<i>Peronospora </i>resistance in <i>spinacia </i>sp

Abstract

The invention pertains to spinach plants comprising a gene or locus which leads to a broad spectrum resistance to Peronospora farinosa f sp. spinaciae (Pfs). The invention also relates to progeny of said spinach plants, to propagation material of said spinach plants, to a cell of said spinach plants, to seed of said spinach plants, and to harvested leaves of said spinach plants. This invention further relates to use of said spinach plants in breeding to confer resistance against Peronospora farinosa f. sp. spinaciae.

Claims

1. A spinach plant comprising a genetic determinant that confers resistance against Peronospora farinosa (Pfs) race 14, wherein the genetic determinant is located on a chromosome 3 and comprises SEQ ID NO:3 and SEQ ID NO:4, and wherein the genetic determinant is present in seeds deposited under accession number NCIMB 42393.

2. The spinach plant of claim 1 comprising the genetic determinant, wherein the genetic determinant confers resistance against Pfs races 1-9, 11-15, and 17.

3. A plant part of the spinach plant of claim 1, wherein the part is selected from the group consisting of a stem, a cutting, a petiole, a cotyledon, a flower, an anther, a pollen, an ovary, a root, a root tip, a protoplast, a callus, a microspore, a stalk, an ovule, a shoot, a seed, an embryo, an embryo sac, a cell, a meristem, and a bud or a leaf, and wherein the part comprises the genetic determinant.

4. The plant part of claim 3, wherein the plant part is a leaf or a seed.

5. A cell culture or tissue culture of the plant of claim 1, wherein the cell culture or tissue culture comprises the genetic determinant.

6. A spinach plant regenerated from the cell culture or tissue culture of claim 5, wherein the regenerated spinach plant comprises the genetic determinant.

7. A progeny plant of the spinach plant of claim 2, wherein the progeny plant comprises the genetic determinant, and wherein the progeny plant is resistant to Pfs races 1-9, 11-15 and 17.

8. A progeny plant of the spinach plant of claim 2, wherein the progeny plant comprises the genetic determinant, and wherein the progeny plant is produced by one or more methods of selfing, crossing, or double haploid production.

9. A food product comprising harvested leaves of the spinach plant of claim 1.

10. A method of generating a spinach plant comprising a genetic determinant that confers resistance against Pfs race 14, said method comprising: (a) crossing the spinach plant of claim 1 with a second spinach plant to provide a population of spinach plants; (b) genotyping the population of spinach plants for the presence of at least one allele linked to the genetic determinant selected from a ‘C’ allele at the SNP at position 51 of SEQ ID NO:3, a ‘T’ allele at the SNP at position 51 of SEQ ID NO:4, a ‘G’ allele at the SNP at position 51 of SEQ ID NO:5, a ‘C’ allele at the SNP at position 51 of SEQ ID NO:6, a ‘C’ allele at the SNP at position 51 of SEQ ID NO:7, and a ‘C’ allele at the SNP at position 51 of SEQ ID NO:8; and (c) selecting one or more spinach plants or seeds comprising the genetic determinant on the basis of the presence of at least one allele in (b).

Description

DETAILED DESCRIPTION

(1) The present invention concerns spinach plants comprising resistance against one or more of Peronospora farinosa races 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, and isolate UA1014APLP (Pfs 17), preferably comprising resistance against races Pfs 1, Pfs 2, Pfs 3, Pfs 4, Pfs 5, Pfs 6, Pfs 9, Pfs 11, Pfs 12, Pfs 13, Pfs 14 and Pfs 15, and Pfs 17. The resistance is a broad range resistance, and may further comprise intermediate resistance to Pfs 7 and Pfs 8.

(2) More specifically the plant is obtainable by (or obtained by, or derivable from, or derived from) introgression from a plant grown from seeds of which a representative sample has been deposited with NCIMB under accession number NCIMB 42392 or NCIMB 42393 or any plant derived therefrom.

(3) The resistance trait may be inherited by a single gene, preferably a dominant gene. In another embodiment, said resistance is conferred by two or more genes, or a multilocus. In fact, the resistance locus or loci (and the Pfs resistance phenotype conferred thereby), can be transferred from the seeds deposited under NCIMB 42392 or NCIMB 42393, or from progeny of said seeds, into any spinach line or variety by traditional breeding techniques and can confer resistance against one or more of Pfs races 1-9, 11-15 and isolate UA1014APLP (Pfs 17) resistance (and optionally resistance against new pathogenic isolates) onto another spinach plant. Thus, for example, a spinach plant of the invention can be used as male or female parent in a cross with another spinach plant, and progeny, such as F1, F2, F3, or further generations of selfing and/or backcross progeny (e.g. BC1, BC2, BC1S1, BC2S1, BC1S2, etc.) can be identified and selected, whereby the progeny comprise the same Pfs resistance phenotype as the initial plant of the invention. Selection of progeny for the presence of the resistance can, therefore, be carried out using a disease resistance assay as described herein, whereby resistance against one or more (or all) of the Pfs races is tested in the progeny.

(4) Whether a spinach plant genotype (i.e. a spinach line or variety) comprises resistance against one or more Pfs races or isolates can be tested using qualitative disease resistance assays under controlled environment conditions. Different protocols of such assays exist and can be used by the person skilled in the art. In short, seedlings of a plurality of plants of the plant genotype to be tested (e.g. at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) are inoculated with inoculum of the Pfs race and the seedlings are incubated under conditions which are favorable to the pathogen. Several days after incubation, the plants are assessed for infection symptoms, especially sporulation on the cotyledons and/or leaves (e.g. first true leaf), and each plant is categorized as “resistant” (showing no signs of sporulation) or “susceptible” (showing sporulation). If a certain percentage of all plants of a genotype are classified as “resistant”, e.g. more than about 95%, 98%, 99% (or even 100%), then the spinach plant genotype is resistant to the race tested. Obviously, also one or more control plants (e.g. a susceptible line or variety, a resistant line or variety) should be included in the assay using the same treatment(s) and environmental conditions, to ensure that the assay works as expected.

(5) Alternatively or in addition to the phenotypic assay, selection or identification of a spinach plant (e.g. a progeny plant) comprising the resistance gene or locus/loci of the invention may be achieved by detecting one or more molecular markers linked to the resistance gene or locus. This aspect will be described elsewhere herein.

(6) In one of the embodiment of the invention, the spinach plant is an inbred line, especially an inbred line which can be used as a parent for F1 hybrid seed production. In another embodiment of the invention, the spinach plant is a hybrid, especially an F1 hybrid. An F1 hybrid may be generated by crossing a first inbred parent line which comprises the resistance gene or locus/loci, preferably in homozygous form, with a second inbred parent line. The first inbred parent line may be a line developed from using seeds deposited under NCIMB 42392 or NCIMB 42393 or from progeny of plants grown from these seeds, whereby the progeny retain the Pfs resistance phenotype (and the resistance gene or locus/loci).

(7) The second inbred parent line may be any spinach line, i.e. it may completely lack Pfs resistance, or it may comprise a different Pfs resistance gene (and different resistance phenotype) or it may also comprise the resistance gene or locus/loci according to the current invention.

(8) As mentioned, the spinach plant according to the invention may be any type of spinach. For example, the spinach plant may be a savoy type, a semi-savoy type or flat- or smooth leaved spinach.

(9) In other words, the resistance can be introduced into any other spinach plant by introgression from a plant grown from seeds of which a representative sample was deposited under NCIMB 42392 or NCIMB 42393, or any spinach plant derived therefrom and comprising the gene or locus/loci. The deposited seeds are therefore a source of the resistance of the invention, as are spinach plants not directly obtained from the deposit, but for example indirectly obtained (e.g. later released commercial varieties) and which contain the resistance gene or locus/loci of the invention.

(10) The resistance of the current invention was identified in wild material from a genebank and was introduced through backcrossing into S. oleracea. In one aspect, therefore, a spinach plant is provided comprising resistance against one or more of Pfs 1-9, 11-15 and isolate UA1014APLP (Pfs 17) and possibly new pathogenic isolates, wherein said resistance against Peronospora farinosa is conferred by an introgression fragment from wild spinach or from a wild relative of spinach. In a preferred aspect, a spinach plant is provided comprising resistance against at least Pfs 1-6, 9, 11-15 and Pfs 17. The resistance is a broad range resistance, and may further comprise intermediate resistance to Pfs 7 and Pfs 8.

(11) In one embodiment, the introgression fragment is the fragment as found in (and as obtainable from; or obtained from; or derivable from; or derived from) spinach seeds, a representative sample of seeds having been deposited under accession number NCIMB 42392 or NCIMB 42393. The fragment can be identified by various methods, such as chromosome painting or sequencing the spinach genome and identifying chromosome parts which are introgressions from wild spinach or wild relatives of spinach. The fragment can also be identified by one or more molecular markers (e.g. SNP markers, AFLP markers, RFLP markers, etc.), especially molecular markers which are polymorphic between cultivated spinach and the wild introgression fragment.

(12) In another embodiment, the introgression fragment is derived from the fragment as found in spinach seeds, a representative sample of seeds having been deposited under accession number NCIMB 42392 or NCIMB 42393, whereby the introgression fragment is shorter but retains the resistance gene or locus/loci (and the Pfs resistance phenotype conferred by the gene). Spinach plants comprising such shorter introgression fragments can be generated by crossing a plant of the invention with another spinach plant and selecting recombinant progeny which retain the resistance phenotype conferred by the resistance gene or locus/loci, but which contain a shorter introgression fragment.

(13) In one aspect a method is provided for generating spinach plant comprising resistance against one or more of Pfs races 1-9, 11-15 and isolate UA1014APLP (Pfs 17), preferably at least Pfs races 1-6, 7(−), 8(−), 9, 11-15 Pfs 17. The method comprises the steps of:

(14) a) Providing a spinach plant comprising resistance against the desired Pfs races;

(15) b) Crossing said spinach plant with another spinach plant to produce F1 seeds;

(16) c) Optionally selfing the plants grown from F1 seeds one or more times to produce F2, F3 or further generation selfing progeny;

(17) d) Identifying (or selecting) spinach plants grown from F1, F2, F3 or further generation selfing progeny which have resistance against the desired Pfs races;

(18) e) Optionally crossing said identified (or selected) F1 progeny or selfing progeny to the spinach plant of step b), to produce a backcross progeny;

(19) f) Optionally selecting backcross progeny comprising resistance against the desired Pfs races (e.g., preferably at least Pfs races 1-6, 7(−), 8(−), 9, 11-15 and 17).

(20) In another embodiment a method is provided for generating a spinach plant comprising resistance against one or more of Pfs 1-9, 11-15 and isolate UA1014APLP (Pfs 17), preferably at least Pfs races 1-6, 7(−), 8(−), 9, 11-15 and 17. The method comprises the steps of:

(21) a) Providing a spinach plant comprising an introgression fragment obtainable from (or as in) accession NCIMB 42392 or NCIMB 42393, which introgression fragment confers resistance against at least Pfs races 1-6, 7(−), 8(−), 9, 11-15 and 17;

(22) b) Crossing said spinach plant with another spinach plant, for example with a spinach plant which is susceptible against one or more of Peronospora farinosa races 1-6, 7(−), 8(−), 9, 11-15 and 17, to produce F1 seeds;

(23) c) Optionally selfing the plants grown from F1 seeds one or more times to produce F2, F3 or further generation selfing progeny;

(24) d) Identifying spinach plants grown from F1, F2, F3 or further generation selfing progeny which have resistance against at least Pfs races 1-6, 7(−), 8(−), 9, 11-15 and 17, and/or which comprise the introgression fragment or a resistance-conferring part of the introgression fragment;
e) Optionally crossing said identified F1 progeny or selfing progeny to the spinach plant of step b), to produce a backcross progeny;
f) Optionally selecting backcross progeny which comprises resistance against the desired Pfs races (e.g., preferably at least Pfs races 1-6, 7(−), 8(−), 9, 11-15 and 17) and/or which comprise the introgression fragment or a resistance-conferring part of the introgression fragment.

(25) Regarding both methods, the following is encompassed herein.

(26) In one aspect the plant of a) comprises the resistance trait as found in seeds deposited under accession number NCIMB 42392 or NCIMB 42393. The spinach plant may be the plant grown from the seeds of the deposit or any spinach plant made using, or having used, the seed deposit and which retains the Pfs resistance phenotype (and the gene or locus/loci conferring it). This includes commercial spinach varieties which were made using the seed deposit. Thus, the spinach plant of a) comprises the resistance gene/locus/loci according to the invention, e.g. as found in (or as obtainable from; obtained from; derivable from; derived from) NCIMB 42392 or NCIMB 42393. The plant in a) may therefore be a plant grown from seeds, a representative sample of which has been deposited under NCIMB 42392 or NCIMB 42393.

(27) Selections (or identification) in step d) and/or f) may be made based on the phenotype (i.e. using a Pfs resistance assay) and/or based on molecular methods, such as detection of molecular markers linked to the resistance gene or locus/loci, or other methods such as sequencing.

(28) In a preferred embodiment, said plants according to the current invention comprise alleles or sequences comprising one or more of SEQ ID NOs:1-8. In some embodiments, the plants comprise one or both of SEQ ID NO:1 and SEQ ID NO:2. In some embodiments, the plants comprise one, two, three, four, five or six of SEQ ID NOs:3-8.

(29) Preferably, said plants according to the current invention are identifiable via use of primers directed to one or more of SEQ ID NOs:1-8, whereby the presence of at least one of these sequences or both is a prerequisite for a plant according to the current invention. In another embodiment, selection of plants or progeny according to the current invention occurs on the basis of the presence of at least one sequence selected from one or more of SEQ ID NOs:1-8 in said plants or progeny. In step b) the spinach plant is, in one aspect, crossed with a spinach plant which is susceptible against at least one of the Pfs races against which the plant of a) is resistant. If the second parent in b) is a spinach plant which is susceptible against at least one of the Pfs races against which the plant of a) is resistant, then the selection in step (d) and/or (f) may be based on selecting plants which now have resistance against that race. Steps e) and f) may be repeated one or more times and preferably on the basis of the sequences given in one or more of SEQ ID NOs:1-8. In some embodiments, the plants comprise one or both of SEQ ID NO:1 and SEQ ID NO:2. In some embodiments, the plants comprise one, two, three, four, five or six of SEQ ID NOs:3-8.

(30) In the above methods also plants can be selected and/or identified which retain the Pfs resistance phenotype according to the current invention, but which have a smaller introgression fragment. This can have advantages, as negative traits coupled to the wild introgression fragment can thereby be removed. Initial introgression fragments from wild sources can be quite large, e.g. 20 Mb or 30 Mb. It is therefore preferred to reduce the size of the introgression fragment by recombination and to select plants comprising smaller introgression fragments, but which retain the resistance-conferring part. So, spinach with all sizes of introgression fragments originating from (or derived from; or derivable from; or obtained from; or obtainable from) seeds deposited under accession number NCIMB 42392 or NCIMB 42393 are included herein, as long as the Pfs resistance conferring part is retained in the spinach plant. As mentioned, the presence can be tested and selected phenotypically and/or using molecular methods known in the art. By preference, selection occurs on the basis of the sequence as given in one or more of SEQ ID NOs:1-8.

(31) Also plants obtainable or obtained by any of the above methods are embodiments of the invention. The plants according to the invention may be any cultivated spinach, e.g. savoy, semi-savoy, flat- or smooth leaved spinach. They may be inbred lines, F1 hybrids, double haploids, transgenic plants, mutant plants, etc.

(32) Plants of the invention can be used to generate progeny, which have or retain the Pfs resistance phenotype as obtainable from (as present in; as derivable from; as obtained or derived from) seeds deposited under accession number NCIMB 42392 or NCIMB 42393. To generate progeny, a spinach according to the invention can be selfed and/or crossed one or more times with another spinach plant and seeds can be collected. The presence of resistance according to the current invention or the gene/locus/loci responsible therefor in the progeny plants can be determined by the Pfs resistance phenotype and/or molecular methods, such as molecular markers (e.g. SNP markers) closely linked to the gene or locus/loci.

(33) Also seeds from which the plants of the invention can be grown are provided. In one embodiment, the use of a spinach plant, of which representative seeds have been deposited under accession number NCIMB 42392 or NCIMB 42393, or progeny thereof (e.g. obtained by selfing) is provided for generating a spinach plant comprising Pfs resistance against one or more of Peronospora farinosa races 1-9, 11-15 and isolate UA1014APLP (Pfs 17). Preferably the spinach plant comprises resistance against at least Pfs races 1-6, 7(−), 8(−), 9, 11-15 and 17.

(34) In another embodiment, methods of use a spinach plant comprising resistance against one or more of Peronospora farinosa races 1-6, 9, 11-15 and isolate UA1014APLP (at least Pfs races 1-6, 7(−), 8(−), 9, 11-15 and 17) conferred by an introgression fragment obtainable from (or as present in; as derivable from; as obtained or derived from) seeds deposited under accession number NCIMB 42392 or NCIMB 42393, or from progeny thereof (e.g. obtained by selfing), is provided for generating a spinach plant comprising resistance against one or more of Peronospora farinosa 1-9, 11-15 and isolate UA1014APLP (at least Pfs races 1-6, 7(−), 8(−), 9, 11-15 and 17).

(35) It is noted that also allelism tests can be used to determine whether the resistance gene in a spinach plant is the same gene/locus/loci or a different gene/locus/loci as the resistance gene/locus/loci as present in NCIMB 42392 or NCIMB 42393 (or in progeny thereof). For instance, NCIMB 42392 or NCIMB 42393 (or progeny) can be crossed with another spinach plant comprising the same resistance phenotype and in progeny of such a cross one can determine in which ratios the phenotype segregates. So in one aspect a spinach plant is provided comprising resistance against one or more of P. farinosa races 1-9, 11-15 and isolate UA1014APLP (at least Pfs races 1-6, 7(−), 8(−), 9, 11-15 and 17), wherein said resistance gene/locus/loci conferring said resistance phenotype is the gene/locus/loci as present in NCIMB 42392 or NCIMB 42393 (or progeny thereof), as determinable in an allelism test. Allelism tests for dominant genes are known in the art (see, e.g., Hibberd et al., 1987, Phytopathology 77:1304-1307).

(36) Also seeds from which any of the plants of the invention can be grown are provided, as are containers or packages containing or comprising such seeds. Seeds can be distinguished from other seeds due to the presence of the resistance gene/locus/loci, either phenotypically (based on plants having the resistance phenotype according to the current invention) and/or using molecular methods.

(37) In one aspect, seeds are packaged into small and/or large containers (e.g., bags, cartons, cans, etc.). The seeds may be pelleted prior to packing (to form pills or pellets) and/or treated with various compounds, such as seed coatings.

(38) Pelleting creates round or rounded shapes, which are easily sown with modern sowing machines. A pelleting mixture typically contains seeds and at least glue and filler material. The latter could be, for example, clay, mica, chalk or cellulose. In addition, certain additives can be included to improve particular properties of the pellet, e.g., a seed treatment formulation comprising at least one insecticidal, acaricidal, nematicidal or fungicidal compound can be added directly into the pelleting mixture or in separate layers. A seed treatment formulation can include one of these types of compounds only, a mixture of two or more of the same type of compounds or a mixture of one or more of the same type of compounds with at least one other insecticide, acaricide, nematicide or fungicide.

(39) Formulations especially suitable for the application as a seed treatment can be added to the seed in the form of a film coating including also the possibility of using the coating in or on a pellet, as well as including the seed treatment formulation directly into the pellet mixture. Characteristically, a film coating is a uniform, dust-free, water permeable film, evenly covering the surface of all individual seeds.

(40) Besides the formulation, the coating mixture generally also contains other ingredients such as water, glue (typically a polymer), filler materials, pigments and certain additives to improve particular properties of the coating. Several coatings can be combined on a single seed.

(41) In addition, several combinations with film coating are possible: the film coating can be added on the outside of the pellet, in between two layers of pelleting material, and directly on the seed before the pelleting material is added. Also more than 1 film coating layer can be incorporated in a single pellet. A special type of pelleting is encrusting. This technique uses less filler material, and the result is a “mini-pellet”.

(42) Seeds may also be primed. Spinach is often primed. Priming is a water-based process that is performed on seeds to increase uniformity of germination and emergence from the soil, and thus enhance vegetable stand establishment. Priming decreases the time span between the emergence of the first and the last seedlings. Methods how to prime spinach seeds are well known in the art.

(43) In a further aspect plant parts, obtained from (obtainable from) a plant of the invention are provided herein, and containers or packages comprising said plant parts. In a preferred embodiment the plant parts are leaves of spinach plants of the invention, preferably harvested leaves, or parts of these. Leaves may be loose, bunched, fresh (e.g. in bags), frozen, blanched or boiled. Leaves may be fresh or processed, they may be part of food or feed products, such as salads, etc. Other plant parts, of plants of the invention, include stems, cuttings, petioles, cotyledons, flowers, anthers, pollen, ovaries, roots, root tips, protoplasts, callus, microspores, stalks, ovules, shoots, seeds, embryos, embryo sacs, cells, meristems, buds etc.

(44) Seeds include for example seeds produced on the plant of the invention after self-pollination or seed produced after cross-pollination, e.g. pollination of a plant of the invention with pollen from another spinach plant or pollination of another spinach plant with pollen of a plant of the invention.

(45) In a further aspect, the plant part is a plant cell. In still a further aspect, the plant part is a non-regenerable cell or a regenerable cell.

(46) In another aspect the plant cell is a somatic cell. A non-regenerable cell is a cell which cannot be regenerated into a whole plant through in vitro culture, but the non-regenerable cell may be in a plant or plant part (e.g. leaves) of the invention.

(47) In a further aspect the plant cell is a reproductive cell, such as an ovule or pollen. These cells are haploid. When they are regenerated into whole plants, they comprise the haploid genome of the starting plant. If chromosome doubling occurs (e.g. through chemical treatment), a double haploid plant can be regenerated. In one aspect the plant of the invention, comprising the resistance gene/locus/loci is a haploid or a double haploid spinach plant.

(48) Moreover, there is provided an in vitro cell culture or tissue culture of spinach plants of the invention in which the cell- or tissue culture is derived from a plant parts described above, such as, for example and without limitation, leaves, pollen, embryos, cotyledon, hypocotyls, callus, meristematic cells, roots, root tips, anthers, flowers, seeds or stems, somatic cells, reproductive cells.

(49) Also provided are spinach plants regenerated from the above-described plant parts, or regenerated from the above-described cell or tissue cultures, said regenerated plant having a Pfs resistance phenotype, i.e. retains the resistance gene/locus/loci (or the introgression fragment comprising the resistance gene/locus/loci) of the invention. These plants can also be referred to as vegetative propagations of plants of the invention.

(50) Also provided are harvested leaves of plants of the invention and packages comprising a plurality of leaves of plants of the invention. These leaves thus comprise the resistance of the invention, detectable by e.g. linked molecular markers or phenotypically (for the originally used whole plant and/or regenerated plant).

(51) The invention also provides for a food or feed product comprising or consisting of a plant part described herein. The food or feed product may be fresh or processed, e.g., canned, steamed, boiled, fried, blanched and/or frozen etc. Examples are salad or salad mixtures comprising leaves or parts of leaves of plants of the invention.

(52) A spinach plant of the invention or a progeny thereof retaining the Pfs resistance phenotype conferred by the gene/locus/loci and/or retaining the introgression fragment comprising the gene/locus/loci, as present in NCIMB 42392 or NCIMB 42393, and parts of the afore-mentioned plants, can be suitably packed for, e.g., transport, and/or sold fresh. Such parts encompass any cells, tissues and organs obtainable from the seedlings or plants, such as but not limited to: leaves, cuttings, pollen, parts of leaves, and the like.

(53) Leaves may be harvested immature, as baby-leaf or baby spinach, or mature. A plant, plants or parts thereof may be packed in a container (e.g., bags, cartons, cans, etc.) alone or together with other plants or materials. Parts can be stored and/or processed further. Encompassed are therefore also food or feed products comprising one or more of such parts, such leaves or parts thereof obtainable from a plant of the invention, a progeny thereof and parts of the afore-mentioned plants. For example, containers such as cans, boxes, crates, bags, cartons, Modified Atmosphere Packaging, films (e.g. biodegradable films), etc. comprising plant parts of plants (fresh and/or processed) of the invention are also provided herein.

(54) In another embodiment, plants and parts of spinach plants of the invention, and progeny of spinach plants of the invention are provided, e.g., grown from seeds, produced by sexual or vegetative reproduction, regenerated from the above-described plant parts, or regenerated from cell or tissue culture, in which the reproduced (seed propagated or vegetatively propagated) plant comprises resistance against one or more of Pfs races 1-9, 11-15 and isolate UA1014APLP (Pfs 17), preferably at least Pfs races 1-6, 7(−), 8(−), 9, 11-15 and 17.

(55) As mentioned before, whether or not a plant, progeny or vegetative propagation comprises the Pfs resistance phenotype as conferred by the current invention can be tested phenotypically using e.g. the Pfs disease resistance assays as described above; and/or using molecular techniques such as molecular marker analysis, DNA sequencing (e.g. whole genome sequencing to identify the wild introgression), chromosome painting, etc.

(56) In one embodiment, the resistance gene/locus/loci obtainable from (obtained from; as found in) plants deposited under NCIMB 42392 or NCIMB 42393, or progeny thereof, can be combined with other Peronospora farinosa resistance genes or resistance loci or with other traits, such resistance against bacteria (e.g. Pseudomonas syringae pv. spinacea; Erwinia carotovora), fungi (e.g. Albugo occidentalis; Colletotrichum dematium f sp. spinaciae; Stemphylium botryosum f sp. spinaciae), viruses (e.g. viruses causing curly top disease) or nematodes. This can be done by traditional breeding techniques, e.g. by backcrossing in order to introduce one or more traits into a plant of the invention or in order to introduce the gene/locus/loci of a plant of the invention into another spinach plant comprising such one or more additional traits. Thus, in one aspect a plant of the invention is used as a donor of the resistance according to the current invention, while in another aspect a plant of the invention is used as recipient of one or more other traits.

(57) Furthermore, the invention provides for progeny comprising or retaining the Pfs resistance phenotype, such as progeny obtained by, e.g., selfing one or more times and/or cross-pollinating a plant of the invention with another spinach plant of a different variety or breeding line, or with a spinach plant of the invention one or more times. In particular, the invention provides for progeny that retain the resistance gene/locus/loci (conferring the Pfs resistance phenotype) of (as found in) NCIMB 42392 or NCIMB 42393. In one aspect the invention provides for a progeny plant comprising the resistance according to the current invention, such as a progeny plant that is produced from a spinach plant comprising the resistance according to the current invention by one or more methods selected from the group consisting of: selfing, crossing, mutation, double haploid production or transformation.

(58) Mutation may be spontaneous mutations or human induced mutations or somaclonal mutations. In one embodiment, plants or seeds of the invention may also be mutated (by e.g. irradiation, chemical mutagenesis, heat treatment, TILLING, etc.) and/or mutated seeds or plants may be selected (e.g. natural variants, somaclonal variants, etc.) in order to change one or more characteristics of the plants.

(59) Similarly, plants of the invention may be transformed and regenerated, whereby one or more chimeric genes are introduced into the plants. Transformation can be carried out using standard methods, such as Agrobacterium tumefaciens mediated transformation or biolistics, followed by selection of the transformed cells and regeneration into plants.

(60) A desired trait (e.g. genes conferring pest or disease resistance, herbicide, fungicide or insecticide tolerance, etc.) can be introduced into the plants, or progeny thereof, by transforming a plant of the invention or progeny thereof with a transgene that confers the desired trait, wherein the transformed plant retains the resistance according to the current invention and the Pfs resistance phenotype conferred by it and contains the desired trait.

(61) The resistance gene or locus/loci may be transferred to progeny by further breeding. In one aspect progeny are F1 progeny obtained by crossing a plant of the invention with another plant or S1 progeny obtained by selfing a plant of the invention. Also encompassed are F2 progeny obtained by selfing the F1 plants, or further generation progeny. “Further breeding” encompasses traditional breeding techniques (e.g., selfing, crossing, backcrossing), marker-assisted breeding, and/or mutation breeding. In one embodiment, the progeny have the Pfs resistance phenotype of NCIMB 42392 or NCIMB 42393.

(62) In one aspect haploid plants and/or double haploid plants of plant of the invention are encompassed herein, which comprise resistance against one or more of Peronospora farinosa races 1-9, 11-15 and isolate UA1014APLP (preferably at least Pfs races 1-6, 7(−), 8(−), 9, 11-15 and 17), as conferred by the gene/locus/loci or by the introgression fragment comprising the resistance gene. Haploid and double haploid (DH) plants can for example be produced by anther or microspore culture and regeneration into a whole plant. For DH production chromosome doubling may be induced using known methods, such as colchicine treatment or the like. So, in one aspect a spinach plant is provided, comprising Pfs resistance phenotype as described, wherein the plant is a double haploid plant.

(63) In another embodiment the invention relates to a method for producing spinach seed, comprising crossing a plant of the invention with itself or a different spinach plant and harvesting the resulting seed. In a further embodiment the invention relates to seed produced according to this method and/or a spinach plant produced by growing such seed. Thus, a plant of the invention may be used as male and/or female parent, in the production of spinach seeds, whereby the plants grown from said seeds comprise resistance against one or more of Peronospora farinosa races 1-9, 11-15 and isolate UA1014APLP (preferably at least Pfs races 1-6, 7(−), 8(−), 9, 11-15 and 17).

(64) Thus, in one aspect progeny of a spinach plant of the invention are provided, wherein the progeny plant is produced by selfing, crossing, mutation, double haploid production or transformation and wherein the progeny retain the resistance gene/locus/loci (and phenotype conferred by it) described herein, i.e. obtainable by crossing a spinach plant, grown from seeds deposited under accession number NCIMB 42392 or NCIMB 42393, with another spinach plant. In other words, the resistance gene or locus (or introgression fragment comprising the gene or locus) present in or as derivable from seed deposited as NCIMB 42392 or NCIMB 42393 is retained in the progeny plants.

(65) Molecular markers may also be used to aid in the identification of the plants (or plant parts or nucleic acids obtained therefrom) containing the resistance gene or locus or allele(s). For example, one can develop one or more suitable molecular markers which are closely genetically (and preferably also physically) linked to the resistance gene, locus or allele. This can be done by crossing a resistant spinach plant with a susceptible spinach plant and developing a segregating population (e.g. F2 or backcross population) from that cross. The segregating population can then be phenotyped for Pfs resistance and genotyped using e.g. molecular markers such as SNPs (Single Nucleotide Polymorphisms), AFLPs (Amplified Fragment Length Polymorphisms; see, e.g. EP 534 858), or others, and by software analysis molecular markers which co-segregate with the Pfs resistance trait in the segregating population can be identified and their order and genetic distance (centimorgan distance, cM) to the resistance gene or locus can be identified. Molecular markers which are closely linked to resistance locus or loci, e.g. markers at a 5 cM distance or less, can then be used in detecting and/or selecting plants (e.g. plants of the invention or progeny of a plant of the invention) or plant parts comprising or retaining the introgression fragment comprising the resistance gene or locus. Such closely linked molecular markers can replace phenotypic selection (or be used in addition to phenotypic selection) in breeding programs, i.e. in Marker Assisted Selection (MAS). Preferably flanking markers are used in MAS, i.e. one marker on either side of the resistance gene or locus/loci.

(66) Any other type of molecular marker and/or other assay that is able to identify the relative presence or absence of a trait of interest in a plant or plant part can also be useful for breeding purposes.

(67) Said progeny plants according to the current invention comprise alleles or sequences which comprise one or more of SEQ ID NOs:1-8. In some embodiments, the progeny plants comprise one or both of SEQ ID NO:1 and SEQ ID NO:2. In some embodiments, the progeny plants comprises one, two, three, four, five or six of SEQ ID NOs:3-8.

(68) Preferably said progeny plants according to the current invention are identifiable via use of primers directed to one or more of SEQ ID NOs:1-8, whereby the presence of at least one of these sequences is a prerequisite for a plant according to the current invention. In some embodiments, selection of plants according to the current invention occurs on the basis of the presence of at least one sequence selected from SEQ ID NOs:1-8. In some embodiments, the plants comprise one or both of SEQ ID NO:1 and SEQ ID NO:2. In some embodiments, the plants comprises one, two, three, four, five or six of SEQ ID NOs:3-8.

(69) Sequence analysis of SEQ ID NOs:1-8 was performed using the BLASTn tool found on the “spinachbase” website in comparison to the draft genome of Spinacia oleracea cultivar Sp75′, released February 2017. All eight sequences were found to align with sequences of chromosome 3 of ‘Sp75’, which has a length of approximately 113 megabases.

(70) TABLE-US-00001 TABLE I Alignment with the genome of Spinacia oleracea cultivar ‘Sp75’ SEQ ID NO: Approximate location on ‘Sp75’ chromosome 3 1 1,271,971 bp 2 1,264,341 bp 3 3,861,266 bp 4 3,963,668 bp 5 3,963,678 bp 6 3,965,092 bp 7 4,005,190 bp 8 4,005,208 bp
Deposit Information

(71) A total of 2500 seeds of spinach line ‘B11-523-1-17’ described in Example 1 were deposited under accession number NCIMB 42392 by Pop Vriend Seeds on 7 Apr. 2015, at the NCIMB Ltd., Ferguson Building, Craibstone Estate, Bucksbum, Aberdeen AB21 9YA, United Kingdom (NCIMB). Likewise, a total of 2500 seeds of spinach line ‘B11-505-3-17’ described in Example 2 were deposited under accession number NCIMB 42393 by Pop Vriend Seeds on 7 Apr. 2015, at NCIMB. Subject to 37 C.F.R. § 1.808(b), all restrictions imposed by the depositor on the availability to the public of the deposited material will be irrevocably removed upon the granting of the patent. The deposit will be maintained for a period of 30 years, or 5 years after the most recent request or for the enforceable life of the patent whichever is longer, and will be replaced if it ever becomes nonviable during that period. Applicant does not waive any rights granted under this patent on this application or under the Plant Variety Protection Act (7 USC 2321 et seq.).

Enumberated Embodiments

(72) The following enumerated embodiments are representative of some aspects of the invention.

(73) 1. A spinach plant comprising resistance against Peronospora farinosa races 1-9, 11-15 and isolate UA1014APLP (Pfs 17), or against Pfs races 1-6, 7(−), 8(−), 9, 11-15 and 17.

(74) 2. The spinach plant of embodiment 1, wherein the plant is obtainable by introgression from a plant grown from seeds of which a representative sample has been deposited with NCIMB under accession number NCIMB 42392 or NCIMB 42393.

(75) 3. The spinach plant of embodiment 1 or 2, whereby said spinach plant comprises at least one allele or sequence selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:2; or selected from the group consisting of SEQ ID NOs:3-8.

(76) 4. The spinach plant of embodiment 3, whereby said allele or sequence is linked to the resistance.

(77) 5. The spinach plant of any one of embodiments 1 to 4, whereby said spinach plant is a hybrid plant.

(78) 6. The spinach plant of any one of embodiments 1 to 4, whereby said spinach plant is an inbred plant.

(79) 7. The spinach plant of any one of embodiments 1 to 6, whereby said plant is selected from the group consisting of: savoy, semi-savoy, flat or smooth leaved.

(80) 8. A progeny plant of the spinach plant of any one of embodiments 1 to 7, wherein said progeny plant retains resistance against Peronospora farinosa races 1-9, 11-15, and isolate UA1014APLP (Pfs 17), or against Pfs races 1-6, 7(−), 8(−), 9, 11-15 and 17.

(81) 9. The progeny plant of embodiment 8, wherein the progeny plant is produced by one or more methods selected from the group consisting of: selfing, crossing, mutation, double haploid production or transformation.

(82) 11. The progeny plant of embodiment 8 or 9, whereby said progeny plant comprises at least one allele or sequence selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:2; or selected from the group consisting of SEQ ID NOs:3-8.

(83) 12. Seed from which a spinach plant of any one of embodiments 1 to 7 can be grown.

(84) 13. Use of one or more seeds as deposited under accession number NCIMB 42392 or NCIMB 42392 or progeny thereof for generating a spinach plant comprising resistance against Peronospora farinosa races 1-9, 11-15 and isolate UA1014APLP (Pfs 17), or against Pfs races 1-6, 7(−), 8(−), 9, 11-15 and 17.
14. A part of the spinach plant of any one of embodiments 1 to 7 or a part of the progeny plant of any one of embodiments 8 to 10, wherein the part is selected from the group consisting of: stems, cuttings, petioles, cotyledons, flowers, anthers, pollen, ovaries, roots, root tips, protoplasts, callus, microspores, stalks, ovules, shoots, seeds, embryos, embryo sacs, cells, meristems, buds, leaves
15. A cell culture or tissue culture comprising cells or tissue derived from the part of embodiment 13.
16. A spinach plant regenerated from the cell or tissue culture of embodiment 14, wherein said spinach plant comprises resistance against Peronospora farinosa races 1-9, 11-15 and isolate UA1014APLP (Pfs 17) or against Pfs races 1-6, 7(−), 8(−), 9, 11-15 and 17.
17. The spinach plant of embodiment 15, wherein said spinach plant comprises at least one allele or sequence selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:2; or selected from the group consisting of SEQ ID NOs:3-8.
18. A food product comprising the harvested leaves of the plant of any one of embodiments 1 to 7 or 15 to 16 or a progeny according to any of the claims 8 to 10.
19. A container comprising one or more spinach plants of any one of embodiments 1, 15 or 8, in a growth substrate for harvest of leaves from said plants.
20. A method for generating a spinach plant comprising resistance against a plurality of Peronospora farinosa f. sp. spinaciae (Pfs) races, comprising the steps of:

(85) a) providing a spinach plant comprising an introgression fragment obtainable from accession number NCIMB 42392 or NCIMB 42393, which introgression fragment confers resistance against the plurality of Pfs races;

(86) b) crossing said spinach plant with another spinach plant, which is susceptible against one or more of the plurality of Pfs races;

(87) c) optionally selfing the plants grown from F1 seeds one or more times to produce F2, F3 or further generation selfing progeny;

(88) d) identifying spinach plants grown from F1, F2, F3 or further generation selfing progeny which have resistance against the plurality of Pfs races and/or which comprise the introgression fragment or a resistance-conferring part of the introgression fragment;

(89) e) optionally crossing said identified F1 progeny or selfing progeny to the spinach plant of step b), to produce a backcross progeny;

(90) f) optionally selecting backcross progeny which comprises resistance the plurality of Pfs races and/or which comprise the introgression fragment or a resistance-conferring part of the introgression fragment,

(91) wherein the plurality of Pfs races comprises Pfs races 1-9, 11-15 and isolate UA1014APLP (Pfs 17) or Pfs races 1-6, 7(−), 8(−), 9, 11-15 and 17.

(92) 21. The method of embodiment 19, whereby said identification step in step d) occurs via marker assisted selection.

(93) 22. The method of embodiment 19, whereby said identifying spinach plants and/or selecting backcross progeny occurs by identifying the presence of at least one allele or sequence in said plants or progeny; wherein the at least one allele or sequence is selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:2; or selected from the group consisting of SEQ ID NOs:3-8.
23. A spinach plant comprising resistance against Peronospora farinosa (Pfs) race 14, wherein said resistance is conferred by a resistance gene, which is present in seeds deposited under accession number NCIMB 42392 or NCIMB 42393.
24. The plant of embodiment 23, wherein said spinach plant further comprises resistance against Pfs races 1-6.
25. The plant of embodiment 23, wherein said spinach plant further comprises resistance against Pfs isolate UA1014APLP.
26. The plant of embodiment 23, wherein said spinach plant comprises resistance against Pfs races 11-15 and isolate UA1014APLP.
27. The plant of embodiment 23, wherein said spinach plant comprises at least one allele selected from the group consisting of:

(94) a ‘T’ allele at a single nucleotide polymorphism (SNP) at position 51 of SEQ ID NO:1;

(95) a ‘T’ allele at a SNP of position 51 of SEQ ID NO:2;

(96) a ‘C’ allele at the SNP of position 51 of SEQ ID NO:3;

(97) a ‘T’ allele at the SNP of position 51 of SEQ ID NO:4;

(98) a ‘G’ allele at the SNP of position 51 of SEQ ID NO:5;

(99) a ‘C’ allele at the SNP of position 51 of SEQ ID NO:6;

(100) a ‘C’ allele at the SNP of position 51 of SEQ ID NO:7; and

(101) a ‘C’ allele at the SNP of position 51 of SEQ ID NO:8.

(102) 28. The plant of embodiment 27, wherein said spinach plant comprises at least one nucleotide sequence selected from the group consisting of SEQ ID NOs:1-8, or at least one nucleotide sequence having at least 90% identity to one ore more of the group consisting of SEQ ID NOs:1-8.

(103) 29. A seed from which the plant of embodiment 23 can be grown.

(104) 30. A leaf of the plant of embodiment 23.

(105) 31. A progeny plant of the plant of embodiment 23, wherein said progeny plant retains the resistance gene which confers resistance to Pfs race 14.

(106) 32. The progeny plant of embodiment 31, wherein said progeny plant is resistant to Pfs races 11-15 and isolate UA1014APLP.

(107) 33. The progeny plant of embodiment 31, wherein said progeny plant is produced by one or more methods of selfing, crossing, mutation, double haploid production or transformation.

(108) 34. The progeny plant of embodiment 31, wherein said progeny plant comprises at least one nucleotide sequence selected from the group consisting of SEQ ID NOs:1-8, or at least one nucleotide sequence having at least 90% identity to one ore more of the group consisting of SEQ ID NOs:1-8.

(109) 35. A method of generating a spinach plant comprising resistance against Pfs race 14, comprising growing a plant from a seed deposited under accession number accession number NCIMB 42392 or NCIMB 42393 or a progeny thereof, wherein said progeny comprises a resistance gene which confers resistance to Pfs race 14, wherein the resistance gene is present in seeds deposited under accession number NCIMB 42392 or NCIMB 42393.

(110) 36. The method of embodiment 35, wherein said resistance gene confers resistance against Pfs races 11-15 and isolate UA1014APLP.

(111) 37. A part of the spinach plant of embodiment 23, wherein the part is selected from the group consisting of a stem, a cutting, a petiole, a cotyledon, a flower, an anther, a pollen, an ovary, a root, a root tip, a protoplast, a callus, a microspore, a stalk, an ovule, a shoot, a seed, an embryo, an embryo sac, a cell, a meristem, a bud or a leaf.

(112) 38. A cell culture or tissue culture comprising a cell or a tissue derived from the part of embodiment 37.

(113) 39. A spinach plant regenerated from the cell culture or tissue culture of embodiment 38 and comprising resistance against Pfs race 14, wherein said resistance is conferred by a resistance gene present in seeds deposited under accession number NCIMB 42392 or NCIMB 42393.

(114) 40. The spinach plant of embodiment 39, wherein said spinach plant comprises at least one nucleotide sequence selected from the group consisting of SEQ ID NOs:1-8, or at least one nucleotide sequence having at least 90% identity to one ore more of the group consisting of SEQ ID NOs:1-8.

(115) 41. A food product comprising harvested leaves of the spinach plant of embodiment 23.

(116) 42. A container comprising the spinach plant of embodiment 23, in a growth substrate for harvest of leaves from said plant.

EXAMPLES

(117) The present disclosure will be more fully understood by reference to the following examples. It should not, however, be construed as limiting the scope of the present disclosure. It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims.

Example 1: Downy Mildew-Resistant Spinach Line ‘B11-523-1-17’

(118) Origin of Breeding

(119) Seeds of spinach line ‘B11-523-1-17’ were deposited as accession number NCIMB 42392. The ‘B11-523-1-17’ spinach line was developed by first crossing a plant of variety ‘Viroflay’ (S. oleracea) with a plant of S. turkestanica with accession number 32. The final outcome was a spinach plant with resistance against Pfs races 1-6, 7(−), 8(−), 9, 11-15 and isolate UA1014APLP (Pfs 17). Seeds of this final outcome were deposited as accession number NCIMB 42392. Observation during the variety selections confirmed that ‘B11-523-1-17’ is uniform and stable.

(120) TABLE-US-00002 TABLE 1-1 Characteristics of the ‘B11-523-1-17’ Spinach Line Characteristic ‘B11-523-1-17’ Seed: spines absent Plant: red coloration of stem, petioles absent and veins Leaf Blade: intensity of green color dark Leaf Blade: blistering absent or very weak Petiole: length long Leaf Blade: shape medium ovate Leaf Blade: shape of apex obtuse Proportion of monoecious plants very high Time of start of bolting between early and medium

(121) The crossing scheme was as follows:

(122) Step 1: crossing between cultivar ‘Viroflay’ (S. oleracea) and S. turkestanica accession number 32;

(123) Step 2: crossing of F1 progeny plants from step 1 with a S. oleracea cultivar with internal reference ‘PV1372’;

(124) Step 3: selfing of the plants obtained from step 2 after selection for downy mildew resistance; and

(125) Step 4: selfing of the plants obtained from step 3 after selection for downy mildew resistance.

(126) Plants from seeds resulting from step 4 were grown and downy mildew test results showed resistance against Pfs races 1-6, 7(−), 8(−), 9, 11-15 and isolate UA1014APLP (Pfs 17). The presence of alleles/sequences as given in SEQ ID NO:1 and SEQ ID NO:2 was confirmed. ‘B11-523-1’ is a line of the F2 generation, and ‘B11-523-1-17’ is a line of the F3 generation.

(127) In accordance with the disclosure, novel varieties may be created by crossing plants grown from NCIMB 42392 followed by multiple generations of breeding according to well-known methods. New varieties may be created by crossing with any second plant. Once initial crosses have been made, inbreeding and selection take place to produce new varieties. For development of a uniform line, often five or more generations of selfing and selection are involved. It is supposed that the present disclosure is not restricted to any form of realization described previously and that some modifications can be added to the presented example of fabrication without reappraisal of the appended claims.

(128) Mapping the Resistance

(129) A mapping population was created as described in the “Origin of breeding” section. In brief, F1 progeny of the cross of between the cultivar ‘Viroflay’ (S. oleracea) and S. turkestanica accession number 32 was created with internal reference ‘B11-523’. The outcome was a spinach plant with resistance against Pfs races 1-9, 11-15 and isolate UA1014APLP. An F2 population was obtained by crossing a ‘B11-523’ individual with a S. oleracea cultivar with internal reference ‘PV1372’. Approximately 120 plants were tested for downy mildew resistance against strain Pfs 14. The parents, the F1 progenitor used and 96 randomly chosen F2 individuals for which the phenotypic data were analyzed were used for molecular genetic analysis.

(130) TABLE-US-00003 TABLE 1-2 Pfs Resistance of 96 F2 Plants Pfs 14 Number Percentage Resistant 55 57% Susceptible 41 43%

(131) Genomic DNA of the parents and F2 progeny was isolated and the F2 progeny was pooled in resistant and susceptible bulks. The gDNA was prepared for Illumina HiSeq sequencing. Briefly, the gDNA was prepared for shot gun library preparation by strict fragmentation and end repair of gDNA, adapter ligation, size selection (approximately 300 bp) PCR amplification, library purification and Quality Control. Two flow channels were prepared and the libraries were sequenced in Hiseq2500 2×150 bp paired-end mode. The data was collected and filtered according to Quality scores in Illumina pipeline 1.8.

(132) The reference sequences of S. oleracea cultivar ‘Viroflay’ were obtained from the Spinach Genome Sequence Resources (SGSR, UC Davis Genome Center, Davis, USA) and is named spinach_assembly-repeatdetect_PACBIO_V1.3. The reference sequences contain 2882 high quality contigs with an average length of 316,211,89 nucleotides. The obtained reads of the parents were stringently mapped using CLC Genomics Workbench V. 9.5.1 with the following parameters:

(133) References=spinach_assembly-repeatdetect_PACBIO_V1.3

(134) Masking mode=No masking

(135) Match score=1

(136) Mismatch cost=2

(137) Cost of insertions and deletions=Linear gap cost

(138) Insertion cost=3

(139) Deletion cost=3

(140) Length fraction=0.8

(141) Similarity fraction=0.95

(142) Global alignment=No

(143) Auto-detect paired distances=Yes

(144) Non-specific match handling=Map randomly

(145) Output mode=Create stand-alone read mappings

(146) Create report=Yes

(147) Collect un-mapped reads=No

(148) TABLE-US-00004 TABLE 1-3 Read Mapping Statistics of the Internal Reference Variety ‘PV1372’ Percentage Number Percentage ‘PV1372’ Count of reads of bases of bases Reference 2,882 — 911,322,679 — Mapped reads 73,862,266 94.78% 11,079,339,900 94.78% Not mapped 4,069,614 5.22% 610,442,100 5.22% reads Reads in pairs 64,277,672 82.48% 9,641,650,800 82.48% Broken paired 9,584,594 12.30% 1,437,689,100 12.30% reads Total reads 77,931,880 100.00% 11,689,782,000 100.00%

(149) TABLE-US-00005 TABLE 1-4 Read Mapping Statistics of ‘B11-523-1’ Percentage Percentage ‘B11-523-1’ Count of reads Number of bases of bases Reference 2,882 — 911,322,679 — Mapped reads 117,314,539 95.55% 17,597,180,850 95.55% Not mapped 5,466,625 4.45% 819,993,750 4.45% reads Reads in pairs 101,964,742 83.05% 15,294,711,300 83.05% Broken paired 15,349,797 12.50% 2,302,469,550 12.50% reads Total reads 122,781,164 100.00% 18,417,174,600 100.00%

(150) The ‘B11-523’ mapping file was used in Probabilistic Variant Detection. The Variant data file was used to filter for variants that are also present in the ‘PV1372’ mapping file with various settings to optimize the data. A total of 14,897 variants (Single Nucleotide Variants or SNVs, and insertions/deletions) were detected for the ‘PV1372’ mapping file and a total of 209,506 variants were detected for the ‘B11-523’ mapping file.

(151) The variant file of ‘B11-523’ was both in silico and manually filtered for: Known variants in the ‘PV1372’ mapping file, Type (SNV), Frequency of the variant, Coverage, Control coverage, Probability, Forward/reverse balance, Average base quality and the Reference allele. In total, 96 heterozygous SNVs were obtained. The contigs containing the variants were manually checked for heterozygous/homozygous coverage of the read mappings and rejected when both frequencies were in vicinity of each other in a random fashion. It is anticipated that S. turkestanica read mappings are semi-hemizygous (i.e., blocks of hemizygous regions are flanked by regions with heterozygosity) as has been seen for previous crossings with genomes having high scores of polymorphism at the nucleotide level. Therefore, a number of dominant SNVs for the hemizygous regions of the aforementioned contigs were also selected. A total of 48 SNVs of eight different contigs were selected for KASP assays on the 96 F2 individuals. Two SNPs were found to be associated with the phenotypic data (e.g., Pfs 14 resistance. These SNPs can be used for the identification of plants having the Pfs resistance phenotype according to the current disclosure (see also sequences given in the sequence listing below). More in detail, plants according to the current invention are linked to a SNP on position 137372 (C to T) and/or a SNP on position 144376 (A to T).

(152) TABLE-US-00006 TABLE 1-5 SNPs Identified in ‘B11-523’ Associated with Pfs 14 Resistance Contig Region Reference Allele Count Coverage Forward/reverse balance uti_cns_0000548 137,372 C T 13 23 0.5 uti_cns_0000548 144,376 A T 11 24 0.43

(153) SEQ ID NO:1=Nucleotide sequence of ‘B11-523’ containing a ‘T’ allele at the SNP of position 51 (region 137,372 of ut_cns_0000548):

(154) TABLE-US-00007 GAATTAAGAATTGGTGTTGGATTTTACTCTGTAGTTTTCAGGTATATCGT TAGGGATGCAAATTAGTCGAGACTTTCAAGAATTGATCTTGGAGTATTTG G.

(155) SEQ ID NO:2=Nucleotide sequence of ‘B11-523’ containing a ‘T’ allele at the SNP of position 51 (region 144,376 of ut_cns_0000548):

(156) TABLE-US-00008 CTTTGTTAATTATATTCATGCTATTGCGCTCTATATTAAAGCTAAGAACA TGAGGTGTTACAAGATGCCATGTTCCGGTCGATCGTTACAAATTGGATTA A.

(157) An example of a read mapping of B11-523 on ‘Viroflay’ contig uti_cns_0000548 containing heterozygous informative SNPs of position 137,372 (C to T) can be found in FIG. 1 of WO 2017/081187, which is incorporated by reference.

Example 2: Downy Mildew-Resistant Spinach Line ‘B11-505-3-17’

(158) Origin of Breeding

(159) Seeds of spinach line ‘B11-505-3-17’ were deposited as accession number NCIMB 42393. The ‘B11-505-3-17’ spinach line was developed by first crossing a plant of variety ‘Viroflay’ (S. oleracea) with a plant of S. turkestanica with accession number KK28. The final outcome was a spinach plant with resistance against Pfs races 1-9, 11-15 and isolate UA1014APLP (Pfs 17). Seeds of this final outcome were deposited as accession number NCIMB 42393. Observation during the variety selections confirmed that ‘B11-505-3-17’ is uniform and stable.

(160) The crossing scheme was as follows:

(161) Step 1: crossing between cultivar ‘Viroflay’ (S. oleracea) and S. turkestanica accession number KK28;

(162) Step 2: crossing of F1 progeny plants from step 1 with a S. oleracea cultivar ‘Crocodile’;

(163) Step 3: selfing of the plants obtained from step 2 after selection for downy mildew resistance; and

(164) Step 4: selfing of the plants obtained from step 3 after selection for downy mildew resistance.

(165) Plants from seeds resulting from step 4 were grown and downy mildew test results showed resistance against Pfs races 1-9, 11-15 and isolate UA1014APLP. Presence of alleles/sequences as given in SEQ ID NOs:3-8 was confirmed. B11-505-3 a line of the F2 generation, and B11-505-3-17 a line of the F3 generation.

(166) In accordance with the disclosure, novel varieties may be created by crossing plants grown from NCIMB 42393 followed by multiple generations of breeding according to well-known methods. New varieties may be created by crossing with any second plant. Once initial crosses have been made, inbreeding and selection take place to produce new varieties. For development of a uniform line, often five or more generations of selfing and selection are involved. It is supposed that the present disclosure is not restricted to any form of realization described previously and that some modifications can be added to the presented example of fabrication without reappraisal of the appended claims.

(167) TABLE-US-00009 TABLE 2-1 Characteristics of the ‘B11-505-3-17’ Spinach Line Characteristic ‘B11-505-3-17’ Seed: spines absent Plant: red coloration of stem, petioles and veins absent Leaf Blade: intensity of green color dark Leaf Blade: blistering absent or very weak Petiole: length medium Leaf Blade: shape medium ovate Leaf Blade: shape of apex obtuse Proportion of monoecious plants very high Time of start of bolting early
Mapping of the Resistance

(168) A mapping population was created as described in the “Origin of breeding” section. In brief, F1 progeny of the cross of between the cultivar ‘Viroflay’ (S. oleracea) and S. turkestanica accession number KK28 was created and given internal reference ‘B11-505’. An F2 population was obtained by crossing a ‘B11-505’ individual with a S. oleracea cultivar ‘Crocodile’. Approximately 120 plants were tested for downy mildew resistance against strain Pfs 14. The parents, the F1 progenitor used and 96 randomly chosen F2 individuals for which the phenotypic data were analyzed were used for molecular genetic analysis.

(169) Genomic DNA of the parents and F2 progeny was isolated and the F2 progeny was pooled in resistant and susceptible bulks. The gDNA was prepared for Illumina HiSeq sequencing. Briefly, the gDNA was prepared for shotgun library preparation by strict fragmentation and end repair of gDNA, adapter ligation, size selection (approximately 300 bp) PCR amplification, library purification and Quality Control. Two flow channels were prepared and the libraries were sequenced in Hiseq2500 2×150 bp paired-end mode. The data was collected and filtered according to Quality scores in Illumina pipeline 1.8.

(170) The reference sequences of S. oleracea cultivar ‘Viroflay’ were obtained from the Spinach Genome Sequence Resources (SGSR, UC Davis Genome Center, Davis, USA) and is named spinach_assembly-repeatdetect_PACBIO_V1.3. The reference sequences contain 2882 high quality contigs with an average length of 316,211,89 nucleotides. The obtained reads of the parents were stringently mapped using CLC Genomics Workbench V. 9.5.1 with the following parameters:

(171) References=spinach_assembly-repeatdetect_PACBIO_V1.3

(172) Masking mode=No masking

(173) Match score=1

(174) Mismatch cost=2

(175) Cost of insertions and deletions=Linear gap cost

(176) Insertion cost=3

(177) Deletion cost=3

(178) Length fraction=0.8

(179) Similarity fraction=0.95

(180) Global alignment=No

(181) Auto-detect paired distances=Yes

(182) Non-specific match handling=Map randomly

(183) Output mode=Create stand-alone read mappings

(184) Create report=Yes

(185) Collect un-mapped reads=No

(186) TABLE-US-00010 TABLE 2-1 The read mapping statistics of internal reference variety ‘Crocodile’ Percentage Percentage ‘Crocodile’ Count of reads Number of bases of bases References 2,882 — 911,322,679 — Mapped reads 82,525,108 96.58% 12,378,766,200 96.58% Not mapped 2,920,510 3.42% 438,076,500 3.42% reads Reads in pairs 72,778,792 85.18% 10,916,818,800 85.18% Broken paired 9,746,316 11.41% 1,461,947,400 11.41% reads Total reads 85,445,618 100.00% 12,816,842,700 100.00%

(187) TABLE-US-00011 TABLE 2-2 The read mapping statistics of ‘B11-505’ Percentage Percentage ‘B11-505’ Count of reads Number of bases of bases References 2,882 — 911.322.679 — Mapped reads 120,355,960 95.97% 18,053,394,000 95.97% Not mapped 5,059,938 4.03% 758,990,700 4.03% reads Reads in pairs 104,653,714 83.45% 15,698,057,100 83.45% Broken paired 15,702,246 12.52% 2,355,336,900 12.52% reads Total reads 125,415,898 100.00% 18,812,384,700 100.00%

(188) The ‘B11-505’ mapping file was used in Probabilistic Variant Detection. The Variant data file was used to filter for variants that are also present in the ‘Crocodile’ mapping file with various settings to optimize the data. A total of 57,394 variants (Single Nucleotide Variants, or SNVs, and insertions/deletions) were detected for the ‘Crocodile’ mapping file and a total of 446,034 variants were detected for the ‘B11-505’ mapping file.

(189) The variant file of ‘B11-505’ was both in silico and manually filtered for: Known variants in the ‘Crocodile’ mapping file, Type (SNV), Frequency of the variant, Coverage, Control coverage, Probability, Forward/reverse balance, Average base quality and the Reference allele. In total, 157 heterozygous SNVs were obtained. The contigs containing the variants were manually checked for heterozygous/homozygous coverage of the read mappings and rejected when both frequencies were in vicinity of each other in a random fashion. It is anticipated that S. turkestanica read mappings are semi-hemizygous (i.e., blocks of hemizygous regions are flanked by regions with heterozygosity) as has been seen for previous crossings with genomes having high scores of polymorphism at the nucleotide level. Therefore, a number of dominant SNVs for the hemizygous regions of the aforementioned contigs were also selected. A total of 48 SNVs of eight different contigs were selected for KASP assays on the 96 F2 individuals. Six regions were found to be associated with the phenotypic data (e.g., Pfs 14 resistance). These SNPs can be used for the identification of plants having the Pfs resistance phenotype according to the current disclosure (see also sequences given in the sequence listing below).

(190) TABLE-US-00012 TABLE 2-3 SNPs Identified in ‘B11-505’ Associated with Pfs 14 Resistance Contig Region Reference Allele Count Coverage Forward/reverse balance uti_cns_0000042 58,929 T C 11 25 0.43 uti_cns_0000042 169,323 A T 11 25 0.5 uti_cns_0000042 169,333 A G 13 26 0.5 uti_cns_0000042 170,880 G C 11 26 0.43 uti_cns_0000042 342,263 T C 15 29 0.42 uti_cns_0000042 342,281 T C 15 29 0.44

(191) SEQ ID NO:3=Nucleotide sequence of ‘B11-505’ containing a ‘C’ allele at the SNP of position 51 (region 58,929 of uti_cns_000042):

(192) TABLE-US-00013 AGCGAAGAGGTTTTAAGAGCTATTTTGATTTAGTCCATTATATTCAATGC CGAAAAGAACAAATGTATCTTTGGCTCCATCGGAAATGGACAGATTTAGA T.

(193) SEQ ID NO:4=Nucleotide sequence of ‘B11-505’ containing a ‘T’ allele at the SNP of position 51 (region 169,323 of uti_cns_000042):

(194) TABLE-US-00014 AATCTTCTGCGGCTTCTGCCGAAGCTCTAGTTTGTTTTATTTGAGGTTCT TTAACAGCATATTCCCCAGCCAGAGAAGGAAGCGGCTGTTGAGTTTCTTG A.

(195) SEQ ID NO:5=Nucleotide sequence of ‘B11-505’ containing a ‘G’ allele at the SNP of position 51 (region 169,333 of uti_cns_000042):

(196) TABLE-US-00015 GGCTTCTGCCGAAGCTCTAGTTTGTTTTATTTGAGGTTCTATAACAGCAT GTTCCCCAGCCAGAGAAGGAAGCGGCTGTTGAGTTTCTTGATGCAACTGA C.

(197) SEQ ID NO:6=Nucleotide sequence of ‘B11-505’ containing a ‘C’ allele at the SNP of position 51 (region 170,880 of uti_cns_000042):

(198) TABLE-US-00016 ACAACACAACTAAATTCGACCTAACAGTCCCTAACAAACCAGAATCGTTA CAATAATCAGACGAATCCCAACAATAATCATGAATTACCTGCTTAATCGA G.

(199) SEQ ID NO:7=Nucleotide sequence of ‘B11-505’ containing a ‘C’ allele at the SNP of position 51 (region 342,263 of uti_cns_000042):

(200) TABLE-US-00017 TTTAGAAACTGAGAAAATAAAGATTTTGATGTTTCCATCCCTAATGTAAC CGCTGCAAGAGATCTGAATAGTATGCAGAATGTTGAGCAGAACCCAATTA T.

(201) SEQ ID NO:8=Nucleotide sequence of ‘B11-505’ containing a ‘C’ allele at the SNP of position 51 (region 342,281 of uti_cns_000042):

(202) TABLE-US-00018 AAAGATTTTGATGTTTCCATCCCTAATGTAACTGCTGCAAGAGATCTGAA CAGTATGCAGAATGTTGAGCAGAACCCAATTATGAGGTAAACTGTAATCA A.

(203) An example of a read mapping of B11-505 on ‘Viroflay’ contig uti_cns_0000042 containing heterozygous informative SNPs of position 169,333 (A to G) can be found in FIG. 1 of WO 2017/081189, which is incorporated by reference.