PRODUCTION OF PROTEIN WITH HUMANIZED N-GLYCOSYLATION IN INSECT CELLS
20220112535 · 2022-04-14
Inventors
- Stine Broch Clemmensen (Hørsholm, DK)
- Magdalena Skrzypczak (Vanløse, DK)
- Teit Max Moscote Søgaard (Kokkedal, DK)
- Willem Adriaan De Jongh (Holte, DK)
Cpc classification
C12N5/0601
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure provides genetically modified insect cells that can produce glycosylated expression products having a human-like glycosylation pattern. In particular, the cells comprise disruption of the fdl and/or FucT6 genes. Also provided is expression systems and methods for recombinant protein production.
Claims
1. An insect cell, wherein expression of the fdl gene has been disrupted.
2. The insect cell according to claim 1, which produces N-glycosylated protein with less than 40% FM3/M3 glycan structures.
3. The insect cell according to claim 1, which produces N-glycosylated protein comprising at least 2% FA1/A1 glycan structures.
4. The insect cell according to claim 1 or 2, comprising insertion of a functional GlcNAcT I gene and/or a functional GlcNAcT II gene.
5. The insect cell according to claim 4, which produces N-glycosylated protein comprising less than 15% FM3/M3 glycan structures, less than 30% FA1/A1 glycan structures, and more than 50% FA2/A2 glycan structures.
6. An insect cell, wherein expression of the FucT6 gene has been disrupted.
7. The insect cell according to claim 6, which produces N-glycosylated protein comprising less than 2%, preferably 0%, core α1,6-fucose.
8. The insect cell according to claim 6 or 7, which further is as defined in any one of claims 1-5.
9. The insect cell according to any one of the preceding claims which is selected from the group consisting of Drosophila cells, such as S2 and S3, Spodoptera frugiperda cells, such as Sf9 (and derivatives thereof) and Sf21, and Trichoplusia ni cells such as BTI-Tn-5B1-4 and Tn-368.
10. The insect cell according to claim 9, which is a Drosophila cell, such as an S2 or S3 cell.
11. The insect cell according to any one of the preceding claims, which further comprises a functional gene expressing a β-1,4-galactosyltransferase.
12. The insect cell according to any one of the preceding claims, which further comprises a functional gene expressing an α2,3-sialyltransferase.
13. The insect cell according to any one of the preceding claims, which further comprises a functional gene expressing an α2,6-sialyltransferase.
14. The insect cell according to any one of the preceding claims, which further comprises a functional gene expressing at least one sialic acid transporter protein.
15. The insect cell according to any one of the preceding claims, which further comprises a functional Mgat4 gene.
16. The insect cell according to any one of the preceding claims, which further comprises a functional Mgat5 gene.
17. A cell clone or cell line, comprising the cell according to any one of the preceding claims.
18. An expression system comprising 1) an insect cell according to any one of claims 1-16 or a cell clone or cell line according to claim 17 and 2) an expression vector comprising the genetic elements necessary for effecting expression of a gene in said insect cell, where said gene has been inserted into said expression vector.
19. A method for producing an N-glycosylated polypeptide of interest, the method comprising culturing an insect cell according to any one of claims 1-16 or a cell clone or cell line according to claim 17, wherein said insect cell or a cell clone or cell line expresses a gene encoding said polypeptide, and subsequently isolating said polypeptide from the culture.
Description
LEGENDS TO THE FIGURE
[0047]
[0048] Dark square: N-acetylglucosamine (GlcNAc), dark circle: glucose, light grey circle: mannose, triangle: fucose, light grey circle: galactose, diamond: sialic acid.
[0049]
[0050]
[0051] Dark square: N-acetylglucosamine (GlcNAc), light grey circle: mannose, triangle: fucose, light grey circle: galactose, diamond: sialic acid.
[0052]
[0053] Dark square: N-acetylglucosamine (GlcNAc), light grey circle: mannose, triangle: fucose, light grey circle: galactose, diamond: sialic acid.
[0054]
[0055]
[0056]
[0057] Square: GlcNAc, circle: mannose, triangle: fucose.
[0058]
[0059] All cell lines are monoclonal. The percentages of equal glycans, where only the core fucose differed were pooled. The label “other” refers to other glycans structures that were present in the glycan pool, but that we deemed irrelevant for the analysis of fdl disruption and insertion of GlcNAcT I and GlcNAcT II—for example higher mannose structure and a few more complex structures.
[0060]
[0061]
[0062]
[0063]
[0064]
DETAILED DISCLOSURE OF THE INVENTION
Definitions
[0065] The term “polypeptide” is in the present context intended to mean both short peptides of from 2 to 10 amino acid residues, oligopeptides of from 11 to 100 amino acid residues, and polypeptides of more than 100 amino acid residues. Furthermore, the term is typically also intended to include proteins, i.e. functional biomolecules comprising at least one polypeptide; when comprising at least two polypeptides, these may form complexes, be covalently linked, or may be non-covalently linked. The polypeptide (s) in a protein can be glycosylated and/or lipidated and/or comprise prosthetic groups. In the present application, polypeptides and proteins are all glycosylated.
[0066] The term “subsequence” means any consecutive stretch of at least 3 amino acids or, when relevant, of at least 3 nucleotides, derived directly from a naturally occurring amino acid sequence or nucleic acid sequence, respectively.
[0067] The term “amino acid sequence” is the order in which amino acid residues, connected by peptide bonds, lie in the chain in peptides and proteins in the direction from the free N-terminus to the free C-terminus.
[0068] “Sequence identity” is in the context of the present invention determined by comparing 2 optimally aligned sequences of equal length (e.g. DNA, RNA or amino acid) according to the following formula: (N.sub.ref−N.sub.dif).Math.100/N.sub.ref, wherein N.sub.ref is the number of residues in one of the 2 sequences and N.sub.dif is the number of residues which are non-identical in the two sequences when they are aligned over their entire lengths and in the same direction. So, two sequences 5′-ATTCGGAAC-3′ and 5′-ATACGGGAC-3′ will provide the sequence identity 77.8% (N.sub.ref=9 and N.sub.dif=2). It will be understood that such a sequence identity determination requires that the two aligned sequences are aligned so that there are no overhangs between the two sequences: each amino acid in each sequence will have to be matched with a counterpart in the other sequence.
[0069] A “linker” is an amino acid sequence, which is introduced between two other amino acid sequences in order to separate them spatially. A linker may be “rigid”, meaning that it does substantially not allow the two amino acid sequences that it connects to move freely relative to each other. Likewise, a “flexible” linker allows the two sequences connected via the linker to move substantially freely relative to each other. In fusion proteins, which are part of the present invention, both types of linkers are useful.
[0070] A “T-helper lymphocyte response” is an immune response elicited on the basis of a peptide, which is able to bind to an MHC class II molecule (e.g. an HLA class II molecule) in an antigen-presenting cell and which stimulates T-helper lymphocytes in an animal species as a consequence of T-cell receptor recognition of the complex between the peptide and the MHC Class II molecule presenting the peptide.
[0071] An “immunogen” is a substance of matter which is capable of inducing an adaptive immune response in a host, whose immune system is confronted with the immunogen. As such, immunogens are a subset of the larger genus “antigens”, which are substances that can be recognized specifically by the immune system (e.g. when bound by antibodies or, alternatively, when fragments of the are antigens bound to MHC molecules are being recognized by T-cell receptors) but which are not necessarily capable of inducing immunity—an antigen is, however, always capable of eliciting immunity, meaning that a host that has an established memory immunity against the antigen will mount a specific immune response against the antigen.
[0072] A “hapten” is a small molecule, which can neither induce nor elicit an immune response, but if conjugated to an immunogenic carrier, antibodies or TCRs that recognize the hapten can be induced upon confrontation of the immune system with the hapten carrier conjugate.
[0073] An “adaptive immune response” is an immune response in response to confrontation with an antigen or immunogen, where the immune response is specific for antigenic determinants of the antigen/immunogen—examples of adaptive immune responses are induction of antigen specific antibody production or antigen specific induction/activation of T helper lymphocytes or cytotoxic lymphocytes.
[0074] “Stimulation of the immune system” means that a substance or composition of matter exhibits a general, non-specific immunostimulatory effect. A number of adjuvants and putative adjuvants (such as certain cytokines) share the ability to stimulate the immune system. The result of using an immunostimulating agent is an increased “alertness” of the immune system meaning that simultaneous or subsequent immunization with an immunogen induces a significantly more effective immune response compared to isolated use of the immunogen.
[0075] The term “animal” is in the present context in general intended to denote an animal species (preferably mammalian), such as Homo sapiens, Canis domesticus, etc. and not just one single animal. However, the term also denotes a population of such an animal species, since it is important that the individuals immunized according to the method disclosed herein substantially all will mount an immune response against the immunogen of the present invention.
[0076] As used herein, the term “antibody” refers to a polypeptide or group of polypeptides composed of at least one antibody combining site. An “antibody combining site” is the three-dimensional binding space with an internal surface shape and charge distribution complementary to the features of an epitope of an antigen, which allows a binding of the antibody with the antigen. “Antibody” includes, for example, vertebrate antibodies, hybrid antibodies, chimeric antibodies, humanised antibodies, altered antibodies, univalent antibodies, Fab proteins, and single domain antibodies.
[0077] “Specific binding” denotes binding between two substances which goes beyond binding of either substance to randomly chosen substances and also goes beyond simple association between substances that tend to aggregate because they share the same overall hydrophobicity or hydrophilicity. As such, specific binding usually involves a combination of electrostatic and other interactions between two conformationally complementary areas on the two substances, meaning that the substances can “recognize” each other in a complex mixture.
[0078] The term “vector” is used to refer to a carrier nucleic acid molecule into which a heterologous nucleic acid sequence can be inserted for introduction into a cell where it can be replicated and expressed. The term further denotes certain biological vehicles useful for the same purpose, e.g. viral vectors and phage—both these infectious agents are capable of introducing a heterologous nucleic acid sequence into cells.
[0079] The term “expression vector” refers to a vector containing a nucleic acid sequence coding for at least part of a gene product capable of being transcribed. In some cases, when the transcription product is an mRNA molecule, this is in turn translated into a protein, polypeptide, or peptide.
[0080] The term “expression system” denotes the combination of one or more cells/cell lines and one or more expression vectors, where the cells/cell lines can be transformed with the expression vectors and brought to produce an expression product encoded by the expression vectors.
[0081] A “glycan” is a carbohydrate or chain of carbohydrate which is linked to biomolecules (such as to lipids or proteins).
[0082] Glycobiology
[0083] Glycobiology is described as the biology, biosynthesis, structure and evolution of saccharides that are widely distributed in nature and of the proteins that recognize them. Saccharides are also called carbohydrates or sugar chains. All cells and numerous macromolecules in nature carry an array of covalently attached sugars or glycosidically linked sugar chains, which are referred to as “glycans”.
[0084] Common Monosaccharide Units of Glycoconjugates
[0085] Monosaccharides have been found in hundreds of different versions in nature. However, in common glycans the monosaccharide variation is limited to the saccharides mentioned in the following table:
TABLE-US-00002 Saccharides Explanation Example Pentoses Five-carbon neutral sugars D-xylose Hexoses Six-carbon neutral sugars D-glucose Hexosamines Hexoses with an amino group N-acetyl-D- at the 2-position, which can glucosamine be either free or N-acetylated 6-Deoxyhexoses L-fucose Uranic acids Hexoses with a carboxylate D-glucoronic acid group at the 6-position Nonulosonic Family of nine-carbon acidic Sialic acids acids sugars
[0086] Glycosidic Linkages
[0087] Monosaccharides are linked together via glycosidic bonds. The anomeric carbon of each saccharide is a stereocenter, which means that each glycosidic linkage can be constructed as either an α- or a β-linkage. Depending on which carbon atom in the sugar structure the binding occurs to, the name can be for example either Manα1,6 or Manα1,3, occurring on the 6.sup.th or the 3.sup.rd carbon atom respectively.
[0088] Glycan-Processing Enzymes
[0089] Generally, there are two groups of glycan-modifying enzymes the transferases and the glycosidases. The glycosyltransferases assemble branched and linear glycan chains and link monosaccharide moieties together. Glycosidases have the opposite effect; they degrade glycan structures, either for turnover of used glycans or as intermediates used as substrates in biosynthesis of glycans. The glycosyltransferases are generally specific in both donor and acceptor substrates. For example, the α2,3-sialyltransferase acts on β-linked galactose and the β1,4-galactosyltransferase acts on β-linked N-acetylglucosamine (GlcNAc).
[0090] Types of Glycosylation
[0091] Glycosylation is a broad term and covers several different types of oligosaccharides and linkages. Glycosylation is found in all domains of life, and they vary greatly in structure across these domains. Bacteria have glycans on their surface. The most recognized is lipopolysaccharide (LPS) also known as “endotoxin” that is found on the surface of the outer membrane of Gram-negative bacteria. Gram-positive bacteria have capsular polysaccharide among other glycans on their cell wall. Archaea also carry glycans on the surface layer of their cell wall and they can even carry out N-glycosylation of proteins. The glycosylation in eukaryotic cells is more extensively studied and the major glycan-categories in mammalian cells are Glycosphingolipids, Proteoglycans, N-linked glycans, and O-linked glycans. See
[0092] Glycolipids
[0093] Glycolipids are lipids with a glycan attached by a glycosidic bond. They are generally found on the extracellular surface of eukaryotic cell membranes. Here, they extend from the phospholipid bilayer and out into the extracellular space. Glycolipids maintain stability of the membrane and aid in cell-to-cell interactions. Furthermore, glycolipids can act as receptor for viruses and other pathogens to enter cells. Glycerolipids and sphingolipids are the two most common types of glycolipids.
[0094] Proteoglycans
[0095] Proteoglycans are heavily glycosylated proteins found on the extracellular side of animal cell membranes. Proteoglycans consists of a core protein and one or more covalently bound linear glycosaminoglycan chains. They fill out the space between cells in a multicellular organism and play significant roles in matrix assembly, modulation of cellular signals, and serve as a reservoir of biologically active small proteins such as growth factors.
[0096] O-Linked Glycosylation
[0097] The broad description of O-linked glycosylation is the attachment of a saccharide to an oxygen atom of an amino acid residue in a protein, most often serine and threonine. O-linked glycans are constructed by the addition of O—N-acetylgalactosamine12, O-fucose, O-glucose, O—N-acetylglucosamine or O-mannose. Hyper-O-glycosylation can result in the formation of mucin-type molecules that coat mucosal surfaces.
[0098] N-Linked Glycosylation
[0099] It is known that the structure, number, and location of N-glycans can affect the biologic activity, protein stability, clearance rate and immunogenicity of biotherapeutic proteins. N-linked glycans are most often found on cell surfaces and on secreted proteins. The N-glycosylation on proteins can occur on the amino acid sequence of a protein where an Asn precedes any amino acid but Pro, which is in turn followed by Ser or Thr. The common N-glycan “core” structure shared between all eukaryotic cells is Manα1-3(Manα1-6)Manβ1-4GlcNAcβ1-4GlcNAcβ1-Asn-X-Ser/Thr (cf.
[0100] N-Linked Glycan Nomenclature in this Application
[0101] Describing N-glycans in writing can cause some confusion. The level of necessary detail and information can vary between situations. Sometimes it is necessary to know each branching and linkage type, and sometimes it is only necessary to communicate whether a structure has e.g. four or five mannoses. There has been no consensus up until recently, and authors have either invented their own nomenclature or modified an existing one. To avoid confusion, the present application will use the “Oxford notation”, which is based on building up N-glycan structures. Therefore it can be used to denote very complex glycans. In brief, the notation is as follows:
[0102] All N-glycans have two core GlcNAcs; F at the start of the abbreviation indicates a core fucose; Mx, number(x) of mannose on core GlcNAcs; Ax, number of antenna (GlcNAc) on trimannosyl core; “A2”, biantennary with both GlcNAcs as alpha1-2 linked; Gx, number (x) of linked galactose on antenna; [3]G1 and [6]G1 indicates that the galactose is on the antenna of the alpha1-3 or alpha1-6 mannose; Sx, number (x) of sialicacids linked to galactose.
[0103] Examples of the most commonly occurring N-linked glycans in this application is given in
[0104] The Oxford nomenclature is relatively intuitive. The “core” consists of two GlcNAc residues and three mannose residues. The first GlcNAc is linked to the Asn amino acid by a β-linkage. The next GlcNAc is linked by β1,4-linkage to a mannose, followed by a β1,4-linked mannose. From here, the glycan structure branches and the two remaining mannoses are attached by either an α1,3-linkage or an α1,6-linkage. This core is ubiquitous in N-glycans and is named “M3”. If it has a core fucose it is called “FM3”. If the position is known, then it is written in parenthesis e.g. “F(6)M3” in the case where the fucose is α1,6-linked, “F(3)M3” in the case where the core fucose is α1,3-linked, or e.g. “F(3)F(6) M3” in the case where the core has both a α1,3-linked and a α1,6-linked fucose. Once the sugars are added to this core, the name depends on these. The core with one GlcNAc is called “A1”. If the position is known, then it is added in square brackets, e.g. “A1[3]” if the GlcNAc is on the α1,3-linked mannose branch. If the glycans fall into the “high-mannose” category, then some structures are “fixed” both structurally and nomenclature-wise, like “M5” and for others like “M6” the position of the added mannose residue can vary. There are names for complex tri- and tetra-antennary structures, where every linkage and position is defined. An example of a more complex structure is the “A2G(4)2S(3)1”, where the “A2” describes the two β1,2-linked GlcNAcs, the “G(4)2” describes the 2 galactoses that are both β1,4-linked (and not e.g. α1,3-linked), and the “S(3)1” describes one sialic acid linked by a α2,3-link. If the position was known, then it would be indicated with a “[3]” or “[6]” referring to the α1,3- or α1,6-linked mannose branch.
[0105] N-Glycan Synthesis
[0106] The category of N-glycan that is found on a protein depends on the organism, from which it originates. All N-glycans, whether in yeast, insect cells or mammalian cells, start out as the same structure in the endoplasmic reticulum lumen. N-glycan synthesis occurs in two steps. 1) Synthesis and transfer of a dolichol-linked precursor and 2) processing steps of the Glc3Man9GlcNAc2Asn glycan.
[0107] Synthesis and Transfer of the Dolichol-Linked Precursor
[0108] The first part of N-glycosylation of a protein is the construction of the Dolichol-precursor and the attachment of this to an asparagine residue of the protein. This is described in detail below.
[0109] Dolichol phosphate is located on the cytoplasmic side of the membrane of the endoplasmic reticulum (ER). Dolichol phosphate receives GlcNAc-1-P from UDP-GlcNAc to make Dol-P-P-GlcNAc, which is then extended to Dol-P-P-M5. At this point an enzyme called “flippase” flips the structure to the inside of the ER lumen and four Man residues from Dol-P-Man and three Glc residues from Dol-P-Glc are added. This oligosaccharide is transferred to the Asn residue of a protein within the sequon N-X-S/T by an oligosaccharyltransferase that covalently binds the glycan to the protein. See
[0110] Processing Steps of the M9Glc3 Glycan
[0111] Once the protein is equipped with the M9Glc3 glycan at the N-glycan sites, the processing starts. Common for most eukaryotic organisms is that the protein is folded and transported to the Golgi apparatus for further N-linked glycan processing. Depending on the organism there are different pathways and enzymes responsible for the final N-linked glycan structure. The initial de-glucosylation is carried out by α-glucosidase I, which removes the first α1,2-linked glucose residue. The next glucose is α1,3-linked and removed by α-glucosidase II. After removal of these two glucose residues the N-linked glycan processing pathway intersects with the protein quality control pathway to ensure proper folding of the newly synthesized proteins carrying M9Glc1. The quality control pathway is mainly mediated by the ER chaperones calnexin and calreticulin. These two chaperones require the presence of the α1,3-linked glucose residue to bind to the protein. As soon the last glucose residue is removed, the chaperones terminate their folding process. This step leaves either a correctly or incorrectly folded protein with M9. The incorrectly folded proteins are re-glucosylated by a glucosyltransferase resulting in a monoglucosylated form that can again bind to chaperones. If proper folding ultimately fails the protein is degraded in a separate ER compartment, the ER-associated degradation pathway (ERAD). Correctly folded glycoproteins are finally processed by a class I α-mannosidase which removes the α1,2-mannose on the B-branch. Now, the glycoprotein, which carries M8, is transported to the Golgi where the remaining glyco-processing takes place. The proteins are delivered to the cis-side of the Golgi and are modified as they move through the medial to the trans Golgi cisternae. The pathway from now on depends on whether the N-linked glycosylation is taking place in yeast, plants, insects or mammals (
[0112] This is where N-linked glycans are split up in “oligomannose”, “complex”, or “hybrid” as described in
[0113] The following abbreviations are used throughout the present application: [0114] α-gal: galactose-α1,3-galactose [0115] BEVS: Baculovirus Expression Vector System [0116] BHK21: Baby Hamster Kidney Cell [0117] Cas9: CRISPR Associated protein 9 [0118] CE: Capillary Electrophoresis [0119] CHO: Chinese Hamster Ovary Cells [0120] CLR: C-type Lectin Receptor [0121] ConA: Concanavalin A [0122] CRISPR: Clustered Regularly Interspaced Short Palindromic Repeats [0123] DC: Dendritic Cell [0124] DC-SIGN: Dendritic Cell Specific Intercellular adhesion molecule-3-Grabbing Non-integrin [0125] Ebola GP1: Ebola Glycoprotein 1 [0126] ESI: Electron spray ionization [0127] FAB: Fast atom bombardment [0128] Fab: Antigen binding fragment (of antibodies) [0129] Fc: Constant fragment (of antibodies) [0130] fdl: fused lobes gene [0131] FucT6: α1,6-fucosylatransferase gene [0132] fut11: α1,3-fucosylatransferase gene [0133] GalNAc: N-acetylgalactosamine [0134] GlcNAc: N-acetylglucosamine [0135] GlcNAcT I: N-acetylglucosaminyl transferase I gene [0136] GlcNAcT II: N-acetylglucosaminyl transferase II gene [0137] HA: hemagglutinin [0138] hEPO: human erythropoietin [0139] HER2: Human epidermal growth factor receptor 2 [0140] HILIC: Hydrophilic interaction chromatography [0141] HM: High-mannose [0142] ID1-ID2a: Interdomain 1-Interdomain 2a (of VAR2CSA). [0143] Indel: Insert/deletion [0144] LC-MS: Liquid Chromatography Mass Spectrometry [0145] LCA: Lens culinaris agglutinin [0146] LPS: Lipopolysaccharide [0147] M3 (or “Man.sub.3”): refers to the “core” structure of glycans [0148] mAb: monoclonal antibody [0149] MALDI-TOF: Matrix-assisted laser desorption/ionization Time of Flight [0150] MGAT4: N-acetylglucosaminyl transferase IV gene [0151] MGAT5: N-acetylglucosaminyl transferase V gene [0152] MHC: Major histocompatibility complex [0153] mo-DC: monocyte derived dendritic cell [0154] MPLA: Monophosphoryl lipid A [0155] MR: Mannose receptor [0156] MS: Mass spectrometry [0157] Neu5Gc: N-glycolylneuraminic acid [0158] NHEJ: Non-homologous end joining [0159] PAM: Protospacer Adjacent Motifs [0160] PM: Placental Malaria [0161] PRR: Pattern recognition receptors [0162] PTM: Post-translational modification [0163] QIT: Quadrupole Ion Trap [0164] S2: Drosophila melanogaster Schneider 2 cells [0165] S3: Drosophila melanogaster Schneider 3 cells [0166] SDS-PAGE: sodium dodecyl sulfate polyacrylamide gel electrophoresis [0167] SPR: Surface Plasmon Resonance [0168] TLR: Toll-like Receptor [0169] VAR2CSA: Receptor of malaria infected erythrocytes, which bind to placenta cells [0170] VLP: Virus-like particle [0171] WT: Wild-type
SPECIFIC EMBODIMENTS OF THE INVENTION
[0172] 1.sup.st Aspect and 2.sup.nd Aspect—the Genetically Modified Insect Cells of the Invention
[0173] Genetically modified insect cells disclosed herein are useful as organisms for producing polypeptides. The first aspect relates to an insect cell, wherein expression of the fdl gene has been disrupted, which has, as shown herein in the examples, the consequence that the FM3/M3 glycan structures are reduced in proportion on expressed protein. For the first aspect of the invention, it is hence preferred that the N-glycosylated protein produced by the cell of the first aspect exhibit less than 40% FM3/M3 glycan structures. Another consequence is that the cells attains FA1/A1 glycan structures, which are not found in the unmodified parent cells. Hence according to the present invention, it is preferred that the cell of the first aspect produces N-glycosylated protein comprising at least 2% FA1/A1 glycan structures, but it is—as shown herein—possible to obtain much higher amounts of FA1/A1 in protein produced by the cell: the cell of the first aspect preferably produces N-glycosylated protein comprising at least 5% FA1/A1 glycan structures, such as at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, and at least 55%. Percentages of about 55, 56, 57, 58, and 59 are preferred, if the no further modifications beyond disruption of fdl have been introduced.
[0174] A preferred version of the cell of the first aspect further comprises insertion of a functional GlcNAcT I gene and/or a functional GlcNAct II gene. This has the effect of further modifying the phenotype of the cell towards one exhibited by human cells, when it comes to N-glycosylation. Preferred cells of the first aspect are those that produce N-glycosylated protein comprising less than 15% (such as <14%, <13%, <12%, <11%, and <10%) FM3/M3 glycan structures (i.e. a further reduction than what the fdl disruption alone provides), less than 30% (such as <29%, <28%, <27%, <26%, <25%, <24%, and <23%) FA1/A1 glycan structures, and more than 50% (such as >51%, >51%, >53%, >54%, >55%, >56%, >57%, >58%, >59%, >60%, >61%, >62%, >63%, and >64%) FA2/A2 glycan structures. Particularly preferred cells produce N-glycosylated protein comprising 8-12% FM3/M3, 20-24% FA1/A1, and 62-66% FA2/A2 glycan structures, such as about 9.7 FM3/M3, about 22.5% FA1/A1, and about 64.5% FA2/A2.
[0175] In this context, the “fdl gene” is a term which also is meant to cover beta-hexosaminidase encoding genes in other insect cells than Drosophila melanogaster derived cells. In fact, the term “fdl gene” in the present context covers not only the gene in D. melanogaster, which encodes beta-hexosaminidase, but any equivalent gene encoding beta-hexosaminidase in other insect cells.
[0176] In the second aspect, the invention relates to a genetically modified insect cell where the expression of the FucT6 gene has been disrupted, which has the effect of blocking attachment of core α1,6-fucose to protein produced by the cells. In fact, it is preferred that the N-glycosylated protein produced by the cells of the second aspect comprises less than 2%, e.g. preferably 0%, core α1,6-fucose.
[0177] In this context, the “FucT6 gene” is a term which also is meant to cover alpha-(1,6)-fucosyltransferase encoding genes in other insect cells than Drosophila melanogaster derived cells. In fact, the term “FucT6 gene” in the present context covers not only the gene in D. melanogaster, which encodes alpha-(1,6)-fucosyltransferase, but any equivalent gene encoding alpha-(1,6)-fucosyltransferase in other insect cells.
[0178] In particular preferred embodiments of the invention, cells having the characteristics of both the first and second aspect are contemplated, i.e. insect cells with disruption of both the fdl gene and the FucT6 gene.
[0179] The insect cells of the both the first and second aspect (and their combination) can be selected from any insect cell useful for recombinant protein production. Preferred insect cells are selected from the group consisting of Drosophila Schneider's cells such as S2 and S3, Spodoptera frugiperda cells, such as Sf9 and derivates thereof (e.g. Mimic™ cells and ExpiSf9 cells) and Sf21, and Trichoplusia ni cells such as BTI-Tn-5B1-4 (High Five™ cells), and Tn-368. However, insect cells of particular interest are Drosophila cells, such as S2, S3 cell, and S2R+ cells.
[0180] As indicated in the examples, in order to further “humanize” the proteins produced by the insect cells of the 1.sup.st and 2.sup.nd aspects of the invention, they may further comprise introduction of a number of functional genes that express enzymes of importance for N-glycosylation. For instance, the cells may comprise a functional gene expressing a β-1,4-galactosyltransferase, and/or a functional gene expressing an α2,3-sialyltransferase and/or a functional gene expressing an α2,6-sialyltransferase and/or a functional gene expressing at least one sialic acid transporter protein and/or a functional Mgat4 gene and/or a functional Mgat5 gene. As indicated, each of these further genetic modifications can appear alone or in combination with any one of or more of the other modifications.
[0181] In addition to these modifications the cells of the first and second aspects can further include a heterologous polynucleotide which expresses a heterologous protein (such as an antibody or other therapeutically relevant compound), where the expression product of the heterologous protein can be N-glycosylated in a desired way due to the cell's modifications. In this context, cf. the description of expression systems below.
[0182] In some embodiments the cells of the first and second aspects are provided as a cell clone or cell line, comprising the cell.
[0183] For production purposes, it is advantageous that the genetically modified cell disclosed herein is stably transformed by having those nucleic acids that are introduced and which are disclosed above stably integrated into its genome, and in certain embodiments it is also preferred that the genetically modified cell secretes or carries on its surface the glycosylated heterologous polypeptide disclosed herein, since this facilitates recovery of the heterologous polypeptides produced.
[0184] As noted above, stably genetically modified cells are preferred—these i.a. allows that cell lines comprised of genetically modified cells as defined herein may be established—such cell lines are particularly preferred aspects of the invention.
[0185] Further details on cells and cell lines are presented in the following:
[0186] Techniques for recombinant gene production, introduction into a cell, and recombinant gene expression are well known in the art. Examples of such techniques are provided in references such as Ausubel, Current Protocols in Molecular Biology, John Wiley, 1987-2002, and Greene and Sambrook: “Molecular Cloning: A Laboratory Manual (Fourth Edition)”, Cold Spring Harbor Laboratory Press (ISBN-10: 9781936113422).
[0187] As used herein, the terms “cell”, “cell line,” and “cell culture” may be used interchangeably. All of these terms also include their progeny, which is any and all subsequent generations. It is understood that all progeny may not be identical due to deliberate or inadvertent mutations. In the context of expressing a heterologous nucleic acid sequence, “host cell” refers to a eukaryotic cell, and it includes any transformable organism that is capable of replicating a vector or expressing a heterologous gene encoded by a vector. A host cell can, and has been, used as a recipient for vectors or viruses. A host cell may be “transfected” or “transformed,” which refers to a process by which exogenous nucleic acid, such as a recombinant protein-encoding sequence, is transferred or introduced into the host cell. A genetically modified cell includes the primary subject cell and its progeny.
[0188] Host cells are in the present application of insect cell origin. Several cell lines and cultures are available for use as a host cell, and they can be obtained through the American Type Culture Collection (ATCC), which is an organization that serves as an archive for living cultures and genetic materials or from other depository institutions such as Deutsche Sammlung vor Micrroorganismen und Zellkulturen (DSM). An appropriate host can be determined by one of skill in the art based on the vector backbone and the desired result. A plasmid or cosmid, for example, can be introduced into a prokaryote host cell for replication of many vectors or expression of encoded proteins.
[0189] Some vectors may employ control sequences that allow it to be replicated and/or expressed in both prokaryotic and eukaryotic cells. One of skill in the art would further understand the conditions under which to incubate all of the above described host cells to maintain them and to permit replication of a vector. Also understood and known are techniques and conditions that would allow large-scale production of vectors, as well as production of the nucleic acids encoded by vectors and their cognate polypeptides, proteins, or peptides.
[0190] 3.sup.rd Aspect—Expression Systems
[0191] Numerous expression systems exist that comprise at least a part or all of the compositions discussed above. Eukaryote-based systems can be employed for use with the present invention to produce N-glycosylated polypeptides, proteins and peptides. Many such systems are commercially and widely available.
[0192] The insect cell/baculovirus system can produce a high level of protein expression of a heterologous nucleic acid segment, such as described in U.S. Pat. Nos. 5,871,986, 4,879,236, both herein incorporated by reference, and which can be bought, for example, under the name MAXBAC® 2.0 from INVITROGEN® and BACPACK™ Baculovirus expression system from CLONTECH®.
[0193] According to the invention, an expression system of the 3.sup.rd aspect comprises
[0194] 1) a genetically modified insect cell disclosed above or a cell clone or cell line comprising the modified insect cell, and
[0195] 2) an expression vector comprising the genetic elements necessary for effecting expression of a (heterologous) gene in said insect cell, where said gene has been inserted into said expression vector. In other words, the cells of the present invention can function together with appropriately selected expression vectors comprising a gene of interest, and any of a number of commercially available expression vectors can hence be used to transfect/transform the cells of the present invention to allow subsequent production and purification of the expression product from the gene of interest.
[0196] 4.sup.th Aspect—Protein/Polypeptide Production
[0197] In this method for producing an N-glycosylated polypeptide of interest, which comprises culturing a genetically modified insect cell of the invention or a cell clone or cell line comprising the insect cell, wherein said insect cell or a cell clone or cell line expresses a gene encoding said polypeptide, and subsequently isolating said polypeptide from the culture, any conventional culturing system and purification method can be used. For the provision of the recombinantly transfected cell, also any useful method for transfection of insect cells is applicable. Thus, in general the present invention provides for optimized insect cells that are useful in recombinant production of N-glycosylated protein which has a humanized or human-like N-glycosylation pattern.
[0198] Compositions Enabled by the Invention
[0199] Pharmaceutical compositions disclosed herein may either be prophylactic (i.e. suited to prevent disease) or therapeutic (i.e. to treat disease).
[0200] Such compositions typically comprise immunising N-glycosylated polypeptide(s), protein(s) or peptide(s), usually in combination with “pharmaceutically acceptable carriers”, which include any carrier that does not itself induce the production of antibodies harmful to the individual receiving the composition or targeting the protein/pathogen. Suitable carriers are typically large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, lipid aggregates (such as oil droplets or liposomes), and inactive virus particles.
[0201] Such carriers are well known to those of ordinary skill in the art. Additionally, these carriers may function as immunostimulating agents (“adjuvants”) in cases where this is relevant.
[0202] Pharmaceutical compositions typically will contain diluents, such as water, saline, glycerol, ethanol, etc. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such vehicles.
[0203] The compositions—since they contain pharmaceutically active polypeptides—are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection may also be prepared. The preparation also may be emulsified or encapsulated in liposomes for enhanced effect.
[0204] Compositions comprise an effective and pharmaceutically acceptable amount of polypeptides, as well as any other of the above-mentioned components, as needed. By “effective amount”, it is meant that the administration of that amount to an individual, either in a single dose or as part of a series, is effective for treatment or prevention as the case may be. This amount varies depending upon the health and physical condition of the individual to be treated, the taxonomic group of individuals to be treated (e.g. nonhuman primate, primate, etc.), the formulation of the active principle, the treating doctor's assessment of the medical situation, and other relevant factors. It is expected that the amount will fall in a relatively broad range that can be determined through routine trials. For administration of therapeutic (humanized) antibodies, the dosing range for humans is typically rather flexible—a review over rational dosing of therapeutic MAbs can be found in Bai S et al. (2012), Clin Pharmacokinet. 51(2): 199-135.
[0205] The compositions are conventionally administered parenterally, eg, by injection, either subcutaneously, intramuscularly, or transdermally/transcutaneously, intraveneously, intraarterially, intrathecally. Additional formulations suitable for other modes of administration include oral, pulmonary and nasal formulations, suppositories, and transdermal applications.
[0206] Dosage treatment may be a single dose schedule or a multiple dose schedule. The composition may be administered in conjunction with other agents such as immunoregulatory agents.
[0207] Pharmaceutical compositions comprise polypeptides/proteins whose production is disclosed herein. The pharmaceutical compositions will comprise a therapeutically effective amount thereof.
[0208] The term “therapeutically effective amount” or “prophylactically effective amount” as used herein refers to an amount of a therapeutic agent to treat, ameliorate, or prevent a desired disease or condition, or to exhibit a detectable therapeutic or preventative effect. The effect can be detected by, for example, chemical markers or antigen levels. Therapeutic effects also include reduction in physical symptoms, such as decreased body temperature. The precise effective amount for a subject will depend upon the subject's size and health, the nature and extent of the condition, and the therapeutics or combination of therapeutics selected for administration. Thus, it is not useful to specify an exact effective amount in advance. Reference is however made to the ranges for dosages of immunologically effective amounts of polypeptides, cf. above.
[0209] However, the effective amount for a given situation can be determined by routine experimentation and is within the judgement of the clinician.
[0210] Pharmaceutically acceptable salts can be used therein, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulphates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like. A thorough discussion of pharmaceutically acceptable excipients is available in Remington's Pharmaceutical Sciences (Mack Pub. Co., N. J. 1991).
[0211] Pharmaceutically acceptable carriers in therapeutic compositions may contain liquids such as water, saline, glycerol and ethanol. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such vehicles. Typically, the therapeutic compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection may also be prepared. Liposomes are included within the definition of a pharmaceutically acceptable carrier.
Example 1
[0212] Preparation of “Humanized” S2 Cell Lines
[0213] Plasmid Construction
[0214] The online E-CRISP tool (www.e-crisp.org; German Cancer Research Center) was used to identify CRISPR/Cas9 sequences within the Drosophila melanogaster genome that target fdl (UniProt: Q8WSF3) and FucT6 (UniProt: Q9VYV5). sgRNA target sequences were selected as 20 nt sequences preceding an NGG PAM sequence in the genome. The oligonucleotide pairs XX-F and XX-R were used to construct DNA fragments consisting of each targeting sequence with overhangs to enable their subcloning into pExpreS.sup.2-CRISPR (ExpreS.sup.2ion Biotechnologies, Hørsholm, Denmark).
[0215] The sequences of the synthetic oligos are as follows:
TABLE-US-00003 Name Sequence of oligo Fdl3-F TTCGCGGCGCAGCGATACAGCCA (SEQ ID NO: 1) Fdl3-R AACTGGCTGTATCGCTGCGCCGC (SEQ ID NO: 2) Fdl12-F TTCGCTGGGCCTTGGTGACTCCT (SEQ ID NO: 3) Fdl12-R AACAGGAGTCACCAAGGCCCAGC (SEQ ID NO: 4) FucT6_ TTCGTATCGCCGATCGAGTTGGCC 36-F (SEQ ID NO: 5) FucT6_ AACGGCCAACTCGATCGGCGATAC 36-R (SEQ ID NO: 6) FucT6_ TTCGAGTTAATTGAGACTATGCAC 71-F (SEQ ID NO: 7) FucT6_ AACGTGCATAGTCTCAATTAACTC 71-R (SEQ ID NO: 8) FucT6_ TTCGCAAGGAACGGGGCTCCGAAC 56-F (SEQ ID NO: 9) FucT6_ AACGTTCGGAGCCCCGTTCCTTGC 56-R (SEQ ID NO: 10)
[0216] N-acetylglucosaminyl transferases I and II were constructed by ordering Drosophila codon optimized GlcNAcT I (NP_525117, NCBI) and GlcNAcT II (GenBank: CAC83074.1) (GeneArt, ThermoFisher) and inserting them into the pExpreS2-PAC plasmid (ExpreS.sup.2ion Biotechnologies, Hørsholm, Denmark) using restriction enzymes EcoRI and NotI.
[0217] S2 Cell Culture, Transfection, and Cloning
[0218] ExpreS.sup.2 Cells (ExpreS.sup.2ion Biotechnologies, Hørsholm, Denmark), hereafter “S2 cells”, were routinely maintained at 25° C. and 130 rpm in suspension in 125 ml shake flasks (vented cap) in culture medium EX-CELL 420 Serum-Free Medium for Insect Cells (Sigma-Aldrich, cat. Nr. 14420C, Steinheim, Germany) supplemented with 100 units/mL penicillin and 0.1 mg/mL streptomycin (Pen-Strep Solution, Biological Industries, cat. 03-031B, Cromwell, Conn., USA), hereafter “culture medium”. The S2 cells were counted with a CASY® Cell Counter every 3-4 days and passaged by centrifugation or dilution to 8×10.sup.6 cells/ml.
[0219] For transfection, the S2 cells were passaged to 8×10.sup.6 cells/ml in shake flasks in culture medium and transfected the following day, by splitting the cells to 2×10.sup.6 cells/ml and mixing with first 50 μl ExpreS.sup.2 Insect-TRx5 (ExpreS.sup.2ion Biotechnologies, Hørsholm, Denmark) transfection reagent and second with 12.5 μg of plasmid DNA. The transfected cells were then transferred to a 25 cm.sup.2 tissue culture flask (In Vitro, Fredensborg, Denmark). A polyclonal cell line was selected herein for 21 days in culture medium supplemented with 10% fetal bovine serum (FBS) (Fischer Scientific, Roskilde, Denmark) and 1.5 mg/ml zeocin (Thermo Fisher, Hvidovre, Denmark) or 4.0 mg/ml geneticin (InvivoGen, Toulouse, France), by dilution to 1×10.sup.6 cells/ml every 3-4 days or whenever the cells reached a density higher than 1.5×10.sup.6 cells/ml.
[0220] For selection with puromycin (GlcNAcT I and GlcNAcT II), the cells were transfected and grown in a 50 ml vented Falcon Tube in 8 ml of culture medium. The cells were transfected by adding and swirling 100 μl ExpreS.sup.2 Insect-TRx5 Transfection Reagent and 20 μg of plasmid DNA. After 2-4 hours FBS was added to a concentration of 10%. Puromycin was added after 24 hours to a final concentration of 100 μg/ml. The cells were counted and split by centrifugation every 3-4 days in culture medium+10% FBS+100 μg/ml puromycin for 2 weeks. Hereafter the stable cell lines were transferred to a 125 ml shake flask and passaged as described previously.
[0221] Monoclonal cell lines were obtained by limited dilution in 96 well plates (In Vitro, cat. GR-655180, Fredensborg, Denmark) using non-transfected S2 feeder cells at 0.6×10.sup.6 cells/ml. Stably transfected polyclonal cells were seeded out at concentrations of 100 cells/mL, 30 cells/mL or 10 cells/mL. The total volume in wells was 150 μl culture medium supplemented with 10% fetal bovine serum and 1.5 mg/ml zeocin or 4.0 mg/ml geneticin. Over 2-3 weeks the 96-well plates were inspected regularly, and monoclonal cell lines were identified and expanded from 96 well plates to 250 mL shake flasks (Sigma-Aldrich, cat. CLS431255, St. Louis, Mo., USA).
[0222] For production of ID1-ID2a (Nielsen M A et al. (2015), PLoS ONE 10:1-12, doi:10.1371/journal.pone.0135406), the cells were expanded to a total volume of 2 L and grown in a 5 L Thomson Optimum Growth Flask (Thomson, Sittingbourne, England) and 200 μl/L PD30 was added. The cell culture supernatant was harvested by centrifugation at 4400 xG, filtered through a 0.22 μm filter, concentrated 1:4 times by tangential flow filtration, and exchanged into 20 mM Phosphate, pH 6.6, using a tangential flow filtration device (Pall, N.Y., USA). Protein purification of ID1-ID2a proceeded through ion exchange chromatography (HiTrap SP Sepharose FF, GE Healthcare Life Sciences) and was eluted step-wise (6%, 15%, and 22%) in 20 mM Phosphate and 1 M NaCl pH 6.6. The purified protein was diluted 1:4 in 20 mM Phosphate pH 7.0 and run on a HiTrap Capto adhere column (GE Healthcare Life Sciences, Brøndbyvester, Denmark) for removal of contaminants, and was eluted step-wise (13%, 30%, 80%) in 20 mM Phosphate, 1 M NaCl pH 7.0 and was aliquoted and then snap-frozen in liquid nitrogen and stored at −80° C.
[0223] Indel Detection by Amplicon Analysis (IDAA)
[0224] Genomic DNA was extracted using PureLink™ Genomic DNA Mini Kit (Fisher Scientific, cat. nr. K182001, Roskilde, Denmark). Primers were designed using the online prediction tool “Primer3”: FucT6 (F:TTCGCAAGGAACGGGGCTCCGAAC (SEQ ID NO:9), R:GCAAGGAACGGGGCTCCGAACGTT, (SEQ ID NO:11)). PCR was performed using Phusion High-Fidelity PCR kit (1×HF buffer, 0.2 mM dNTP, 0.25 U Phusion polymerase, 0.025 μM forward primer, 0.25 μM reverse primer and 0.25 μM 6-FAM 5′-labelled universal primer (Thermofisher, cat. nr. F553S, Hvidovre, Denmark)). The PCR-amplicons were analyzed by fragment length analysis (Eurofins, Glostrup, Denmark).
[0225] SDS-PAGE and Lectin Blotting
[0226] Supernatant samples were analyzed by SDS-PAGE and Western Blot analysis. Briefly, proteins were resolved by 10% SDS-PAGE and then transferred to a nitrocellulose membrane. Non-specific binding was blocked by incubating the membrane in Carbo-Free™ Blocking Solution (VectorLabs, Cat. No. SP-5040, Burlingame, Calif., USA) for 30 minutes at room temperature. Then the blot was incubated for 30 minutes in PBS with 10 μg/ml biotinylated lectin and washed in PBS+0.2% Tween 20™. The secondary antibody was HRP-conjugated Streptavidin (Fisher Scientific, Roskilde, Denmark) diluted 1:5000 for 45 min followed by a wash in PBS+0.2% Tween 20™. Novex® ECL (WP20005, Fisher Scientific, Roskilde, Denmark) was used for detection. Lectin used: for recognition of α1,6-fucose: Biotinylated Lens culinaris (LCA) from VectorLabs, Burlingame, Calif., USA.
[0227] Glycoprofiling
[0228] Glycoprofiling was performed as previously described in Grav L M et al. (2015), Biotechnology Journal 10:1446-56, doi:10.1002/biot.201500027. Briefly, supernatants were filtered and proteins contained in the sample were concentrated by centrifugation using Amicon Ultra columns (Merck Millipore, Merck KGaA, Darmstadt, Germany) with 3000 Da cutoff. N-glycans from retained proteins were released and fluorescently labeled with GlycoPrep Rapid N-Glycan kit (ProZyme Inc., Hayward, Calif.) or GlycoWorks RapiFluor-MS N-Glycan Kit (Waters, Elstree, UK). Labelled N-glycans were analyzed by LC-MS on a Thermo Ultimate 3000 HPLC with fluorescence detector coupled on-line to a Thermo Velos Pro Ion Trap MS. Glycan abundance was measured by integrating the areas under normalized fluorescence spectrum peaks with Xcalibur software (Thermo Fisher Scientific, Hvidovre, Denmark) giving the relative amount of the glycans. All annotated sugar structures are peaks with correct mass and at least a signal to noise value of 10:1 as calculated with Xcalibur.
[0229] Results
[0230] Initial Glycan Profiling and Glycan Consistency Test Showed Two Main N-Glycans
[0231] The work on a humanized glycan structure was carried out in a monoclonal S2 cell line that recombinantly expresses the placental malaria protein VAR2CSA truncation variant ID1-ID2a. VAR2CSA has been shown to bind to many cancer cell types and can reduce or clear the cancer cells efficiently in mouse models, when coupled to a toxin. One way to optimize this protein for future cancer therapy could be to reduce the immunogenicity by adding human-like glycans to it. Therefore, it was attempted to humanize the glycan structure on ID1-ID2a. The glycosylation of wild-type S2 cell expressed ID1-ID2a was analyzed on Liquid Chromatography-Mass Spectrometry (LC-MS) prior to any modifications and showed two main peaks of 36% M3 and 58% FM3 (
[0232] Next it was confirmed that the glycosylation profile did not change significantly under different growth conditions and purification protocols. Purified ID1-ID2a from production batches grown for three or four days, from shake flasks and bioreactors, and during different steps of the purification, was analyzed. The results (data not shown) were consistent: M3 with or without core fucose in an approximately 40:60 ratio, very similar to the profile seen in
[0233] Humanization: Disruption of fdl and Insertion of GlcNAcT I and GlcNAcT II
[0234] In an effort to achieve a more humanized glycan structure, disruption of fdl was aimed at. For this, two different target sgRNAs were chosen (cf. above under “plasmid construction”) and stable cell lines were established for both targets in parallel. One monoclonal cell line (henceforth called Δfdl) showed an increase of FA1/A1 from 0% to 58% on LC-MS (
[0235] The second step towards humanizing this cell line was to transfect it with GlcNAcT I and GlcNAcT II expression plasmids, which were responsible for attaching GlcNAcs to the mannose tree (Δfdl+ GlcNAcT I and GlcNAcT II ID1-ID2a). Purified ID1-ID2a from Δfdl+ GlcNAcT I and GlcNAcT II ID1-ID2a was analyzed on LC-MS (
[0236] In the WT ID1-ID2a cell line there was >97% FM3/M3 glycans. After disruption of fdl and re-cloning, there was a significant decrease from >97% FM3/M3 to <39% and an increase of FA1/A1 to 58%. According to a previously suggested glycosylation pathway in Sf9 insect cells it should only be necessary to insert the N-acetylglucosaminyl transferases II (GlcNAcT II), since the insect cells already harbor GlcNAcT I. Shi X and Jarvis D L (2013), Current Drug Targets 8:1116-25. However, since >38% FM3/M3 was observed after the disruption of fdl, both GlcNAcT I and GlcNAcT II were incorporated into the genome of this monoclonal cell line and re-cloned. Hereafter, <10% FM3/M3, <22% FA1/A1, and >64% FA2/A2 were found on purified ID1-ID2a as depicted in
[0237] This Δfdl+ GlcNAcT I and GlcNAcT II ID1-ID2a cell line is a solid foundation for building the next steps in constructing humanized glycosylation on ID1-ID2a.
[0238] Glycan Analysis by LC-MS of the Impact of the FucT6 Disruption
[0239] It was also of interest to construct a cell line that does not attach core α1,6-fucose to the glycan, as this allows production of antibodies with enhanced effector functions. In order to achieve this, the goal was to disrupt FucT6, which encodes an α1,6-fucosyltransferase. The work on disrupting the FucT6 gene was conducted in a wild type cell line (S2-WT). Three CRISPR/Cas9 sgRNA target sequences were designed for the disruption of the FucT6 gene (cf. above under “plasmid construction) and these were transfected in parallel in S2 cells to establish stable cell lines. All supernatant proteins, or the secretome, of S2-WT and the ΔFucT6 with a polyclonal disruption were analyzed on LC-MS (
[0240] In contrast to the fdl disruption in the WT-ID1-ID2a cell line described above, it was possible to see an effect of the disruption on a polyclonal level (
[0241] Other insect cell lines have been shown to carry core α1,3-linked fucose. To investigate if the cells had any α1,3-fucose in the glycan pool a Western Blot on the full secretome was carried out with an α1,3-fucose specific antibody, and a α1,3-fucose positive control: no such structures (data not shown) was detected. The monoclonal cell line with a disrupted FucT6 gene can now serve the basis of future antibody and Fc-fusion protein expression in S2 cells for instance in combination with the humanized glycomodifications discussed above.
DISCUSSION
[0242] Two new cell lines were constructed: 1) Partial humanization by disruption of fdl and insertion of GlcNAcT I and GlcNAcT II and 2) Disruption of the FucT6 gene to produce antibodies and Fc-fusion proteins.
[0243] The first glycan-modification we performed was disruption of fdl and insertion of GlcNAcT I and GlcNAcT II to achieve a more human-like glycosylation on ID1-ID2a. Previously, fdl has been inhibited by addition of GlcNAcase inhibitor (2-acetamido-1,2-dideoxynojirimycin), by RNA interference or by attempting to outcompete it by inserting glycosyltransferases. On a monoclonal level it was observed that the CRISPR/Cas9 editing of the fdl locus reduced or limited the FDL function. Although the disruption strategy worked, approximately 38% of the native FM3/M3 glycan structures remained on ID1-ID2a expressed in Δfdl (
[0244] Furthermore, after addition of GlcNAcT I and GlcNAcT II and after cloning, FA2/A2 was present >64% on purified ID1-ID2a. This appears to be the highest percentage FA2/A2 reported on any insect cell produced protein. The closest to a humanized structure reached in insect cell culture is that of Toth A M et al. (2014), Journal of Biotechnology 182-183:19-29. doi:10.1016/j.jbiotec.2014.04.011, who managed to achieve 39% terminally sialylated N-glycans on purified hEPO.
[0245] In an effort to humanize the N-glycosylation of S2 cells, Kim et al. (Kim Y K et al. (2011), Journal of Biotechnology 153:160-6, doi:10.1016/j.jbiotec.2011.02.009) RNAi suppressed fdl and inserted the β1,4-galactosyltransferase into the genome. In this cell line they reached small amounts of G2 on purified recombinant hEPO. Kim et all also found that by addition of β1,4-galactosyltransferase without the addition of GlcNAcT I and GlcNAcT II there was an increase in the level of G1 on hEPO (Kim Y K et al. (2009), Glycobiology 19:301-8, doi:10.1093/glycob/cwn138). We only found these glycan structures present on ID1-ID2a after insertion of GlcNAcT I and GlcNAcT II and cloning. This could both be due to differences in glycosylation sites in the recombinant proteins and differences in the S2 cell lines as these adapt, grow and glycosylate differently over time in different laboratories. The glycan profile for the Δfdl+ GlcNAcT I and GlcNAcT II ID1-ID2a cell line also included small amounts of a glycan with m/z: 1203.5. This mass corresponds to a FG2 with a glycolyl deoxynonulosonate on the one branch. This has not previously been reported in S2 cells or other insect cells.
[0246] It is contemplated that the next steps for modification of this cell line towards an even more human-like glycan structure will be introduction of a gene expressing a β1,4-galactosyltransferase. Furthermore, after obtaining a G2 glycan structure, it then follows to additionally introduce genes expressing α2,3-sialyltransferase and α2,6-sialyltransferase, and sialic acid transporter proteins, to achieve fully humanized glycan structures. It could also be of value to express Mgat4 and Mgat5 to make tri- and tetra-antennary structures. However, it is expected that glycans of >64% FA2/A2 will induce immunological advantages in a mouse cancer model and increase serum half-life compared to native ID1-ID2a.
[0247] The second modification performed was the disruption of the FucT6 gene. The FucT6 gene was successfully disrupted in a WT S2 cell line by the use of CRISPR/Cas9. The polyclonal pool showed an effect and the analyzed clone showed 100% absence of α1,6-fucose. Some insect cell lines, such as the High Five cell line, are known to express the immunogenic α1,3-fucose. Even though small amounts of di-fucosylated glycans have been detected and even less with only the α1,3-fucose in the Drosophila embryo, no 1,3-fucose or double-fucosylated glycans was detected in the WT-S2 cells or the ΔFucT6 clone upon western blot analysis with an α1,3-fucose specific antibody.
[0248] It does not appear that a disruption of FucT6 in S2 cells or in other insect cell lines has been published; this unique cell line creates a strong foundation for the expression of antibodies in S2 cells and for expressing Fc-fusion proteins due to the enhanced effector functions that the fucose-lacking glycan structures facilitate.
Example 2
[0249] G2F Cell Line (Biantennary Galactose)
[0250] S2 cells transfected with ExpreS2 vector harboring gene encoding Cas9 and guide RNA targeting fdl (knockout of β-N-acetylhexosaminidase, G418 selection), genes encoding N-acetylglucosaminyltransferase I and N-acetylglucosaminyltransferase II (Drosophila Mgat1 and Mgat2, puromycin selection). This polyclonal cell line has been cloned by serial dilution resulting in cell line with ca 65% biantennary GlcNAcs (G0, data already submitted for initial filing).
[0251] This monoclonal cell line was transfected with bovine β-1,4-galactosyltransferase 1 from Bos indicus (B4GT1, accession number XP_019821962) and the one from human (B4GalT1, NP_001488) where CTS (cytoplasmic/transmembrane/stem) domain was exchanged for the one of human FUT7 gene CTS (Genbank accession number NP_004470, amino acids 1-48) as done by Geisler et al. (2014) in ‘Engineering β-1,4-galactosyltransferase I to reduce secretion and enhance N-glycan elongation in insect cells’. This has shown shift of the enzyme being present in pellet instead of supernatant (anti human galactosyl transferase Western blot,
TABLE-US-00004 TABLE 1 list of samples in blot in FIG. 10. Expression kDa 1 Ladder 2 B4GT1_bovin, pExpreS2-blast Transient Sup. Cleaved (CAT 31.4 only) 3 Transient Pellet Uncleaved 44.8 4 FUT7(CTS)-B4GT1_bovin(CAT), pExpreS2- Transient Sup. Cleaved (CAT 31.4 Blast only) 5 Transient Pellet Uncleaved 37.0 6 Ladder 7 B4GalT1_human, pExpreS2-Blast Transient Sup. Cleaved (CAT 31.4 only) 8 Transient Pellet Uncleaved 43.9 9 FUT7(CTS)-B4GalT1_human(CAT), Transient Sup. Cleaved (CAT 31.4 pExpreS2-Blast only) 10 Transient Pellet Uncleaved 36.9 11 12 13 WT (no GalT) — Sup. Control 14 — Pellet Control
[0252] For detection of galactose we used Ricinus Communis lectin (RCA I, Vector Biolabs) that is specific to galactose. We also used EX-CELL® Glycosylation Adjust (Gal+) protein quality supplement to increase occupancy of galactoses (the producer does not specify what is inside the supplement). In
TABLE-US-00005 TABLE 2 List of samples in lectin blot in FIG. 11. Expression Additive 1 Ladder — — 2 S2 WT — — 3 G0 negative control Stable, (passaged as for monoclonal transient transf.) 4 GFP transfection control Transient — 5 B4GT1_bovin Transient 6 B4GT1_bovin Transient +Glycosylation Adjust 7 FUT7(CTS)- Transient B4GalT1_human(CAT) 8 FUT7(CTS)- Transient +Glycosylation Adjust B4GalT1_human(CAT)
TABLE-US-00006 TABLE 3 List of samples from lectin blot from FIG. 13. Expression Additive 1 FUT7(CTS)-B4GT1_bovine(CAT), Transient in G0 monoclone — pExpreS2-Blast 2 Ladder — 3 FUT7(CTS)-B4GT1_bovine(CAT), Stable In Δfdl clone 1 — pExpreS2-1 Mgat1 + Mgat2, pExpreS2-PAC 4 FUT7(CTS)-B4GT1_bovine(CAT), Stable In Δfdl clone 6 — pExpreS2-1 Mgat1 + Mgat2, pExpreS2-PAC 5 FUT7(CTS)-B4GT1_bovine(CAT), Stable In Δfdl clone 1 — pExpreS2-1 Mgat1, pExpreS2-PAC Mgat2, pExpreS2-PAC 6 FUT7(CTS)-B4GT1_bovine(CAT), Stable In Δfdl clone 6 — pExpreS2-1 Mgat1, pExpreS2-PAC Mgat2, pExpreS2-PAC 7 FUT7(CTS)-B4GT1_bovine(CAT), Stable In Δfdl clone 1 +Glycosylation Adjust pExpreS2-1 Mgat1 + Mgat2, pExpreS2-PAC 8 FUT7(CTS)-B4GT1_bovine(CAT), Stable In Δfdl clone 6 +Glycosylation Adjust pExpreS2-1 Mgat1 + Mgat2, pExpreS2-PAC 9 FUT7(CTS)-B4GT1_bovine(CAT), Stable In Δfdl clone 1 +Glycosylation Adjust pExpreS2-1 Mgat1, pExpreS2-PAC Mgat2, pExpreS2-PAC 10 FUT7(CTS)-B4GT1_bovine(CAT), Stable In Δfdl clone 6 +Glycosylation Adjust pExpreS2-1 Mgat1, pExpreS2-PAC Mgat2, pExpreS2-PAC