Method to produce protein in <i>Penicillium amagasakiense</i>'s sleeping spores by transformation of ssRNA
11286504 · 2022-03-29
Assignee
Inventors
Cpc classification
C12N15/8206
CHEMISTRY; METALLURGY
C07K2319/60
CHEMISTRY; METALLURGY
C12N15/87
CHEMISTRY; METALLURGY
C12N5/10
CHEMISTRY; METALLURGY
C12N13/00
CHEMISTRY; METALLURGY
International classification
C12N15/87
CHEMISTRY; METALLURGY
C12N5/10
CHEMISTRY; METALLURGY
C12N15/82
CHEMISTRY; METALLURGY
C12N13/00
CHEMISTRY; METALLURGY
Abstract
The present invention discloses A METHOD TO PRODUCE PROTEIN IN PENICILLIUM AMAGASAKIENSE'S SLEEPING SPORES BY TRANSFORMATION OF SSRNA. The method includes three steps of culture of Penicillium amagasakiense and collection of spores, pretreatment of Penicillium anagasakiense spores, and electroporation of Penicillium anagasakiense spores by using HDEN method. In the present invention, non-germinated spores are used as a starting material for introduction of exogenous molecules. The exogenous protein coding single stranded RNA is introduced into the resting spores of Penicillium amagasakiense by employing the HDEN electrotransformation technique to express protein. The method of this invention is simple and fast, the effect is excellent, and the transformation rate reaches more than 90%.
Claims
1. A method for direct transformation of exogenous single stranded RNA into resting spores of Penicillium amagasakiense to express protein, characterized in that, the method comprising steps of: 1) culture of Penicillium amagasakiense and collection of spores Penicillium amagasakiense is inoculated onto a surface of a solid agar medium, and cultured until Penicillium amagasakiense spores are overgrown on the surface of the medium, the Penicillium amagasakiense spores are washed off from the surface of the medium, suspension of the spores is aspirated off and filtered to remove mycelia, and filtrate containing the spores is collected, and centrifuged to collect the pelleted resting spores; 2) pretreatment of Penicillium amagasakiense spores the spores are re-suspended in an electroporation buffer, and centrifuged to collect the spore pellets, the re-suspension and centrifugation steps are repeated 3-4 times, and the last collected spore pellets are re-suspended in the electroporation buffer, to obtain an Penicillium amagasakiense spore suspension with a spore concentration of 10.sup.4-10.sup.11 spores/ml, in which the electroporation buffer consists of 4-hydroxyethyl piperazineethanesulfonic acid having a final concentration of 0.01-100 mmol/L and mannitol having a final concentration of 0.5-5000 mmol/L, and the pH of the electroporation buffer is 3.0-9.5; and 3) Electroporation of Penicillium amagasakiense spores by using high-density distributed electrode network (HDEN) method the Penicillium amagasakiense spore suspension prepared in the above steps and a RNA to be transformed are added to wells of a cell culture plate and mixed uniformly, to obtain a mixture of the spores and the RNA, the cell culture plate is placed on an ice bath for 10-15 min, subsequently electroporation is carried out by using the HDEN method using an Etta Biotech X-Porator H1 electroporator, by inserting an electroporator head fitted with a matrix electrode into the mixture of the spores and the RNA, and energizing, to generate an electric field inside the mixture of the spores and the RNA, the cell culture plate is placed on the ice bath again for 10-15 min after electroporation, and subsequently the mixture of the spores and the RNA is aspirated off, to obtain resting spores of Penicillium amagasakiense with introduction of exogenous RNA, in which ratio of the Penicillium amagasakiense suspension to the RNA to be transformed is 0.6-60000 μl of Penicillium amagasakiense spore suspension to 0.1-10000 μg of RNA to be transformed; and parameters for the electroporation comprise: a voltage of 1-6000 V, pulse duration of 2-2000000 ms, and repeat for 1-100 times at an interval of 5-50000 ms.
2. The method for direct transformation of exogenous single stranded RNA into resting spores of Penicillium amagasakiense to express protein according to claim 1, characterized in that, the medium in the step 1) is PDA medium, YPD medium, or Czapek-Dox medium.
3. The method for direct transformation of exogenous single stranded RNA into resting spores of Penicillium amagasakiense to express protein according to claim 1, characterized in that, in the step 1), Penicillium amagasakiense is cultured at a temperature of 16-40° C. with 15-85% humidity for 3-15 days.
4. The method for direct transformation of exogenous single stranded RNA into resting spores of Penicillium amagasakiense to express protein according to claim 1, characterized in that, in the step 2), the Penicillium amagasakiense spore suspension is observed under a microscope before electroporation, to confirm that the spore suspension is free of contamination with mycelia and the spores are non-germinated, and subsequently electroporation is carried out.
5. The method for direct transformation of exogenous single stranded RNA into resting spores of Penicillium amagasakiense to express protein according to claim 1, characterized in that, in the step 3), the RNA to be transformed is an exogenous protein encoding single-stranded RNA and can produce protein in host cells.
6. The method for direct transformation of exogenous single stranded RNA into resting spores of Penicillium amagasakiense to express protein according to claim 5, characterized in that, the RNA is encoded RNA of the green fluorescent protein, or encoded RNA of the red fluorescent protein, or encoded RNA of the yellow fluorescent protein.
7. The method for direct transformation of exogenous single stranded RNA into resting spores of Penicillium amagasakiense to express protein according to claim 6, characterized in that, the following PCR primers are used to amplify the green fluorescent protein gene or the yellow fluorescent protein gene: TABLE-US-00005 F: (SEQ ID NO. 1) 5′ AGATGACGTCGCTAGCATGGTGAGCAAGGGC 3′, R: (SEQ ID NO. 2) 5′ ACGCGTCGACTTACTTGTACAGCTCGT3′, Among them, the GCTAGC sequence in the primer F near the 5′ end is used to promote binding of eukaryotic initiation factor and RNA which in vitro transcribed from DNA, this sequence adjacent to the target gene's start codon ATG.
8. The method for direct transformation of exogenous single stranded RNA into resting spores of Penicillium amagasakiense to express protein according to claim 6, characterized in that, the following PCR primers are used to amplify the red fluorescent protein gene: TABLE-US-00006 RFP-F: (SEQ ID NO. 3) 5′ CGGAATTCGCCACCATGGCCTCCTCCGAGGACGT 3′, RFP-R: (SEQ ID NO. 4) 5′ TCGAGCTCGTTAGGCGCCGGTGGAGTGG 3′, The GCCACC sequence in the primer RFP-F near the 5′ end is used to promote binding of eukaryotic initiation factor and RNA which in vitro transcribed from DNA, this sequence adjacent to the target gene's start codon ATG.
9. The method for direct transformation of exogenous single stranded RNA into resting spores of Penicillium amagasakiense to express protein according to claim 1, characterized in that, in the step 3), in which ratio of the Penicillium amagasakiense suspension to the RNA to be transformed is 60 μl of Penicillium amagasakiense spore suspension to 10 μg of RNA to be transformed.
10. The method for direct transformation of exogenous single stranded RNA into resting spores of Penicillium amagasakiense to express protein according to claim 1, characterized in that, in the step 3), the parameters for the electroporation comprise: a voltage of 450 V, pulse duration of 2500 ms, and repeat for 3 times at an interval of 400 ms.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The following are further instructions of this invention with attached FIGURES and DESCRIPTION OF THE EMBODIMENTS.
(2)
DESCRIPTION OF THE EMBODIMENTS
(3) The following examples are provided for a better understanding of the present invention; however, the present invention is not limited thereto.
(4) All the experimental process should follow the principle of aseptic condition while conducting the microbial experiments, and the instruments, consumable materials, and reagents should be sterilized.
(5) All restriction endonuclease used in the present invention are FastDigest series obtained from Fermentas company, as well as T4 DNA ligase. Enzyme digestion and ligation and gel recovery and DNA purification, are operated in accordance with the manual from toolkit's manufacturer.
Example 1
(6) Expression of green fluorescent protein (GFP) in Penicillium amagasakiense cells:
(7) 1. Construction of plasmid for in vitro transcription
(8) The GFP gene encoding sequence is shown in SEQ ID No. 5,
(9) The GFP protein sequence is shown in SEQ ID No. 6,
(10) PCR primers for amplification of GFP gene:
(11) TABLE-US-00003 (SEQ ID NO: 1)
(12) Among them, the GCTAGC sequence in the primer F near the 5′ end is used to promote binding of eukaryotic translation initiation factor and RNA which transcribed from DNA in vitro, this sequence adjacent to the target gene's start codon ATG. After PCR with above primers, the GFP gene can be fused with GCTAGC in the upstream, and restriction enzyme cutting sites in the upstream and downstream.
(13) PCR system (50 μl): GFP template 1 μL, primer F 2 μL, primer R 2 μL, 2× Taq PCR mix 25 μL, and ddH.sub.2O top up to 50 μL. PCR program: 94° C. for 2 min, 30 cycles of (94° C. for 30 s, 61.6° C. for 30 s, and 72° C. for 60 s), and 72° C. for 5 min.
(14) After detection of the correct PCR product by agarose gel electrophoresis, the PCR product was recovered and purified using Thermo GeneJet Gel extraction and DNA Cleanup Micro Kit.
(15) The PCR product was cut with Aat II and Sal I, then the T4 DNA ligase was used to connect it to Promega pGEM-T easy plasmid, which was also treated by Aat II and Sal I. The ligation mix was transmitted to Escherichia coli with Chemical Transformation, screening for positive clones. The recombinant plasmid was extracted in large quantities after the insertion sequence was verified by sequencing. The above steps just allow the GFP gene to be located downstream of the plasmid's T7 promoter.
(16) In Vitro Transcription:
(17) Fermentas Company's Fastdigest Nde1 enzyme was used to linearize the recombinant plasmid. Then it was transcribed in vitro using Thermo Scientific transcriptAid T7 High Yield transcription Kit, which was operated in accordance with the manual.
(18) Purification of transcribed RNA products:
(19) 1) Add 115 μl DEPC-H.sub.2O and 15 μl 3M NaAc solution (pH 5.2) to the 20 μl transcription reaction system and mix evenly;
(20) 2) Add the same volume of phenol, chloroform, isoamyl alcohol mixture (phenol:Chloroform:Isoamyl alcohol=25:24:1), mix evenly;
(21) 3) High-speed centrifugation to stratify the liquid, take the upper aqueous phase to another 1.5 ml centrifugal tube.
(22) 4) Add two volume of ethanol in the aqueous phase, place at least 30 min at −20° C., centrifuge at high speed to precipitate RNA, and discard the supernatant.
(23) 5) Add 1 ml pre-cooled 70% ethanol, gently inverted the tube and then centrifuge at a high speed for 1 min.
(24) 6) The precipitation is suspended in a suitable volume of DEPC-H.sub.2O, so that the RNA concentration is not less than 10 μg/μl.
(25) The gel electrophoresis is shown in
(26) Lane 1: RiboRuler RNA Ladder, high range, ready-to-use.
(27) Lane 2: Positive control, 2222nt.
(28) Lane 3: The RNA of GFP from in vitro transcription, ˜750nt.
(29) 2. Using the above-mentioned green fluorescent protein encoded RNA to express green fluorescent protein in Penicillium amagasakiense dormant spores, the steps are as follows:
(30) 1) Culture of Penicillium amagasakiense and Collection of Spores
(31) In a 15-cm Petri dish, a solid agar medium (PDA medium) was prepared. Penicillium amagasakiense CICC 40341 was inoculated onto the surface of the solid agar medium and cultured at a temperature of 25° C. with 50-60% humidity for 8 days, to allow Penicillium amagasakiense spores to overgrow on the surface of the medium.
(32) Sterilized water was poured onto the surface of the medium, to wash down the Penicillium amagasakiense spores off from the surface of the medium (by vibrating, or gently scratching with a sterilized smooth glass spreading rod). The spore suspension was aspirated with a pipette and filtered using sterilized lens paper (or fritted glass filter, filter paper, etc.) to remove the mycelia and retain the spores. The filtered liquid was placed in a centrifuge tube and centrifuged to collect the pelleted resting spores, and the supernatant was discarded. The collected spores were subjected to chromosome staining, to observe and confirm that the chromosomes in the spores are haploid.
(33) 2) Pretreatment of Penicillium amagasakiense Spores
(34) The spore pellets were re-suspended in an electroporation buffer (where the volume of the electroporation buffer added should fill up the centrifuge tube), centrifuged again to collect the spore pellets, and the supernatant was discarded. After repeating the above steps twice, the spores were re-suspended in the electroporation buffer again, and observed under a microscope, to confirm that the spore suspension was free of contamination with mycelia and the spores were non-germinated. When the spores were finally re-suspended in the electroporation buffer, the volume of the electroporation buffer was controlled to maintain a spore concentration in the Penicillium amagasakiense spore suspension of 108 spores/ml.
(35) The electroporation buffer consisted of HEPES having a final concentration of 1 mmol/L and mannitol having a final concentration of 50 mmol/L, and the pH of the electroporation buffer was 7.0.
(36) 3) Electroporation of the Penicillium amagasakiense Spores by Using HDEN Method
(37) 60 μl of the Penicillium amagasakiense spores suspension and 10 μg of GFP protein encoding RNA were added to one well of a 96-well cell culture plate and mixed evenly, to obtain a mixture of the spores and RNA. The cell culture plate was placed on an ice bath for 10 min, electroporation was carried out subsequently by using the HDEN method using an Etta Biotech X-Porator H1 electroporator, by inserting an electroporator head fitted with a matrix electrode into the mixture of the spores and the RNA, and energizing, to generate an electric field inside the mixture of the spores and the RNA. The cell culture plate was placed on the ice bath again for 10 min after electroporation, and subsequently the mixture of the spores and the RNA was aspirated off, to obtain resting spores of Penicillium amagasakiense with introduction of exogenous RNA.
(38) In this example, the parameters for electroporation include: a voltage of 450 V, pulse duration of 2500 ms, and repeat for 3 times at an interval of 400 ms.
(39) 4) Confirmatory Experiment
(40) The aspirated mixture of the spores and the RNA was added to a 100 volumes YPD medium and cultured at a temperature of 30° C. for 20 hours. Then it was observed by a laser confocal microscope.
(41) At the same time when the above experimental steps were performed, a control was prepared. The same mixture of “the spores and the RNA” that was not electroporated was added to a 100 volumes YPD medium and cultured at a temperature of 30° C. for 20 hours. Then it was observed by a laser confocal microscope too.
(42) The results showed that cells in the control had no fluorescence, and at least 95% cells in the sample group had green fluorescence, indicating successful RNA transformation.
Example 2
(43) Expression of red fluorescent protein (RFP) in Penicillium amagasakiense cells:
(44) 1. Construction of plasmid for in vitro transcription
(45) The RFP gene encoding sequence is shown in SEQ ID No. 7,
(46) The RFP protein sequence is shown in SEQ ID No. 8,
(47) PCR primers for amplification of RFP gene:
(48) TABLE-US-00004 RFP-F: (SEQ ID NO. 3) 5′ CGGAATTCGCCACCATGGCCTCCTCCGAGGACGT 3′, with EcoR I site. RFP-R: (SEQ ID NO. 4) 5′ TCGAGCTCGTTAGGCGCCGGTGGAGTGG 3′, with Sal I site.
(49) In RFP-F, the GCCACC sequence near the 5′ end is used to promote binding of eukaryotic translation initiation factor and RNA which in vitro transcribed from DNA, this sequence adjacent to the target gene's start codon ATG.
(50) RFP-R′ 5′ end contains Sal I site.
(51) In accordance with example 1, the RFP gene is amplified by PCR, ligated to the PGEM-T easy plasmid, then in vitro transcription, and the resulting RNA will be transformed into the host spores.
(52) 2. Using the above-mentioned red fluorescent protein encoded RNA to express red fluorescent protein in Penicillium amagasakiense dormant spores, the steps are as follows:
(53) 1) Culture of Penicillium amagasakiense and Collection of Spores
(54) In a 15-cm Petri dish, a solid agar medium (PDA medium) was prepared.
(55) Penicillium amagasakiense CICC 40341 was inoculated onto the surface of the solid agar medium and cultured at a temperature of 16° C. with 15-50% humidity for 15 days, to allow Penicillium amagasakiense spores to overgrow on the surface of the medium.
(56) Sterilized water was poured onto the surface of the medium, to wash down the Penicillium amagasakiense spores off from the surface of the medium (by vibrating, or gently scratching with a sterilized smooth glass spreading rod). The spore suspension was aspirated with a pipette and filtered using sterilized lens paper (or fritted glass filter, filter paper, etc.) to remove the mycelia and retain the spores. The filtered liquid was placed in a centrifuge tube and centrifuged to collect the pelleted resting spores, and the supernatant was discarded. The collected spores were subjected to chromosome staining, to observe and confirm that the chromosomes in the spores are haploid.
(57) 2) Pretreatment of Penicillium amagasakiense Spores
(58) The spore pellets were re-suspended in an electroporation buffer (where the volume of the electroporation buffer added should fill up the centrifuge tube), centrifuged again to collect the spore pellets, and the supernatant was discarded. After repeating the above steps twice, the spores were re-suspended in the electroporation buffer again, and observed under a microscope, to confirm that the spore suspension was free of contamination with mycelia and the spores were non-germinated. When the spores were finally re-suspended in the electroporation buffer, the volume of the electroporation buffer was controlled to maintain a spore concentration in the Penicillium amagasakiense spore suspension of 10.sup.11 spores/ml.
(59) The electroporation buffer consisted of HEPES having a final concentration of 0.01 mmol/L and mannitol having a final concentration of 0.5 mmol/L, and the pH of the electroporation buffer was 3.0.
(60) 3) Electroporation of the Penicillium amagasakiense Spores by Using HDEN Method
(61) 0.6 μl of the Penicillium amagasakiense spores suspension and 0.1 μg of GFP protein encoding RNA were added to wells of a 96-well cell culture plate and mixed evenly, to obtain a mixture of the spores and RNA. The cell culture plate was placed on an ice bath for 15 min, electroporation was carried out subsequently by using the HDEN method using an Etta Biotech X-Porator H1 electroporator, by inserting an electroporator head fitted with a matrix electrode into the mixture of the spores and the RNA, and energizing, to generate an electric field inside the mixture of the spores and the RNA. The cell culture plate was placed on the ice bath again for 15 min after electroporation, and subsequently the mixture of the spores and the RNA was aspirated off, to obtain resting spores of Penicillium amagasakiense with introduction of exogenous RNA.
(62) In this example, the parameters for electroporation include: a voltage of 1 V, pulse duration of 2000000 ms, and repeat for 100 times at an interval of 5 ms.
(63) 4) Confirmatory Experiment
(64) The aspirated mixture of the spores and the RNA was added to a 10 volumes YPD medium and cultured at a temperature of 10° C. for 25 hours. Then it was observed by a laser confocal microscope.
(65) At the same time when the above experimental steps were performed, a control was prepared. The same mixture of “the spores and the RNA” that was not electroporated was added to a 10 volumes YPD medium and cultured at a temperature of 10° C. for 25 hours. Then it was observed by a laser confocal microscope too.
(66) The results showed that cells in the control had no fluorescence, and at least 90% cells in the sample group had red fluorescence, indicating successful RNA transformation.
Example 3
(67) Expression of yellow fluorescent protein (YFP) in Penicillium amagasakiense cells:
(68) 1. Construction of plasmid for in vitro transcription
(69) The YFP gene encoding sequence is shown in SEQ ID No. 9,
(70) The YFP protein sequence is shown in SEQ ID No. 10,
(71) In accordance with example 1, the YFP gene is amplified by PCR using the same primers as GFP, ligated to the PGEM-T easy plasmid, then in vitro transcription, and the resulting RNA will be transformed into the host spores.
(72) 2. Using the above-mentioned yellow fluorescent protein encoded RNA to express yellow fluorescent protein in Penicillium amagasakiense dormant spores, the steps are as follows:
(73) 1) Culture of Penicillium amagasakiense and Collection of Spores
(74) In a 15-cm Petri dish, a solid agar medium (PDA medium) was prepared.
(75) Penicillium amagasakiense CICC 40341 was inoculated onto the surface of the solid agar medium and cultured at a temperature of 40° C. with 60-85% humidity for 3 days, to allow Penicillium amagasakiense spores to overgrow on the surface of the medium.
(76) Sterilized water was poured onto the surface of the medium, to wash down the Penicillium amagasakiense spores off from the surface of the medium (by vibrating, or gently scratching with a sterilized smooth glass spreading rod). The spore suspension was aspirated with a pipette and filtered using sterilized lens paper (or fritted glass filter, filter paper, etc.) to remove the mycelia and retain the spores. The filtered liquid was placed in a centrifuge tube and centrifuged to collect the pelleted resting spores, and the supernatant was discarded. The collected spores were subjected to chromosome staining, to observe and confirm that the chromosomes in the spores are haploid.
(77) 2) Pretreatment of Penicillium amagasakiense Spores
(78) The spore pellets were re-suspended in an electroporation buffer (where the volume of the electroporation buffer added should fill up the centrifuge tube), centrifuged again to collect the spore pellets, and the supernatant was discarded. After repeating the above steps twice, the spores were re-suspended in the electroporation buffer again, and observed under a microscope, to confirm that the spore suspension was free of contamination with mycelia and the spores were non-germinated. When the spores were finally re-suspended in the electroporation buffer, the volume of the electroporation buffer was controlled to maintain a spore concentration in the Penicillium amagasakiense spore suspension of 10.sup.4 spores/ml.
(79) The electroporation buffer consisted of HEPES having a final concentration of 100 mmol/L and mannitol having a final concentration of 5000 mmol/L, and the pH of the electroporation buffer was 7.0.
(80) 3) Electroporation of the Penicillium amagasakiense Spores by Using HDEN Method
(81) 600000 μl of the Penicillium amagasakiense spores suspension and 10000 μg of YFP protein encoding RNA were added to wells of a 96-well cell culture plate and mixed evenly, to obtain a mixture of the spores and RNA. The cell culture plate was placed on an ice bath for 10 min, electroporation was carried out subsequently by using the HDEN method using an Etta Biotech X-Porator H1 electroporator, by inserting an electroporator head fitted with a matrix electrode into the mixture of the spores and the RNA, and energizing, to generate an electric field inside the mixture of the spores and the RNA. The cell culture plate was placed on the ice bath again for 10 min after electroporation, and subsequently the mixture of the spores and the RNA was aspirated off, to obtain resting spores of Penicillium amagasakiense with introduction of exogenous RNA.
(82) In this example, the parameters for electroporation include: a voltage of 6000 V, pulse duration of 2 ms, and repeat for 1 times at an interval of 50000 ms.
(83) 4) Confirmatory Experiment
(84) The aspirated mixture of the spores and the RNA was added to a 10 volumes YPD medium and cultured at a temperature of 40° C. for 24 hours. Then it was observed by a laser confocal microscope.
(85) At the same time when the above experimental steps were performed, a control was prepared. The same mixture of “the spores and the RNA” that was not electroporated was added to a 10 volumes YPD medium and cultured at a temperature of 40° C. for 24 hours. Then it was observed by a laser confocal microscope too.
(86) The results showed that cells in the control had no fluorescence, and at least 90% cells in the sample group had yellow fluorescence.
Example 4
(87) In this example, the parameters for electroporation include: a voltage of 30 V, pulse duration of 1000000 ms, and repeat for 50 times at an interval of 5000 ms. The remaining steps are the same as example 1.
Example 5
(88) In this example, the parameters for electroporation include: a voltage of 3000 V, pulse duration of 100 ms, and repeat for 5 times at an interval of 25000 ms. The remaining steps are the same as example 1.
(89) The single stranded RNA coding protein mentioned in this invention can be the natural protein which is constitutive expression in the host, as well as protein of another species, and novo artificial designed protein.
(90) All protein coding single-stranded RNA can be transformed by the method of the present invention, not be restricted to the embodiment of the green, red or yellow fluorescent protein encoding RNA.