Alginate chitosan nanoformulation of OmpA—a <i>Shigella </i>protein subunit

Abstract

Provided herein is a Formulation of OmpA including a) OmpA protein as active molecule obtained as a product of OmpA gene inserted in a plasmid comprising a novel set of forward and reverse primer set, and b) Alginate chitosan nanoparticles as vehicle.

Claims

1. An oral formulation of outer membrane protein A (OmpA) comprising essentially of: a) OmpA protein as an active molecule, obtained as a product of an OmpA gene derived from Shigella flexneri 2a 2457T, inserted in a plasmid comprising a set of a forward and a reverse primer set; and b) Alginate chitosan nanoparticles as a vehicle; wherein the formulation has a particle diameter in a range of 240 nm to 700 nm; wherein the formula is administered orally; wherein the formulation has a mean particle size of 535.0 nm, a particle size distribution of 0.470 and a zeta potential of −20.78; wherein the forward primer has a nucleotide sequence 5′-AAAAAGACACATATG CG ATT GCAG-3′ (SEQ ID NO: 1) and the reverse primer has a nucleotide sequence 5′-GTATCTCGAGAGCTTGCGCTGAGTTAC-3′ (SEQ ID NO: 2); and, wherein bases “CATATG” in the forward primer represents restriction site specific for NcoI and the bases “CTCGAG” in the reverse primer represents restriction site specific for XhoI.

2. A method of preparation of an oral formulation of an outer membrane protein A (OmpA), the method comprising the steps: a) preparing a recombinant plasmid comprising an OmpA forward primer having a nucleotide sequence 5′-AAAAAGACACATATG CG ATT GCAG-3′ (SEQ ID NO: 1) and an OmpA reverse primer having a nucleotide sequence 5′-GTATCTCGAGAGCTTGCGCTGAGTTAC-3′ (SEQ ID NO: 2) wherein the bases “CATATG” in the forward primer represents restriction site specific for NcoI and the bases “CTCGAG” in the reverse primer represents restriction site specific for XhoI; b) transferring the recombinant plasmid to E. coli BL21 (DE3) for multiplication; c) isolating OmpA protein as a product from the E. coli BL21 (DE3); d) preparing chitosan with alginate nanoparticles; and e) loading OmpA protein into said chitosan with alginate nanoparticles; wherein the formulation has a particle diameter in a range of 240 nm to 700 nm; wherein the OmpA is derived from Shigella flexneri 2a 2457T; wherein the formulation is configured for an oral administration; and wherein the formulation has a mena particle size of 535.9 nm, a particle size distribution of 0.470 and a zeta potential of −20.78.

3. The method as claimed in claim 2, wherein preparing the plasmid is performed by common restriction sites specific to restriction enzymes NcoI and XhoI.

4. The method as claimed in claim 2, wherein preparing the plasmid is performed through ligation of the plasmid and said primers by mixing the plasmid and primers in a molar ratio of 1:3.

5. The method as claimed in claim 2, wherein isolating OmpA protein as a product from the E. coli BL21 (DE3) is performed in the mid log phase of said bacteria.

6. The method as claimed in claim 2, wherein preparing chitosan nanoparticles comprises the steps of: a) preparing a chitosan solution by dissolving chitosan in 1% (v/v) acetic acid solution at a concentration of 2 mg/ml; b) preparing an anionic tripolyphosphate (TPP) solution by dissolving TPP in distilled water at a concentration of 1 mg/ml; c) adding the TPP solution into the chitosan solution dropwise at 1:2 ratio; d) forming chitosan colloid nanoparticles under mild agitation in room temperature condition; e) formulating colloid chitosan nanoparticles at room temperature during centrifugation at 35,000 rpm for 1 hr.; f) discarding supernatant and re-dispersing deposit in distilled water to obtain chitosan nanoparticles.

7. The method as claimed in claim 2, wherein loading the OmpA protein into said chitosan with alginate nanoparticles comprises the steps of: a) redispersing a colloid of said chitosan nanoparticles in 25 ml of distilled water at a concentration of 2 mg/mL under continuous ultrasonication to disaggregate the nanoparticles; b) loading OmpA protein subunit into the chitosan nanoparticles by incubating OmpA protein obtained as a product from the E. coli BL21 (DE3) with said nanoparticles under mild agitation for 15 minutes at room temperature condition to make final concentration of OmpA protein 1 mg/mL; c) adding dropwise OmpA-loaded chitosan nanoparticles suspensions with pH 5.1 into sodium alginate solution at a concentration of 1 mg/mL under mild agitation at pH 7 for 10-20 minutes; d) centrifuging the resulting suspension at 3400 rpm for 5 minutes and discarding the supernatant to obtain alginate coated chitosan nanoparticles; and e) redispersing alginate coated chitosan nanoparticles into an aqueous solution of calcium chloride (CaCl.sub.2) at a concentration of 0.524 mmol/L to crosslink the alginate layer present on the surface of chitosan nanoparticles.

Description

BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS

(1) FIG. 1 Illustrates TEM image of chitosan Nano particle.

(2) FIGS. 2A-2B illustrate TEM image of OmpA coated with chitosan and alginate.

(3) FIG. 3 Illustrates intensity distribution of A) Chitosan, B) Chitosan with alginate, C) OmpA loaded chitosan with alginate (CAOP), D) Alginate.

(4) FIG. 4 Illustrates Serum immunoglobulin titers in immunized sera were measured against OmpA protein of Shigella sp.

(5) FIG. 5 Illustrates agarose gel electrophoresis M-Marker, 1-pET28a plasmid, 2-pET28a plasmid with OmpA gene.

(6) FIG. 6 Illustrates western blotting with anti his-tagged antibody. M-Protein pre-stained molecular weight marker, 1-BL21 E. coli containing OmpA without IPTG, 2-BL21 E. coli containing OmpA induced by IPTG

(7) FIG. 7 Illustrates SDS-PAGE of OmpA. M-Marker, 1-Whole cell lysate of BL21 E. coli containing OmpA without IPTG, 2-Whole cell lysate of BL21 E. coli containing OmpA induced by IPTG, 3-In Supernatant, 4-In pellet as inclusion body, 5-In Wash buffer no protein, 6-purified fraction of OmpA in Elution buffer

(8) FIG. 8 Illustrates western blot analysis of recombinant OmpA of S. flexneri 2a with antisera from CAOP immunized mice with the whole-cell lysate of Shigella lane 1. S. dysenteriae 1Δstx NT4907, lane 2. S. boydii type 4 BCH612, lane 3. S. sonnei IDH00968, lane 4. S. flexneri 2a 2457T, lane 5. S. flexneri 3a C519, and lane 6. S. flexneri 6 C347.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

(9) This according to the invention is provided a formulation for immunogen delivery system and a process for the preparation thereof.

(10) In accordance with this invention, a novel formulation for immunogen delivery method has been developed by using chitosan alginate nano formulation with OmpA protein (CAOP) of Shigella sp. and the protective efficacy and immunogenicity of CAOP against homologous as well as heterologous Shigella strains in animal model has been studied. Also the duration of protection offered by CAOP has been studied.

(11) Sodium-alginate and chitosan both are extensively used in encapsulation of drug for the purpose of sustained release. These are polysaccharide polymers, formed of repeating units joined together by glycosidic bond. Both polymers have the properties of an ideal carrier for drug delivery, such as biocompatibility, biodegradability, non-toxicity, and low cost. Thus the formulation prepared from chitosan alginate nanoparticle will effectively deliver the OmpA in the gut epithelia. The controlled release of OmpA from the said nanoformulations could maintain steadier levels of this protein in bloodstream for longer durations.

(12) Chitosan nanoparticles are prepared by the ionic gelation of Chitosan Solution with anionic tripolyphosphate (TPP). Briefly, chitosan was dissolved in 1% (v/v) acetic acid aqueous solution at concentration of 2 mg/ml. Then, TPP was dissolved in distilled water at the concentration of 1 mg/ml. Subsequently, TPP solution was added drop wise into chitosan solution at 1:2 ratio. Chitosan colloid nano-particles formed spontaneously under mild agitation at room temperature. Two hours later, chitosan colloid nano particles was centrifuged at 35,000 rpm for 1 hr. Then, the supernatant was discarded and the deposit was re-dispersed in distilled water.

(13) After the preparation of chitosan nanoparticle, it is loaded with OmpA.

(14) The loading of OmpA procedure has been given below:

(15) Colloid chitosan nanoparticles were then re-dispersed in 25 ml of distilled water at concentration of 2 mg/ml under continuous ultrasonication to disaggregate the chitosan nano particles. The loading procedure was performed by incubating OmpA with chitosan nano particles under mild agitation at room temperature for 15 min so that final concentration of OmpA protein 1 mg/ml.

(16) Preparation of alginate coated chitosan nano particles:

(17) OmpA loaded chitosan nanoparticles suspensions with pH value at 5.1 were added drop wisely into sodium alginate solution (pH=7.2) at concentration of 1 mg/ml under mild agitation for 10 min. Then the suspension was centrifuged at 3,400 rpm for 5 min, and the supernatant was discarded.

(18) Finally, alginate coated chitosan nano particles were re-dispersed into calcium chloride (CaCl.sub.2) aqueous solution (pH=7.0) at concentration of 0.524 mmol/L to crosslink the alginate layer presents on the surface of chitosan nano particles.

(19) The final formulation of OmpA loaded chitosan alginate is clearly disclosed in accordance with FIG. 2.

(20) FIG. 3 illustrates the intensity distribution of a) chitosan, b) chitosan with alginate, c) OmpA loaded chitosan with alginate (CAOP) d) Alginate.

(21) The cloning of OmpA protein has been given below:

(22) a) Sequence of OmpA gene:

(23) The ompA gene was searched out from NCBI genome sequence of Shigella flexneri 2a 2457T. This sequence was used for designing of primers required for cloning.

(24) The sequence was used for designing of primers required for cloning. The primers are designed from the upstream and downstream sequence of ompA gene using commercially available primer designing software. Two novel restriction sites were introduced in the primers.

(25) The unique primer sequence is as below with underlined restriction digestion site. Forward primer contains same sequence while reverse contains the complementary sequence.

(26) The primers are given as below:

(27) b) Primer designing:

(28) The primers were designed by IDT software. They are as follows,

(29) OmpA forward primer (NcoI):

(30) TABLE-US-00002 5′,-AAAAAGACACATATG CG ATT GCAG-3′,

(31) OmpA reverse primer (XhoI):

(32) TABLE-US-00003 5′-GTATCTCGAGAGCTTGCGCTGAGTTAC-3′

(33) Internal primers:

(34) TABLE-US-00004 5′-ACC AGG TTA ACC CGT ATG TTG GCT TTG-3′ 5′-TGT TGA GTA CGC GAT CAC TCC TGA AAT C-3′ 5′-GTT CAA CTT CAA CAA AGC AAC CCT GAA AC-3′ 5′-TCG GAC AGA CCC TGG TTG TAA G-3′ 5′-AGC TGG AGC CGG AGC AAC TAC TGG-3′ 5′-CTG AGC TTT GTA TGC ACC GTT TTC AA-3′

(35) Template DNA was prepared from Shigella flexneri 2a 2457t. Genes were amplified by PCR. PCR amplified product was resolved by electrophoresis and analyzed.

(36) d) Vector preparation:

(37) Plasmid pET28a was isolated and digested with NcoI and XhoI restriction enzyme.

(38) Template DNA was prepared from Shigella flexneri 2a 2457t. Genes were amplified by PCR using the primers for 30 cycles. PCR amplified product was resolved in 1% agarose gel by electrophoresis and analyzed using Gel-Doc (Bio-Rad). PCR products were purified and digested with XhoI. Now vector plasmid pET28a was isolated and digested with NcoI and XhoI restriction enzyme.

(39) e) Ligation:

(40) Vector and insert was used for ligation. Insert part contains two overhang with those two restriction enzyme site. Now ligation was performed. Vector and insert was mixed with a molar ratio of 1:3 for ligation. The ligated construct was transformed into E. coli BL21 (DE3). The positively cloned cells were selected by using ampicilin as a selective marker. The selected cells were confirmed further by colony PCR by using the forward and reverse primers. The colonies containing the recombinant plasmid was identified and confirmed by DNA sequencing.

(41) Recombinant protein was purified by Ni-NTA (nickel-nitrilotriacetic acid) affinity chromatography. After induction, recombinant cells were lysed by lysis buffer (composition: Benzonase, PMSF, EDTA Free Protease inhibitor cocktail, Triton X 100, Lysozyme, Benzamidine, Glycerol, Tris-HCl pH 7.5, NaCl, (3-marcaptoethanol), centrifuged at 7,000 g for 15 mins at 4° C. Now, pellet was collected and mixed with solubilization buffer (composition: Tris-HCl pH 7.5, NaCl, (3-marcaptoethanol, Urea 8 M, Imidazole). Ni-NTA resin with solubilization buffer was loaded on the column and finally the purified protein was eluted using elution buffer (Tris-HCl pH 7.5, NaCl, βmarcaptoethanol, Imidazole 500 mM) after washing with wash buffer (Tris-HCl pH 7.5, NaCl,β marcaptoethanol, Imidazole 30 Mm and 50 mM). The affinity purified fraction was dialysed in the buffer 100 mM Tris-HCl (pH-7.5)-150 mM NaCl. The expression and purity of the recombinant protein was confirmed by running on 10% SDS-PAGE.

(42) The overexpression has been performed by the below method:

(43) The recombinant BL21 (DE3) E. coli containing the OmpA gene was grown on 5 ml LB broth containing ampicillin and incubated overnight at 37° C. An aliquot of the overnight cell culture was added into another LB medium (containing 100 μg/ml ampicillin) and grown to mid log phase and incubated at 37° C. with shaking (200 rpm). Once an optical density at 600 nm of the cultures reached 0.4-0.6 (mid log), cells were induced with 0.1 mM isopropyl thiogalactoside (IPTG) in one test tube while other was not induced. Next these two were subjected to SDS-PAGE followed by western blot with anti-His antibody which confirms overexpression of OmpA protein.

(44) The sequence of OMPA gene of Shigella flexneri 2a 2457T has been given below:

(45) TABLE-US-00005    1 atgaaaaagacagctatcgcgattgcagtggcactggctggtttcgctaccgtagcgcag   61 gccgctccgaaagataacacctggtacactggtgctaaactgggctggtcccagtaccat  121 gacactggttttattcctaacaatggtccgacccacgaaaaccaactgggtgcaggtgct  181 tttggtggttaccaggttaacccgtatgttggttttgaaatgggttacgactggttaggt  241 cgtatgccgtacaaaggcgacaacatcaacggcgcatacaaagctcagggcgttcagctg  301 accgctaaactgggttacccaatcactgacgatctggacatctacactcgtctgggtggt  361 atggtatggcgtgcagacaccaaggctaacgtacctggtggcgcatcctttaaagaccac  421 gacactggcgtttctccggttttcgcaggtggtgttgagtacgcgatcactcctgaaatc  481 gctacccgtctggaataccagtggaccaacaacatcggtgacgcaaacaccatcggtact  541 cgtccggacaacggtctgctgagcctgggtgtttcctaccgtttcggtcagggcgaagca  601 gctccggtagttgctccagctccggcaccggaagtacagaccaagcacttcactctgaag  661 tctgacgttctgttcaacttcaacaaagcaaccctgaaaccggaaggtcaggctgctctg  721 gatcagctgtacagccagctgagcaacctagatccgaaagacggttccgtagttgttctg  781 ggttacactgaccgcatcggttctgacgcttacaaccagggtctgtccgagcgccgtgct  841 cagtctgttgttgattacctgatctccaaaggtatcccggcagacaagatctccgcacgt  901 ggtatgggcgaatccaacccggttactggcaacacctgtgacaacgtgaaacagcgtgct  961 gcactgatcgactgcttggctccggatcgtcgcgtagagatcgaagttaaaggtatcaaa 1021 gacgttgtaactcagccgcaggcttaa

(46) Various experiments have done for the novel formulation as claimed hereafter. The detailing of the experiments and data associated with those have been discussed below:

(47) The morphological characteristics of nano particles were examined by transmission electron microscopy. The particle size distribution will detected by Dynamic light scattering. These measurements were run at least three times with independent particle batches.

(48) FIG. 3 depicts the intensity distribution curves for A) Chitosan, B) Chitosan with alginate C) OmpA loaded chitosan with alginate (CAOP) and D) alginates.

(49) According to FIG. 1, FIG. 2 and FIG. 2a, TEM images have shown the morphological properties and surface appearance of nano particles. The chitosan nano particles have nearly spherical shape and size range of about 50-350 nm whereas size range of CAOP particles are 240-700 nm.

(50) The respective average diameters, measured by Zetasizer, of chitosan nano particles and OmpA-loaded nano particles were approximately 240 nm and 535 nm. The PDI value of chitosan nanoparticles was 0.256 while that of OmpA-loaded chitosan nano particles was 0.199, thus indicating a narrow and favorable particle size distribution (PDI<0.5) (Table 1).

(51) Morphological characterization, size and surface charge:

(52) In present study the results obtained by Zetasizer revealed that the OmpA—loaded nano particles are larger than the chitosan-TPP ones, possibly due to the coating of alginate, high molecular weight and large size of the OmpA protein molecules.

(53) The table 1 is provided which illustrates the size, PDI and zeta potential of different chitosan and alginate samples:

(54) TABLE-US-00006 TABLE 1 MEAN PARTICLES SAMPLE SIZE (NM) PDI ZETA POTENTIAL Chitosan 136.0 nm 0.385 +32.70 Chitosan with 249.2 nm 0.260 −40.54 alginate OMPA loaded 535.9 nm 0.470 −20.78 chitosan with alginate Alginate 327.9 nm 0.331 −45.47

(55) The effectiveness of the novel formulation as claimed herein after is illustrated with foregoing example:

(56) Swiss male and female mice, six to seven weeks old, were taken from animal resource department of NICED. Mice were caged separately and maintained at 25° C. with 75% humidity and fed sterile food and water under the care of full time staff and in accordance with the rules of the institutional animal ethical committee (IAEC) (Apro/77/24/11/2O10, Reg. No. NICED/CPCSEA (AW) 215/2009-2015).

(57) Female mice were immunized orally at days 0, 7, and 14 with 50 μg per 100 μl of purified OmpA coated with chitosan-alginate (CAOP) using the concentration. Fifteen minutes before the oral immunization; each mouse was anaesthetized by intramuscular injection of a mixture of ketamine (35 mg kg.sup.−1 body weight; Sterfil Laboratories Pvt. Ltd, India) and xylazine (5 mg kg.sup.−1 body weight, AstraZeneca Pharma India Ltd, India). CAOP was introduced directly into the stomach through a mouse feeding needle (Harvard Instrument, USA). The same volume of PBS was given by oral administration to the non-immunized group. All immunized and non-immunized group of mice were returned to their cages and given limited amounts of sterile food and water.

(58) Infectious dose determination for challenge:

(59) The infectious dose and the challenge dose of each strain were listed in table 2. The ID.sub.50 was considered to be the dose which ensured ˜10.sup.6-10.sup.7 bacteria per gram of intestine of the challenged neonates, after six hour incubation in 3 to 4 days old suckling mice.

(60) TABLE-US-00007 TABLE 2 ID.sub.50 and challenge dose of Shigella strains INFECTIOUS DOSE.sub.50 CHALLENGE DOSE STRAIN (ID.sub.50) (×10.sup.8 ML.sup.1) (×10.sup.9 ML.sup.1) S. dysenteriae 1 (NT4907) 1 ± 0.241 5 ± 0.356 S. flexneri 2a (2457T) 3 ± 0.151 4 ± 0.158 S. sonnei (IDHO0968) 1 ± 0.275 5 ± 0.141 Values are means ± SEM of three independent experiments.

(61) Death or visible side effects due to toxicity (such as ruffled fur or lethargy or diarrhea or weight loss) did not occur in mice after three successive oral immunizations with 50 μg of purified OmpA coated with chitosan-alginate (CAOP). A significant level of protection after both first and second challenge studies were achieved in newborn mice of immunized dams. Most of the suckling mice from non-immunized mother became sick and eventually died between 10 and 16 hr of incubation (Table 4). More or less same results were obtained after both challenge studies. Control mice from non-immunized groups showed higher intestinal colonization (˜10.sup.7 CFU/gm of intestine) leading to Shigellosis. Dead mice from immunized groups showed colonization ˜10.sup.5 CFU/gm of intestine which was 100 fold lower than the rate of intestinal colonization in control mice (˜10.sup.7 CFU/gm of intestine) and alive neonates showed even lesser intestinal colonization (˜10.sup.3 CFU/gm of intestine). CAOP conferred 100% protection against S. flexneri 2a after both challenge studies. Protective efficacies against S. dysenteriae 1 and S. sonnei, (Table 3) were above 75%. The above results suggest CAOP immunization could confer 83-100% passive protection against shigellosis in neonatal mice model.

(62) Protective Efficacy Against Shigellosis to the Neonatal Mice:

(63) The aim of our study is to develop an oral subunit vaccine with Shigella protein OmpA coated with chitosan-alginate. We used female mice model to measure the protective efficacy and to study the immune responses that are elicited following disease or immunization. Two groups of mice (Immunized and Control, weighing between 25 g) were selected for oral immunization with Shigella protein OmpA coated with chitosan-alginate. Each group contained 10 mice. The immunization experiment was done according to the method of Sack et al (1988) and the challenge experiment was done according to the method of Fernandez et al. (2003).

(64) 100% homologous protection was observed against virulent wild serotype while in average 75% was achieved in heterologous protection challenged by S. dysenteriael (NT4907) and S. sonnei (IDH00968). High reciprocal increase of serum lgG antibody titer was observed during the period of immunization.

(65) Immunoblot data of whole cell lysate (WCL) also supported strong homologous protection as well as heterologous protection against CAOP immunization.

(66) TABLE-US-00008 TABLE 3 First and second challenge study in suckling mice from immunized mother % O OF PROTECTIVE % OF PROTECTIVE NO. OF SURVIVAL EFFICACY SURVIVAL EFFICACY A NEONATES IN AFTER L % L AFTER AFTER (% L AFTER CHALLENGED EXPERIMENTAL EACH FIRST FIRST SECOND SECOND STRAIN GROUP GROUP CHALLENGE CHALLENGE CHALLENGE CHALLENGE S. dysenteriae Control 10 10 (1/10) 77.78 20 (2/10) 77.78 1 (NT4907) Immunized 10 80 (8/10) 90 (9/10) S. flexneri Control 10 10 (1/10) 100 10 (1/10) 100 2a (2457T) Immunized 20 100 (20/20) 100 (10/10) S. sonnei Control 10 10 (1/10) 88.89 20 (2/10) 77.78 (IDH00968) Immunized 10 90 (9/10) 90 (9/10) .sup.aProtective efficacy was calculated as {[(percent deaths of non-immunized mice) − (percent deaths of immunized mice)] ÷ [percent deaths of non-immunized mice]} × 100.
M. ELISA:

(67) Blood was collected at days 0, 7, 14, 28, 35, 56, 72 and 120, after the first oral immunization. The collected blood was allowed to clot at room temperature (RT) for 30 min and serum was isolated by removing the blood clot with a sterile toothpick, followed by centrifugation (91 g, 10 min and 4° C.). After adding sodium azide (final concentration 0.05%), the sera were stored at −80° C. (Schild et al., 2008) until use. IgG (whole molecule) response in immunized and non-immunized sera were measured by ELISA, essentially following the method developed by Keren (1979). Disposable polystyrene (Nunc, Denmark) microtiter wells were coated with 100 μL of CAOP and incubated for 18 h at 4° C. Wells were washed three times with PBS (pH 7.4). Nonspecific binding sites were blocked by incubating the wells with 200 uL of 5% bovine serum albumin (BSA; Sigma Chemical) for 2 h at 37° C. The wells were washed three times with PBS-T (PBS with 0.5% Tween-20) and incubated with serially diluted serum samples at 37° C. for 1″ h. Following washing, 100 μL HRP-conjugated goat anti-mouse immunoglobulin (Sigma Chemical) was added to each well and the plate was incubated at 37° C. After washing with PBS, the substrate o-phenyl-D-amine (OPD) was added to each well. The reaction was stopped after 10 min by adding 100 μL of 2 N Sulphuric acids and the reading was taken at 492±2 nm wave length using an ELISA reader. The experiments were repeated three times with the immunized and non-immunized serum, collected from individual mice, before, during and after the immunization period.

(68) FIG. 4 illustrates these test results clearly with the help of a graph.

Western Blot Analysis

(69) Whole cell lysates (WCL) of six virulent strain of Shigella sp, S. dysenteriae 1Δstx NT4907, S. boydii type 4 BCH612, S. sonnei IDH00968, S. flexneri 2a 2457T, S. flexneri 3a C519, S. flexneri 6 C347 were resolved by SDS-PAGE followed by immunoblot using alkaline phosphatase conjugated lgG (whole-molecule), according to the protocol described previously.

(70) Immunoblot by anti-CAOP sera against WCL (FIG. 9) demonstrated that CAOP antiserum cross reacted with the whole cell lysates of S. dysenteriae 1Δstx NT4907, S. boydii type 4 BCH612, S. sonnei IDH00968, S. flexneri 2a 2457T. S. flexneri 3a C519, S. flexneri 6 C347. The recombinant protein also showed reactivity with mouse antisera produced by challenged with whole cell virulent S. flexneri 2a suggesting the strong immunogenicity of the recombinant OmpA. This also proved that the antigenicity of the protein is maintained. As chromosomally encoded OmpA protein is conserved among Shigella strains and E. coli strains it will give heterologous protection against not only Shigella species but also against pathogenic E. coli strains.

(71) The novel formulation helps to protect the protein from acid barrier of stomach and chitosan being mucoadhesive can adhere with the mucus membrane and increase the bioavailability of the protein.

(72) Hence, this innovative formulation provides substantially higher immunogenicity and protective efficacy than that of OmpA protein itself.