by genetic engineering hybridizing a spacer and an RGD domain with eADF4 (C.sub.16).

(2) FIG. 2: Preparation of the pig skin and application of the C.sub.16 or C.sub.16spRGD solution to the pig skin for the adhesive test. (A) Pig skin was used for the adhesive test. The pig skin was cut into pieces having a size of about 9.5×11.0 cm (a size which fits in a Petri dish having a diameter of 14.5 cm) using a scalpel. (B) The pieces were fixed at their edges with nails onto a board to tighten the skin. (C) and (D) Three incisions per piece of skin were made according to an exemplary sample of 1 cm×1 cm using a scalpel. (E) The resulting skin graft was subsequently lifted with tweezers and cut to produce a skin pocket. (F) The C.sub.16 or C.sub.16spRGD solution was dropped on the cutting area using a pipette (at low protein concentrations of <40 mg/ml) or spread on the cutting area using a spatula (at high protein concentrations of ≥40 mg/ml) to cover the surface of the “wound”. (G) The separated skin flap was subsequently repositioned on the cutting area.

(3) FIG. 3: Adhesive test. The adhesive effect of C.sub.16 or C.sub.16spRGD was tested by bending (e.g. rolling) the pig skin piece as prepared above (see FIG. 2). The bending (e.g. rolling) was carried out in order to apply tension to the “wound”. (A) Photographic picture of a bended pig skin piece comprising a cutting area treated with a C.sub.16 solution. The skin flap remained connected to the treated cutting area. (B) Schematic picture of the bended pig skin piece as shown in (A). (C) Shows a skin flap before the application of a C.sub.16spRGD solution and (D) Shows a skin flap after application of a C.sub.16spRGD solution (concentration: 40 mg/ml and incubation time: 1 hour). The dotted line represents the cutting edges of the skin flap.

(4) FIG. 4: Preparation of the pig skin and application of the C.sub.16 or C.sub.16spRGD solution to the pig skin for the pulling test. (A) Pig skin was used for the pulling test. Pig skin stripes having a size of 1.5 cm×6 cm were generated. One vertical incision of 1.5 cm in length was made at a distance of 2.5 cm from the short end of the stripe using a scalpel (see continuous line within the pig skin stripe). (B) The incision was terminated at half of the thickness (the thickness is marked with a “d”) of the pig skin piece (see incision marked with “a”). The incision was continued horizontally for 1 cm (see incision marked with “b”) before turning in vertical direction to cut the tissue (see incision marked with “c”). The incision to cut the tissue is also indicated as dotted line within the pig skin stripe in (A). (C) The cutting areas/surfaces of the produced two pig skin strip halves were coated with a C.sub.16 or C.sub.16spRGD solution.

(5) FIG. 5: (A) a super glue (e.g. “UHU Kunststoff Spezialsekundenkleber”) was applied to the skin side of the stripe. The super glue was spread using a spatula or cell scraper. No glue was applied in near vicinity of the cutting site. Plastic slides (e.g. “Rinzle plastic micro-slides”) having a length of 2.5 and 3.5 cm were subsequently connected with the glued site of the skin stripe (the slide having a length of 2.5 cm was positioned on the short site of the skin slide and the slide having a length of 3.5 cm was positioned on the longer site of the skin slide). (B) The same was done for the side opposite to the skin side of the stripe. (C) The adhesion force under tangential stress was tested using a tensile tester. Therefore, the glued pig skin stripe was fixed in the tensile tester using sample holders. The arrows indicate the direction of movement.

(6) FIG. 6: Visual analysis of silk protein coated or uncoated implants after submuscular implantation in the back of rats. (A) and (B) The uncoated implants showed capsular fibrosis. (C) The capsular fibrosis in the silk protein coated implants was strongly reduced (the capsule was thinner). In addition, no scarring was visible.

(7) FIG. 7: Comparison of the capsule thickness: implants coated with the silk adhesive and non-coated implants (control).

(8) FIG. 8: Immunogenicity test. Endpoint IgG titers 2, 5 and 8 weeks after administration of eADF4 (C.sub.16). The entire group of five mice showed no or no significant increase of IgG and therefore no or no significant specific antibody formation.

EXAMPLES

(9) 1. Production of eADF4 (C.sub.16), C.sub.16spRGD, and ntagCysC.sub.16-c(RGDfK)

(10) 1.1 Production of eADF4 (C.sub.16)

(11) The recombinant spider silk protein eADF4 (also designated as C.sub.16 herein) is based on the consensus sequence of one of three spidroins of the dragline silk of the European garden spider (Araneus diadematus). The consensus motif (C module) of ADF4 (GSSAAAAAAAASGPGGYGPENQGPSGPGGYGPGGP (SEQ ID NO: 21)) is repeated 16 times in the recombinant protein (FIG. 1B). For detection, an N-terminal T7-tag may be attached to the molecule. Production in E. coli and purification was performed as described in WO 2011/120690 A2 (“Separation of insoluble target proteins”).

(12) 1.2 Genetic Modification of eADF4 (C.sub.16)

(13) DNA cassettes encoding RGD and a spacer sequence were created by annealing two synthetic oligonucleotides. For the RGD-tag: GATCCATGGGCGGTCGTGGTG ACTCTCCGGGTTAATGAA (SEQ ID NO: 72) and AGCTTTCATTAACCCGGAGAGTCACCACGACCGCCCATG (SEQ ID NO: 73) and for the spacer sequence: GATCCATGGGCGGTGGCTCTGGTTAATGAA (SEQ ID NO: 74) and AGCTTT CATTAACCAGAGCCACCGCCCATG (SEQ ID NO: 75) were used. The resulting amino acid sequence for the specific tag spRGD was GGSGGRGDSPG (SEQ ID NO: 53) (FIG. 1B). The insertion of the DNA sequences into the cloning vector and the ligation with the gene encoding eADF4 (C.sub.16) were accomplished by a seamless cloning strategy as described previously by Huemmerich et al. (“Primary structure elements of spider dragline silks and their contribution to protein solubility”, Biochemistry, 2004, 43: 13604-12). The DNA sequence of the genetically engineered C.sub.16spRGD was confirmed by sequencing. Protein production and purification procedures were identical to that of eADF4 (C.sub.16) (see above). A sequence of the genetically engineered C.sub.16spRGD including a T7 Tag is shown in SEQ ID NO: 78.

(14) 1.3 Chemical Coupling of RGD to a Cysteine-Modified Variant of eADF4 (C.sub.16)

(15) For high coupling specificity, chemical coupling of RGD peptides was performed with the cysteine containing eADF4 (C.sub.16) variant ntag.sup.CysC.sub.16 which has been previously established by Spiess et al. (“Structural characterization and functionalization of engineered spider silk films”, Soft Matter, 2010, 6: 4168-74) (FIG. 1B) (ntag.sup.Cys also designated as TAG.sup.CYS3 herein, has a sequence according to SEQ ID NO: 37, and C.sub.16 comprises 16 times module C having a sequence according to SEQ ID NO: 21). For coupling of the cyclic RGD c(RGDfK)-spacer moiety-part of SMCC (SMCC=Succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate) (see Peptides International, Louisville, Ky., USA) (see also Pierschbacher and Ruoslahti, “Influence of stereochemistry of the sequence Arg-Gly-Asp-Xaa on binding specificity in cell adhesion”, J Biol Chem, 1987, 262: 17294-8; Haubner et al. “Stereoisomeric peptide libraries and peptidomimetics for designing selective inhibitors of the alpha(V)beta(3) integrin for a new cancer therapy”, Angew. Chem. Int. Edit., 1997, 36: 1375-89; and Aumailley et al. “Arg-Gly-Asp constrained within cyclic pentapeptides, Strong and selective inhibitors of cell adhesion to vitronectin and laminin fragment P1”, FEBS Lett, 1991, 291: 50-4) (FIG. 1A), lyophilized ntag.sup.CysC.sub.16 was dissolved in 6 M guanidinium thiocyanate (GdmSCN), dialyzed against 20 mM HEPES, pH 7, and diluted to a final concentration of 2 mg/ml. For reduction of disulfide bonds, proteins were incubated in a ten-fold excess of tris(2-carboxyethyl)phosphine (TCEP) for 2 h at RT. After addition of a twenty-fold excess of c(RGDfK)-spacer moiety-part of SMCC, the reaction of maleimide and free thiol-groups was carried out for 2 h at RT. The protein was purified by precipitation with potassium phosphate (pH 8) at a final concentration of 1 M, followed by washing the pellet three times with deionized water.

(16) 2. Preparation of the Silk Protein Solution

(17) C.sub.16 and C.sub.16spRGD have been produced as described above. Respective amounts of C.sub.16 and C.sub.16spRGD were dissolved in 6M Guanidinium thiocyanate and dialyzed for at least 3 days at 4° C. against 5 mM Tris, pH 9. After dialysis, the samples were centrifuged for 15 min at 14.000 rpm at 4° C. Then the protein concentration was estimated by UV-Vis spectrometer. The protein solutions were diluted with 5 mM Tris solution, pH 9 to the requested concentrations.

(18) 3. Adhesive Test

(19) 3.1 Preparation of Skin

(20) Pig skin was used for the adhesive test. The pig skin was cut into pieces having a size of about 9.5×11.0 cm (a size which fits in a Petri dish having a diameter of 14.5 cm) using a scalpel. The pieces were fixed at their edges with nails onto a board to tighten the skin (see FIGS. 2A and B). Three incisions per piece of skin were made according to an exemplary sample of 1 cm×1 cm using a scalpel (see FIGS. 2C and D). The resulting skin graft was subsequently lifted with tweezers and cut to produce a skin pocket as shown in FIG. 2E.

(21) 3.2 Application of the Silk Protein Solution to the Skin

(22) The C.sub.16 or C.sub.16spRGD solution as produced above was dropped on the cutting area using a pipette (at low protein concentrations of <40 mg/ml), or spread on the cutting area using a spatula or cell scraper (at high protein concentrations of ≥40 mg/ml) to cover the surface of the “wound” (see FIG. 2F). The separated skin flap was subsequently repositioned on the cutting area (see FIG. 2G). The cutting area may also be designated as cutting surface. The samples were incubated at 37° C.

(23) The adhesive effect was tested by bending (e.g. rolling) the pig skin piece as prepared above (see FIGS. 3A and 3B). The bending (e.g. rolling) was carried out in order to apply tension to the “wound”. If the skin flap remained connected to the cutting area treated with the C.sub.16 or C.sub.16spRGD solution during bending (e.g. rolling), the sample was graded as a sample showing adhesive properties. If the skin flap detached from the cutting area treated with the C.sub.16 or C.sub.16spRGD solution during bending (e.g. rolling), the sample was graded as a sample showing no adhesive properties.

(24) In the following, the results of the adhesive test using pig skin pieces treated with C.sub.16spRGD solutions having a concentration of 30, 40, 50, and 70 mg/ml (see Tables 2 and 3), or C.sub.16 solutions having a concentration of 40, 50, and 70 mg/ml (see Table 3) are shown.

(25) TABLE-US-00002 TABLE 2 Results of a first C.sub.16spRGD adhesive test with different silk protein concentrations at an incubation time of 15 min and 1 h C.sub.16spRGD concentration [mg/ml] after 15 min after 1 h 30 ✓ 40 + ✓ : no adhesive effect, +: adhesive effect at the edges of the cutting surface, ✓: adhesive effect at the complete cutting surface

(26) TABLE-US-00003 TABLE 3 Results of a second C.sub.16 and C.sub.16spRGD adhesive test with different silk protein concentrations and volumes at an incubation time of 1 h Concentration Volume [μl/cm.sup.2] [mg/ml]  C.sub.16 C.sub.16spRGD References 50 70 ✓ ✓ Ref-Tris 50 ✓ ✓ Ref 40 + + 25 70 ✓ ✓ Ref-Tris 50 ✓ ✓ Ref 40 ✓ ✓ Ref-Tris: Tris buffer Ref: H.sub.2O : no adhesive effect, +: adhesive effect at the edges of the cutting surface, ✓: adhesive effect at the complete cutting surface

(27) An adhesive effect of C.sub.16 and C.sub.16spRGD has been shown for all samples treated with C.sub.16 and C.sub.16spRGD solutions (concentration 40 to 70 mg/ml, volume of 50 μl/cm.sup.2 and concentration 40 to 70 mg/ml, volume of 25 μl/cm.sup.2) after an incubation time of 1 hour. In each case, the skin flap remained connected to the cutting area during bending (see, for example, FIGS. 3A and B for C.sub.16). No adhesive effect has been shown for both reference samples (Ref-Tris: cutting area treated with Tris buffer and Ref: cutting area treated with H.sub.2O) used as negative controls. In these samples, the skin flap detached from the cutting area during bending.

(28) FIG. 3C further shows a skin flap before the application of the C.sub.16spRGD solution and FIG. 3D shows a skin flap after application of the C.sub.16spRGD solution (concentration: 40 mg/ml and incubation time: 1 hour). The dotted line represents the cutting edges of the skin flap.

(29) Similar results were achieved with pig skin pieces having the skin flap completely removed. The cutting area was covered with the C.sub.16 and C.sub.16spRGD solutions as described above. Afterwards, the skin flap was repositioned on the cutting area. The adhesive test was carried out as described above.

(30) 4. Pulling Test

(31) 4.1 Preparation of Skin

(32) Pig skin was used for the pulling test. The pig skin was cut into pieces having a size of about 6.0×11.0 cm using a scalpel. The pieces were fixed at their edges with nails onto a board to tighten the skin. In a next step, pig skin stripes having a size of 1.5 cm×6 cm were cut out from the pig skin pieces (see FIG. 4A). The single pig skin stripes were further processed as follows: One vertical incision of 1.5 cm in length was made at a distance of 2.5 cm from the short end of a stripe using a scalpel (see continuous line within the pig skin stripe in FIG. 4A). The incision was terminated at half of the thickness (the thickness is marked with a “d” in FIG. 4B) of the pig skin stripe (see incision marked with “a” in FIG. 4B). The incision was continued horizontally for 1 cm (see incision marked with “b” in FIG. 4B) before turning in vertical direction to cut the tissue (see incision marked with “c” in FIG. 4B and dotted line within the pig skin stripe in FIG. 4A).

(33) 4.2 Application of the Silk Protein Solution to the Skin

(34) The above described incision/cutting procedure separated the pig skin stripe in two halves. The pig skin stripe halves were separated from each other to treat the cutting areas with the C.sub.16 or C.sub.16spRGD solution as produced above. Therefore, the C.sub.16 or C.sub.16spRGD solution was dropped on the cutting areas using a pipette (at low protein concentrations of <40 mg/ml), or spread on the cutting areas using a spatula or cell scraper (at high protein concentrations of ≥40 mg/ml) to cover the surface of the “wound”. The two pig skin stripe halves were subsequently repositioned so that the treated cutting areas came in contact with each other (see FIG. 4C). The samples were incubated at 37° C. for 30 min.

(35) 4.3 Sample Preparation for Pulling Test

(36) Upon expiry of the incubation time of 30 min, a super glue (e.g. “UHU Kunststoff Spezialsekundenkleber”) was applied to the skin side of the stripe. The super glue was spread using a spatula or cell scraper. No glue was applied to the cutting site. Plastic slides (e.g. “Rinzle plastic micro-slides”) having a length of 2.5 and 3.5 cm were subsequently connected with the glued site of the skin stripe (the slide having a length of 2.5 cm was positioned on the short site of the skin slide and the slide having a length of 3.5 cm was positioned on the longer site of the skin slide) (see FIG. 5A). The same was done for the side opposite to the skin side of the stripe (see FIG. 5B).

(37) The adhesion force under tangential stress was tested using a tensile tester (e.g. Zwicki Z 0.5; Zwick Roell, 50 N load cell). Therefore, the glued pig skin stripe was fixed in the tensile tester using sample holders as shown in FIG. 5C.

(38) The parameters of the pulling test were as follows: Preload: 0.01 MPa Testing speed: 10 mm/min Clamping length at starting position: 15.00 mm Speed tensile modulus: 10 mm/min

(39) In the following, the results of the pulling test using pig skin stripes treated with C.sub.16spRGD or C.sub.16 solutions having a concentration of 35 mg/ml are shown.

(40) TABLE-US-00004 TABLE 4 Results of the C.sub.16 and C.sub.16spRGD pulling test Concentration [35 mg/ml] of Incubation time Average σ.sub.max (N) C.sub.16 30 min 2.92 C.sub.16spRGD 30 min 5.29

(41) The average maximal adhesion strength is indicated in Table 4. The maximal adhesion strength can be defined as the maximal load per unit width of the bond line required to produce progressive separation of two bonded adherents, particularly flexible adherents. The average maximal adhesion strength for C.sub.16spRGD was increased by about 80% compared to the average maximal adhesion strength for C.sub.16.

(42) The above experimental data clearly demonstrate that silk proteins (e.g. C.sub.16) or modified silk proteins (e.g. C.sub.16spRGD) function as tissue adhesives. Thus, silk proteins can be used, for example, as tissue adhesives to treat wounds or sutured wounds.

(43) 5. Implant Coating with Silk Proteins

(44) Textured silicone implants (Polytech Health & Aesthetics/Germany) having a diameter of 2.6 cm and a volume of 3 ml were covered with a silk protein layer of a thickness of 10 μm according to the following protocol: C.sub.16 protein was produced as described above. 1.35 g of C.sub.16 protein was dissolved in 135 ml of 6M Guanidinium Thiocyanate under gentle agitation. 135 ml of 50 mM Tris buffer (pH 9 (Roth) 4° C.) was slowly added to obtain a homogeneous solution. The resulting protein solution was dialyzed overnight against 50 mM Tris buffer pH 9 at 4° C. Guanidinium-SCN remnants were removed via cross-flow filtration at 4° C. while Tris buffer (50 mM, pH 9) was constantly added. Subsequently the C.sub.16 protein solution was concentrated to 60 ml. The final concentration was 10.8 mg/ml (determined by UV/Vis-Spectroscopy, Beckman Coulter, DU 800).

(45) The coating was performed in a sterile chamber (sterilized at 140° C. for 1 hour). The silicone implants were washed with ethanol and dried at RT prior to the coating process. The silicone implants were coated 3 times with the C.sub.16 protein solution (30 ml at 10.8 mg/ml) by dipping the silicone implants into the solution for 120 s and drying at air for 300 s, respectively. For post-treatment, the transplants were dipped in KH.sub.2PO.sub.4 solution (1M pH4 (Roth, 99%), NaCl 0.91% w/v (Roth, 99.5%)) for 120 s and dried for 120 s before washing the transplants in a saline solution (9 g/l). After sterilization by gamma-irradiation with a dose of 5 kGray (at Isotron, Allershausen), the silk protein coated implants were implanted submuscular in the back of Sprague-Dawley rats having a weight of 250 to 300 mg. As a control, uncoated implants were used.

(46) After 3 months, the Sprague-Dawley rats were sacrificed. The implants were exposed and subsequently analyzed. The results are illustrated in FIG. 6. While the uncoated implants showed capsular fibrosis (see FIGS. 6A and B), the capsular fibrosis in the silk protein coated implants was strongly reduced (see FIG. 6C). This results in less scarring tissue being formed at the interface of the implant and the host tissue, as evident by a 30% reduction of the scarring tissue forming the implant capsule compared to the control group (see FIG. 7). Further, the capsules of the silk protein coated implants were thinner (see FIG. 6C) in contrast to the capsules of the uncoated implants (see FIG. 6A).

(47) These data allow the conclusion that wounds which are glued with self-assembling proteins, particularly silk proteins, exhibit reduced or no scarring and/or reduced or no fibrosis, particularly capsular fibrosis.

(48) 6. Safety Tests

(49) 6.1 Acute Eye Irritation Test

(50) The acute eye irritation test was performed according to DIN EN ISO 1093-1 und GLP conditions. Particularly, 0.3 mg spider silk protein eADF4 (C.sub.16) dissolved in 100 μl phosphate-buffered saline was applied to one of the two eyes of three female New Zealand white rabbits. The non-treated eye of each female New Zealand white rabbit was taken as a control. This treatment did not cause any signs of pain and did not result in any clinical findings. It showed neither eye damage (a risk of serious damage to the eyes could be excluded according to GHS H 318 (Global Harmonizing System)) nor eye irritation (eADF4 (C.sub.16) was not classified as irritant according to GHS H 319).

(51) 6.2 Immunogenicity Test

(52) A composition of eADF4 (C.sub.16) was administered subcutaneously to five female BALB/c mice at final doses of 2, 10 and 50 μg, respectively. One week before and two, five and eight weeks after administration, sera were harvested and analyzed for the presence of antibodies directed against the test substances. The entire group of five mice showed no significant specific antibody formation (see FIG. 8).

(53) 6.3 Acute Systemic Toxicity Test

(54) The Acute systemic toxicity test was performed according to DIN EN ISO 10993-11 under GLP conditions. Particularly, eADF4 (C.sub.16) was given once i.p. at a dose of 250 mg/kg to female NMRI mice. Two groups of five female mice each were tested, one with the test item dissolved in phosphate-buffered saline, one with the vehicle. No test item group animal showed any clinical findings at the end of the observation period. There was no significant change of body weight. No further findings, such as macroscopic findings or change of organ weights were noted during the observation period.

(55) 6.4 Acute Skin Irritability Test

(56) The acute skin irritability test was performed according to OECD 404 guidelines und GLP conditions. Particularly, an ADF4 (C.sub.16) film patch of 42.5 mg and 6 cm.sup.2 area was moistened with 100 μl saline, applied to previously shaved skin on the backs of each of three male New Zealand white rabbits, and fixated with sterile gauze pads and hypoallergic plaster. After four hours incubation the film patches were removed and the treated skin was examined. The treatment with a eADF4 (C.sub.16) film did not cause any erythema formation or edema formation directly after the application or during the observation period. No general clinical findings and no initial pain reaction were observed after administration.