MODULATION OF LC3-ASSOCIATED ENDOCYTOSIS PATHWAY AND GENETICALLY MODIFIED NON-HUMAN ANIMALS AS A MODEL OF NEUROINFLAMMATION AND NEURODEGENERATION
20220104468 · 2022-04-07
Assignee
Inventors
Cpc classification
A01K2217/206
HUMAN NECESSITIES
A61P25/28
HUMAN NECESSITIES
International classification
A61P25/28
HUMAN NECESSITIES
Abstract
Compositions and methods are provided for modifying and treating neuroinflammatory and neurodegenerative diseases. The methods and compositions can be used to ameliorate the effects of a deficiency in the LC3-associated endocytosis (LANDO) pathway for clearing β-amyloid. Thus, methods are further provided for modulating β-amyloid clearance using an effective amount of a pharmaceutical composition that targets the LANDO pathway. Accordingly, pharmaceutical compositions that target the LANDO pathway are provided herein. The methods and compositions described herein can be used to treat neuroinflammatory and neurodegenerative diseases, such as Alzheimer's disease.
Claims
1. A method for decreasing neuroinflammation or neurodegeneration in a LC3-associated endocytosis (LANDO)-deficient subject comprising administering an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway, wherein said administration of an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway decreases neuroinflammation or neurodegeneration.
2. The method of claim 1, wherein said pharmaceutical composition that activates or enhances the LANDO pathway has no significant effect on LC3-associated phagocytosis (LAP).
3. The method of claim 1 or 2, wherein said LANDO-deficient subject has reduced expression of at least one of: Beclin1, VPS34, ATG5, ATG7, ATG4, LC3A, LC3B, Rubicon, and Atg16L WD-domain; when compared to a subject not deficient in LANDO.
4. The method of any one of claims 1-3, wherein said LANDO-deficient subject has reduced expression of Rubicon, ATG5 or Atg16L WD-domain when compared to a subject not deficient in LANDO.
5. The method of any one of claims 1-4, further comprising detecting failed clearance of β-amyloid prior to administering an effective amount of said pharmaceutical composition.
6. The method of any one of claims 1-5, wherein said decreased neuroinflammation or neurodegeneration comprises any one of: reduced expression of pro-inflammatory genes, reduced β-amyloid deposition or plaque formation, reduced tau hyperphosphorylation, reduced microglial activation, reduced microglial ramified to ameboid transition, reduced microgliosis, reduced neuronal cell death, reduced electrophysiological impairment, reduced behavior deficits, and reduced memory deficits.
7. A method for treating Alzheimer's disease comprising administering an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway to a subject diagnosed with Alzheimer's disease or demonstrating symptoms of the disease, wherein said administration of an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway decreases at least one symptom of Alzheimer's disease.
8. The method of claim 7, wherein said subject has reduced expression of at least one of: Beclin1, VPS34, ATG5, ATG7, ATG4, LC3A, LC3B, Rubicon, and Atg16L WD-domain; when compared to a subject not deficient in LANDO.
9. The method of claim 7 or 8, wherein said subject has reduced expression of Rubicon or ATG5 when compared to a subject not deficient in LANDO.
10. The method of any one of claims 7-9, further comprising detecting failed clearance of β-amyloid prior to administering an effective amount of said pharmaceutical composition.
11. A method for clearing β-amyloid in a subject deficient in β-amyloid clearance comprising administering an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway.
12. The method of claim 11, wherein said subject is a LANDO-deficient subject.
13. The method of claim 12, wherein said subject has reduced expression of at least one of: Beclin1, VPS34, ATG5, ATG7, ATG4, LC3A, LC3B, Rubicon, and Atg16L WD-domain; when compared to a subject not deficient in LANDO.
14. The method of claim 12 or 13, wherein said subject has reduced expression of Rubicon or ATG5 when compared to a subject not deficient in LANDO.
15. The method of any one of claims 11-14, wherein said subject comprises β-amyloid accumulation in at least one of the cortex and hippocampus prior to administration of said pharmaceutical composition.
16. The method of claim 15, wherein said subject exhibits symptoms of said β-amyloid accumulation prior to administration of said pharmaceutical composition.
17. A method for identifying a compound that modulates LANDO activity and does not significantly modulate LAP activity, said method comprising: measuring a first level of LANDO activity and LAP activity in a cell or tissue; contacting the cell or tissue with a candidate compound; measuring a second level of LANDO activity and LAP activity of said cell or tissue after contact with said candidate compound; comparing said first level of LANDO activity with the second level of LANDO activity and comparing said first level of LAP activity with the second level of LAP activity; and selecting compounds that modulate the LANDO activity and do not significantly modulate the LAP activity.
18. A method for identifying a compound that modulates LANDO activity and does not significantly modulate LAP activity, said method comprising: contacting a test cell or tissue with a candidate compound; measuring a first level of LANDO activity and LAP activity of said test cell or tissue after contact with said candidate compound; measuring a second level of LANDO activity and LAP activity from a control cell or tissue; comparing said first level of LANDO activity with said second level of LANDO activity and comparing said first level of LAP activity with the second level of LAP activity; and selecting compounds that modulate the LANDO activity and do not significantly modulate the LAP activity.
19. The method of claim 17 or 18, wherein compounds are selected that increase LANDO activity.
20. The method of any one of claims 17-19, wherein measuring said first and second level of LANDO activity comprises measuring β-amyloid clearance.
21. The method of any one of claims 17-20, wherein measuring said first and second level of LANDO activity comprises measuring recycling of at least one β-amyloid receptor from endosomes to plasma membrane.
22. The method of claim 21, wherein said at least one β-amyloid receptor is selected from CD36, TLR4, and TREM2.
23. The method of any one of claims 17-22, wherein measuring said first and second level of LAP activity comprises measuring phagocytosis.
24. The method of any one of claims 17-23, wherein said cell or tissue comprises a bone marrow-derived macrophage or a culture of bone marrow-derived macrophages, a microglial cell or a culture of microglial cells, or a myeloid cell or a culture of myeloid cells.
25. The method of claim 24, wherein said bone marrow-derived macrophage, microglial cell, or myeloid cell is derived from LANDO-deficient mice.
26. The method of claim 25, wherein said LANDO-deficient mice are Rubicon deficient, ATG5 deficient or Atg16L WD-domain deficient.
27. The method of any one of claims 17-26, wherein said selected molecule modulates LANDO activity when administered to a subject.
28. The method of claim 27, wherein said subject is a LANDO-deficient subject.
29. The method of claim 28, wherein said LANDO-deficient subject has reduced expression of at least one of: Beclin1, VPS34, ATG5, ATG7, ATG4, LC3, Rubicon, and Atg16L WD-domain; when compared to a subject not deficient in LANDO.
30. The method of claim 28 or 29, wherein said LANDO-deficient subject has reduced expression of Rubicon, ATG5 or Atg16L WD-domain when compared to a subject not deficient in LANDO.
31. The method of any one of claims 28-30, wherein said LANDO-deficient subject exhibits neuroinflammation or neurodegeneration.
32. A pharmaceutical composition comprising a molecule selected by the method of any one of claims 17-31.
33. Use of a pharmaceutical composition that activates or enhances the LANDO pathway for decreasing neuroinflammation or neurodegeneration or treating Alzheimer's disease according to the methods of claims 1-6 or 7-10, respectively.
34. Use of a pharmaceutical composition that activates or enhances the LANDO pathway according to the method of any one of claims 1-16 or that is identified by the method of any one of claims 17-30 as a medicament.
35. A pharmaceutical composition that activates or enhances the LANDO pathway for use in treating a neuroinflammatory disorder, neurodegenerative disorder, or Alzheimer's disease in a LANDO-deficient subject, said use comprising administering an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway to the subject.
36. The pharmaceutical composition of claim 35, wherein said subject has reduced expression of at least one of: Beclin1, VPS34, ATG5, ATG7, ATG4, LC3A, LC3B, Rubicon, and Atg16L WD-domain; when compared to a subject not deficient in LANDO.
37. A mouse model of neuroinflammation or neurodegeneration comprising microglial LANDO knockdown or knockout and at least one additional genetic modification that contributes to neuroinflammation or neurodegeneration.
38. The mouse model of claim 37, wherein said microglial LANDO knockdown or knockout targets at least one of Rubicon, ATG5 and Atg16L WD-domain.
39. The mouse model of claim 37 or 38, wherein said microglial LANDO knockdown or knockout targets Rubicon.
40. The mouse model of any one of claims 37-39, wherein said microglial LANDO knockdown or knockout is tissue-specific.
41. The mouse model of claim 40, wherein said microglial LANDO knockdown or knockout is specific to cells of the myeloid lineage and microglia.
42. The mouse model of any one of claims 37-41, wherein said microglial LANDO knockdown or knockout is mediated by a site-specific recombinase system.
43. The mouse model of claim 42, wherein said site-specific recombinase system comprises Cre/lox.
44. The mouse model of claim 42 or 43, wherein expression of a site-specific recombinase is under the control of the lysozyme 2 promoter.
45. The mouse model of any one of claims 40-44, wherein said knockdown or knockout targets ATG5 or Atg16L WD-domain.
46. The mouse model of any one of claims 37-45, wherein said at least one additional genetic modification that contributes to neuroinflammation or neurodegeneration comprises mutations or expression of transgenic molecules that lead to overexpression of a mutated amyloid precursor protein (APP) present in familial Alzheimer's disease (FAD).
47. The mouse model of claim 46, wherein said mutated amyloid precursor protein comprises at least one of K670N, M671L, I716V, and V717I in relation to human APP(695).
48. The mouse model of claim 47, wherein said mouse model transgenically expresses mutant human APP(695) comprising all of the following mutations: K670N, M671L, I716V, and V717I.
49. The mouse model of claim 48, wherein expression of mutant human APP(695) is regulated by a tissue-specific promoter that is expressed in the central nervous system.
50. The mouse model of claim 49, wherein expression of mutant human APP(695) is under the regulation of the murine Thy1 promoter.
51. The mouse model of any one of claims 46-50, wherein said mouse model transgenically expresses mutant human presinilin 1 comprising a M146L mutation and a L286V mutation.
52. The mouse model of claim 51, wherein expression of mutant human presinilin 1 is regulated by a tissue-specific promoter that is expressed in the central nervous system.
53. The mouse model of claim 52, wherein expression of mutant human presinilin 1 is under the regulation of the murine Thy1 promoter.
54. The mouse model of any one of claims 46-53, wherein said mouse model comprises a 5×FAD transgenic mouse transgenically expressing a mutant human APP(695) with the following mutations: K670N, M671L, I716V, and V717I and transgenically expressing a mutant human presinilin 1 comprising a M146L mutation and a L286V mutation.
55. The mouse model of any one of claims 37-54, wherein said microglial LANDO knockdown or knockout increases penetrance of neuroinflammation or neurodegeneration, reduces age of onset of neuroinflammation or neurodegeneration, or both increases penetrance and reduces age of onset of neuroinflammation or neurodegeneration, when compared to a mouse lacking microglial LANDO knockdown or knockout.
56. A method of making a mouse model of neuroinflammation or neurodegeneration comprising microglial LANDO knockdown or knockout and at least one additional genetic modification that contributes to neuroinflammation or neurodegeneration, wherein said method comprises knocking down or knocking out LANDO in microglial tissues in a mouse comprising at least one additional genetic modification that contributes to neuroinflammation or neurodegeneration.
57. The method of claim 56, wherein said method further comprises introducing said at least one additional genetic modification that contributes to neuroinflammation or neurodegeneration.
58. The method of claim 56, wherein said method comprises crossing a mouse comprising microglial LANDO knockdown or knockout with a mouse comprising at least one additional genetic modification that contributes to neuroinflammation or neurodegeneration.
59. The method of any one of claims 56-58, wherein said microglial LANDO knockdown or knockout targets at least one of Rubicon, ATG5 and Atg16L WD-domain.
60. The method of any one of claims 56-59, wherein said microglial LANDO knockdown or knockout targets Rubicon.
61. The method of any one of claims 56-60, wherein said microglial LANDO knockdown or knockout is tissue-specific.
62. The method of claim 61, wherein said microglial LANDO knockdown or knockout is specific to cells of the myeloid lineage and microglia.
63. The method of any one of claims 56-62, wherein said microglial LANDO knockdown or knockout is mediated by a site-specific recombinase system and wherein said method further comprises generating said mouse comprising microglial LANDO knockdown or knockout using said site-specific recombinase system.
64. The method of claim 63, wherein said site-specific recombinase system comprises Cre/lox.
65. The method of claim 63 or 64, wherein expression of a site-specific recombinase is under the control of the lysozyme 2 promoter.
66. The method of any one of claims 61-65, wherein said knockdown or knockout targets ATG5 or Atg16L WD-domain.
67. The method of any one of claims 56-66, wherein said at least one additional genetic modification that contributes to neuroinflammation or neurodegeneration comprises mutations or expression of transgenic molecules that lead to overexpression of a mutated amyloid precursor protein (APP) present in familial Alzheimer's disease (FAD).
68. The method of claim 67, wherein said mutated amyloid precursor protein comprises at least one of K670N, M671L, I716V, and V717I in relation to human APP(695).
69. The method of claim 68, wherein said mouse model transgenically expresses mutant human APP(695) comprising all of the following mutations: K670N, M671L, I716V, and V717I.
70. The method of claim 69, wherein expression of mutant human APP(695) is regulated by a tissue-specific promoter that is expressed in the central nervous system.
71. The method of claim 70, wherein expression of mutant human APP(695) is under the regulation of the murine Thy1 promoter.
72. The method of any one of claims 67-71, wherein said mouse model transgenically expresses mutant human presinilin 1 comprising a M146L mutation and a L286V mutation.
73. The method of claim 72, wherein expression of mutant human presinilin 1 is regulated by a tissue-specific promoter that is expressed in the central nervous system.
74. The method of claim 73, wherein expression of mutant human presinilin 1 is under the regulation of the murine Thy1 promoter.
75. The method of any one of claims 67-74, wherein said mouse model comprises a 5×FAD transgenic mouse transgenically expressing a mutant human APP(695) with the following mutations: K670N, M671L, I716V, and V717I and transgenically expressing a mutant human presinilin 1 comprising a M146L mutation and a L286V mutation.
76. The method of any one of claims 56-75, wherein said microglial LANDO knockdown or knockout increases penetrance or neuroinflammation or neurodegeneration, reduces age of onset of neuroinflammation or neurodegeneration, or both increases penetrance and reduces age of onset of neuroinflammation or neurodegeneration, when compared to a mouse lacking microglial LANDO knockdown or knockout.
77. A mouse model of neuroinflammation or neurodegeneration produced by the method of any one of claims 56-76.
78. A method for identifying a compound that modulates neuroinflammation or neurodegeneration, said method comprising: a) administering a candidate compound to said mouse model of any one of claims 37-55 or 77; b) measuring the effect of said candidate compound on neuroinflammation or neurodegeneration as compared to said mouse model prior to administration of said candidate compound or said mouse model not having been administered said candidate compound; and c) selecting compounds that modulate neuroinflammation or neurodegeneration.
79. The method of claim 78, wherein measuring the effect of said candidate compound on neuroinflammation or neurodegeneration comprises measuring any one of: expression of pro-inflammatory genes, β-amyloid deposition or plaque formation, tau hyperphosphorylation, microglial activation, microglial ramified to ameboid transition, microgliosis, neuronal cell death, electrophysiological impairment, behavior deficits, and memory deficits.
80. The method of claim 79, wherein expression of any one of the following pro-inflammatory genes are measured: IL-1β, IL-6, CCL5, and TNFα.
81. The method of claim 79, wherein said microglial activation is measured by measuring expression of Iba1.
82. The method of claim 79, wherein behavior deficits are measured using a sucrose preference test.
83. The method of claim 79, wherein memory deficits are measured using a novel object recognition test, a Y-maze test, or both.
84. Use of a pharmaceutical composition that activates or enhances the LANDO pathway in the manufacture of a medicament for decreasing neuroinflammation or neurodegeneration or treating Alzheimer's disease according to the methods of claims 1-6 or 7-10, respectively.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0006]
[0007]
[0008]
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
DETAILED DESCRIPTION OF THE INVENTION
[0025] The present inventions now will be described more fully hereinafter with reference to the accompanying drawings, in which some, but not all embodiments of the inventions are shown. Indeed, these inventions may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will satisfy applicable legal requirements. Like numbers refer to like elements throughout.
[0026] Many modifications and other embodiments of the inventions set forth herein will come to mind to one skilled in the art to which these inventions pertain having the benefit of the teachings presented in the foregoing descriptions and the associated drawings. Therefore, it is to be understood that the inventions are not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.
1. Overview
[0027] Compositions and methods are provided herein for the treatment of conditions associated with a deficiency in the LC3-associated endocytosis (LANDO) pathway. LANDO is a newly discovered form of receptor-mediated endocytosis and receptor recycling characterized by the association of LC3 (light chain 3)/GABARAP (gamma-aminobutyric acid receptor-associated protein)-family proteins (herein, “LC3”) with endosomal membranes. LANDO in myeloid cells is a critical regulator of immune-mediated aggregate removal by receptor-mediated endocytosis and neuroinflammation.
[0028] Mice lacking LANDO but not canonical autophagy in the myeloid compartment (with a 5×FAD background in which the mice express transgenes of amyloid precursor protein and presenilin1 containing several mutations associated with human familial Alzheimer's disease) have a robust increase in pro-inflammatory cytokine production in the hippocampus and have increased levels of neurotoxic β-amyloid (Aβ) accumulation. This inflammation and Aβ deposition leads to reactive microgliosis and hyperphosphorylation of tau, a protein that is vital to neuronal structure and function. As a consequence, LANDO-deficient mice have increased neurodegeneration, resulting in impaired neuronal signaling and consequential behavioral and memory deficits. Thus, LANDO serves a protective role in myeloid cells of the central nervous system (CNS) in neurodegenerative pathologies resulting from β-amyloid deposition.
[0029] The LANDO pathway is distinct from the previously discovered LC3-associated phagocytosis (LAP) pathway, and also distinct from the canonical autophagy pathway. Macroautophagy (herein, autophagy or canonical autophagy) is a catabolic, cell survival mechanism activated during nutrient scarcity involving degradation and recycling of unnecessary or dysfunctional components. The proteins of autophagy machinery often interact with pathogens, such as Salmonella enterica, Listeria monocytogenes, Aspergillus fumigatus and Shigella flexneri, and function to quarantine and degrade invading organisms (xenophagy). LC3 (mammalian homologue of Atg8) is the most commonly monitored autophagy-related protein, and its lipidated form, LC3-II, is present on autophagosomes during canonical autophagy.
[0030] LC3-associated phagocytosis (LAP) is a process triggered following phagocytosis of particles that engage cell-surface receptors such as TLR1/2, TLR2/6, TLR4, TIM4 and FcR, resulting in recruitment of some, but not all, members of the autophagic machinery to stimulus-containing phagosomes, facilitating rapid phagosome maturation, degradation of engulfed pathogens, and modulation of immune responses. LAP and autophagy have been shown to be functionally and mechanistically distinct processes. Whereas the autophagosome is a double-membrane structure, the LAP-engaged phagosome (LAPosome) is composed of a single membrane. Autophagy requires the activity of the pre-initiation complex, but LAP does not. However, LAP requires some autophagic components, such as the Class III PI(3)K (phosphoinositide 3-kinase) complex and elements of the ubiquitylation-like, protein conjugation systems (ATG5, ATG7). The Class III PI(3)K-associated protein, Rubicon, has been identified as required for LAP, yet non-essential for autophagy.
[0031] Rubicon (RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein) is a negative regulator of canonical autophagy through its involvement in the localization and activity of the Class III PI3K complex. Rubicon binds to Beclin 1 and VPS34 (vacuolar protein sorting 34), the catalytic subunit of the Class III PI3K complex, and the interaction between Rubicon and VPS34 inhibits VPS34 lipid kinase activity and autophogosome formation. In contrast to canonical autophagy, Rubicon is required for efficient LAP, during which Rubicon promotes PI(3)P (phosphatidylinositol 3-phosphate) formation by VPS34 to recruit the ATG5-12 and LC3-PE (LC3-phosphatidylethanolamine) conjugation systems and to stabilize and activate the NOX2 (catalytic, membrane-bound subunit of NADPH oxidase) complex. Rubicon further interacts with the p22.sup.phox subunit of NOX2 to stabilize the complex for optimal ROS (reactive oxygen species) production in LAP.
[0032] In both canonical autophagy and LAP, the E3-ligase complex ATG7 and ATG10 mediates the conjugation of ubiquitin-like ATG5 to ATG12 in association with ATG16L1 to form a stabilizing, multimeric complex. Conversion of cytosolic LC3 to lipidated LC3-I is mediated by ATG4, which cleaves the LC3 precursor allowing it to be subsequently conjugated to the lipid, phosphatidylethanolamine (PE), via the activity of ATG7 and ATG3. The ATG5/12/16L1 complex is also required for the conversion of LC3I to LC3-II in canonical autophagy and LAP. However, while LC3 lipidation plays a key role in both canonical and non-canonical autophagy pathways, recent studies have shown that the WD-domain of the autophagy protein Atg16L1 is essential for single membrane lipidation of LC3, but dispensable for the canonical autophagy pathway (Fletcher et al., EMBO J 37:e97840 (2018); Fracchiolla and Martens, EMBO J 37:e98895 (2018)).
[0033] Although the LANDO pathway shares some of the same components with the canonical autophagy and LAP pathway, each of the three pathways are distinct from one another. While LAP functions to promote phagosome maturation and cargo destruction (Abnave et al. (2014) Cell Host Microbe 16:338-350; Akoumianaki et al. (2016) Cell Host Microbe 19:79-90; Cunha et al. (2018) Cell 175:429-441, e416; de Luca et al. (2014) Proc Natl Acad Sci USA 111:3526-3531; Frost et al. (2015) Mol Neurobiol 52:1135-1151; Kim et al., 2013; Kyrmizi et al. (2013) J Immunol 191:1287-1299; Lai and Devenish (2012) Cells 1:396-408; Martinez et al. (2011) Proc Natl Acad Sci USA 108:17396-17401; Martinez et al. (2016) Nature 533:115-119; Martinez et al. (2015) Nat Cell Biol 17:893-906), no effects of the deletions of LANDO pathway components, such as ATG5 or Rubicon on the rate of Aβ degradation, endosome maturation, or lysosome association were observed (
[0034] Rubicon and ATG5 are required for the recycling of Aβ receptors. In addition to Rubicon and ATG5, it was further found that Beclin1, VPS34, ATG7, and ATG4 were required for the recycling of Aβ receptors, while ULK1 (Unc-51-like autophagy activating kinase), FIP200 (FAK-interacting protein of 200 kDa), and ATG14 were dispensable for this effect. The Legionella-derived protease, RavZ, which irreversibly cleaves lipidated LC3 (Choy et al. (2012) Science 338:1072-1076; Kwon et al. (2017) Autophagy 13:70-81) also prevented this receptor recycling. The role for ATG4, which processes LC3 proteins to LC3-I for lipidation, and the effect of RavZ, as well as the roles for the ligation machinery (ATG7, ATG5) strongly suggest that lipidation of LC3 at the endosome functions in the recycling of these receptors. Although the WD-domain of Atg16L1 has been identified to play a role in single membrane lipidation of LC3 (Fletcher et al., EMBO J 37:e97840 (2018); Fracchiolla and Martens, EMBO J 37:e98895 (2018)), its role in recycling of Aβ receptors remains to be explored.
[0035] Overall, LANDO is distinct from canonical autophagy and the LAP pathway and plays a requisite role in the recycling of Aβ receptors. LANDO in the myeloid compartment of the CNS functions to protect neurons from the neuroinflammatory and neurodegenerative effects of Aβ deposition.
[0036] LANDO functions in microglia not only to promote Aβ clearance but also to promote an anti-inflammatory immune response. LANDO-associated proteins function to limit the expression and production of inflammatory cytokines and chemokines in response to β-amyloid in bone marrow-derived macrophages, RAW264.7 myeloid cells, BV2 microglial cells, and primary microglia in vitro (
[0037] Methods are provided for clearing Aβ in a subject deficient in Aβ clearance by administering an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway. The present disclosure also provides methods for decreasing neuroinflammation or neurodegeneration in a LANDO-deficient subject by administering an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway. Also provided are methods for treating Alzheimer's disease by administering an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway to a subject diagnosed with Alzheimer's disease or demonstrating symptoms of the disease.
[0038] Methods are provided for identifying a compound that modulates LANDO activity and does not significantly modulate LAP activity, wherein the method comprises measuring a first level of LANDO activity and LAP activity in a cell or tissue, contacting the cell or tissue with a candidate compound, and measuring a second level of LANDO activity and LAP activity of the cell or tissue after contact with the candidate compound, and comparing the first and second level of LANDO and LAP activity and selecting compounds that modulate the LANDO activity and do not significantly modulate the LAP activity.
[0039] Further, a non-human animal model of neuroinflammation and neurodegeneration is provided in which the animal comprises microglial LANDO knockdown or knockout and at least one additional genetic manipulation that contributes to neuroinflammation or neurodegeneration. The non-human animal model exhibits accelerated disease pathology and neurodegeneration, reactive microgliosis, neuroinflammation, tau pathology, and behavioral impairment is observed, thereby replicating the major aspects of human disease in a rapidly developing, manipulatable animal model. Methods of making the genetically modified non-human animal model and methods for identifying a compound that modulates neuroinflammation or neurodegeneration using the animal model are provided.
2. Non-Human Animal Model of Neuroinflammation
[0040] The present disclosure provides a genetically modified non-human animal model of neuroinflammation or neurodegeneration, wherein the animal comprises microglial LANDO knockdown or knockout and at least one additional genetic modification that contributes to neuroinflammation or neurodegeneration.
[0041] In some embodiments, the microglial LANDO knockdown or knockout increases the penetrance of neuroinflammation or neurodegeneration associated with the additional genetic modification, reduces the age of onset of neuroinflammation or neurodegeneration, or both increases penetrance and reduces the age of onset of neuroinflammation or neurodegeneration, when compared to an animal of the same species lacking microglial LANDO knockdown or knockout, but having the genetic modification that contributes to neuroinflammation or neurodegeneration.
[0042] As used herein, the term “penetrance” refers to the extent to which a particular gene or set of genes is phenotypically expressed in individuals carrying it, which is measured by the proportion of individuals carrying this particular gene or set of genes that also express an associated trait. In particular embodiments, the LANDO knockdown or knockout increases the percentage of individuals having the additional genetic modification that also exhibit neuroinflammation or neurodegeneration. In some of these embodiments, the percentage of individuals exhibiting neuroinflammation or neurodegeneration is increased by LANDO knockdown or knockout by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 150%, about 200% or more.
[0043] As used herein “age of onset” refers to the age at which an individual acquires, develops, or first experiences a condition or symptoms of a disease or disorder (e.g., neuroinflammation or neurodegeneration). In some embodiments, the LANDO knockdown or knockout reduces the age of onset of neuroinflammation or neurodegeneration as compared to an animal having the genetic modification associated with neuroinflammation or neurodegeneration. In some of these embodiments, the age of onset of neuroinflammation or neurodegeneration is reduced by LANDO knockdown or knockout by days, weeks, months, or years, including 5 days, 10 days, 20 days, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 1.25 years, 1.5 years, 1.75 years, 2 years, 2.25 years, 2.5 years, 2.75 years, 3 years.
[0044] Given the increased penetrance and/or reduced age of onset of neuroinflammation or neurodegeneration, the presently disclosed mouse models are particularly useful in studying neuroinflammation, neurodegeneration, behavioral and/or memory impairment resulting from neurodegeneration, RA clearance and/or deposition, tau hyperphosphorylation, the LANDO pathway, Alzheimer's disease, and screening for compounds that modulate the LANDO pathway, and can be used to treat neuroinflammation or neurodegeneration in general, or Alzheimer's disease in particular.
[0045] As used herein, the term “knockout” refers to a method by which at least one of an organism's genes is made inoperative. As used herein, the term “knockout” refers to either a heterozygous knockout, wherein only one of two gene copies (alleles) is made inoperative, or a homozygous knockout in which both copies of a gene are made inoperative. The term “knockout” can also encompass a knockin, in those situations wherein a gene is replaced with another gene. The term “knockdown” refers to a method by which the expression of one or more of an organisms's genes is reduced. A LANDO knockdown or knockout refers to a knockdown or knockout of a LANDO-related molecule. In particular embodiments, the microglial LANDO knockdown or knockout targets Rubicon, ATG5, or both. Additionally, or alternatively, LANDO knockdown or knockout may target the WD-domain of Atg16L.
[0046] Any method known in the art to knockout or knockdown a LANDO-related molecule can be used, such as RNA interference, or homologous recombination with or without the use of a site-specific nuclease (e.g., zinc finger nucleases, CRISPR-cas nucleases, TALENs, meganucleases).
[0047] As many components of LANDO are also involved in autophagy or LAP and might be required for development or post-natal survival, in some embodiments, the LANDO knockout or knockdown is tissue-specific. In some of those embodiments wherein the LANDO knockout or knockdown is tissue-specific, the knockout or knockdown is specific to cells of the myeloid lineage and microglia. Promoters that are specific for cells of the myeloid lineage and microglia are known in the art. Non-limiting examples of such a promoter are the lysozyme 2 promoter, the chemokine receptor CX3CR1 promoter (Yona et al. (2013) Immunity 38(1):79-91), and the transmembrane protein 119 (TMEM119) promoter (The Jackson Laboratory).
[0048] In some of those embodiments wherein the LANDO knockout or knockdown is tissue-specific, a site-specific recombinase system is used, wherein expression of the site-specific recombinase is under the control of a tissue-specific promoter. As used herein, a “site-specific recombinase system” refers to both a site-specific recombinase that performs rearrangements of DNA segments by recognizing and binding to short DNA sequences (recombination sites), at which the recombinase cleaves the DNA backbone and exchanges the two DNA helices involved and rejoins the DNA strands, along with the recombination sites. The site-specific recombinase system can be used to generate excisions, inversions, or insertions of replacement DNA. Site-specific recombinase systems are known in the art and include, but are not limited to, the Cre-lox system and the FLP-frt system. In particular embodiments, a tissue-specific promoter (e.g., the lysozyme M promoter) regulates the expression of the site-specific recombinase (e.g., Cre).
[0049] The presently disclosed genetically modified non-human animal models comprise a genetic modification that contributes to neuroinflammation or neurodegeneration, in addition to the LANDO knockout or knockdown. Any genetic modification, such as a genomic or somatic mutation (e.g., deletion, addition, substitution) or transgene expression, known in the art to cause neuroinflammation or neurodegeneration may be used. In some embodiments, however, this additional genetic modification comprises modifications that lead to the overexpression of amyloid precursor protein (APP) or the aggregation of RA. In some of these embodiments, the non-human animal transgenically expresses APP. In particular embodiments, the non-human animal transgenically expresses APP comprising at least one mutation present in familial Alzheimer's disease (FAD). In some of these embodiments, the non-human animal model transgenically expresses a mutated APP comprising at least one of K670N, M671L, I716V, and V717I in relation to the human 770 amino acid APP (NCBI NP_000475.1). In particular embodiments, the non-human animal model transgenically expresses a mutated APP comprising all of the following mutations: K670N, M671L, I716V, and V717I in relation to the human 770 amino acid APP.
[0050] In some embodiments, the non-human animal model transgenically expresses mutant human presinilin 1 comprising at least one of M146L and L286V mutations in relation to human presinilin 1 (NCBI NP_000012.1). In some of these embodiments, the transgenic expression of mutant human APP and/or presinilin 1 is under the control of a tissue-specific promoter that is expressed in the central nervous system. Suitable promoters are known in the art and include, but are not limited to, the Thy1 promoter, the platelet derived growth factor (PDGF) promoter (Games et al. (1995) Nature 373(6514):523-527), and the prion protein (PrP) promoter (Hsiao et al. (1996) Science 274(5284):99-102).
[0051] In particular embodiments, the non-human animal model comprises a 5×FAD transgenic animal transgenically expressing a mutant human APP with each of the following mutations: K670N, M671L, I716V, and V717I, and transgenically expressing a mutant human presinilin 1 comprising a M146L mutation and a L286V mutation.
[0052] In alternative embodiments, the non-human animal model comprises a deletion or mutation of the WD-domain of Atg16L (Atg16L.sup.ΔWD), which is also referred to herein as the Atg16L WD-domain. In some embodiments, the non-human animal model comprises an Atg16L WD-domain deficient (Atg16L.sup.ΔWD) animal transgenically expressing a mutant human APP with at least one of, or all of, the following mutations: K670N, M671L, I716V, and V717I, and transgenically expressing a mutant human presinilin 1 comprising a M146L mutation and a L286V mutation.
[0053] Any non-human animal may be genetically modified according to the subject disclosure. Nonlimiting examples include laboratory animals, domestic animals, livestock, etc., e.g., species such as murine, rodent, canine, feline, porcine, equine, bovine, ovine, non-human primates, etc.; for example, mice, rats, rabbits, hamsters, guinea pigs, cattle, pigs, sheep, goats and other transgenic animal species, particularly-mammalian species, as known in the art. In other embodiments, the non-human animal may be a bird, e.g., of Galliformes order, such as a chicken, a turkey, a quail, a pheasant, or a partridge; e.g., of Anseriformes order, such as a duck, a goose, or a swan, e.g., of Columbiformes order, such as a pigeon or a dove. In various embodiments, the subject genetically modified animal is a mouse, a rat or a rabbit.
[0054] In some embodiments, the non-human animal is a mammal. In some such embodiments, the non-human animal is a small mammal, e.g., of the superfamily Dipodoidea or Muroidea. In one embodiment, the genetically modified animal is a rodent. In one embodiment, the rodent is selected from a mouse, a rat, and a hamster. In one embodiment, the rodent is selected from the superfamily Muroidea. In one embodiment, the genetically modified animal is from a family selected from Calomyscidae (e.g., mouse-like hamsters), Cricetidae (e.g., hamster, New World rats and mice, voles), Muridae (true mice and rats, gerbils, spiny mice, crested rats), Nesomyidae (climbing mice, rock mice, white-tailed rats, Malagasy rats and mice), Platacanthomyidae (e.g., spiny dormice), and Spalacidae (e.g., mole rats, bamboo rats, and zokors). In a specific embodiment, the genetically modified rodent is selected from a true mouse or rat (family Muridae), a gerbil, a spiny mouse, and a crested rat.
[0055] In one embodiment, the subject genetically modified non-human animal is a mouse, e.g. a mouse of a C57BL strain (e.g. C57BL/A, C57BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL/10Cr, C57BL/Ola, etc.); a mouse of the 129 strain (e.g. 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 12951/SV, 12951/SvIm), 12952, 129S4, 129S5, 12959/SvEvH, 129S6 (129/SvEvTac), 129S7, 129S8, 129T1, 129T2); a mouse of the BALB strain; e.g., BALB/c; and the like. See, e.g., Festing et al. (1999) Mammalian Genome 10:836, see also, Auerbach et al (2000) Establishment and Chimera Analysis of 129/SvEv- and C57BL/6-Derived Mouse Embryonic Stem Cell Lines). In another embodiment, a mouse is a mix of the aforementioned strains.
[0056] In another embodiment, the subject genetically modified non-human animal is a rat. In one such embodiment, the rat is selected from a Wistar rat, an LEA strain, a Sprague Dawley strain, a Fischer strain, F344, F6, and Dark Agouti. In another embodiment, the rat strain is a mix of two or more strains selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti.
[0057] Any method known in the art for generating the non-human animal model can be used. Such techniques are well-known in the art and include, but are not limited to, pronuclear microinjection, transformation of embryonic stem cells, homologous recombination and knock-in techniques. Methods for generating genetically modified animals that can be used include, but are not limited to, those described in Sundberg and Ichiki (2006) Genetically Engineered Mice Handbook, CRC Press; Hofker and van Deursen (2002) Genetically modified Mouse Methods and Protocols, Humana Press; Joyner (2000) Gene Targeting: A Practical Approach, Oxford University Press; Turksen (2002) Embryonic stem cells: Methods and Protocols in Methods Mol Biol., Humana Press; Meyer et al. (2010) Proc. Nat. Acad. Sci. USA 107:15022-15026; and Gibson (2004), A Primer of Genome Science 2nd ed. Sunderland, Mass.: Sinauer; U.S. Pat. No. 6,586,251; Rathinam et al. (2011) Blood 118:3119-28), Willinger et al. (2011) Proc Natl Acad Sci USA 108:2390-2395; Rongvaux et al. (2011) Proc Natl Acad Sci USA 108:2378-83; and Valenzuela et al. (2003) Nat Biot 21:652-659.
[0058] For example, the subject genetically modified animals can be created by introducing the nucleic acid construct into an oocyte, e.g., by microinjection, and allowing the oocyte to develop in a female foster animal. In preferred embodiments, the nucleic acid construct is injected into fertilized oocytes. Fertilized oocytes can be collected from superovulated females the day after mating and injected with the expression construct. The injected oocytes are either cultured overnight or transferred directly into oviducts of 0.5-day p.c. pseudopregnant females. Methods for superovulation, harvesting of oocytes, expression construct injection and embryo transfer are known in the art and described in Manipulating the Mouse Embryo (2002) A Laboratory Manual, 3rd edition, Cold Spring Harbor Laboratory Press. Offspring can be evaluated for the presence of the introduced nucleic acid by DNA analysis (e.g., PCR, Southern blot, DNA sequencing, etc.) or by protein analysis (e.g., ELISA, Western blot, etc.).
[0059] As another example, the nucleic acid construct may be transfected into stem cells (e.g., ES cells or iPS cells) using well-known methods, such as electroporation, calcium-phosphate precipitation, lipofection, etc. The cells can be evaluated for the presence of the introduced nucleic acid construct by DNA analysis (e.g., PCR, Southern blot, DNA sequencing, etc.) or by protein analysis (e.g., ELISA, Western blot, etc.). Cells determined to have incorporated the expression construct can then be introduced into preimplantation embryos. For a detailed description of methods known in the art useful for the compositions and methods of the invention, see Nagy et al., (2002, Manipulating the Mouse Embryo: A Laboratory Manual, 3rd edition, Cold Spring Harbor Laboratory Press), Nagy et al. (1990, Development 110:815-821), U.S. Pat. Nos. 7,576,259, 7,659,442, 7,294,754, and Kraus et al. (2010, Genesis 48:394-399).
[0060] Genetically modified LANDO knockdown or knockout animals can be bred to additional animals carrying the genetic modification in order to produce a non-human animal that is homozygous for the LANDO knockdown or knockout.
[0061] In certain embodiments, the method comprises knocking down or knocking out LANDO in microglial tissues in a non-human animal comprising at least one additional genetic modification that contributes to neuroinflammation or neurodegeneration. The method can comprise simply crossing a non-human animal comprising the microglial LANDO knockdown or knockout with another non-human animal of the same species that comprises the at least one additional genetic modification. Alternatively, the method comprises knocking down or knocking out a LANDO-related molecule in a non-human animal already comprising the additional genetic modification.
[0062] In particular embodiments, the methods for making the non-human model further comprise introducing the at least one additional genetic modification that contributes to neuroinflammation or neurodegeneration into the non-human animal.
3. Methods of Treatment
[0063] Methods and compositions are provided herein for decreasing neuroinflammation or neurodegeneration in a subject comprising administration of an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway. In certain embodiments the subject to be treated is a LANDO-deficient subject, a subject with neuroinflammation, a subject with neurodegeneration, a subject with impaired β-amyloid clearance, a subject with β-amyloid accumulation, a subject with reactive microgliosis, a subject with hyperphosphorylation of tau, and/or a subject with behavioral and memory deficits when compared to an appropriate control.
[0064] In certain embodiments, administration of an effective amount of a pharmaceutical composition that targets the LANDO pathway can decrease the symptoms of LANDO-deficiency, decrease neuroinflammation and/or neurodegeneration, or increase β-amyloid clearance in a subject. “Treatment” is herein defined as curing, healing, alleviating, relieving, altering, remedying, ameliorating, improving, or affecting the condition or the symptoms of a LANDO-deficient subject. The subject to be treated can be suffering from or at risk of developing a neuroinflammatory or neurodegenerative disease or be at risk of developing any disease associated with LANDO-deficiency. Reducing at least one symptom of a LANDO-deficiency, neuroinflammation, neurodegeneration, Alzheimer's disease, or decreased β-amyloid clearance refers to a statistically significant reduction of at least one symptom. Such decreases or reductions can include, for example, at least a 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% decrease in the measured or observed level of at least one symptom, as disclosed elsewhere herein. Non-limiting examples of symptoms of LANDO-deficiency, neuroinflammation, neurodegeneration, Alzheimer's disease, or decreased β-amyloid clearance include behavioral and memory deficits, mood changes, anxiety, agitation, loss of inhibition, seizures, cognitive deficits, and personality changes.
[0065] In some embodiments, the subject is a LANDO-deficient subject having reduced expression of a LANDO-related molecule. As used herein, the term “LANDO-related” refers to any nucleic acid, protein, cytokine, or any other molecule that participates in the LANDO pathway. LANDO-related molecules include, but are not limited to Beclin1, ATG7, ATG5, ATG4, LC3, Rubicon, and VPS34.
[0066] As used herein, the term “reduced” refers to any reduction in the expression or activity of a LANDO-related molecule when compared to the corresponding expression or activity of the same LANDO-related molecule in a control cell. Such a reduction may be up to 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or up to 100%. Accordingly, the term “reduced” encompasses both a partial knockdown and a complete knockdown of the activity of a LANDO-related molecule.
[0067] By “subject” is intended animals. In specific embodiments, subjects are mammals, e.g., primates or humans. In other embodiments, subjects include domestic animals, such as a feline or canine, or agricultural animals, such as a ruminant, horse, swine, poultry, or sheep. In specific embodiments, the subject undergoing treatment with the pharmaceutical formulations of the invention is a human. In some embodiments, the human undergoing treatment can be a newborn, infant, toddler, preadolescent, adolescent or adult. The subjects of the invention may be suffering from the symptoms of a neuroinflammatory or neurodegenerative disorder or may be at risk for developing a neuroinflammatory or neurodegenerative disorder.
[0068] The expression of three proteins obligatory for LANDO function, Beclin1, ATG5, and ATG7, decreases with age (Lipinski et al. (2010) Proc Natl Acad Sci USA 107:14164-14169), which may lead to an insufficiency in LANDO, establishing a putative risk factor for physiological to pathological transition. Accordingly, the presently disclosed compositions can be administered to subjects that are LANDO-deficient. The term “LANDO-deficient” refers to an alteration in the LANDO pathway such that the LANDO pathway does not function properly. That is, a LANDO-deficient organism does not effectively recycle β-amyloid receptors back to the plasma membrane and subsequently suffers from β-amyloid deposits and increased neuroinflammation and neurodegeneration. A LANDO-deficient subject could have an increase or decrease in the expression or activity of any LANDO related molecule (e.g., Rubicon, ATG5, Beclin1, VPS34, ATG7, and ATG4), or a defect in the subject's clearance of β-amyloid. Particularly, a LANDO-deficient subject has an increase in pro-inflammatory cytokines or a decrease in anti-inflammatory cytokines, which may lead to increased inflammation, increased levels of neurotoxic β-amyloid accumulation, which can lead to reactive microgliosis, hyperphosphorylation of tau, neurodegeneration, and behavioral and memory deficits.
[0069] The methods and compositions disclosed herein involve a method for decreasing neuroinflammation or neurodegeneration, for treating Alzheimer's disease, or for clearing βA by administering to a subject in need thereof an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway. Such compositions can be identified using the screening methods disclosed herein. In one non-limiting embodiment, the method for decreasing neuroinflammation or neurodegeneration, for treating Alzheimer's disease, or for clearing βA comprises administering an effective amount of an agent which increases or enhances the biological activity of Rubicon. In another non-limiting embodiment, the method for decreasing neuroinflammation or neurodegeneration, for treating Alzheimer's disease, or for clearing βA comprises administering an effective amount of an agent which increases or enhances the biological activity of ATG5. In another non-limiting embodiment, the method for decreasing neuroinflammation or neurodegeneration, for treating Alzheimer's disease, or for clearing βA comprises administering an effective amount of an agent which increases or enhances the biological activity of the WD-domain of Atg16L.
[0070] A subject is considered successfully treated if they exhibit, for example, an improvement in any one of the symptoms of neuroinflammation, neurodegeneration, LANDO deficiency, Alzheimer's disease, or decreased βA clearance.
[0071] In some embodiments, it may be necessary to formulate agents to cross the blood-brain barrier (BBB). One strategy for drug delivery through the blood-brain barrier (BBB) entails disruption of the BBB, either by osmotic means such as mannitol or leukotrienes, or biochemically by the use of vasoactive substances such as bradykinin. A BBB disrupting agent can be co-administered with the agent when the compositions are administered by intravascular injection. Other strategies to go through the BBB may entail the use of endogenous transport systems, including Caveolin-1 mediated transcytosis, carrier-mediated transporters such as glucose and amino acid carriers, receptor-mediated transcytosis for insulin or transferrin, and active efflux transporters such as p-glycoprotein. Active transport moieties may also be conjugated to the therapeutic compounds for use in the invention to facilitate transport across the endothelial wall of the blood vessel. Alternatively, drug delivery of agents behind the BBB may be by local delivery, for example by intrathecal delivery, e.g. through an Ommaya reservoir (see e.g. U.S. Pat. Nos. 5,222,982 and 5,385,582, incorporated herein by reference); by bolus injection, e.g. by a syringe, e.g. intravitreally or intracranially; by continuous infusion, e.g. by cannulation, e.g. with convection (see e.g. US Application No. 20070254842, incorporated here by reference); or by implanting a device upon which the agent has been reversibly affixed (see e.g. US Application Nos. 20080081064 and 20090196903, incorporated herein by reference).
[0072] A. Neuroinflammatory or Neurodegenerative Disease
[0073] In some embodiments, neuroinflammatory disorders associated with a LANDO deficiency can be treated or prevented. Neuroinflammatory diseases can arise where there is an inflammation of the brain or neuronal tissue. The term “neuroinflammatory diseases” as used herein, includes, but are not limited to, local inflammatory responses and systemic inflammation.
[0074] In some embodiments, neurodegenerative disorders associated with a LANDO deficiency can be treated or prevented. The term “neurodegenerative disorders” as used herein, refers to the progressive loss of the structure or function of neurons, including the death of neurons. Some disorders have hallmarks of both neuroinflammation and neurodegeneration.
[0075] In specific embodiments, the disorder to be treated by the methods and compositions described herein is Alzheimer's disease. Further disorders that could be treated or prevented by the methods and compositions described herein include, but are not limited to CNS inflammatory disorders, Parkinson's disease, multiple sclerosis, Huntington's disease, and amyotrophic lateral sclerosis.
[0076] In some embodiments, administration of an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway results in a decrease in pro-inflammatory cytokine production, which may decrease or prevent an inflammatory response. As used herein, a decrease in the level of pro-inflammatory cytokine production comprises any statistically significant decrease in the level of pro-inflammatory cytokine production in a subject when compared to an appropriate control. Such decreases can include, for example, at least a 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% decrease in the level of proinflammatory cytokines. Non-limiting examples of proinflammatory cytokines include IL1-alpha, IL1-beta, TNF-alpha, IL-2, IL-3, IL-6, IL-7, IL-9, IL-12, IL-17, IL-18, TNF-alpha, CCL5, LT, LIF, IFN-alpha, IFN-beta, or IFN-gamma. Methods to assay for cytokine levels are known and include, for example Leng S., et al. (2008) J Gerontol A Biol Sci Med Sci 63(8): 879-884. Methods to assay for the production of pro-inflammatory cytokines include multiplex bead assay, ELISPOT and flow cytometry. See, for example, Maecker et al. (2005) BMC Immunology 6:13.
[0077] In certain embodiments, the administration of an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway results in an increase in anti-inflammatory cytokine production. As used herein, an “increase in” or “increasing” anti-inflammatory cytokine production comprises any statistically significant increase the anti-inflammatory cytokine level when compared to an appropriate control. Such increases can include, for example, at least a 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200% or greater increase in the anti-inflammatory cytokine level. Such increases can also include, for example, at least about a 3%-15%, 10%-25%, 20% to 35%, 30% to 45%, 40%-55%, 50%-65%, 60%-75%, 70%-85%, 80%-95%, 90%-105%, 100%-115%, 105%-120%, 115%-130%, 125%-150%, 140%-160%, 155%-500% or greater increase in the anti-inflammatory cytokine level. Anti-inflammatory cytokines of the invention include interleukin (IL)-1 receptor antagonist, IL-4, IL-10, IL-11, and IL-13, IL-16, IFN-alpha, TGF-beta, G-CSF. Methods to assay for the level of anti-inflammatory cytokine level, are known. See, for example, Leng S., et al. (2008) J Gerontol A Biol Sci Med Sci 63(8): 879-884. Methods to assay for the production of anti-inflammatory cytokines include multiplex bead assay, ELISPOT and flow cytometry. See, for example, Maecker et al. (2005) BMC Immunology 6:13.
[0078] Inflammatory cytokine production can also be measured by assaying the ratio of anti-inflammatory cytokine production to proinflammatory cytokine production. In specific aspects, the ratio of anti-inflammatory cytokine production to proinflammatory cytokine production is increased by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 300, 600, 900, 1000 fold or greater when compared to an appropriate control. In other aspects, the ratio of anti-inflammatory cytokine production to pro-inflammatory cytokine production is increased by about 1 to 5 fold, about 5 to 10 fold, about 10 to 20 fold, about 20 to 30 fold, about 30 to 40 fold, about 40 fold to 60 fold, about 60 fold to 80 fold, about 80 fold to about 100 fold, about 100 to 200 fold, about 200 fold to 300 fold, about 300 to 400 fold, about 400 to about 500 fold, about 500 to about 500 fold, about 500 fold to about 700 fold, about 700 fold to 800 fold, about 800 fold to about 1000 fold or greater when compared to an appropriate control. Methods to determine the ratio of anti-inflammatory cytokine production to pro-inflammatory cytokine production can be found, for example, Leng S., et al. (2008) J Gerontol A Biol Sci Med Sci 63(8): 879-884. Methods to assay for the production of cytokines include multiplex bead assay, ELISPOT and flow cytometry. See, for example, Maecker et al. (2005) BMC Immunology 6:13.
[0079] B. Alzheimer's Disease
[0080] In certain embodiments, administration of an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway treats Alzheimer's Disease in a subject diagnosed with Alzheimer's disease or demonstrating symptoms of the disease or those at increased risk for developing the disease.
[0081] Alzheimer's disease (AD) is a multifactorial progressive neurodegenerative disorder characterized by loss of memory and cognitive deficits. Alzheimer's disease is the most common form of both senile and presenile dementia in the world and is recognized clinically as relentlessly progressive dementia that presents with increasing loss of memory, intellectual function and disturbances in speech (Merritt (1979) A Textbook of Neurology, 6th edition, pp. 484-489 Lea & Febiger, Philadelphia). The disease itself usually has a slow and insidious progress that affects both sexes equally, worldwide. It begins with mildly inappropriate behavior, uncritical statements, irritability, a tendency towards grandiosity, euphoria and deteriorating performance at work; it progresses through deterioration in operational judgement, loss of insight, depression and loss of recent memory; it ends in severe disorientation and confusion, apraxia of gait, generalized rigidity and incontinence (Gilroy & Meyer (1979) Medical Neurology, pp. 175-179 MacMillan Publishing Co.).
[0082] Alzheimer's disease afflicts an estimated 4 million human beings in the United States alone at a cost of 35 billion dollars a year (Hay &: Ernst (1987) Am. J. Public Health 77:1169-1175). It is found in 10% of the population over the age of 65 and 47% of the population over the age of 85 (Evans et al. (1989) JAMA, 262:2551-2556). A very small percentage of AD cases (5-7%) arise in family clusters (“familial” AD) with early onset (before the age of 60) and the remaining majority of cases (>90%) with late onset (after the age of 60). Current state of knowledge suggests that familial AD is caused by a dominant mutation in one of three genes: presinilin 1 (PSEN1), presinilin 2 (PSEN2), or amyloid precursor protein (APP). A person with one of these mutations is at risk of developing symptoms before age 60. Such families are quite rare, but the 50 percent risk for each child of an affected member to carry the causative mutation means that these tests can be important for those at risk.
[0083] Genetic factors have also been associated with the sporadic or non-familial form of the disease and the allele e4 of the apolipoprotein E (Apo E) significantly increases the risk of AD, but is neither necessary nor sufficient for the development of the disease. Therefore, other genetic and environmental factors are likely to be implicated and are actively being investigated.
[0084] There are several current methods used in diagnosing Alzheimer's that include neurological exam, mental status tests, mood assessment, family history, and brain imaging. Brain imaging, such as magnetic resonance imaging (MRI), computed tomography (CT), positron emission tomography (PET), can be used to rule out other diagnoses and in some cases, help to diagnose Alzheimer's disease. PET imaging can be performed in which ligands that selectively bind to amyloid-beta plaques or hyperphosphorylated tau deposits are employed. In another technique, magnetic resonance imaging (MRI) biomarkers may be detected as an indication of Alzheimer's. These include the reduction of brain volume, specifically hippocampal volume which controls the memory part of the brain. Another indication may be decreased concentrations of Aβ or increased hyperphosphorylated tau in the cerebral spinal fluid (CSF) of an individual.
[0085] Deficiencies in the LANDO pathway can result in the failure of Aβ clearance, an increase in pro-inflammatory cytokine production, reactive microgliosis, hyperphosphorylation of tau, neurodegeneration, impaired neuronal signaling leading to behavioral and memory deficits—many of the hallmarks of Alzheimer's disease. Thus, the administration of a composition that enhances or activates the LANDO pathway can be used to restore the function of the pathway and decrease symptoms of Alzheimer's disease. Any symptom of Alzheimer's disease as described herein can be reduced by the methods described herein. In a particular embodiment, inflammation is reduced by administration of an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway in a subject experiencing AD symptoms.
[0086] C. β-Amyloid Clearance
[0087] In specific embodiments, administration of an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway decreases the symptoms of a deficiency in Aβ clearance. Accordingly, administration of an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway can increase Aβ clearance. In certain embodiments, clearance of Aβ is increased because of a restoration of all or a portion of the LANDO pathway.
[0088] In some of these embodiments, the subject to which the pharmaceutical composition is administered is a LANDO-deficient subject. The LANDO-deficient subject may have reduced expression of at least one of Beclin 1, VPS34, ATG5, ATG7, ATG4, LC3, Rubicon, and Atg16L (e.g., WD-domain of Atg16L) when compared to a control subject. The subject may comprise Aβ accumulation in the cortex, hippocampus, or both and exhibit symptoms of the same. The symptoms associated with Aβ accumulation are similar to those associated with Alzheimer's disease and include behavioral and memory deficits, mood changes, anxiety, agitation, loss of inhibition, seizures, cognitive deficits, and personality changes.
[0089] Methods for measuring Aβ clearance are known in the art and are disclosed elsewhere herein. Non-limiting examples include measuring levels of Aβ in the CSF, PET imaging with ligands that selectively bind to Aβ plaques, measuring uptake of labeled Aβ in primary microglial cells isolated from the subject, and measuring recycling of Aβ receptors (e.g., TREM2, CD36, TLR4) in primary microglial cells isolated from the subject.
4. Pharmaceutical Compositions
[0090] The methods and compositions disclosed herein encompass administration of an effective amount of a pharmaceutical composition that enhances or activates the LANDO pathway. Methods are also disclosed herein for screening for compositions or molecules that modulate (i.e., increases or decreases) LANDO activity. As used herein, the term “specifically” means the ability of a molecule that modulates the LANDO pathway to increase or decrease LANDO activity without impacting other related processes (i.e., LAP pathway, canonical autophagy). A molecule that modulates the LANDO pathway preferentially, increases or decreases LANDO activity, but might impact other phagocytosis-related pathways. Accordingly, a molecule that modulates the LANDO pathway could be any LANDO-related nucleic acid, protein, or cytokine, such as Beclin1, VPS34, ATG5, ATG7, ATG4, LC3, Rubicon, and Atg16L (e.g., WD-domain of Atg16L).
[0091] The pharmaceutical composition may be a liquid formulation or a solid formulation. When the pharmaceutical composition is a solid formulation it may be formulated as a tablet, a sucking tablet, a chewing tablet, a chewing gum, a capsule, a sachet, a powder, a granule, a coated particle, a coated tablet, an enterocoated tablet, an enterocoated capsule, a melting strip or a film. When the pharmaceutical composition is a liquid formulation it may be formulated as an oral solution, a suspension, an emulsion or syrup. Said composition may further comprise a carrier material independently selected from, but not limited to, the group consisting of lactic acid fermented foods, fermented dairy products, resistant starch, dietary fibers, carbohydrates, proteins, and glycosylated proteins. As used herein, the pharmaceutical composition could be formulated as a food composition, a dietary supplement, a functional food, a medical food, or a nutritional product as long as the required effect is achieved.
[0092] The pharmaceutical composition according to the invention, used according to the invention or produced according to the invention may also comprise other substances, such as an inert vehicle, or pharmaceutical acceptable adjuvants, carriers, preservatives etc., which are well known. By “therapeutically effective dose,” “therapeutically effective amount,” or “effective amount” is intended an amount of the composition or molecule that enhances or activates the LANDO pathway that brings about a positive therapeutic response with respect to treatment or prevention. “Positive therapeutic response” refers to, for example, improving the condition of at least one of the symptoms of a neuroinflammatory disorder, neurodegenerative disorder, decreasing at least one symptom of Alzheimer's disease and/or increasing Aβ clearance.
[0093] Examples of possible routes of administration include parenteral, (e.g., intravenous (IV), intramuscular (IM), intradermal, subcutaneous (SC), or infusion) administration. Moreover, the administration may be by continuous infusion or by single or multiple boluses. In specific embodiments, one or both of the agents is infused over a period of less than about 4 hours, 3 hours, 2 hours or 1 hour. In still other embodiments, the infusion occurs slowly at first and then is increased over time.
[0094] Generally, the dosage of the composition that activates or enhances the LANDO pathway will vary depending upon such factors as the patient's age, weight, height, sex, general medical condition and previous medical history. In specific embodiments, it may be desirable to administer the composition that enhances or activates the LANDO pathway in the range of from about 1 to 100 mg/kg, 20 to 30 mg/kg, 30 to 40 mg/kg, 40 to 50 mg/kg, 50 to 60 mg/kg, 60 to 70 mg/kg, 70 to 80 mg/kg, 80 to 100 mg/kg, 5 to 10 mg/kg, 2 to 10 mg/kg, 10 to 20 mg/kg, 5 to 15 mg/kg, 1 to 10 mg/kg, 1 to 5 mg/kg, 2 to 5 mg/kg or any range in between 1 and 100 mg/kg.
[0095] In some embodiments of the invention, the method comprises administration of multiple doses of the composition that enhances or activates the LANDO pathway. The method may comprise administration of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, or more therapeutically effective doses of a composition that enhances or activates the LANDO pathway. In some embodiments, doses are administered over the course of 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 14 days, 21 days, 30 days, or more than 30 days. The frequency and duration of administration of multiple doses of the compositions is such as to improve the condition of at least one of the symptoms of a neuroinflammatory disorder, a neurodegenerative disorder, decrease at least one symptom of Alzheimer's disease, and/or increase Aβ clearance. Changes in dosage may result and become apparent from the results of diagnostic assays for detecting neuroinflammation, neurodegeneration, Alzheimer's disease symptoms, and Aβ clearance known in the art and described herein.
5. Methods of Identifying Compounds for Modulation of LANDO Activity, Neuroinflammation, and Neurodegeneration
[0096] The methods and compositions disclosed herein include methods for identifying a molecule or composition that modulates LANDO activity. Modulating LANDO activity refers to increasing or decreasing LANDO activity or LANDO-related neuroinflammation or LANDO-related neurodegeneration. LANDO activity can be measured by any means known in the art.
[0097] In some embodiments, LANDO activity can be determined by measuring neuroinflammation. For example, measuring neuroinflammation can comprise measuring the level of a pro-inflammatory cytokine, an anti-inflammatory cytokine, or a combination of pro-inflammatory cytokines and anti-inflammatory cytokines. In specific embodiments, measuring neuroinflammation comprises measuring the level of TNFα (tumor necrosis factor alpha), IL (interleukin)-10, IL-6, or CCL5 (C—C motif chemokine ligand 5).
[0098] In other embodiments, LANDO activity can be determined by measuring β-amyloid clearance or aggregation. For example, β-amyloid plaque number and size can be measured in the hippocampus or cortex using any method known in the art, including but not limited to immunohistochemistry. In other embodiments, secondary β-amyloid uptake is measured using any method known in the art, including but not limited to using labeled β-amyloid that has been labeled with two different labels wherein the first labeled β-amyloid is initially added to medium surrounding cells or tissue and detection of the first label is an indication of primary β-amyloid uptake, and wherein the second labeled β-amyloid is subsequently added to the culture medium and detection of the second label is an indication of secondary β-amyloid uptake. The detection of the first and/or second label can be performed with any method known in the art, including but not limited to flow cytometry.
[0099] In other embodiments, LANDO activity can be determined by measuring β-amyloid receptor recycling. In some of these embodiments, the β-amyloid receptor that is measured is at least one of CD36 (cluster of differentiation 36), TLR4 (toll-like receptor 4), and TREM2 (triggering receptor expressed on myeloid cells 2). Any method known in the art can be used to measure β-amyloid receptor recycling, including immunocytochemistry and flow cytometry.
[0100] In still other embodiments, LANDO activity can be determined by measuring the association of LC3 to endosomal membranes in response to β-amyloid.
[0101] In order to identify molecules or compositions that modulate LANDO activity, but do not have an effect on the LAP pathway, the methods can comprise measuring LAP activity, such as phagocytosis (i.e., phagosome maturation, degradation of engulfed pathogens) mediated by LAPosomes (single membrane phagosome). In other embodiments, the methods and compositions that modulate LANDO activity do not have an effect on autophagy (mediated by double-membrane phagosomes).
[0102] Generally, molecules or compositions that modulate LANDO activity can be identified by any screening assay known in the art. For example, a first level of LANDO activity can be measured prior to contact with candidate molecules. A second level of LANDO activity can then be measured following contact with the candidate molecules. Molecules can be selected based on the relative first and second level of LANDO activity, before and after contact with the candidate molecules. Likewise, the level of LANDO activity could be measured in a test cell, tissue, or animal and in a control cell, tissue, or animal following exposure to the candidate molecule. In such an embodiment, the candidate molecule would be selected if the level of LANDO activity is modulated in the test cell, tissue, or animal when compared to the control cell, tissue, or animal. Similarly, the level of LANDO activity could be measured following contacting of the candidate molecule with a LANDO-deficient cell, tissue, or animal. In such an embodiment, the candidate molecule could be selected if LANDO activity was restored in the LANDO-deficient cell, tissue, or animal when compared to a wild type control.
[0103] Accordingly, candidate molecules can be selected that modulate (i.e., increase or decrease) the level of LANDO activity. A modulated level of LANDO activity can be an increase of LANDO activity, for instance an increase of at least 1.2, 1.5, 2, 3, 4, 5, 6, 7, 8, 10, 20, 50 times or more relative to an appropriate control. Alternatively, modulation can be a decrease of the level of LANDO activity, for instance a decrease of at least 1.2, 1.5, 2, 3, 4, 5, 6, 7, 8, 10, 20, 50 times or more relative to an appropriate control. In some embodiments, the increase or decrease in LANDO activity is a statistically significant increase or decrease as determined by methods known in the art.
[0104] The cells or tissue used for identifying modulation of LANDO activity could be any cell or tissue in which LANDO activity can be measured. In some embodiments the cell or tissue is a bone marrow-derived macrophage or a culture of bone marrow-derived macrophages. In other embodiments, the cell or tissue is a microglial cell or a culture of microglial cells. In still other embodiments, the cell or tissue is a myeloid cell or a culture of myeloid cells. For example, the bone marrow-derived macrophages, microglial cells, or myeloid cells can be from a LANDO-deficient animal (e.g., the genetically modified non-human animals disclosed herein). In specific embodiments, bone marrow-derived macrophages are isolated from Rubicon or ATG deficient mice. In alternative embodiments, bone marrow-derived macrophages are isolated from Atg16L.sup.ΔWD mice or mice lacking the WD-domain of Atg16L (also referred to herein as Atg16L WD-domain deficient mice).
[0105] Methods for identifying a molecule or composition that modulates LANDO activity can also be tested in vivo in the genetically modified non-human animals comprising a microglial LANDO knockdown or knockout disclosed herein. These methods can comprise measuring a first LANDO activity in the genetically modified non-human animal, then administering a candidate compound to the genetically modified non-human animal and measuring a second LANDO activity after administration to determine the effect on LANDO activity by the candidate compound. These measurements can also be compared to the effects of the candidate compound on a control animal in which the LANDO pathway is intact.
[0106] An analysis of the response of cells, tissues, or an animal to the candidate agent may be performed at any time following treatment with the agent. For example, the cells may be analyzed 1, 2, or 3 days, sometimes 4, 5, or 6 days, sometimes 8, 9, or 10 days, sometimes 14 days, sometimes 21 days, sometimes 28 days, sometimes 1 month or more after contact with the candidate agent, e.g., 2 months, 4 months, 6 months or more. In some embodiments, the analysis includes analysis at multiple time points. The selection of the time point(s) for analysis will be based upon the type of analysis to be performed, as will be readily understood by the ordinarily skilled artisan.
[0107] Candidate agents of interest for screening include known and unknown compounds that encompass numerous chemical classes, primarily organic molecules, which may include organometallic molecules, inorganic molecules, genetic sequences, vaccines, peptides, polypeptides, antibodies, antigen-binding proteins, agents that have been approved pharmaceutical for use in a human, etc.
[0108] Candidate agents include organic molecules including functional groups necessary for structural interactions, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, frequently at least two of the functional chemical groups. The candidate agents often include cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Candidate agents are also found among biomolecules, including peptides, polynucleotides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof. Included are pharmacologically active drugs, genetically active molecules, etc.
[0109] Candidate agents may be obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds, including biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs.
[0110] Molecules and compounds isolated by the methods disclosed herein can be formulated as pharmaceutical compositions for administration according to the methods disclosed herein.
EMBODIMENTS
[0111] 1. A method for decreasing neuroinflammation or neurodegeneration in a LC3-associated endocytosis (LANDO)-deficient subject comprising administering an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway, wherein said administration of an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway decreases neuroinflammation or neurodegeneration.
[0112] 2. The method of embodiment 1, wherein said pharmaceutical composition that activates or enhances the LANDO pathway has no significant effect on LC3-associated phagocytosis (LAP).
[0113] 3. The method of embodiment 1 or 2, wherein said LANDO-deficient subject has reduced expression of at least one of: Beclin1, VPS34, ATG5, ATG7, ATG4, LC3A, LC3B, Rubicon, and Atg16L WD-domain; when compared to a subject not deficient in LANDO.
[0114] 4. The method of any one of embodiments 1-3, wherein said LANDO-deficient subject has reduced expression of Rubicon, ATG5, or Atg16L WD-domain when compared to a subject not deficient in LANDO.
[0115] 5. The method of any one of embodiments 1-4, further comprising detecting failed clearance of β-amyloid prior to administering an effective amount of said pharmaceutical composition.
[0116] 6. The method of any one of embodiments 1-5, wherein said decreased neuroinflammation or neurodegeneration comprises any one of: reduced expression of pro-inflammatory genes, reduced β-amyloid deposition or plaque formation, reduced tau hyperphosphorylation, reduced microglial activation, reduced microglial ramified to ameboid transition, reduced microgliosis, reduced neuronal cell death, reduced electrophysiological impairment, reduced behavior deficits, and reduced memory deficits.
[0117] 7. A method for treating Alzheimer's disease comprising administering an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway to a subject diagnosed with Alzheimer's disease or demonstrating symptoms of the disease, wherein said administration of an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway decreases at least one symptom of Alzheimer's disease.
[0118] 8. The method of embodiment 7, wherein said subject has reduced expression of at least one of: Beclin1, VPS34, ATG5, ATG7, ATG4, LC3A, LC3B, Rubicon, and Atg16L WD-domain; when compared to a subject not deficient in LANDO.
[0119] 9. The method of embodiment 7 or 8, wherein said subject has reduced expression of Rubicon, ATG5 or Atg16L WD-domain when compared to a subject not deficient in LANDO.
[0120] 10. The method of any one of embodiments 7-9, further comprising detecting failed clearance of β-amyloid prior to administering an effective amount of said pharmaceutical composition.
[0121] 11. A method for clearing β-amyloid in a subject deficient in β-amyloid clearance comprising administering an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway.
[0122] 12. The method of embodiment 11, wherein said subject is a LANDO-deficient subject.
[0123] 13. The method of embodiment 12, wherein said subject has reduced expression of at least one of: Beclin1, VPS34, ATG5, ATG7, ATG4, LC3A, LC3B, Rubicon, and Atg16L WD-domain; when compared to a subject not deficient in LANDO.
[0124] 14. The method of embodiment 12 or 13, wherein said subject has reduced expression of Rubicon, ATG5 or Atg16L WD-domain when compared to a subject not deficient in LANDO.
[0125] 15. The method of any one of embodiments 11-14, wherein said subject comprises β-amyloid accumulation in at least one of the cortex and hippocampus prior to administration of said pharmaceutical composition.
[0126] 16. The method of embodiment 15, wherein said subject exhibits symptoms of said β-amyloid accumulation prior to administration of said pharmaceutical composition.
[0127] 17. A method for identifying a compound that modulates LANDO activity and does not significantly modulate LAP activity, said method comprising:
[0128] measuring a first level of LANDO activity and LAP activity in a cell or tissue;
[0129] contacting the cell or tissue with a candidate compound;
[0130] measuring a second level of LANDO activity and LAP activity of said cell or tissue after contact with said candidate compound;
[0131] comparing said first level of LANDO activity with the second level of LANDO activity and comparing said first level of LAP activity with the second level of LAP activity; and selecting compounds that modulate the LANDO activity and do not significantly modulate the LAP activity.
[0132] 18. A method for identifying a compound that modulates LANDO activity and does not significantly modulate LAP activity, said method comprising:
[0133] contacting a test cell or tissue with a candidate compound;
[0134] measuring a first level of LANDO activity and LAP activity of said test cell or tissue after contact with said candidate compound;
[0135] measuring a second level of LANDO activity and LAP activity from a control cell or tissue;
[0136] comparing said first level of LANDO activity with said second level of LANDO activity and comparing said first level of LAP activity with the second level of LAP activity; and
[0137] selecting compounds that modulate the LANDO activity and do not significantly modulate the LAP activity.
[0138] 19. The method of embodiment 17 or 18, wherein compounds are selected that increase LANDO activity.
[0139] 20. The method of any one of embodiments 17-19, wherein measuring said first and second level of LANDO activity comprises measuring β-amyloid clearance.
[0140] 21. The method of any one of embodiments 17-20, wherein measuring said first and second level of LANDO activity comprises measuring recycling of at least one β-amyloid receptor from endosomes to plasma membrane.
[0141] 22. The method of embodiment 21, wherein said at least one β-amyloid receptor is selected from CD36, TLR4, and TREM2.
[0142] 23. The method of any one of embodiments 17-22, wherein measuring said first and second level of LAP activity comprises measuring phagocytosis.
[0143] 24. The method of any one of embodiments 17-23, wherein said cell or tissue comprises a bone marrow-derived macrophage or a culture of bone marrow-derived macrophages, a microglial cell or a culture of microglial cells, or a myeloid cell or a culture of myeloid cells.
[0144] 25. The method of embodiment 24, wherein said bone marrow-derived macrophage, microglial cell, or myeloid cell is derived from LANDO-deficient mice.
[0145] 26. The method of embodiment 25, wherein said LANDO-deficient mice are Rubicon deficient, ATG5 deficient or Atg16L WD-domain deficient.
[0146] 27. The method of any one of embodiments 17-26, wherein said selected molecule modulates LANDO activity when administered to a subject.
[0147] 28. The method of embodiment 27, wherein said subject is a LANDO-deficient subject.
[0148] 29. The method of embodiment 28, wherein said LANDO-deficient subject has reduced expression of at least one of. Beclin1, VPS34, ATG5, ATG7, ATG4, LC3, Rubicon, and Atg16L WD-domain; when compared to a subject not deficient in LANDO.
[0149] 30. The method of embodiment 28 or 29, wherein said LANDO-deficient subject has reduced expression of Rubicon, ATG5 or Atg16L WD-domain when compared to a subject not deficient in LANDO.
[0150] 31. The method of any one of embodiments 28-30, wherein said LANDO-deficient subject exhibits neuroinflammation or neurodegeneration.
[0151] 32. A pharmaceutical composition comprising a molecule selected by the method of any one of embodiments 17-31.
[0152] 33. Use of a pharmaceutical composition that activates or enhances the LANDO pathway for decreasing neuroinflammation or neurodegeneration or treating Alzheimer's disease according to the methods of embodiments 1-6 or 7-10, respectively.
[0153] 34. Use of a pharmaceutical composition that activates or enhances the LANDO pathway according to the method of any one of embodiments 1-16 or that is identified by the method of any one of embodiments 17-30 as a medicament.
[0154] 35. A pharmaceutical composition that activates or enhances the LANDO pathway for use in treating a neuroinflammatory disorder, neurodegenerative disorder, or Alzheimer's disease in a LANDO-deficient subject, said use comprising administering an effective amount of a pharmaceutical composition that activates or enhances the LANDO pathway to the subject.
[0155] 36. The pharmaceutical composition of embodiment 35, wherein said subject has reduced expression of at least one of: Beclin1, VPS34, ATG5, ATG7, ATG4, LC3A, LC3B, Rubicon, and Atg16L WD-domain; when compared to a subject not deficient in LANDO.
[0156] 37. A mouse model of neuroinflammation or neurodegeneration comprising microglial LANDO knockdown or knockout and at least one additional genetic modification that contributes to neuroinflammation or neurodegeneration.
[0157] 38. The mouse model of embodiment 37, wherein said microglial LANDO knockdown or knockout targets at least one of Rubicon, ATG5, and Atg16L WD-domain.
[0158] 39. The mouse model of embodiment 37 or 38, wherein said microglial LANDO knockdown or knockout targets Rubicon.
[0159] 40. The mouse model of any one of embodiments 37-39, wherein said microglial LANDO knockdown or knockout is tissue-specific.
[0160] 41. The mouse model of embodiment 40, wherein said microglial LANDO knockdown or knockout is specific to cells of the myeloid lineage and microglia.
[0161] 42. The mouse model of any one of embodiments 37-41, wherein said microglial LANDO knockdown or knockout is mediated by a site-specific recombinase system.
[0162] 43. The mouse model of embodiment 42, wherein said site-specific recombinase system comprises Cre/lox.
[0163] 44. The mouse model of embodiment 42 or 43, wherein expression of a site-specific recombinase is under the control of the lysozyme 2 promoter.
[0164] 45. The mouse model of any one of embodiments 40-44, wherein said knockdown or knockout targets ATG5 and/or Atg16L WD-domain.
[0165] 46. The mouse model of any one of embodiments 37-45, wherein said at least one additional genetic modification that contributes to neuroinflammation or neurodegeneration comprises mutations or expression of transgenic molecules that lead to overexpression of a mutated amyloid precursor protein (APP) present in familial Alzheimer's disease (FAD).
[0166] 47. The mouse model of embodiment 46, wherein said mutated amyloid precursor protein comprises at least one of K670N, M671L, I716V, and V717I in relation to human APP(695).
[0167] 48. The mouse model of embodiment 47, wherein said mouse model transgenically expresses mutant human APP(695) comprising all of the following mutations: K670N, M671L, I716V, and V717I.
[0168] 49. The mouse model of embodiment 48, wherein expression of mutant human APP(695) is regulated by a tissue-specific promoter that is expressed in the central nervous system.
[0169] 50. The mouse model of embodiment 49, wherein expression of mutant human APP(695) is under the regulation of the murine Thy1 promoter.
[0170] 51. The mouse model of any one of embodiments 46-50, wherein said mouse model transgenically expresses mutant human presinilin 1 comprising a M146L mutation and a L286V mutation.
[0171] 52. The mouse model of embodiment 51, wherein expression of mutant human presinilin 1 is regulated by a tissue-specific promoter that is expressed in the central nervous system.
[0172] 53. The mouse model of embodiment 52, wherein expression of mutant human presinilin 1 is under the regulation of the murine Thy1 promoter.
[0173] 54. The mouse model of any one of embodiments 46-53, wherein said mouse model comprises a 5×FAD transgenic mouse or a Atg16L.sup.ΔWD mouse transgenically expressing a mutant human APP(695) with the following mutations: K670N, M671L, I716V, and V717I and transgenically expressing a mutant human presinilin 1 comprising a M146L mutation and a L286V mutation.
[0174] 55. The mouse model of any one of embodiments 37-54, wherein said microglial LANDO knockdown or knockout increases penetrance of neuroinflammation or neurodegeneration, reduces age of onset of neuroinflammation or neurodegeneration, or both increases penetrance and reduces age of onset of neuroinflammation or neurodegeneration, when compared to a mouse lacking microglial LANDO knockdown or knockout.
[0175] 56. A method of making a mouse model of neuroinflammation or neurodegeneration comprising microglial LANDO knockdown or knockout and at least one additional genetic modification that contributes to neuroinflammation or neurodegeneration, wherein said method comprises knocking down or knocking out LANDO in microglial tissues in a mouse comprising at least one additional genetic modification that contributes to neuroinflammation or neurodegeneration.
[0176] 57. The method of embodiment 56, wherein said method further comprises introducing said at least one additional genetic modification that contributes to neuroinflammation or neurodegeneration.
[0177] 58. The method of embodiment 56, wherein said method comprises crossing a mouse comprising microglial LANDO knockdown or knockout with a mouse comprising at least one additional genetic modification that contributes to neuroinflammation or neurodegeneration.
[0178] 59. The method of any one of embodiments 56-58, wherein said microglial LANDO knockdown or knockout targets at least one of Rubicon, ATG5, and Atg16L WD-domain.
[0179] 60. The method of any one of embodiments 56-59, wherein said microglial LANDO knockdown or knockout targets Rubicon.
[0180] 61. The method of any one of embodiments 56-60, wherein said microglial LANDO knockdown or knockout is tissue-specific.
[0181] 62. The method of embodiment 61, wherein said microglial LANDO knockdown or knockout is specific to cells of the myeloid lineage and microglia.
[0182] 63. The method of any one of embodiments 56-62, wherein said microglial LANDO knockdown or knockout is mediated by a site-specific recombinase system and wherein said method further comprises generating said mouse comprising microglial LANDO knockdown or knockout using said site-specific recombinase system.
[0183] 64. The method of embodiment 63, wherein said site-specific recombinase system comprises Cre/lox.
[0184] 65. The method of embodiment 63 or 64, wherein expression of a site-specific recombinase is under the control of the lysozyme 2 promoter.
[0185] 66. The method of any one of embodiments 61-65, wherein said knockdown or knockout targets ATG5 and/or the Atg16L WD-domain.
[0186] 67. The method of any one of embodiments 56-66, wherein said at least one additional genetic modification that contributes to neuroinflammation or neurodegeneration comprises mutations or expression of transgenic molecules that lead to overexpression of a mutated amyloid precursor protein (APP) present in familial Alzheimer's disease (FAD).
[0187] 68. The method of embodiment 67, wherein said mutated amyloid precursor protein comprises at least one of K670N, M671L, I716V, and V717I in relation to human APP(695).
[0188] 69. The method of embodiment 68, wherein said mouse model transgenically expresses mutant human APP(695) comprising all of the following mutations: K670N, M671L, I716V, and V717I.
[0189] 70. The method of embodiment 69, wherein expression of mutant human APP(695) is regulated by a tissue-specific promoter that is expressed in the central nervous system.
[0190] 71. The method of embodiment 70, wherein expression of mutant human APP(695) is under the regulation of the murine Thy1 promoter.
[0191] 72. The method of any one of embodiments 67-71, wherein said mouse model transgenically expresses mutant human presinilin 1 comprising a M146L mutation and a L286V mutation.
[0192] 73. The method of embodiment 72, wherein expression of mutant human presinilin 1 is regulated by a tissue-specific promoter that is expressed in the central nervous system.
[0193] 74. The method of embodiment 73, wherein expression of mutant human presinilin 1 is under the regulation of the murine Thy1 promoter.
[0194] 75. The method of any one of embodiments 67-74, wherein said mouse model comprises a 5×FAD transgenic mouse transgenically expressing a mutant human APP(695) with the following mutations: K670N, M671L, I716V, and V717I and transgenically expressing a mutant human presinilin 1 comprising a M146L mutation and a L286V mutation.
[0195] 76. The method of any one of embodiments 56-75, wherein said microglial LANDO knockdown or knockout increases penetrance or neuroinflammation or neurodegeneration, reduces age of onset of neuroinflammation or neurodegeneration, or both increases penetrance and reduces age of onset of neuroinflammation or neurodegeneration, when compared to a mouse lacking microglial LANDO knockdown or knockout.
[0196] 77. A mouse model of neuroinflammation or neurodegeneration produced by the method of any one of embodiments 56-76.
[0197] 78. A method for identifying a compound that modulates neuroinflammation or neurodegeneration, said method comprising:
[0198] a) administering a candidate compound to said mouse model of any one of embodiments 37-55 or 77;
[0199] b) measuring the effect of said candidate compound on neuroinflammation or neurodegeneration as compared to said mouse model prior to administration of said candidate compound or said mouse model not having been administered said candidate compound; and
[0200] c) selecting compounds that modulate neuroinflammation or neurodegeneration.
[0201] 79. The method of embodiment 78, wherein measuring the effect of said candidate compound on neuroinflammation or neurodegeneration comprises measuring any one of: expression of pro-inflammatory genes, β-amyloid deposition or plaque formation, tau hyperphosphorylation, microglial activation, microglial ramified to ameboid transition, microgliosis, neuronal cell death, electrophysiological impairment, behavior deficits, and memory deficits.
[0202] 80. The method of embodiment 79, wherein expression of any one of the following pro-inflammatory genes are measured: IL-1β, IL-6, CCL5, and TNFα.
[0203] 81. The method of embodiment 79, wherein said microglial activation is measured by measuring expression of Iba1.
[0204] 82. The method of embodiment 79, wherein behavior deficits are measured using a sucrose preference test.
[0205] 83. The method of embodiment 79, wherein memory deficits are measured using a novel object recognition test, a Y-maze test, or both.
[0206] 84. Use of a pharmaceutical composition that activates or enhances the LANDO pathway in the manufacture of a medicament for decreasing neuroinflammation or neurodegeneration or treating Alzheimer's disease according to the methods of embodiments 1-6 or 7-10, respectively.
EXPERIMENTAL
Example 1. ATG5 and Rubicon-Deficiency Exacerbate β-Amyloid Deposition and Pathology
[0207] To ascertain the involvement of myeloid autophagy in the establishment and progression of amyloid deposition and neuroinflammation, a murine model was employed in which animals express transgenes of APP and Presenilin1 containing several mutations associated with human familial AD, the 5×FAD (B6.Cg-Tg (APPSwFILon, PSEN1*M146L*L286V) 6799Vas) model (Oakley et al. (2006) J Neurosci 26:10129-10140). These animals accumulate β-amyloid, have increased tau phosphorylation, and eventually show signs of neuronal loss and behavioral changes consistent with neurodegeneration (Oakley et al. (2006)). The 5×FAD transgene was crossed into mice with conditional ablation of the key autophagy regulators FIP200 and ATG5 using lysozyme M (LysM/Lyz2)-Cre-lox recombination, which targets cells of the myeloid lineage and microglia, with an efficiency ranging from 40-90% in microglia (Abram et al. (2014) J Immunol Methods 408:89-100; Ferro et al. (2018) PLoS One 13:e0200013; Pulido-Salgado et al. (2017) J Neuroinflammation 14:54). Primary microglia isolated from LysM-Cre.sup.+ FIP200.sup.fl/fl and ATG5.sup.fl/fl mice (referred to as FIP200,cre.sup.+ and ATG5,cre.sup.+) showed a significant reduction in mRNA and protein expression when compared to LysM-Cre-littermates (
[0208] Mice that are autophagy-deficient (5×FAD, FIP200,cre.sup.+) have no difference in β-amyloid deposition when compared to LysM-Cre.sup.− littermates (
Example 2. LC3 is Recruited to Endosomes Containing β-Amyloid
[0209] In an attempt to delineate the discrepancies in β-amyloid accumulation in the animal models presented above and the role of the autophagy proteins in this process, BV2 murine microglial cells expressing GFP-LC3 that are deficient in FIP200, ATG5, or Rubicon were engineered using CRISPR/Cas9 (
[0210] These findings with ATG5, Rubicon, and FIP200 are consistent with a well-established non-canonical function of autophagy proteins in the LC3-associated phagocytosis (LAP) pathway (Heckmann et al. (2017) J Mol Biol 429:3561-3576). Deficiencies in LAP have been shown to reduce the ability of a cell to degrade phagosome cargo, including dying cells, fungi, and bacteria by impairing phagosome maturation and lysosomal interaction (Heckmann et al. (2017); Martinez et al. (2011) Proc Natl Acad Sci USA 108:17396-17401; Martinez et al. (2016) Nature 533:115-119; Martinez et al. (2015) Nat Cell Biol 17:893-906). This may in part explain the increased β-amyloid accumulation observed in these deficient murine models. To test this idea, a pulse-chase assay was performed using oligomeric TAMRA-labeled Aβ1-42. Ablation of either ATG5 or Rubicon, however, had no effect on either the endocytosis or degradation of β-amyloid (
[0211] A previous study has shown that the recycling of the putative β-amyloid receptors TREM2 and CD36 to the plasma membrane, following receptor-mediated endocytosis, required two autophagy proteins, Beclin1 and VPS34 (Lucin et al. (2013) Neuron 79:873-886). Therefore, the role of FIP200, ATG5, and Rubicon in recycling of TREM2, CD36, and TLR4 was examined (the latter has been suggested to be another putative β-amyloid receptor (Reed-Geaghan et al. (2009) J Neurosci 29:11982-11992; Song et al. (2011) J Neuroinflammation 8:92). First, it was assessed if subsequent rounds of β-amyloid endocytosis would be impacted in the microglial model. BV2 cells were treated with Aβ1-42 labeled with a 488-fluor and measured primary β-amyloid uptake. Consistent with the clearance assay, the loss of FIP200, ATG5, or Rubicon had no effect on primary uptake of β-amyloid (
[0212] To better understand the abrogation of secondary uptake, the impact of loss of FIP200, ATG5, and Rubicon on receptor recycling was evaluated, using an established method (Lucin et al. (2013) Neuron 79:873-886). In BV2 microglia, depletion of FIP200 had no effect on the internalization (
[0213] To further explore this phenomenon, the RAW264.7 myeloid cell line was employed, and it was found that TLR4, TREM2, and CD36 effectively recycled to the plasma membrane following antibody-induced internalization. This recycling was dramatically impaired upon CRISPR/Cas9-mediated ablation of Rubicon or ATG5 (
[0214] The analysis was then extended, using primary, bone marrow-derived macrophages (BMDMs) from animals with myeloid ablation of a number of genes required for autophagy and/or LAP (
Example 3. LANDO Protects Against β-Amyloid Induced Neuroinflammation
[0215] These data suggest that the exacerbation of β-amyloid accumulation in the LANDO-deficient mice is a result of impaired recycling of putative β-amyloid receptors leading to extracellular deposition. β-amyloid, especially the Aβ1-42 oligomer and fibril, is an established instigator of neuroinflammation (Cai et al. (2014) Int J Neurosci 124:307-321). Since a vital role for LAP in regulating inflammatory immune responses has previously been shown (Martinez et al. (2016) Nature 533:115-119), it was hypothesized that defective LANDO may have a similar effect. Therefore, the production of inflammatory cytokines in the BMDMs exposed to Aβ1-42 oligomers in the above experiment was assessed. Strikingly, those genotypes that displayed defective receptor recycling showed a dramatically elevated TNFα, IL-1β, and IL-6 response to Aβ1-42 (
[0216] Similarly, the effects of Aβ1-42 on microglia were examined. As expected, BV2 cells treated with Aβ1-42 had elevated pro-inflammatory gene expression, including IL-1β, IL-6, CCL5, and TNFα as reported (Pan et al. (2011) Mol Neurodegener 6:45) and consistent with human disease. FIP200-deficiency failed to have any impact on cytokine expression in response to Aβ1-42 (
[0217] These findings were further substantiated in primary microglia from Rubicon-deficient mice. A potent hyperactivation of TNFα, IL1-β and IL-6 was observed at both the mRNA (
[0218] Since a strong exacerbation of pro-inflammatory gene expression was observed in response to Aβ1-42 in vitro, it was next assessed if reactive microglial activation and neuroinflammation was present in the murine models. Using Iba1 as a marker for microglial activation (Hoogland et al. (2015) J Neuroinflammation 12:114), hippocampal and cortical sections were assessed to evaluate microglial activation. Consistent with the in vitro findings, myeloid FIP200-deficiency had no effect on the extent of microglial activation in either the hippocampus or cortex of 5×FAD mice (
[0219] Hyperactivation of microglia typically leads to the morphological transition of cells from the ramified to the ameboid state, resulting in a decreased phagocytic/endocytic capacity and increased inflammatory polarization (Kim and Joh (2006) Exp Mol Med 38:333-347). Morphological analysis of microglia in the hippocampus of 5×FAD LANDO-deficient mice revealed ramified to ameboid transition, with Rubicon-deficient and myeloid ATG5-deficient mice having a reduction in ramified microglia in the hippocampus when normalized to total microglial population compared to control littermates (
[0220] Due to the high level of microglia activation in the ATG5 and Rubicon-deficient mice, and the transition to the more active/reactive ameboid morphology, the most clinically relevant pro-inflammatory cytokines implicated in neuroinflammation in AD were profiled (Shaftel et al. (2008) J Neuroinflammation 5:7). Consistent with what was observed with cultured cells (
[0221] These results suggest a critical role for Rubicon and myeloid ATG5 in mitigating reactive/inflammatory microglial activation in the 5×FAD model, thereby dampening neuroinflammation. Taken as a whole, these data suggest that LANDO may contribute to not only the regulation of aberrant β-amyloid deposition but also the immune activation of microglial cells in response to β-amyloid exposure.
Example 4. LANDO-Deficient 5×FAD Mice have Robust Tau Pathology
[0222] In agreement with human AD, LANDO-deficient 5×FAD animals displayed severe β-amyloid accumulation that promoted reactive microgliosis and neuroinflammation. A marker of progressive AD in both humans and mice is the hyperphosphorylation of the microtubule-stabilizing protein tau. The incidence of tau hyperphosphorylation increases as disease progresses and leads to microtubule de-stabilization and ultimately failure of the microtubule architecture, especially within neuronal axons (Frost et al. (2015) Trends Cell Biol 25:46-53; Gong and Iqbal (2008) Curr Med Chem 15:2321-2328; Noble et al. (2013) Front Neurol 4:83). The phosphorylation state of tau was evaluated and the presence of phospho-tau was identified which paralleled both our β-amyloid and microglial phenotypes. Again, myeloid FIP200 depletion had no impact on the phosphorylation of tau, however loss of either Rubicon or myeloid ATG5 promoted tau hyperphosphorylation throughout the hippocampus (
Example 5. LANDO-Deficient 5×FAD Mice Display Accelerated Neuronal Death and Impaired Neuronal Function
[0223] Because tau hyperphosphorylation is likely to promote axonal degeneration and eventual neuronal death, we analyzed cell death within the brains of our 5×FAD models. To evaluate the total number of neurons within the hippocampus, sections were stained with the neuronal nuclei marker, NeuN. 5×FAD Rubicon.sup.−/− and myeloid ATG5-deficient mice both have a decrease in NeuN positive neurons in the hippocampus (
[0224] Since a reduction in the number of neurons was observed in both of the LANDO-deficient models, but not the autophagy-deficient model, cell death was evaluated in brains isolated from the more penetrant genotype (5×FAD Rubicon.sup.−/−). To measure neuronal apoptosis specifically, immunofluorescence microscopy staining was performed for cleaved-caspase 3. There was a robust increase in cleaved-caspase 3 positive neurons in 5×FAD Rubicon-deficient mice compared to littermate controls in the CA3-field of the hippocampus (
[0225] Electrophysiological assessment of neuronal function was next performed in an effort to substantiate and define the results demonstrating neuron loss in the CA3-field. Through the use of hippocampal electrophysiology, it was found that 5×FAD Rubicon.sup.−/− mice had a large reduction in synaptic transmission and as a consequence impaired long-term potentiation (LTP) when compared to littermate controls (
Example 6. LANDO-Deficiency Accelerates Behavioral and Memory Impairment in 5×FAD Mice
[0226] Thus far, these data are supportive of a physiological role for LANDO in the mitigation and protection against neuroinflammation and immune-mediated aggregate (β-amyloid) removal. Mice were therefore subjected to a variety of well-characterized behavioral tests known to be affected at late stages in the 5×FAD model. In advanced AD, patients often complain of anhedonia, or the inability to sense pleasure (Naudin et al. (2015) Psychiatry Res 228:228-232; Reichman and Coyne (1995) J Geriatr Psychiatry Neurol 8:96-99), which can be analyzed in mice using a sucrose preference test (SPT) (Briones et al. (2012) Br J Pharmacol 165:897-907; Liu et al. (2018) Nat Protoc 13:1686-1698). 5×FAD mice that were deficient in myeloid FIP200 showed no variation in their preference for sucrose water when compared to wild-type 5×FAD animals, suggesting they have intact reward behavior (
[0227] Results from the SPTs suggested a more pervasive memory impairment. Therefore, two routinely used tests for short-term and working short-term memory were employed, the novel object recognition test (NOR) and the Y-maze test respectively. Consistent with their performance in the SPT, 5×FAD Rubicon.sup.−/− and myeloid ATG5-deficient mice had a reduction in spontaneous alternation (
Example 7. Deletion of Atg16L WD-Domain Results in Spontaneous AD-Like Pathology
[0228] To determine the importance of the WD-domain of Atg16L in central nervous system physiology, aged mice lacking the WD-domain of Atg16L (Atg16L.sup.ΔWD mice) (Rai et al. 2018 Autophagy 15(4): 599-612) were evaluated. The findings are described in
[0229] When compared to littermate controls (Atg16L.sup.+/− mice), WD-domain deficient (Atg16L.sup.ΔWD) mice aged to two years showed robust deposition of endogenous murine Aβ in both the hippocampus (
[0230] In addition to Aβ deposition, pervasive hyper phosphorylation of the microtubule-stabilizing protein Tau was observed in the hippocampus (
[0231] Since aged mice lacking the WD-domain of Atg16L had robust Aβ deposition and Tau hyperphosphorylation, it was important to know how the loss of the WD-domain was contributing to endogenous Aβ accumulation. It has previously been shown that components of the autophagy machinery are required for recycling of Aβ receptors in LANDO, and defects in this recycling can lead to aberrant Aβ accumulation. Therefore, to interrogate a plausible mechanism leading to Aβ deposition, LANDO-dependent recycling of the putative Aβ receptors TREM2, CD36, and TLR4, and contribution of the WD-domain of Atg16L to this process was evaluated. As described in
Example 8. Mice Lacking the WD-Domain of Atg16L have Robust Neuroinflammation
[0232] As described in Example 7, mice lacking the WD-domain of Atg16L (Atg16L.sup.ΔWD mice) showed spontaneous AD-like pathology, including robust deposition of endogenous Aβ. A consequence of Aβ-deposition in both human disease and murine models of AD is the activation of microglia towards a pro-inflammatory phenotype. Thus, to determine the effect of WD-domain deficiency on neuroinflammation, aged mice lacking the WD-domain of Atg16L (Atg16L.sup.ΔWD mice) were evaluated. The findings are described in
[0233] As described in
Example 9. Atg16L WD-Domain Deficiency Leads to Neurodegeneration in Aged Mice
[0234] As described in Examples 7 and 8, mice lacking the WD-domain of Atg16L (Atg16L.sup.ΔWD mice) showed endogenous Aβ-deposition, Tau phosphorylation, and neuroinflammation, all of which are known risk factors for impairment of neuronal function. Thus, to determine the effect of WD-domain deficiency on impairment of neuronal function, neuronal architecture and function of Atg16L WD-domain deficient mice (Atg16L.sup.ΔWD mice) was evaluated. The findings are described in
[0235] Compared to control littermates (Atg16L.sup.+/+ mice), 2-year-old Atg16L.sup.ΔWD mice had widespread cleavage of caspase 3 in CA3-pyramidal neurons extending into the axonal protrusions, suggesting activation of caspase-3 and apoptotic death (
[0236] Due to the observed loss of neurons within the CA3-field, the physiological function of neurons within the hippocampus was next evaluated. Impaired synaptic plasticity is a well-established consequence of AD in humans. Using hippocampal electrophysiology, it was found that 2-year-old Atg16L.sup.ΔWD mice had a significant reduction in hippocampal long-term potentiation (LTP) (
[0237] As a consequence of reduced LTP, Atg16L.sup.ΔWD mice presented with severe behavioral and memory deficiency. As described in
Example 10. Inhibition of Neuroinflammation Alleviates AD-Like Pathology in Atg16L.SUP.ΔWD .Mice
[0238] Results described in Examples 7-9 indicated that deletion of the WD-domain of Atg16L leads to age-associated development of an endogenous, spontaneous AD-like pathology. Next, the Atg16L WD-domain deficient mice (Atg16L.sup.ΔWD mice) were evaluated to determine whether the observed pathology and memory impairment could be reversed once established, and to what extent was the behavioral pathology a consequence of neurodegeneration compared to neuroinflammation. The findings are described in
[0239] Inflammasome inhibition has recently been proposed as putative therapeutic approach that reduces neuroinflammation and Tau phosphorylation (PMID: 31748742). Thus, Atg16L WD-domain deficient mice (Atg16L.sup.ΔWD mice) with established disease (starting at 20 months of age) and behavioral impairment, as measured by both impaired spontaneous alternation and NOR (
[0240] Consequently, Atg16L.sup.ΔWD mice treated with MCC950 had a restoration in their behavioral and memory capacity trending towards wild-type littermates (Atg16L.sup.+/+ mice) in both the Y-maze (
Example 11. Methods for Examples 1-10
Materials & Reagents
[0241]
TABLE-US-00001 REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-TLR4 Abcam ab22048 Anti-CD36 Abcam ab23680 Anti-NeuN (1B7) Abcam ab104224 Anti-NeuN Abcam ab177487 Anti-LAMP1 Abcam ab25630 Anti-CD11b Abcam ab8878 Anti-TMEM119 Abcam ab209064 Anti-Cleaved-caspase 3 Cell Signaling 9664 Anti-FIP200 Cell Signaling 12436 Anti-ATG5 Cell Signaling 12994 Anti-Rubicon (D9F7) Cell Signaling 8465 Anti-Tau Cell Signaling 46687 Anti-Ap 82E1 IBL 10326 Anti-Iba1 Novus NB100-1028 Anti-Aβ MOAB-2 Novus NBP2-13075 Anti-TREM2 R&D Systems MAB17291 Anti-FLAG M2 Sigma-Aldrich F3165 Anti-β-actin HRP Thermo MA1-91399 Anti-phospho-tau (S202/T205) Thermo 44-768G Chemicals, Peptides, and Misc, Reagents p-amyloid (1-42) peptide - unlabeled Anaspec AS-20276 p-amyloid (1-42) peptide - TAMRA Anaspec AS-60476 p-amyloid (1-42) peptide - Hilyte 488 Anaspec AS-60479-01 p-amyloid (1-42) scrambled peptide - TAMRA Anaspec Custom Synthesis Dextran - Texas Red Invitrogen D1863 Zymosan A - AF594 Invitrogen Z23374 ProLong Diamond DAPI mounting media Invitrogen P36971 Rapamycin Sigma-Aldrich R8781 Latrunculin A Sigma-Aldrich L5163 Commercial Assays & Kits Neural Tissue Dissociation Kit Miltenyi 130-092-628 Microglia Isolation Kit Miltenyi 130-093-634 Universal SYBR Green Bio-Rad 1725271 M-MLV Kit Invitrogen 28025013 CLICK-IT™ TUNEL Alexa Fluor™ 488 Imaging Invitrogen C10245 Assay kit Mouse Multianalyte Inflammatory Cytokine ELISA Qiagen MEM-004A RNeasy Mini Kit Qiagen 74104 Oligonucleotides Rubicon-sgRNA1 N/A N/A 5′-CACCGAGGAGACTCGTCCATACACG-3′ (SEQ ID NO: 1) 3′-AAACCGTGTATGGACGAGTCTCCTC-5′ (SEQ ID NO: 2) Rubicon-sgRNA2 N/A N/A 5′-CACCGTGATGAGGAACGGGCGAAGA-3′ (SEQ ID NO: 3) 3′-AAACTCTTCGCCCGTTCCTCATCAC-5′ (SEQ ID NO: 4) ATG5-sgRNA1 N/A N/A 5′-GTGAGCCTCAACCGCATCCT-3′ (SEQ ID NO: 5) 3′-CACTCGGAGTTGGCGTAGGA-5′ (SEQ ID NO: 6) ATG5-sgRNA2 N/A N/A 5′-CGGAACAGCTTCTGGATGAA-3′ (SEQ ID NO: 7) 3′-GCCTTGTCGAAGACCTACTT-5′ (SEQ ID NO: 8) FIP200-sgRNA1 N/A N/A 5′-AGAGTGTGTACTTACAGCGC-3′ (SEQ ID NO: 9) 3′-TCTCACACATGAATGTCGCG-5′ (SEQ ID NO: 10) FIP200-sgRNA2 N/A N/A 5′-GAGGATCATGCTCCTAGAAC-3′ (SEQ ID NO: 11) 3′-CTCCTAGTACGAGGATCTTG-5′ (SEQ ID NO: 12) Actin qPCR N/A N/A F: ATGGAGGGGAATACAGCCC (SEQ ID NO: 13) R: TTCTTTGCAGCTCCTTCGTT (SEQ ID NO: 14) TNFa qPCR N/A N/A F: CCTGTAGCCCACGTCGTAGC (SEQ ID NO: 15) R: AGCAATGACTCCAAAGTAGACC (SEQ ID NO: 16) IL1b qPCR N/A N/A F: CACAGCAGCACATCAACAAG (SEQ ID NO: 17) R: GTGCTCATGTCCTCATCCTG (SEQ ID NO: 18) IL6 qPCR N/A N/A F: GAGGATACCACTCCCAACAGACC (SEQ ID NO: 19) R: AAGTGCATCATCGTTGTTCATACA (SEQ ID NO: 20) CCL5 qPCR N/A N/A F: CCAATCTTGCAGTCGTGTTTGT (SEQ ID NO: 21) R: CATCTCCAAATAGTTGATGTATTCTTGAAC (SEQ ID NO: 22) Iba1 qPCR N/A N/A F: CAGACTGCCAGCCTAAGACA (SEQ ID NO: 23) R: AGGAATTGCTTGTTGATCCC (SEQ ID NO: 24)
Experimental Model & Subject Details
Mice
[0242] The 5×FAD transgenic mice carrying the following five mutations: Swedish (K670N and M671L), Florida (I716V) and London (V717I) in human APP695 and human PS1 cDNA (M146L and L286V) under the transcriptional control of the neuron-specific Thy-1 promoter and were purchased from The Jackson Laboratory. 5×FAD mice were crossed to FIP200.sup.fl/fl LysM-Cre+ (kindly provided by Jun-Lin Guan, University of Michigan), ATG5.sup.fl/fl LysM-Cre+ (kindly provided by Thomas A. Ferguson, Washington University), and Rubicon.sup.−/− mice which were generated as described previously (Martinez et al. (2015) Nat Cell Biol 17:893-906). Mice used for bone marrow isolation and BMDM culture were kindly provided as follows; Beclin1.sup.fl/fl LysM-Cre+ (Edmund Rucker, University of Kentucky), ATG7.sup.fl/fl LysM-Cre+ (Masaaki Komatsu at The Tokyo Metropolitan Institute of Medical Science), ATG14.sup.fl/fl LysM-Cre+ (Herbert Virgin, Washington University), VPS34.sup.fl/fl LysM-Cre+ (Richard Flavell, Yale University), and ULK1.sup.−/− LysM-Cre+ (Mondira Kundu, St. Jude Children's Research Hospital).
[0243] Unless otherwise noted, all experiments were performed on mixed sex cohorts at 4-months of age. Depending on genotype, either LysM-cre.sup.− or Rubicon.sup.+/− littermates were used as controls.
[0244] Atg16.sup.ΔWD mice were generated by deletion of the WD-domain of Atg16L, as previously described (Rai et al 2018(online) Autophagy 15(4)599-612). In brief, 2 stop codons were inserted into exon 6 of murine Atg16L1 immediately after glutamate E230 to preserve binding sites for WIPI2 (required for canonical autophagy) but prevent translation of the linker and WD-domain. Mice were produced and maintained on a mixed 129, C57BL/6 background. Unless otherwise noted, all experiments were performed on mixed sex cohorts at 2 years of age. Mice treated with MCC950 or placebo were mixed sex cohorts, 20 months of age at time of treatment onset and were treated for 8-weeks. The genetic backgrounds of mice used were assessed at the DartMouse™ Speed Congenic Core Facility at the Geisel School of Medicine at Dartmouth. DartMouse uses the Illumina, Inc. (San Diego, Calif.) Infinium Genotyping Assay to interrogate a custom panel of 5307 SNPs spread throughout the genome. The raw SNP data was analyzed using DartMouse's SNaP-Map™ and Map-Synth™ software, allowing the determination for each mouse of the genetic background at each SNP location. Background strain percentage was subsequently compared against markers of disease pathology to evaluate any influence stemming from variations in background (
[0245] The St. Jude Institutional Animal Care and Use Committee approved all procedures in accordance with the Guide for the Care and Use of Animals. All mice were housed in pathogen-free facilities, in a 12-hour light/dark cycle in ventilated cages, with chow and water supply ad libitum.
Cells
[0246] BV2 murine microglia and RAW264.7 cells were obtained from ATCC. Cells were maintained in complete DMEM media (10% fetal bovine serum (FBS), 200 mM L-glutamine and 100 units/ml penicillin-streptomycin). All the cell lines used were confirmed as mycoplasma negative using MycoAlert Mycoplasma Detection kit (Lonza #LT07).
[0247] For preparation of bone marrow-derived macrophages (BMDM), male or female mice at 6 to 12 weeks of age were euthanized and bone marrow cells were harvested from the femurs and differentiated in DMEM containing 20% FBS, 200 mM L-glutamine, 100 units/ml penicillin-streptomycin, 20 ng/ml recombinant human M-CSF for 10 days. BMDMs were harvested and seeded on tissue culture plates one day before stimulation and maintained in complete DMEM media. All cells used in this study were cultivated at 37° C. with 5% CO2.
Method Details
Generation and Maintenance of Cell Lines
[0248] BV2 microglia deficient in FIP200, ATG5, and Rubicon were generated using CRISPR/Cas9 technology by lentiviral transduction and puromycin selection. Two guide RNAs (gRNA) were designed for each gene (See Reagents List for sequences) and cloned into the pLenti-V2 plasmid (Addgene). Lentivirus was produced using HEK293T cells co-expressing pPAX and pVSVg plasmids (Addgene) and our CRISPR pLenti-V2 plasmids using Lipofectamine 2000 (Invitrogen). BV2 cells were subsequently transduced and transduction efficiency was confirmed by immunoblot analysis following two weeks of puromycin selection. An empty pLenti-V2 vector was transduced to establish a parental cell line. Once confirmed, cells were then exposed to LentiBrite GFP-tagged LC3 lentivirus (Millipore) to establish GFP-LC3 positive lines.
[0249] RAW264.7 lines deficient in Rubicon or ATG5 were established using CRISPR/Cas9 viral transduction as described above for BV2 cells. RAW264.7 cells that overexpress either RavZ or a dominant-negative ATG4 were generated by transduction using a retrovirus carrying pMXs-Flag-mATG4B-C74A (Blasticidin) or pMXs-Flag-RavZ (Blasticidin) or the empty vector. The retroviral vectors were created as follows. Mouse ATG4B was cloned from a mouse cDNA library into pMXs retroviral vector. The active site Cysteine (C74) was mutated to Alanine using site-directed mutagenesis. The original vector expressing RavZ was a gift from Craig Roy (Yale University), the ORF was subcloned into pMXs.
[0250] All lentiviral and retroviral work was performed in accordance with the guidelines set forth by the SJCRH Institutional Biosafety Committee and within the scope of our approved Biosafety protocol.
β-Amyloid Preparation and Treatment
[0251] Both labeled and unlabeled Ab1-42 was purchased in lyophilized form and resuspended according to the manufacturer's recommendation at a concentration of 100 μM (Anaspec). In brief, Ab1-42 was resuspended to 5 mM in DMSO and then adjusted to 100 μM using DMEM/F12 culture media. Oligomerization was allowed to occur for 24h at 4° C. prior to addition to cells at 1 μM unless otherwise indicated.
Primary Microglia Isolation and Culture
[0252] Mice were anesthetized with isoflurane and perfused with 1% BSA in PBS. Brains were subsequently harvested and immediately processed using the papain-based Neural Dissociation Kit (Miltenyi). Myelin was removed using myelin removal beads and microglia were purified using CD11b microglia beads (Miltenyi). Isolated cells were subsequently cultured and maintained in complete DMEM media (10% fetal bovine serum (FBS), 200 mM L-glutamine and 100 units/ml penicillin-streptomycin) at 37° C. with 5% CO2. The cells were then used as indicated. All steps were performed per the manufacturer's instructions.
Microscopy and Image Analysis
[0253] For all non-live cell-based imaging, cells were cultured in 4-well chamber slides (Ibidi) and were fixed and stained as indicated. In brief, cells were fixed with 4% PFA for 10 min followed by permeabilization using 200 μg/ml digitonin for 10 min. Cells were blocked in 0.5% BSA in PBS for 30 min prior to staining with primary antibodies overnight at 4° C. Cells were then washed 3× in PBS and then stained with the indicated fluorescent secondary antibodies for 30 min. Cells were subsequently washed 3× with PBS and post-fixed in 1% PFA for 10 min prior to imaging. For all live cell-based imaging, cells were immediately transferred to an environment controlled, live-cell imaging chamber (Ibidi).
[0254] For preparation of brain tissue see “Preparation of brain samples” below. Slides were subjected to antigen retrieval using 1% sodium citrate boiling for 20 min followed by 3× PBS washing. Slides were blocked in 0.5% BSA in PBS. Antibody staining was carried out as described above. Following final washing, slides were mounted using ProLong Diamond Anti-Fade mounting media with DAPI.
[0255] All imaging was performed on either an Eclipse Ti-E TIRF/N-Storm/epifluorescence microscope (Nikon) or a MARIANIS spinning disk confocal microscope (Intelligent Imaging Innovations (3i)) equipped with an EMCCD camera. Image analysis including all quantification was performed using Nikon NIS-elements Advanced Research Imaging software or Slidebook 6 (3i).
[0256] Image analysis for relative Aβ, Iba1, and phospho-Tau staining was achieved by quantifying the mean fluorescent intensity (MFI) of either Iba1 or phospho-Tau signal using NIS-elements. Analysis and quantification of microglial morphology was achieved using Slidebook 6 software. Morphological state was determined by measuring cell diameter following 3D reconstruction and confirmed by manual counting/analysis of microglia shape per defined field across multiple areas of each slide.
Flow Cytometry
[0257] For all uptake assays, cells were analyzed without fixation. For membrane-associated GFP-LC3 analysis, cells were processed as described below. For brain infiltrating monocytes, cells were isolated as described using the Neural Tissue Dissociation Kit (Miltenyi). Primary cells were fixed, permeabilized, and stained using the Cyto Fix/Perm Staining Kit (BD Bioscience) and the indicated, conjugated primary antibodies. For all experiments, cells were analyzed using a Sony SP6800 Spectral Analyzer (Sony). All analyses were performed using FlowJo v10.4 (Tree Star). Fluorescent compensation was performed using BD compensation beads (BD Bioscience).
Preparation of Brain Samples
[0258] Mice were anesthetized with isoflurane and perfused with ice-cold PBS containing 1 U/ml of heparin. Right brain hemispheres were fixed in 4% PFA overnight at 4° C., rinsed in PBS, and incubated overnight at 4° C. in 30% sucrose before freezing in a 2:1 mixture of 30% sucrose and optimal cutting temperature compound (OCT). Serial 20 μm coronal sections were cut on a cryo-sliding microtome. Cortices and hippocampi of the left-brain hemispheres were carefully dissected out and flash frozen for biochemical analysis or processed for RNA isolation.
Membrane-Associated LC3 Analysis
[0259] To quantify membrane association of GFP-LC3, cells were harvested and permeabilized using 200 μg/ml digitonin for 15 min on ice. Cytosolic GFP-LC3 was removed by washing cells 5× in cold PBS. Cells were then resuspended in 0.5% BSA in PBS for analysis by flow cytometry as described above.
Cell & Tissue Lysis and Immunoblot
[0260] Cells were lysed in RIPA buffer for 30 min on ice [50 mM Tris (pH 7.5), 150 mM NaCl, 1% Triton X100, 0.5% deoxycholate (DOC), 0.1% SDS, protease inhibitor tablet (Roche), 1 mM NaF, 1 mM Na.sub.3VO.sub.4, and 1 mM PMSF]. Brain samples were mechanically homogenized in RIPA buffer. After centrifugation, supernatants were analyzed by SDS/PAGE. All blots were imaged using H1RP-conjugated secondary antibodies and ECL using a LiCOR Odyssey Fx imaging system (LiCOR). All immunoblot analysis was performed using LiCOR Image Studio software.
Real-Time RT-PCR
[0261] Total RNA was isolated from cells or tissue using the RNeasy Kit (Qiagen) according to the manufacturer's instructions. First-strand synthesis was performed using M-MLV reverse transcriptase (Invitrogen). Realtime PCR was performed using SYBR GREEN PCR master mix (Applied Biosystems) in an Applied Biosystems 7900HT thermocycler using SyBr Green detection protocol as outlined by the manufacturer using the following PCR conditions: 50° C. for 2 min, 95° C. for 10 min, and 40 cycles of 95° C. for 15s and 60° C. for 1 min. mRNA was normalized to actin allowing for comparison of mRNA levels. Please see key reagents table for qPCR primer sequences.
Receptor Recycling
[0262] For receptor recycling, cells were plated on 4-well Ibidi tissue culture-coated chamber slides and allowed to reach 50% confluence. Cells were then blocked for 15 min in the presence of 10% normal donkey-serum at 37° C. Primary antibodies targeting the indicated receptor (see reagent list) were then added at a dilution of 1:100 in 1% donkey-serum in DMEM and cells were incubated at 37° C. for 1h. Antibody-containing media was aspirated and cells were acid washed with cold-DMEM, pH 2.0. Cells were returned to 10% donkey-serum in DMEM for 1 h. Alexa Fluor 568-labeled secondary antibodies were diluted 1:1000 in 1% donkey-serum in DMEM and added to cells for 1 h at 37° C. to label recycled receptors. Cells were subsequently acid washed as described above and then fixed in 4% PFA in PBS for 15 min. Cell permeable Hoechst dye was added to label nuclei.
[0263] Quantification of recycling was achieved by calculating the sum of AF568-fluorescent area divided by the total number of cells. Nikon NIS-Elements AR software was used for all image analyses and quantification.
Amyloid Uptake
[0264] Primary and secondary β-amyloid uptake was assayed as follows. BV2 clones were treated with 1 μM Alexa Fluor 488-labeled Aβ1-42. Mean fluorescent intensity (MFI) for AF-488 was determined by flow cytometry after 12h and considered the primary uptake. 1 μM TAMRA-labeled Aβ1-42 was subsequently added to the medium following the primary uptake phase. MFI for TAMRA was assessed by flow cytometry 12h following the primary uptake timepoint. This timepoint constitutes the secondary uptake.
Phagocytosis and Endocytosis Analysis
[0265] To delineate between phagocytosis and endocytosis, cells were treated as indicated with the phagocytic inhibitor latrunculin A. Cells were pre-treated for 1 h prior to the addition of target substrates. The following control substrates were used, zymosan (phagocytosis) and dextran (endocytosis), both were fluorescently labeled as indicated. Co-incubation with specific substrates was carried out at 37° C. for 3h. Cells were either fixed for imaging or analyzed by flow cytometry as described above respectively.
Electrophysiology
[0266] Acute transverse hippocampal slices (400 m) were prepared as previously described (Gingras et al. (2015) J Neurosci 35:10510-10522). Briefly, mouse brains were quickly removed and placed in cold (4° C.) dissecting ACSF containing 125 mm choline-Cl, 2.5 mm KCl, 0.4 mm CaCl.sub.2), 6 mm MgCl.sub.2, 1.25 mm NaH.sub.2PO.sub.4, 26 mm NaHCO.sub.3, and 20 mm glucose (285-295 mOsm) under 95% O2 and 5% CO2. After dissection, slices were incubated for 1 h in ACSF containing 125 mm NaCl, 2.5 mm KCl, 2 mm CaCl.sub.2), 2 mm MgCl.sub.2, 1.25 mm NaH.sub.2PO.sub.4, 26 mm NaHCO.sub.3, and 10 mm glucose (285-295 mOsm) under 95% O2 and 5% CO2 at room temperature and then transferred into the submerged recording chamber and superfused (2-3 ml/min) with warm (30° C.-32° C.) ACSF. The field recordings were performed by using a setup with 8 submerged recording chambers (Campden Instruments). The fEPSPs were recorded from the CA1 stratum radiatum by using an extracellular glass pipette (3-5 MΩ) filled with ACSF. Schaffer collateral/commissural fibers in the stratum radiatum were stimulated with a bipolar tungsten electrode placed 200-300 m away from the recording pipette.
Behavior & Memory Analysis
[0267] For sucrose preference tests (SPT), mice were individually housed and allowed to acclimate to the testing room for 48h prior to starting the experiment. A dual bottle setup was introduced where both bottles contained only standard water. Again, mice were allowed to acclimate to the dual bottle setup for 3 days. After acclimation, one bottle was replaced with a 2% sucrose solution. Water consumption was monitored daily for 4 days. Bottles were rotated daily to minimize side bias and normalized for leakage. All results are shown as the averaged consumption and preference over the 4-day test period.
[0268] For Y-maze spontaneous alternation analysis, mice were housed in the testing room and allowed to acclimate for 48h. The Y-maze test consisted of a single 5 min trial per mouse. Spontaneous Alternation [%] was defined as consecutive entries in 3 different arms (ABC), divided by the number of possible alternations (total arm entries minus 2). Mice with less than 5 arm entries during the 5 min trial were excluded from the analysis.
[0269] Novel object recognition (NOR) was performed in an open-field box (40 cm×40 cm). Mice were allowed to acclimate to the testing room for 48h. For habituation, mice were allowed to explore the open-field for 15 min per day for two days. Mice were then exposed to two identical objects for 10 min on the day of testing. 2h later a novel object was introduced, and mice were allowed to explore for 5 min during the test phase. The time spent exploring each object was quantified manually. Novel object preference (%) and the discrimination index ((time with novel)/(novel+familiar)*100) were calculated for each mouse.
MCC950 Inflammasome Inhibition In Vivo
[0270] Mice with established disease were treated for 8-weeks with either a vehicle (placebo) control or MCC950 (Invivogen) as reported previously (Gordon et al. 2018 Science Translational Medicine 10(465)). In brief, MCC950 was suspended in 100% DMSO and titrated to a working dose using sterile water. The final concentration of DMSO in the injection was <1%. Matching solution without MCC950 was used as the vehicle (placebo). Mice were injected every 3 days for 8-weeks at a dose of 10 mg/kg via intraperitoneal injection.
Statistical Analysis
[0271] Please refer to the descriptions of the figures for description of sample sizes and statistical test performed. Data were plotted and analyzed with GraphPad Prism 7.0 software. All experiments were designed and are powered to a minimum of 0.8 as calculated using G*Power. Differences were considered statistically significant when the p-value was less than 0.05.