Lettuce Plant Resistant to Downy Mildew and Resistance Gene

Abstract

Provided herein is a lettuce plant that is resistant to downy mildew, more specifically a lettuce plant that includes a mutated gene that confers broad spectrum resistance to oomycetes in lettuce, more specifically Bremia lactucae. Furthermore also provided herein are a resistance gene and a method for obtaining a lettuce plant that is resistant to downy mildew, wherein the method includes the step of mutating a gene.

Claims

1. A lettuce plant that is resistant to downy mildew, comprising one or more mutations in a SL7 gene, wherein said SL7 gene encodes for a protein having the sequence of SEQ ID No. 2 or having at least 90% sequence identity with SEQ ID No. 2, wherein the one or more mutations in the SL7 gene result in an amino acid substitution at position 38 in the SL7 protein represented by SEQ ID No.2.

2. The lettuce plant according to claim 1, wherein the one or more mutations in the SL7 gene result in amino acid substitutions in the region comprising amino acid positions 6 to 142 in the SL7 protein represented by SEQ ID No.2.

3. The lettuce plant according to claim 1, wherein the one or more mutations in the SL7 gene further result in an amino acid substitution at position 11 in the SL7 protein represented by SEQ ID No.2.

4. The lettuce plant according to claim 1, wherein the one or more mutations in the SL7 gene further result in an amino acid substitution at position 40 in the SL7 protein represented by SEQ ID No.2, preferably K40T.

5. The lettuce plant according to claim 1, wherein the one or more mutations in the SL7 gene additionally result in an amino acid substitution at position 48 in the SL7 protein represented by SEQ ID No.2.

6. The lettuce plant according to claim 1, wherein the one or more mutations in the SL7 gene additionally result in an amino acid substitution at position 61 in the SL7 protein represented by SEQ ID No.2, preferably T61S.

7. The lettuce plant according to claim 1, wherein the one or more mutations in the SL7 gene additionally result in an amino acid substitution at position 69 in the SL7 protein represented by SEQ ID No.2.

8. The lettuce plant according to claim 1, wherein the one or more mutations in the SL7 gene additionally result in an amino acid substitution at position 84 in the SL7 protein represented by SEQ ID No.2.

9. The lettuce plant according to claim 1, wherein the one or more mutations in the SL7 gene additionally result in an amino acid substitution at position 91 in the SL7 protein represented by SEQ ID No.2.

10. The lettuce plant according to claim 1, wherein the one or more mutations in the SL7 gene additionally result in an amino acid substitution at position 129 in the SL7 protein represented by SEQ ID No.2.

11. The lettuce plant according to claim 1, wherein the one or more mutations in the SL7 gene further result in amino acid substitutions at position 11, 40, and 84 in the SL7 protein represented by SEQ ID No.2.

12. The lettuce plant according to claim 1, wherein the one or more mutations in the SL7 gene result in amino acid substitutions at positions 11, 38, 40, 48, 61, 69, 84, 91 and 129 in the SL7 protein represented by SEQ ID No.2.

13. The lettuce plant according to claim 1, wherein the SL7 gene that comprises one or more mutations encodes for a protein having the sequence of SEQ ID No. 4.

14. The lettuce plant according to claim 1, wherein the lettuce plant is selected from Lactuca sativa, Lactuca virosa, Lactuca saligna, Lactuca serriola, Lactuca aculeate, Lactuca georgica, Lactuca perennis, Lactuca tatarica, and Lactuca viminea.

15. The lettuce plant according to claim 1, wherein downy mildew is caused by Bremia lactucae.

16. The lettuce plant according to claim 1, wherein the lettuce plant is resistant to downy mildew caused by one or more of Bremia lactucae selected from races Bl17, Bl18, Bl22, Bl24 to Bl26, Bl28 to Bl35.

17. The lettuce plant according to claim 1, wherein the plant comprises an SL7R gene having the nucleotide sequence of SEQ ID No. 3.

18. Seed produced by a lettuce plant according to claim 1, wherein the seed comprises the SL7 gene.

19. (canceled)

20. (canceled)

21. (canceled)

22. (canceled)

23. A method for obtaining a lettuce plant that is resistant to downy mildew, comprising the steps of, a) crossing a first lettuce plant comprising a resistance gene SL7R having the nucleotide sequence of SEQ ID No. 3 with a second lettuce plant that does not comprise said SL7R gene, thereby producing a first offspring plant b) optionally, selfing the offspring plant obtained in step a) for at least one time, thereby producing a second offspring plant c) selecting one or more first and/or second offspring plants that are resistant to downy mildew.

24. (canceled)

25. (canceled)

26. (canceled)

27. (canceled)

28. (canceled)

29. (canceled)

30. (canceled)

31. The method according to claim 23, wherein the first and/or second lettuce plant is selected from Lactuca sativa, Lactuca virosa, Lactuca saligna, Lactuca serriola, Lactuca aculeate, Lactuca georgica, Lactuca perennis, Lactuca tatarica, and Lactuca viminea.

32. (canceled)

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0047] The present invention will be further detailed in the following examples and figures wherein:

[0048] FIG. 1: shows the number (#) of leaves of Lettuce (Y-axis) that are resistant or susceptible to Bremia lactucae after VIGS silencing of either SL7R (by 1A and 1B), or gene Lsa042767 (by 2A or 2B) (X-axis). The SL7R gene has been silenced in these plants using VIGS gene silencing and subsequently infected with Bremia lactucae (Bl30). On the x-axis from left to right: sample leaves of plants in which the SL7R gene is silenced using silencing construct 1A or 1B, sample leaves of plants in which gene Lsa042767 is silenced using silencing construct 2A or 2B, sample leaves of plants in which PDS is silenced, sample leaves of plants of susceptible parent R273. In the samples with a resistant phenotype, there is no Bremia present. In the samples with susceptible phenotypes, Bremia is present. As expected with transient gene silencing, VIGS gene silencing does not result in fully 100% silencing of the SL7R gene in all plants. However, the leaves from plants wherein the resistance gene has been silenced by VIGS silencing, showed a higher number of susceptible leaves when infected with Bremia as compared to plants where the SL7R gene was not silenced. Indeed no susceptible leaves were observed when SL7R expression was not affected by VIGS.

[0049] FIG. 2: shows quantification of Bremia actin in Lettuce after VIGS gene silencing. In case SL7R gene expression levels were VIGS silenced in lettuce infected with Bremia (Bl30), expression levels of Bremia actin increased dramatically. The Bremia expression levels in the leaves of plants that showed to be resistant or susceptible to downy mildew after gene silencing, were collected and RNA was isolated to determine the expression levels of Bremia by qPCR. The transcription levels of Bremia lactuca was determined by the transcripts of a Bremia house keeping gene (actin) in relation to the lettuce house keeping gene TUA-3 in a set of leave samples of Lettuce plants of the experiment of FIG. 1. Leaves of the plant that were susceptible to Bremia lactucae, showed high transcriptional levels of the Bremia lactucae house keeping gene actin, indicating the susceptibility corresponds with low SL7R gene expression due to VIGS silencing.

[0050] FIG. 3: shows SL7R expression levels in SL7R VIGS silenced lettuce lines infected with Bremia (Bl30), determined by qPCR. The transcription levels of Bremia lactuca was determined by the transcripts of a Bremia house keeping gene (actin) in relation to the lettuce house keeping gene TUA-3 of Bremia lactucae were determined in leave samples of L. sativa plants of the experiment of FIG. 1. Leaves of the plants that were resistant to Bremia lactucae showed to have a high SL7R gene expression and low transcriptional levels of the Bremia lactucae house keeping gene. Leaves of the plant that were susceptible to Bremia lactucae, showed low SL7R gene expression (because of VIGS silencing the gene) and high transcriptional levels of the Bremia lactucae house keeping gene, indicating the susceptibility corresponds with low SL7R gene expression.

[0051] FIG. 4: shows an overview of the disease test performed with the most recent isolates of Bremia Bl16 to Bl35 on L. sativa lines Cobham Green R273, Green Towers, Vanity and SL7R. SL7R is a lettuce plant (L. sativa) of present invention comprising the SL7R resistance gene. The plant of present invention shows to be resistant to most downy mildew isolates, with the exception of Bremia lactucae Bl16, Bl20, Bl21, Bl23, and Bl27.

[0052] FIG. 5: shows the alignment of the amino acid sequence region of 1 to 150 amino acids, including the LLR region (amino acid 6 to 147) and the single LRR domain (amino acid 26 to 72) of SL7 (SEQ ID No.2) and the SL7R (SEQ ID No.4) protein. The mutations between the two protein sequences have been indicated in the boxed areas. The SL7R protein comprises amino acid substitutions at position 11 (T.fwdarw.R), 38 (S.fwdarw.N), 40 (K.fwdarw.T), 48 (S.fwdarw.N), 61 (T.fwdarw.S), 69 (I.fwdarw.V), 84 (C.fwdarw.R), 91 (D.fwdarw.N) and 129 (V.fwdarw.I).

[0053] FIG. 6: shows the cDNA sequence (SEQ ID No. 1) encoded by the SL7 gene of Lactuca sativa.

[0054] FIG. 7: shows the protein sequence (SEQ ID No. 2) encoded by the SL7 gene of Lactuca sativa.

[0055] FIG. 8: shows the cDNA sequence (SEQ ID No. 3) encoded by the SL7R gene of Lactuca saligna.

[0056] FIG. 9: shows the protein sequence (SEQ ID No. 4) encoded by the SL7R gene of Lactuca saligna.

DETAILED DESCRIPTION

Examples

[0057] Gene Mapping SL7 Resistance Gene in L. saligna

[0058] Gene mapping experiments were done to identify the of the Bremia (Bremia lactucae) resistance gene SL7R from Lactuca saligna. SL7R was originally isolated from L. saligna lettuce accession LAC0364. A dominant resistance gene was mapped on chromosome 3, Lettuce genome V8. The SL7R resistance gene is the first Bremia resistance gene described and mapped on chromosome 3 in Lettuce.

[0059] After fine mapping 12000 plants two putative genes were present. The SL7R region is currently flanked by two markers based on a SNP at position V8_3_200695773 and a SNP at position V8_3_200770104. The two candidate genes are designates as Lsa011563 and Lsa042767. VIGS silencing was used to silence both genes independently in a resistant source (L. saligna), see below. These experiments indicated that when resistance gene Lsa011563 was silenced the plants became susceptible after Bremia infection, whereas when gene Lsa042767 was silenced, the plants remained resistant. This confirms that the Lsa011563 gene provide the plant resistance against Bremia. This resistance gene is renamed to the resistance gene SL7R of present invention.

Construction of SL7 Construct and Transformation into Lettuce (L. saligna).

[0060] After gene mapping two candidate resistance genes were found and designated as Lsa011563 (=SL7R) and Lsa042767. To identify which gene (or both) are responsible for the observed resistance, VIGS silencing can be used to silence both genes independently in the resistant source L. saligna. Therefore, two VIGS-constructs were made per gene, for Lsa011563 (=SL7) (1A and 1B) and for Lsa042767 (2A and 2B) and cloned in the K20 vector (See Table 1 for sequences, respectively SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8). Thus two SL7R specific VIGS constructs were made (1A and 1B) and two construct that target a different gene Lsa042767 (2A, 2B) can be used as a negative control. The multiple constructs of above were transformed into lettuce (L. sativa) using co-cultivation with agrobacterium (GV3101) to study the SL7R function. The two resistance candidate genes are individual silenced in VIGS independent experiments. With the leaves of VIGS-experiments independent disease tests (see below) were performed to observe that when SL7R was silenced, plants became susceptible to Bremia.

TABLE-US-00001 TABLE 1 VIGS-constructs Sequence Lsa011563_1A TTCATGTAGCTTCTTCAGTCACCATGTTGGAAATAGGTAATATT (SEQ ID No. 5) TCAGGGCTTAATGATGAACTGTGGAGAAGTGCTTTCAAGTATCT TGGGAAACTTGAAAAGTTATACATTCGTGGGTGTAATGAAATAA GATATTTGTGGCAATCAGAAGTAGAGGCAAGTAAGTCTCTAGTG AATTTAAGGAATTTGGATGTGAGTGATTGTTCAAATCTGGTGGG TTTAGGAGAGAAAGTGGAGGATAACTCTGGAAGCATCCAGACGT TTATTAGGATGTTGTCTATAGCACGTTGTGAGA Lsa011563_1B TGAGTTACCTTGGAATAGGAGGATTGAAGAAGCCCATCTCAGAG (SEQ ID No. 6) TGGGGCCCACAGAATTTCCCAACCTCACTCGAGCACTTAATGTT AAATGGCGGAATATATGATGATGTGAAAAACTTTGATCAATTGT CGCATCTTTTTCCTTCATCTCTTGCTTCTCTTTCGATAACGGGA TTTCAGAAACTTGAATCAGTTTCATTGGGACTCCAAAACCTCAC CTTTCTCCAGCGTCTCTCTGTTTCCAAGTGCCCAAAGATGTTAC ATCTACCAGAAAAGTTGCTTCCTTCGCTTTTGTCTTTGAG Lsa042767_2A GTGGAGATCAAGCTGGATTATAAGAAGGATTTGTTTGATGGGAA  (SEQ ID No. 7) GAGGAATATTGTCACGGCGGAGGAGATAGAGAGCGGGATAAGGC  GGCTGATGGAGGATGACGATGTAAGAGAAAAGATAAAAGAGATG GGGAAAAAGAGCAAAGCGACTGTTAAAGAGGGAGGTTCGTCTTA CGCTTCT Lsa042767_2B CACATTCTTGGAATTAGAAACACGCCCAATCGAGTCGTTGTCTA  (SEQ ID No. 8) CCGACAGCAGGATACCGTCTGTGTATCCGGTAGGACCTGTACTG  AACCTAGAAGACGGTGCCGGAACACCGCCGGAAAGTGACGTCAT CAGCTGGTTGGACAATCAACCACCTTCCTCGGTTGTTTTCTTGT GTTTTGGGAGTCTGGGATGTTTTGATGAAGTCCAAGTGAAGGAG ATTGCATATGCTTTAGAGCGAAGCGGGCGTTCTTTCTTGTGGTC ACTAC

SL7R Gene Silencing Experiment Using Virus Induced Gene Silencing (VIGS)

[0061] Tobacco rattle virus (TRV)-derived VIGS vectors have been abundantly described to study gene function in Arabidopsis thaliana, Nicotiana benthamiana, Solanum esculentum and other plants (see for example Huang C, Qian Y, Li Z, Zhou X.: Virus-induced gene silencing and its application in plant functional genomics. Sci China Life Sci. 2012; 55(2):99-108).

[0062] Briefly, Lettuce containing SL7 were silenced for SL7R by VIGS. Independent of SL7R silencing the PDS gene is silenced as well that serves as positive control to indicate if VIGS is working and to determine the efficiency. PDS is involved in carotenoid biosynthesis and is the first step in lycopene biosynthesis. This step is catalyzed by phytoene desaturase (PDS). When silencing of the PDS gene is achieved, this results in bleached leaves.

[0063] Furthermore, all plants that were SL7R-VIGS inoculated were harvested and put in a tray and sprayed with Bremia to test the effect of the gene silencing on disease resistance.

Disease Test and Biotest for Downy Mildew in Lettuce

[0064] Leaves of resistant plants transiently transformed with the above described VIGS constructs (1A, 1B, 2A, 2B and PDS), were put in trays with moistened paperboard and infected with Bremia race 30. The infected seedlings are suspended in 20 mL water, filtered by cheesecloth and the flow-through is collected in a spray flask. One tray is spray-inoculated with the Bremia lactucae suspension. The trays are covered with a glass plate and stored in a climate chamber at 15° C. (12 hours of light). A black, opaque foil is placed over the trays for one day to improve growth of B. lactucae. After one day, the foil is removed. Experiments were performed in triple, and eight to ten days after infection leaves are phenotypically scored by eye on the presence of Bremia, i.e. being susceptible or resistant (FIG. 1).

[0065] Disease resistance tests show that resistance gene SL7R provides resistance to most Bremia races from Bl:15 to Bl:35, with the exceptions being Bl:16, BL20, Bl21, Bl23, and Bl:27. Furthermore a qPCR was performed to determine SL7R expression.

[0066] A single gene line comprising the SL7R gene used internally to test Bremia diagnostic samples is R290. Seeds of this line are deposited at NCIMB (NCIMB Limited, Ferguson Building; Craibstone Estate, Bucksburn ABERDEEN, Scotland, AB21 9YA United Kingdom) on 12 Jul. 2017 under the number NCIMB 42785.

Determine Bremia Expression in Lettuce Comprising the SL7R Gene

[0067] A number of gene expression experiments were conducted in lettuce tissues obtained from the VIGS experiment as outlined above, to determine SL7R expression. The response of lettuce leaves to Bremia lactucae infection was examined and gene expression studies were used to assess VIGS analysis.

[0068] To obtain more insight in the response of lettuce to infection with Bremia, leaves of resistant and susceptible plants were harvested. cDNA was synthesized from RNA that had been isolated from infected leaves. The expression of SL7R was assessed in lettuce by conducting qPCR. Expression of Bremia lactucae actin and expression of SL7R were analyzed by qPCR using the primers as set out in Table 2. (SEQ ID No.9, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12, SEQ ID No.13, and SEQ ID No.14, respectively).

TABLE-US-00002 TABLE 2 Primer name Sequence SL7QPCR-F 5′-TCCAAGTATTGATGCCTCCTT-3′ (SEQ ID No. 9) SL7QPCR-R 5′-CACTCTGAGATGGGCTTCTTC-3′ SEQ ID No. 10) B. lactucae 5′-GCGAGAAATTGTGCGTGATA-3′ actin Fwd (SEQ ID No. 11 B. lactucae 5′-ACTCGGCTGCAGTCTTCATT-3′ actin Rv (SEQ ID No. 12) LsTUA-3F 5′-CTTCTTAGTGTTCAATGCTGTTGG-3′ (SEQ ID No. 13) LsTUA-3R 5′-GAAGGGTAGATAGTGAAACCGAGC-3′ (SEQ ID No. 14)

[0069] FIG. 2 shows the results of a qPCR of housekeeping gene Bremia actin. Values on the y-axis are CT values (the fold increase is calculated as 2{circumflex over ( )}−(Ct Bremia actin−Ct TUA3A). On the x-axis from left to right: sample leaf of a plant in which PDS is silenced, sample leaves of plants of susceptible parent R273, sample leaves of plants in which the SL7R gene is silenced using silencing construct 1B, sample leaves of plants in which the SL7R gene is silenced using silencing construct 2B. In the samples with a resistant (R) phenotype, there is no or almost no Bremia present. In the samples with susceptible (S) phenotypes, high transcription levels of the housekeeping gene Bremia actin were measured.

[0070] In addition, FIG. 3 shows that in leaves of the plants that are resistant to Bremia, little to no Bremia was detected and that the level of SL7R expression was very high. The leaves that originate from plants that are susceptible to Bremia, showed the opposite pattern, a high level of Bremia and low levels of SL7R expression.