TRANSPOSASE WITH ENHANCED INSERTION SITE SELECTION PROPERTIES

Abstract

The present invention relates to a polypeptide comprising a transposase and at least one heterologous chromatin reader element (CRE). Further, the present invention relates to a polynucleotide encoding the polypeptide. Furthermore, the present invention relates to a vector comprising the polynucleotide. In addition, the present invention relates to a kit comprising a transposase and at least one heterologous chromatin reader element (CRE).

Claims

1. A polypeptide comprising a transposase or a fragment or a derivative thereof having transposase function and at least one heterologous chromatin reader element (CRE).

2-3. (canceled)

4. The polypeptide of claim 1, wherein the at least one heterologous CRE is a chromatin reader domain (CRD).

5. The polypeptide of claim 4, wherein the at least one heterologous CRD is a naturally occurring CRD recognizing histone methylation degree and/or acetylation state of histones.

6. (canceled)

7. The polypeptide of claim 5, wherein the naturally occurring CRD recognising histone methylation degree is a plant homeodomain (PHD) type zinc finger, or the naturally occurring CRD regonizing the acetylation state of histones is a bromodomain.

8. The polypeptide of claim 7, wherein the PHD type zinc finger is a transcription initiation factor TFIID subunit 3 PHD, or the bromodomain is a histone acetyltransferese KAT2A domain.

9. The polypeptide of claim 8, wherein the transcription initiation factor TFIID subunit 3 PHD has an amino acid sequence according to SEQ ID NO: 20, or the histone acetyltransferase KAT2A domain has an amino acid sequence according to SEQ ID No. 21.

10-12. (canceled)

13. The polypeptide of claim 1, wherein the CRE is an artificial CRE recognizing histone tails with specific methylated and/or acetylated sites.

14. (canceled)

15. The polypeptide of claim 13, wherein the artificial CRE is selected from the group consisting of a micro antibody, a single chain antibody, an antibody fragment, an affibody, an affilin, an anticalin, an atrimer, a DARPin, a FN2 scaffold, a fynomer, and a Kunitz domain.

16. The polypeptide of claim 1, wherein the transposase is selected from the group consisting of a wild-type PiggyBac transposase, a hyperactive PiggyBac transposase, a wild-type PiggyBac-like transposase, a hyperactive PiggyBac-like transposase, a sleeping beauty transposase, and a Tol2 transposase.

17-19. (canceled)

20. A polynucleotide encoding the polypeptide of claim 1.

21. A vector comprising the polynucleotide of claim 20.

22. A method for producing a transgenic cell comprising the steps of: (i) providing a cell, and (ii) introducing a transposable element comprising at least one polynucleotide of interest, and a polypeptide of claim 1 into the cell, thereby producing the transgenic cell.

23-25. (canceled)

26. The method of claim 22, wherein the transposable element comprises terminal repeats (TRs) and wherein the at least one polynucleotide of interest is flanked by these TRs.

27. (canceled)

28. The method of claim 22, wherein the transposable element is a DNA transposable element, or a retrotransposable element.

29. The method of claim 28, wherein the DNA transposable element comprises inverted terminal repeats (ITRs), or the retrotransposable element is a long terminal repeat (LTR) retrotransposable element.

30-32. (canceled)

33. The method of claim 22, wherein the cell is a eukaryotic cell.

34-35. (canceled)

36. The method of claim 22, wherein the at least one polynucleotide of interest is selected from the group consisting of a polynucleotide encoding a polypeptide, a non-coding polynucleotide, a polynucleotide comprising a promoter sequence, a polynucleotide encoding a mRNA, a polynucleotide encoding a tag, and a viral polynucleotide.

37-38. (canceled)

39. A kit comprising (i) a transposable element comprising a cloning site for inserting at least one polynucleotide of interest, and (ii) a polypeptide of claim 1.

40-50. (canceled)

51. A targeting system comprising (i) a transposable element comprising at least one polynucleotide of interest, and (ii) a polypeptide of claim 1.

52-54. (canceled)

55. A method for producing a transgenic cell comprising the steps of: providing a cell, and (ii) introducing a transposable element comprising at least one polynucleotide of interest, and a polynucleotide of claim 20 into the cell, thereby producing the transgenic cell.

56. A method for producing a transgenic cell comprising the steps of: (i) providing a cell, and (ii) introducing a transposable element comprising at least one polynucleotide of interest, and a vector of claim 21 into the cell, thereby producing the transgenic cell.

57. A kit comprising (i) a transposable element comprising a cloning site for inserting at least one polynucleotide of interest, and (ii) a polynucleotide of claim 20.

58. A kit comprising (i) a transposable element comprising a cloning site for inserting at least one polynucleotide of interest, and (ii) a vector of claim 21.

59. A kit comprising (i) a transposable element comprising a cloning site for inserting at least one polynucleotide of interest, and (ii) at least one heterologous CRE and a polypeptide comprising a transposase or a fragment or a derivative thereof having transposase function.

60. A targeting system comprising (i) a transposable element comprising at least one polynucleotide of interest, and (ii) a polynucleotide of claim 20.

61. A targeting system comprising (i) a transposable element comprising at least one polynucleotide of interest, and (ii) a vector of claim 21.

62. A targeting system comprising (i) a transposable element comprising at least one polynucleotide of interest, (ii) at least one heterologous CRE, optionally associated with the transposable element, and (iii) a polypeptide comprising a transposase or a fragment or a derivative thereof having transposase function.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0158] The following Figures and examples are merely illustrative of the present invention and should not be construed to limit the scope of the invention as indicated by the appended claims in any way.

[0159] FIG. 1: Synthesised transposase constructs. PiggyBac wt (PBw): wt PiggyBac transposase, Trichoplusia ni, GenBank accession number #AAA87375.2; hyperactive PiggyBac (haPB): transposase mutated in I30V, G165S, M282V, N538K compared to wt PiggyBac transposase according to GenBank accession number #AAA87375.2; TAF3 PHD: TaflID sub III PHD domain, Homo sapiens, GenBank accession number #NP_114129.1 855 . . . 929; KAT2A Bromodomain: histone acetyltransferase KAT2A Bromodomain, Homo sapiens, GenBank accession number NP_066564.2 741 . . . 837; L1: Peptidelinker, KLGGGAPAVGGGPKKLGGGAPAVGGGPK SEQ ID NO: 22; L2: Peptidelinker, AAAKLGGGAPAVGGGPKAADKGAA SEQ ID NO: 23. The coding sequence (CDS) of Taf3-haPB is shown under SEQ ID NO: 1 and the coding sequence (CDS) of KATA2A-PBw-TAF3 is shown under SEQ ID NO: 3. SEQ ID NO: 2 shows the amino acid sequence of Taf3-haPB and SEQ ID NO: 4 shows the amino acid sequence of KATA2A-PBw-TAF3.

[0160] FIG. 2: Tested variants of PiggyBac fusion proteins. PiggyBac wt (PBw): wt PiggyBac transposase, Trichoplusia ni, GenBank accession number #AAA87375.2; Hyperactive PiggyBac (haPB): transposase mutated in I30V, G165S, M282V, N538K compared to wt PiggyBac transposase; TAF3 PHD: TaflID sub III PHD domain, Homo sapiens, GenBank accession number #NP_114129.1 855 . . . 929; KAT2A Bromodomain: histone acetyltransferase KAT2A Bromodomain, Homo sapiens, GenBank accession number NP_066564.2 741 . . . 837; L1: Peptidelinker, KLGGGAPAVGGGPKKLGGGAPAVGGGPK SEQ ID NO: 22; L2: Peptidelinker, AAAKLGGGAPAVGGGPKAADKGAA SEQ ID NO: 23. The nucleotide sequences and the corresponding amino acid sequences are listed under SEQ ID NO: 3 and SEQ ID NO: 4 for KATA2A-PBw-TAF3, under SEQ ID NO: 5 and SEQ ID NO: 6 for PBw, under SEQ ID NO: 7 and SEQ ID NO: 8 for TAF3-PBw, under SEQ ID NO: 9 and SEQ ID NO: 10 for PBw-TAF3, under SEQ ID NO: 11 and SEQ ID NO: 12 for KAT2A-PBw, under SEQ ID NO: 13 and SEQ ID NO: 14 for haPB, under SEQ ID NO: 15 and SEQ ID NO: 16 for KATA2A-haPB-TAF3, under SEQ ID NO: 29 and SEQ ID NO: 30 for KATA2A-haPB, and under SEQ ID NO: 31 and SEQ ID NO: 32 for haPB-TAF3.

[0161] FIG. 3: Maps of PBGGPEx2.0p_hc_PiggyBG and PBGGPEx2.0m_lc_PiggyBG. Promoter regions are shown as blue blocks: EF2/CMV hybrid promoter=strong heavy chain promoter, CMV/EF1 hybrid promoter=strong light chain promoter. Polyadenylation signals=pA are shown as yellow boxes. Antibiotic resistance genes, selection marker genes and the coding region for the light chain gene or rather the heavy chain gene are shown as orange arrows: pac=puromycin-N-acetyltransferase; dhfr=dehydrofolate reductase; aph=kanamycin resistance.

[0162] FIG. 4: IgG antibody concentrations of CHO-DG44 clones pools generated with different PiggyBac fusion proteins.

[0163] FIG. 5: IgG antibody titer concentrations of CHO-DG44 clones pools generated with different hyperactive PiggyBac fusion proteins.

[0164] FIG. 6: A: IgG antibody titer concentrations of CHO-DG44 clones pools generated with or without different hyperactive PiggyBac transposases. B: Real-Time PCR strategy to analyze and discriminate between total transgene copy number and randomly integrated transgenes. Gray arrows=PCR to detect randomly integrated transgenes. White arrows: PCR to detect transgene copies originating from random and transposase-mediated integration. C: Real-Time PCR results. Total and randomly integrated transgene copy numbers of samples derived from the hyperactive transposase or the hyperactive fusion domain variant TAF3-haPB relative to a sample generated without transposases.

EXAMPLES

[0165] The examples given below are for illustrative purposes only and do not limit the invention described above in any way.

Example 1

Gene Optimization and Synthesis

[0166] The amino acid sequences of PiggyBac wt transposase (Trichoplusia ni; GenBank accession number #AAA87375.2; SEQ ID NO: 6 [Virology 172(1) 156-169 1989]), a hyperactive PiggyBac transposase (I30V; G165S; M282V; N538K compared to PiggyBac wt transposase; SEQ ID NO: 6), TafIID sub III PHD domain (Homo sapiens; GenBank accession number #NP_114129.1 855 . . . 929; SEQ ID NO 20), histone acetyltransferase KAT2A Bromodomain (Homo sapiens; GenBank accession number NP_066564.2 741 . . . 837; SEQ ID NO 21), and two peptide linkers (linked: KLGGGAPAVGGGPKKLGGGAPAVGGGPK SEQ ID NO: 22; linker2: AAAKLGGGAPAVGGGPKAADKGAA SEQ ID NO: 23 were reverse translated and the resulting nucleotide sequences were linked as shown in FIG. 1.

[0167] The nucleotide sequences were optimized by knockout of cryptic splice sites and RNA destabilizing sequence elements, optimized for increased RNA stability and adapted to match the requirements of CHO cells (Cricetulus griseus) regarding the codon usage. The nucleotide sequences were synthesized by GeneArt Gene Synthesis (Life technologies). The coding sequence (CDS) of Taf3-haPB is shown under SEQ ID NO: 1 and the coding sequence (CDS) of KATA2A-PBw-TAF3 is shown under SEQ ID NO: 3. SEQ ID NO: 2 shows the amino acid sequence of Taf3-haPB and SEQ ID NO: 4 shows the amino acid sequence of KATA2A-PBw-TAF3.

Example 2

Construction of the Transposase Expression Plasmids

[0168] The synthesized constructs were used to generate the constructs shown in FIG. 2a and FIG. 2b using standard cloning procedures. The nucleotide sequences of the generated constructs are listed here under SEQ ID NO: 3 (KATA2A-PBw-TAF3), SEQ ID NO: 5 (PBw), SEQ ID NO: 7 (TAF3-PBw), SEQ ID NO: 9 (PBw-TAF3), SEQ ID NO: 11 (KAT2A-PBw), SEQ ID NO: 1 (Taf3-haPB), SEQ ID NO: 13 (haPB), SEQ ID NO: 15 (KATA2A-haPB-TAF3), SEQ ID NO: 29 (KATA2A-haPB) and SEQ ID NO: 31 (haPB-TAF3). The constructs were ligated into an expression vector, which allows transient expression of the transposase variants under control of the CMV promoter. General procedures for constructing expression plasmids are described in Sambrook, J., E. F. Fritsch and T. Maniatis: Cloning I/II/III, A Laboratory Manual New York/Cold Spring Harbor Laboratory Press, 1989, Second Edition.

Example 3

Construction of the Transposon Plasmids

[0169] Transposons were created containing the PiggyBac ITRs recognized by the PiggyBac transposase. Minimal ITR sequences of the PiggyBac transposon were integrated in the empty expression vectors PBGGPEx2.0m and PBGGPEx2.0p in 5′ and 3′ position to the bacterial backbone sequence with bacterial replication origin and antibiotic resistance gene by amplifying said bacterial backbone using the primers V1028_Piggy_forward, V1029_Piggy_reverse and V1036 Pbac_reverse 2 listed here under SEQ ID NO: 17 (V1028_Piggy_forward) and SEQ ID NO: 18 (V1029_Piggy_reverse) or rather SEQ ID NO: 17 (V1028_Piggy_forward) and SEQ ID NO: 19 (V1036 Pbac_reverse 2) and replacing the backbone of the corresponding vectors by one of the PCR-products via restriction digest with NdeI+NheI (PBGGPEx2.0m) or rather SfiI+NheI (PBGGPEx2.0p) to generate PBGGPEx2.0p_PiggyBG and PBGGPEx2.0m_PiggyBG.

Synthetic heavy or rather light chain fragments of an monoclonal antibody assembled with a signal peptide were ligated into the transposon containing empty expression vectors PBGGPEx2.0p_PiggyBG and PBGGPEx2.0m_PiggyBG to generate PBGGPEx2.0p_hc_PiggyBG and PBGGPEx2.0m_lc_PiggyBG (FIG. 3). General procedures for constructing expression plasmids are described in Sambrook, J., E. F. Fritsch and T. Maniatis: Cloning I/II/III, A Laboratory Manual New York/Cold Spring Harbor Laboratory Press, 1989, Second Edition.

Example 4

Generation and Analysis of Clone Pools

[0170] As starter cell line the dihydrofolate reductase-deficient CHO cell line, CHO/DG44 [Urlaub et al., 1986, Proc Natl Acad Sci USA. 83 (2): 337-341] was used. The cell line was maintained in serum-free medium. Plasmids containing the PB transposons (PBGGPEx2.0p_hc_PiggyBG and PBGGPEx2.0m_lc_PiggyBG) and transient expression vectors for expression of one of the transposase variants each were transfected by electroporation according to the manufacturer's instructions (Neon Transfection System, Thermo Fisher Scientific). In each transfection 1.5 μg of circular HC and LC transposon vector DNA and 1.2 μg of circular transposase DNA were used. Transfectants were subjected to selection with puromycin and methotrexate to eliminate untransfected cells, as well as non- and low-producer. Two consecutive series of transfections and selections were performed using the same vector combinations, DNA amounts and selection conditions. After a selection period of two weeks selection pressure was removed and resulting clone pools were subjected to Fed-batch processes under generic conditions with defined seeding cell densities. Fed batch processes were performed in shake flasks (SF125, Corning) with working volumes of 30 mL in chemically defined culture medium. A chemically defined feed was applied every two days following a generic feeding regiment. Antibody concentrations of cell culture supernatant samples were determined by the Octet® RED96 System (Fortebio) against purified material of the expressed antibody as standard curve.

[0171] FIG. 4 shows the fed batch results of clone pools derived from wt PiggyBac transposase and wt PiggyBac fusion variants. For the clone pools generated with the KAT2A-PBw, TAF3-PBw, PBw-TAF3 and KAT2A-PBw-TAF3 fusions variants and wt PiggyBac transposase antibody yields were determined at day 14 of the fed-batch process. The strongest increase by a single chromatin reader was observed for TAF3 fused to the N terminus (TAF3-PBw: 8.4 fold based the arithmetic mean of the respective pools) and somewhat less when fused to the C terminus (PBw-TAF3: 5.7 fold) A very moderate increase (1.3 fold) was observed with KAT2A (KAT2A-PBw) fused in the same way. The addition of a second chromatin reader domain (in this case KAT2A) is supportive: pools generated with KAT2A-PBw-TAF3 show 1.7 higher expression compared to PBw-TAF3.

[0172] FIG. 5 shows the effects of the different fusion domains on a hyperactive (ha) transposase. Clone pools derived from this transposase achieved a ˜5.1-fold higher antibody concentration than the wt PiggyBac transposase pools. Compared to the hyperactive PiggyBac transposase pools antibody yields of the KAT2A-haPB, TAF3-haPB, haPB-TAF3 and KAT2A-haPB-TAF3 fusion variant clone pools were found to be ˜2-fold, ˜2.8-fold, ˜2.4-fold and 2.9-fold higher. Consequently, chromatin reader domains not only promote expression from cassettes introduced with the wt transposase but also for a hyperactive form. Remarkably, the fusion domains did not only improve both, the wt PiggyBag and hyperactive PiggyBac transposases, but expression levels are highly similar independent of the activity of the naked transposase

Example 5

Transposase Specific Genomic Integration of the Transposons.

[0173] Despite presence of a transposase expression unit in the transfection mix, the circular plasmid containing the transposon can also integrate into the host genome in an transposase-independent fashion. In this case, the plasmid is linearized at random and backbone as well as transposon sequence are integrated. In contrast, transposases mediate integration of the transposon sequences only. The frequency of transposase independent integration is rather similar between transfections carried out under identical transfection and selection conditions and can serve as an internal standard. For such random integration of the whole plasmid, segments located entirely within the transposon and segments reaching into the plasmid backbone are equally abundant. In pools generated in the presence of any transposase, transposon sequences will be more abundant. The ratio of pure transposon segments (transposase mediated and random integration events) and segments reaching into the backbone (random integration events) is a measure of transposase activity.

[0174] Genomic integration of the transposons was analysed by Real-Time qPCR. For sample preparation clone pools were generated and analysed in fed batch processes as described in Example 4, except for the DNA amounts. 7 μg of transposon vector DNA and 2.8 μg of transposase vector DNA was transfected. An additional clone pool was generated with circular transposon vectors only. For each clone pool genomic DNA was purified from 2E6 viable cells using the QIAamp DNA Blood Mini Kit (QIAGEN, REF: 51104) and DNA Purification from Blood or Body Fluids, Spin Protocol. Genomic DNA concentrations were determined by a NanoPhotometer NP80 (Implen) and genomic DNA samples were diluted to a concentration of 10 ng/μl with DEPC Treated Water (Invitrogen, REF: 46-2224). The PCR reaction mixes were prepared as follows: 90 nM forward primer, 90 nM backwards primer, 50 ng sample DNA, 10 μL Power SYBR Green PCR Master Mix (Applied Biosystems, REF: 4367659), add to 20 μL with DEPC Treated Water (Invitrogen, REF: 46-2224). Samples were analyzed as triplicates using a StepOnePlus Real-Time PCR System (Applied Biosystems). Three different primer sets and PCR reactions were performed for each sample. To measure the ration of specific integrated transposons and random integrated plasmid DNA the primers V1075 PBG forward (TATTGGTAGCCCACAAGCTG; SEQ ID NO: 26) and V1076 PBG reverse 1 (TTTCTTTCAGTGCTATGTTATGGTG; SEQ ID NO: 27) or rather V1075 PBG forward (TATTGGTAGCCCACAAGCTG; SEQ ID NO: 26) and V1077 PBG reverse 2 (GGTTGTGCTGTGACGCT; (SEQ ID NO: 28) were used to amplify a small fragment within the transposon (77 bp fragment, specific for integration of transposon and random integration of plasmid DNA) or rather a fragment comprising the 5′ PiggyBac ITR (169 bp fragment, specific for random integration of plasmid DNA) (FIG. 6). In order to normalize and compare the different samples the primer V455 qPCR-ALU-Forward (TAAgAgCACCAACTgCTCTTCCA; SEQ ID NO: 33) and V456 qPCR-ALU-Reverse (ACCAgAAgAgggCACCAgATCT; SEQ ID NO: 34) were used to amplify an endogenous ALU sequence. The following PCR conditions were applied: 95° C. for 10 min, 95° C. for 15 sec, 60° C. for 60 sec, 40 cycles. Real time PCR data were analysed using the comparative CT(ΔΔCT) method.

[0175] 3 pools were compared: the first generated with transposase, the second with the same transposase fused to the TAF3 domain (TAF3-haPB) and a third without any transposase. In the fed batch processes titers of 1100 μg/ml, 2500 μg/ml and 115 μg/ml were measured respectively as shown in FIG. 6A.

[0176] Using the Real-Time PCR detection strategy shown in FIG. 6B, genomic DNA samples of the three clone pool were analysed for relative copy numbers of the transposon-specific segment (all integration events (A)—transposase-mediated and random) and a segment containing both transposon and backbone sequences (random only (R)) as outlined in FIG. 6C. Relative copy number of the transposase-mediated integration (T) can be calculated as A−R=T

[0177] In the absence of transposase A=R and T=0. Hence, relative copy numbers determined for both R and A were set to 1 to account for different length PCR fragments.

[0178] In the presence of any transposase A>>R, a ratio of transposase dependent to random integration can be determined. For the transposase without a fusion domain this ratio is T/R=A−R/R=0.84. Although under the given conditions random integration still dominates slightly in terms of copy number, expression from the respective pools is considerably higher showing the benefit of the transposase approach. This may be due to removal of prokaryotic backbone sequences next to the transgenes and selection of active loci by the transposase itself. For the transposase with the TAF3 fusion domain this ratio is T/R=A−R/R=1.86. Here, the transposase-dependent integration events dominate. Respective cells benefit from the higher expression of the selection marker genes compared to the random approach which results in earlier recovery and multiplication during selection at the expense of cells harbouring randomly integrated copies. In addition, the titer obtained with this pool is 2.5× higher compared to that obtained with the unmodified transposase. Strikingly, chromatin reader domain can clearly potentiate stringency of selection for highly active sites on the background of such selection by the transposase itself.