FAST AND PORTABLE MICROFLUIDIC DETECTION SYSTEM AS AN ALTERNATIVE TO SALMONELLA'S CLASSICAL CULTURE METHOD

20220098645 · 2022-03-31

Assignee

Inventors

Cpc classification

International classification

Abstract

Every year, approximately 94 million cases of Salmonella gastroenteritis, with 155000 deaths, are reported each year and 85% of them reported to be food-borne. Investigation of the foods whether they are clean for Salmonella and sensitivity, easy applicability, absence of false positivity and negativity and the speed are the features sought in the analysis method for this investigation. It is not desirable for analysis to detect the presence of dead bacteria in food. Although the final product does not contain microbiologically harmful live bacteria during the food process, the detection of dead bacteria transmitted before the process causes the food product to be unfairly diagnosed as harmful. To prevent this situation, the analysis kits depending on molecular methods, increase their microorganism detection levels up to to 10.sup.4 while reducing their sensitivity. Since the molecular methods cannot discriminate dead and live organisms, a confirmation test is required to prove that the positive result of the analysis belongs to the live bacteria in the food, which results in additional cost and time loss. In the same way, it is necessary to verify whether the colonies that grow in the gold standard culture method, belong to Salmonella bacteria. In the developed system; 10.sup.5 dead bacterial DNA is eliminated in the food to prevent false positive results and the minimum detection limit is 10 bacteria. Also, in developed system, 4 primers specific to 6 regions of DNA are used. Therefore, the specificity of the method is very high (99.9%) and no verification test is needed. Since PCR systems require a device with complex temperature control units, they can make analysis in a laboratory-dependent manner. In the proposed system, DNA is amplified at constant temperature; no temperature cycle is required, therefore no complex instrument and laboratory infrastructure are required. All the procedures can be easily performed outside the laboratory on a portable mini-heater where pre-enrichment, DNA isolation from the sample and PCR steps are performed. For molecular analyses, the device is required to display the result of imaging or analysis. In the developed method, DNAs amplified by the loop-mediated isothermal DNA amplification method, are hybridized and combined with the labeled probe and then can be read by lateral flow method with the naked eye. As the results are visible by eye, no additional device is required. The classical culture method is accepted as the gold standard, but the duration of analysis is 7 days for positive samples, 3 days with verification test, for the molecular methods, and 5.5 hours including pre-enrichment time in the developed system.

Claims

1) A Salmonella pathogen detection method, characterized in that the method comprises following process steps; a. Sample preparation and pre-enrichment, completed in no more than 4 hours, b. Separation of dead/live bacteria, by the application of DNAse I 25U, at 37° C. for 30 min; and PMA 5-50 μM, in the dark, at 25° C. for 7 min, in no particular order, c. DNA isolation where, Proteinase K and solution A (10-100 mM Tris-HCl, 10-100 KCl, 1-10 mM M-gCl.sub.2, pH 8.2) are applied together, d. Loop-mediated Isothermal DNA Amplification with 4 primers specifically designed for the InvA gene, e. Hybridization of amplicons with unique probes, which are hybridized in disposable cassettes, and evaluation of results with the naked eye, f. Performing of pre-enrichment, DNA isolation, DNA amplification and result display on the portable mini-heating device (FIG. 1).

2) (canceled)

3) The method according to claim 1 wherein the LAMP primer set used for Salmonella detection contains; TABLE-US-00002 F3: TCGATCAGTACCAGTCGTCT, B3: ATACCGGCCTTCAAATCGG, FIP: FAM/ACAACAAAACCCACCGCCAGGCCGGGGAAATTATCGCCAC, BIP: ACCAAAGGTTCAGAACGCGTCGCCGGGCATACCATCCAGA primers and that the 5′ end of the FIP primer is marked with  FAM.

4) The method according to claim 1 characterized in that, the specifically designed 5′-GTCTTATCTTGATTGAAGC-3′ probe is attached in single-use disposable cassettes.

5) The method according to claim 1 characterized in that, the surface to which the probe is attached, might be; nitrocellulose, SU-8, PDMS or glass.

6) (canceled)

7) (canceled)

Description

DESCRIPTION OF THE FIGURES

[0028] The figures are provided for a better understanding of the subject matter of the patent and the scope of the patent it is not limited with these figures.

[0029] FIG. 1. A portable mini heater and analysis cassette on which example pre-enrichment, DNA isolation and DNA amplification processes takes place.

[0030] FIG. 2. is a top view of the analysis cassette.

[0031] FIG. 3. is a side view of the analysis cassette.

DESCRIPTION OF REFERENCES IN THE FIGURES

[0032] Parts shown in the figures are numbered one by one, It is given. [0033] 101: Mini heater [0034] 102: Cassette inlet [0035] 103: Touch Screen Display [0036] 104: 1.5 ml tube inlet [0037] 105: 50 ml tube inlet [0038] 201: Disposable analysis cassette [0039] 202: Sample loading opening [0040] 203: Amplification well [0041] 204: Switch [0042] 205: Hybridization channel [0043] 206: Hand holding portion

DISCLOSURE OF THE INVENTION

[0044] Developed system is a kit containing the portable mini heater (FIG. 1) where the pre-enrichment, DNA isolation and LAMP reaction takes place, analysis cassette (FIG. 2) and analysis solutions. Kit is ready to use in a box. Loop mediated isothermal DNA amplification reaction in itself can be controlled by negative, positive and inhibition controls. Invention kit content included; Dead/live bacteria DNA separation solutions (PMA and DNAse I), Salmonella isothermal DNA amplification primer set (10× Primary Mix, 2 μM F3, 2 μM B3, 16 μM FIP and 16 μM BIP) and lateral flow result in display cassette.

[0045] In the sample preparation step; incubation of sample placed in peptone water, liquid nutrient media or any other nutrient media used for similar purposes, in the well (105) shown in FIG. 1 for 4 hours at 37° C. in a 50 ml tube, to ensure the growth of bacteria in tubes without disrupting the 1/9 sample-medium ratio is within the scope of this patent.

[0046] To separate dead and live cells during the pre-enrichment stage, an optimized PMA/DNase I; a protocol for the removal of dead bacterial DNA was developed. Combined application of DNAse I and PMA, for the destruction and removal of dead bacterial DNA found in the sample, is within the scope of this patent. PMA and DNAse I can be applied in different orders for the Dead/Live separation. Application of DNAse I 25U, at 37° C., 30 min; and PMA 10 μM, in the dark at, at 25° C., 7 min. is within the scope of this patent. The use of PMA at a concentrations of 5 μM and more and the incubation in room temperature and dark environment are also within the scope of this patent. For DNA isolation, Proteinase K can be used at a concentration of 10 mg/ml or more and 30 μl or more. Solutions, prepared with different concentrations of Tris-HCl, KCl, and MgCl.sub.2 can be used in the pH range of 7-9.

[0047] Primers specific to the InvA gene were specifically designed to enrich the Salmonella pathogen with the LAMP method. Primer Explorer V5 program was used to design the primers.

[0048] The sequences of the designed external forward (F3), external reverse (B3), internal forward (FIP) and internal reverse (BIP) primers are given sequentially in 5′-3′ direction;

TABLE-US-00001 F3: TCGATCAGTACCAGTCGTCT, B3: ATACCGGCCTTCAAATCGG, FIP: FAM-ACAACAAAACCCACCGCCAGGCCGGGGAAATTATCGCCAC, BIP: ACCAAAGGTTCAGAACGCGTCGCCGGGCATACCATCCAGA

[0049] The FIP primer is marked with FAM at the 5′ end. The molar ratios of the primers used in the reaction (external primers; internal primers) are: 1-4: 2-8:4-16. As a DNA polymerase, Bst polymerase enzyme is used because of its strand displacement property. MgSO.sub.4 concentration is 4 mM, dNTP concentration is 0.4 mM, Bst polymerase amount is 2 U. DNase and RNAse free ddH.sub.2O is used as a negative control.

[0050] Detection can be achieved if there is a genome that can be amplified for the loop-mediated isothermal DNA amplification reaction. Pre-enrichment can be kept short for fast-breeding bacteria (ones have short doubling time).

[0051] If the amount of contamination is high, the method can yield directly just by DNA isolation, without no need to pre-enrichment. If the amount of contamination is high or if the sample is taken directly from the main reserve (eg wash water); instead of DNA isolation, the sample can also be transferred directly to the reaction tube after a short lyse. Once DNA has been isolated from the food sample, confirmation could be done repeatedly by LAMP reaction.

[0052] For molecular analyses, the device is required for visualization or the display of analysis results. Lateral flow devices (LFD), which are also test method itself, have recently begun to be used for visualization of the results of molecular analyses. In the developed method, specially designed DNA probes, that identify the target DNA, were hybridized to the lateral flow visualization cassettes.

[0053] In the developed lateral flow system, as it could be possible to evaluate results by naked eye with the help of gold nanoparticles, through the probe hybridization on the surface and a lateral flow application where hybridization of positive DNA to this probe takes place at 65° C., no additional device is needed.

[0054] The use of bst enzyme or a different enzyme with DNA strand opening capability for DNA amplification, the incubation of samples for different periods in the range of 60-75° C. for DNA amplification and the carrying out of this process in a portable mini heater specially designed for the disposable cassette (FIG. 1), is within the scope of this patent.

[0055] FIG. 1 depicts the device that can be charged and operated without the need for continuous connection to the electrical source, on which pre-enrichment, DNA isolation, and DNA amplification can be performed. The device has three 50 ml (105), six 2-1.5 ml tube inlets (104) and two diagnostic cassette inlets (102). It also has a touch screen display (103) where the controls can be conducted. The device is suitable for operation in the 0-100° C. range.

[0056] FIG. 2 shows a single-use analysis cassette in which DNA amplification takes place, as well as the results can be displayed. Generally, it is composed of the amplification well (203) where the amplification takes place and the microfluidic hybridization channel where the result is displayed (205). The cassette is provided with a sample loading opening (202) to which the sample is loaded into the amplification well, a switch (204) for carrying the amplification product to the hybridization channel, and a hand holding portion (206).

[0057] The amplification well (203) offers a capacity of 200 μl. It also has an opening for delivering the reaction mixture to the amplification well. There is a lock system between the well and the channel. After the amplification period, the amplicons can be transferred to the channel by pressing the switch (204) to perform the diagnostic process. By designing the hybridization channel (205) inclined, the flow can be achieved without the need for any additional device (pump). There are two bands in the microfluidic channel: control and test. The test band contains the pathogen-specific DNA probe to be diagnosed, while the control band contains the antibody that recognizes the gold nanoparticles indicating that the system is operating.

[0058] The use of a probe hybridized microfluidic system and the use of a probe as 5 pmol or more is also within the scope of patent protection. The alignment of the original probe attached to the surface is; 5′-GTCTTATCTTGATTGAAGC-3.

[0059] The hybridized sample and the phosphate buffer (hybridization buffer) containing 1% BSA can be used at different concentrations. In the disposable cassette which is used for diagnosis (FIG. 2), the hybridization surface may be nitrocellulose, SU-8, PDMS or glass. The analysis cassette consists of two different parts on which amplification, and hybridization takes place separately. During the amplification, new FAM labeled products will be formed with the help of FAM (Fluorescein) labeled FIP. The two parts of cassette are connected by a simple collapsible switch (204). After amplification, the switch opens and the FAM-labeled product interacts with the anti-FAM antibody in the hybridization zone with the hybridized gold nanoparticle buffer. Because the cellulose membrane or hybridization portion is inclined, the product will travel along the path. During this process, the hybridization channel is heated to 65° C. to allow hybridization between the product and the probe that is specific to the target DNA sequence. In positive samples, visual result evaluation is possible with the accumulation of amplification products containing gold nanoparticle with anti-FAM antibody in the band where the probe is located. Anti-rabbit Antibody was hybridized to the surface as a control band. As a result of the reaction, gold nanoparticles with free anti-FAM antibody hybridize to the control band.

[0060] This indicates that the system is running. The specificity of the probe is 100%.

Sample Application:

I.

[0061] In a 50 ml tube, 1/9 ratio of peptone/water is put, and 5 g of homogenized food samples are added. The tube is incubated for 4 hours at 37° C. in the device shown in FIG. 1 for pre-enrichment.

II.

[0062] After 4 hours, the tube is homogenized by hand shaking and 1.5 ml sample is taken into a 2 ml centrifuge tube. The samples are centrifuged at 8000 rpm for 3 minutes using a portable mini-centrifuge. The supernatant is discarded. 25U DNAse I and 100 μl DNAse I buffer were added onto the precipitate. Let it stand for 30 minutes at 37° C. in the device shown in FIG. 1. Then 5-50 μM PMA (Biotium 10 Inc. USA) was added and incubated for 5 minutes in the dark at room temperature. Finally, it is kept under agitation for 2 minutes on ice at 20 cm distance under a 650 W halogen lamp.

III.

[0063] Samples are centrifuged at 8000 rpm for 3 minutes to discard the supernatant and 30 μl proteinase K (20 mg/ml) and 100 μl solution A (10-100 mM Tris-HCl, 10-100 KCl, 1-10 mM MgCl, pH 8.2) is added. The samples are stored in a mini-heater as shown in FIG. 1 for 20 minutes at room temperature, then for 10 minutes at 90-100° C. The top phase is used as a DNA sample after centrifugation at the last speed for 5 minutes with the help of portable mini centrifuge.

IV.

[0064] The loop-mediated isothermal DNA amplification reaction is prepared for diagnosis. Per reaction; 1× reaction buffer (NEB, USA), 1-10 mM MgSO.sub.4, 1-5 mM dNTP, 1-2 μM FIP/BIP, 0.1-1 μM F3/B3 primers, 50-500 U/ml Bst 3.0 DNA polymerase, 5 μl of DNA and ddH.sub.2O until complete to 25 μl reaction mix, are added.

[0065] In the amplification well (203) where the reaction will take place, the DNA is incubated for 1 hour at 60-72° C. for amplification. It is then incubated for 20 minutes at 80° C. for enzyme inactivation in the device shown in FIG. 1.

[0066] After DNA amplification, 100 μl of hybridization buffer is added to the sample and passed through the microfluidic channel where the Salmonella probe is hybridized at the temperature in the range of 60-70° C. through the device shown in FIG. 1. The result is observed within 5 minutes.

INDUSTRIAL APPLICATION OF THE INVENTION

[0067] The aforementioned microfluidic detection system has; high accuracy, speed, efficiency, specificity and sensitivity, easy applicability, portability, no need for complex devices and it issued for import and export quarantine site detection, food hygiene and inspection. It is also important in foodstuff kitchens, in mass consumption points, and in individual food safety guarantee, because of being portable.