CYCLIC SULFAMIDE COMPOUNDS FOR TREATMENT OF HBV

20220081433 · 2022-03-17

    Inventors

    Cpc classification

    International classification

    Abstract

    The present disclosure provides, in part, cyclic sulfamide compounds, and pharmaceutical compositions thereof, useful for disruption of HBV core protein assembly, and methods of treating Hepatitis B (HBV) infection.

    Claims

    1. A compound of Formula I: ##STR00131## or a pharmaceutically acceptable salt thereof, wherein: R.sup.1 is a phenyl, naphthyl or heteroaryl, wherein: the phenyl, naphthyl or heteroaryl is optionally substituted with one, two, or three independently selected R.sup.32 groups; R.sup.2 is hydrogen or C.sub.1-6alkyl; R.sup.3 is a phenyl optionally substituted with one, two or three substituents independently selected from the group consisting of R.sup.32, R.sup.34 and R.sup.7a; R.sup.7a is a phenyl or heteroaryl, wherein: the phenyl or heteroaryl is optionally substituted with one, two or three independently selected R.sup.32 groups; R.sup.4 is hydrogen or C.sub.1-6alkyl optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, —OH, —CN, —S(O).sub.q—C.sub.1-6alkyl, —NR.sup.aR.sup.b, —NR.sup.c—S(O).sub.t—C.sub.1-6alkyl, —S(O).sub.t—NR.sup.aR.sup.b, C.sub.2-6alkenyl, C.sub.2-6alkynyl, haloC.sub.1-6alkyl, C.sub.1-6alkoxy, haloC.sub.1-6alkoxy, —C(O)NR.sup.aR.sup.b, —C(O)—C.sub.1-6alkyl, formyl, —C(O)OH, a —C(O)O—C.sub.1-6alkyl, benzyloxy, C.sub.1-4alkoxyphenyl, pyrrolidinyl, morpholinyl, tetrahydrofuranyl and triazolyl; R.sup.5 is hydrogen or C.sub.1-6alkyl optionally substituted with one, two or three substituents independently selected from the group consisting of halogen, —OH, C.sub.1-6alkoxy, —NR.sup.aR.sup.b, and R.sup.aR.sup.bN—C.sub.1-6 alkyl; R.sup.6 is hydrogen or C.sub.1-6alkyl; R.sup.32 is halo, —OH, —CN, —NO.sub.2, oxo, hydrazino, formyl, azido, silyl, siloxy, —S(O).sub.q—C.sub.1-6alkyl, —NR.sup.aR.sup.b, —NR.sup.c—S(O).sub.t—C.sub.1-6alkyl, —S(O).sub.t—NR.sup.aR.sup.b, C.sub.1-6 alkyl, C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.3-6cycloalkyl, haloC.sub.1-6alkyl, hydroxyC.sub.1-6alkyl, R.sup.aR.sup.bN—C.sub.1-6alkyl-, C.sub.1-6alkoxy, haloC.sub.1-6alkoxy, hydroxyC.sub.1-6alkoxy-, R.sup.aR.sup.bN—C.sub.1-6alkoxy-, C.sub.1-6alkoxyC.sub.1-6alkyl, —C(O)NR.sup.aR.sup.b, —C(O)—C.sub.1-6alkyl, —C(O)OH, or —C(O)O—C.sub.1-6alkyl; R.sup.34 is hydrogen or C.sub.1-4alkyl; R.sup.a and R.sup.b are independently selected for each occurrence from the group consisting of hydrogen and C.sub.1-6alkyl; or R.sup.a and R.sup.b may be taken together with the nitrogen to which R.sup.a and R.sup.b are attached to form: ##STR00132## R.sup.c is independently selected for each occurrence from the group consisting of hydrogen and C.sub.1-6alkyl; for each occurrence, q is independently 0, 1 or 2; for each occurrence, t is independently 1 or 2; and w is 0, 1 or 2.

    2. The compound of claim 1, wherein the compound of Formula I is of Formula II: ##STR00133## or a pharmaceutically acceptable salt thereof.

    3. The compound of claim 1 or 2, or a pharmaceutically acceptable salt thereof, wherein R.sup.2 is hydrogen.

    4. The compound according to any one of claims 1-3, or a pharmaceutically acceptable salt thereof, wherein R.sup.7a is a phenyl optionally substituted with one, two or three independently selected R.sup.32 groups.

    5. The compound according to any one of claims 1-3, or a pharmaceutically acceptable salt thereof, wherein R.sup.7a is a heteroaryl optionally substituted with one, two or three independently selected R.sup.32 groups.

    6. The compound of claim 5, or a pharmaceutically acceptable salt thereof, wherein R.sup.7a is a 5-6 membered monocyclic heteroaryl optionally substituted with one, two or three independently selected R.sup.32 groups.

    7. The compound according to any one of claims 1-6, or a pharmaceutically acceptable salt thereof, wherein R.sup.4 is methyl or methoxyethyl.

    8. The compound of claim 7, or a pharmaceutically acceptable salt thereof, wherein R.sup.4 is methyl.

    9. The compound according to any one of claims 1-8, or a pharmaceutically acceptable salt thereof, wherein R.sup.5 is hydrogen.

    10. The compound according to any one of claims 1-9, or a pharmaceutically acceptable salt thereof, wherein R.sup.6 is hydrogen.

    11. The compound according to any one of claims 1-10, or a pharmaceutically acceptable salt thereof, wherein R.sup.1 is phenyl optionally substituted with one, two or three substituents independently selected from halo, cyano, methyl and trifluoromethyl.

    12. The compound of claim 11, or a pharmaceutically acceptable salt thereof, wherein R.sup.1 is 3-chloro-4-fluorophenyl.

    13. A pharmaceutical composition comprising a compound according to any one of claims 1-12, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.

    14. A method of treating a Hepatitis B (HBV) infection in a patient, the method comprising: administering an effective amount of the compound according to any one of claims 1-12, or a pharmaceutically acceptable salt thereof, to a patient in need thereof.

    15. A method of treating a Hepatitis B (HBV) infection in a patient, the method comprising: administering an effective amount of a pharmaceutical composition of claim 13 to a patient in need thereof.

    Description

    BRIEF DESCRIPTION OF DRAWINGS

    [0012] FIG. 1 is the crystal structure of HBV-CSU-016-Isomer-I as described herein.

    DETAILED DESCRIPTION

    [0013] The features and other details of the disclosure will now be more particularly described. Before further description of the present disclosure, certain terms employed in the specification, examples and appended claims are collected here. These definitions should be read in light of the remainder of the disclosure and as understood by a person of skill in the art. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art.

    Definitions

    [0014] The term “alkenyl” as used herein refers to an unsaturated straight or branched hydrocarbon having at least one carbon-carbon double bond. Exemplary alkenyl groups include, but are not limited to, a straight or branched group of 2-6 carbon atoms, referred to herein as C.sub.2-6alkenyl. Exemplary alkenyl groups include, but are not limited to, vinyl, allyl, butenyl, pentenyl, etc.

    [0015] The term “alkoxy” as used herein refers to a straight or branched alkyl group attached to oxygen (i.e., alkyl-O—). Exemplary alkoxy groups include, but are not limited to, alkoxy groups of 1-6 or 1-4 carbon atoms, referred to herein as C.sub.1-6alkoxy and C.sub.1-4alkoxy, respectively. Exemplary alkoxy groups include, but are not limited to methoxy, ethoxy, isopropoxy, etc.

    [0016] The term “alkoxyalkyl” as used herein refers to an alkyl group substituted with an alkoxy group (i.e., alkoxy-alkyl- or alkyl-O-alkyl-). Examples include, but are not limited to, CH.sub.3CH.sub.2OCH.sub.2—, CH.sub.3OCH.sub.2CH.sub.2— and CH.sub.3OCH.sub.2—.

    [0017] The term “alkyl” as used herein refers to a saturated straight or branched hydrocarbon. Exemplary alkyl groups include, but are not limited to, straight or branched hydrocarbons of 1-6 or 1-4 carbon atoms, referred to herein as C.sub.1-6alkyl and C.sub.1-4alkyl, respectively. Exemplary alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, 2-methyl-1-butyl, 3-methyl-2-butyl, 2-methyl-1-pentyl, 3-methyl-1-pentyl, 4-methyl-1-pentyl, 2-methyl-2-pentyl, 3-methyl-2-pentyl, 4-methyl-2-pentyl, 2,2-dimethyl-1-butyl, 3,3-dimethyl-1-butyl, 2-ethyl-1-butyl, n-butyl, isobutyl, t-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, etc.

    [0018] The term “alkynyl” as used herein refers to an unsaturated straight or branched hydrocarbon having at least one carbon-carbon triple bond. Exemplary alkynyl groups include, but are not limited to, straight or branched groups of 2-6 carbon atoms, referred to herein as C.sub.2-6alkynyl. Exemplary alkynyl groups include, but are not limited to, ethynyl, propynyl, butynyl, pentynyl, hexynyl, methylpropynyl, etc.

    [0019] The term “carbonyl” as used herein refers to the biradical —C(O)—.

    [0020] The term “cyano” as used herein refers to the radical —CN.

    [0021] The terms “cycloalkyl” as used herein refers to a saturated monocyclic hydrocarbon group of, for example, 3-6 carbons, referred to herein as C.sub.3-6cycloalkyl, or bicyclic hydrocarbon ring structure of, for example, 8-12 carbons, referred to herein as C.sub.8-12 cycloalkyl. For bicyclic cycloalkyl groups, the two rings may be attached through the same or different carbons. Exemplary monocyclic cycloalkyl groups include, but are not limited to, cyclohexyl, cyclopentyl, cyclopentenyl, cyclobutyl and cyclopropyl. Exemplary bicyclic cycloalkyl groups include, but are not limited to, spiro[2.5]octanyl, spiro[3.5]nonanyl, bicyclo[2.2.2]octanyl, bicyclo[4.1.0]heptanyl, octahydropentalenyl, bicyclo[4.2.0]octanyl, bicyclo[1.1.1]pentanyl, bicyclo[2.2.1]heptanyl, and bicyclo[2.2.2]octanyl.

    [0022] The term “cycloalkenyl” as used herein refers to a partially unsaturated monocyclic hydrocarbon group of, for example, 3-7 carbons, referred to herein as C.sub.4-7cycloalkenyl, or bicyclic hydrocarbon ring structure of, for example, 8-12 carbons, referred to herein as bicyclicC.sub.8-12cycloalkenyl. For bicyclic cycloalkenyl groups: 1) either one or both rings contain one or more double bonds and 2) the two rings may be attached through the same or different ring carbons. Exemplary monocyclic cycloalkenyl groups include, but are not limited to, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl and cycloheptenyl. Exemplary bicyclic cycloalkenyl groups include, but are not limited to, spiro[2.5]oct-5-enyl, spiro[2.5]oct-4-enyl, spiro[3.5]non-5-enyl, spiro[3.5]non-6-enyl, bicyclo[4.1.0]hept-3-enyl, bicyclo[4.1.0]hept-2-enyl, and bicyclo[2.2.2]oct-2-enyl.

    [0023] The term “carbocyclyl” as used herein refers to a bicyclic ring system formed by fusing a phenyl ring to a C.sub.3-6cycloalkyl, C.sub.4-7cycloalkenyl, 4-7 membered monocyclic heterocycloalkyl or 4-7 membered monocyclic heterocycloalkenyl ring. Where possible, the rings may be linked to the adjacent radical though carbon or nitrogen. Examples of heterocyclyls include, but are not limited to 2,3-dihydro-1H-indenyl, 1,2,3,4-tetrahydronaphthalene, isochromanyl, and 1H-indenyl, and 2H-quinolinyl.

    [0024] The terms “halo” or “halogen” as used herein refer to F, Cl, Br or I.

    [0025] The term “haloalkyl” as used herein refers to an alkyl group substituted with one or more halogen atoms. For example, haloC.sub.1-6 alkyl refers to a straight or branched alkyl group of 1-6 carbon atoms substituted with one or more halogen atoms. Examples include but are not limited to —CH.sub.2F, —CHCl.sub.2, —CF.sub.3, —CH.sub.2CF.sub.3, —CF.sub.2CH.sub.3, —CCl.sub.2CF.sub.3 and —CF.sub.2CF.sub.3.

    [0026] The term “haloalkoxy” as used herein refers to an alkoxy group substituted with one or more halogen atoms. Examples include, but are not limited to, CCl.sub.3O—, CF.sub.3O—, CF.sub.3CH.sub.2O—, and CF.sub.3CF.sub.2O—.

    [0027] The terms “heteroaryl” as used herein refers to a monocyclic aromatic 5-6 membered ring system or bicyclic aromatic 8-12 membered ring system containing one or more independently selected heteroatoms, for example one to four heteroatoms, such as nitrogen, oxygen and sulfur. Where possible, the heteroaryl ring may be linked to the adjacent radical though carbon or nitrogen. Examples of 5-6 membered monocyclic heteroaryls include, but are not limited to, furanyl, thiophenyl (also referred to as thienyl), pyrrolyl, thiazolyl, oxazolyl, isothiazolyl, isoxazolyl, imidazolyl, pyrazolyl, 1H-1,2,3-triazolyl, 2H-1,2,3-triazolyl, 1,2,4-triazolyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, 1,3,5-triazinyl, 1,2,4-triazinyl, 1,2,3-triazinyl, 1,2,4-oxadiazolyl, 1,3,4-oxadiazolyl, 1,2,5-oxadiazolyl, 1,2,4-thiadiazolyl, 1,3,4-thiadiazolyl, 1,2,5-thiadiazolyl and tetrazolyl. Examples of 8-12 membered bicyclic heteroaryls include, but are not limited to, benzofuranyl, isobenzofuranyl, benzo[b]thiophenyl, benzo[c]thiophenyl, indolyl, isoindolyl, benzo[d]isoxazolyl, benzo[c]isoxazolyl, benzo[d]oxazolyl, benzo[d]isothiazolyl, benzo[c]isothiazolyl, benzo[d]thiazolyl, indazolyl, benzo[d]imidazolyl, benzo[d]imidazolyl, and benzo[d][1,2,3]triazolyl.

    [0028] The term “heterocycloalkyl” refers to a saturated monocyclic 3-7 membered ring system or bicyclic 8-12 membered ring system containing one or more independently selected heteroatoms, such as nitrogen, oxygen, and sulfur (including its oxidation states: S, S(O) and SO.sub.2). Where possible, “heterocycloalkyl” rings may be linked to the adjacent radical through carbon or nitrogen. Examples of 4-7 membered monocyclic “heterocycloalkyl” groups include, but are not limited to, aziridinyl, oxiranyl, thiiranyl 1,1-dioxide, oxetanyl, azetidinyl, thietanyl 1,1-dioxide, pyrrolidinyl, tetrahydrofuranyl, piperidinyl, tetrahydro-2H-pyranyl, morpholinyl, thiomorpholinyl, and piperazinyl. Examples of bicyclic 8-12 membered heterocycloalkyl groups include, but are not limited to, 1,4-dioxaspiro[4.5]decanyl and 1,5-dioxaspiro[5.5]undecanyl.

    [0029] The term “heterocycloalkenyl” refers to a partially unsaturated monocyclic 3-7 membered ring system or bicyclic 8-12 membered ring system containing one, two or three independently selected heteroatoms, such as nitrogen, oxygen, and sulfur (including its oxidatiaon states: S, S(O) or SO.sub.2). Where possible, heterocycloalkenyl rings may be linked to the adjacent radical through carbon or nitrogen. For bicyclic heterocycloalkenyl groups: 1) either one or both rings contain one or more double bonds and 2) the two rings may be attached through the same or different ring atoms. Examples of 4-7 membered monocyclic heterocycloalkenyl groups include, but are not limited to 2,3-dihydro-1H-pyrrolyl, 2,5-dihydro-1H-pyrrolyl, 4,5-dihydro-1H-pyrazolyl, 2,3-dihydro-1H-pyrazolyl, 4,5-dihydro-1H-imidazolyl, 2,3-dihydro-1H-imidazolyl, 2,3-dihydrothiophenyl, 2,5-dihydrothiophenyl, 4,5-dihydrothiazolyl, 2,3-dihydrothiazolyl, 4,5-dihydroisothiazolyl, 2,3-dihydroisothiazolyl, 2,3-dihydrofuranyl, 2,5-dihydrofuranyl, 4,5-dihydrooxazolyl, 2,3-dihydrooxazolyl, 4,5-dihydroisoxazolyl, 2,3-dihydroisoxazolyl, 3,4-dihydropyridinyl, 2,3-dihydropyridinyl, 2,3,4,5-tetrahydropyridinyl, 1,6-dihydropyridazinyl, 4,5-dihydropyridazinyl, 3,4,5,6-tetrahydropyridazinyl, 4,5-dihydropyrimidinyl, 1,2,5,6-tetrahydropyrimidinyl, 1,2-dihydropyrimidinyl, 1,2-dihydropyrazinyl, 2,3-dihydropyrazinyl, 1,2,3,6-tetrahydropyrazinyl, 4H-1,4-oxazinyl, 3,4-dihydro-2H-1,4-oxazinyl, 4H-1,4-thiazinyl, and 3,4-dihydro-2H-1,4-thiazinyl. Examples of 8-12 membered heterocycloalkyl groups include, but are not limited to 6,7-dihydroindolyl, 4,5-dihydroindolyl, 7,8-dihydroimidazo[1,2-a]pyridinyl, 5,6-dihydroimidazo[1,2-a]pyridinyl, 4,5-dihydrobenzo[d]imidazolyl, 6,7-dihydro-1H-indazolyl, 4,5-dihydro-1H-indazolyl, 4,5-dihydropyrazolo[1,5-a]pyridinyl, and 6,7-dihydropyrazolo[1,5-a]pyridinyl.

    [0030] The term “heterocyclyl” as used herein refers to a bicyclic ring system formed by fusing a monocyclic aromatic 5-6 membered heteroaryl ring to a C.sub.3-6cycloalkyl, C.sub.4-7cycloalkenyl, 4-7 membered monocyclic heterocycloalkyl or 4-7 membered monocyclic heterocycloalkenyl ring. Where possible, the rings may be linked to the adjacent radical though carbon or nitrogen. Examples of heterocyclyls include, but are not limited to 6,7,8,9-tetrahydro-5H-[1,2,4]triazolo[4,3-a]azepine, 5,6,8,9-tetrahydro-[1,2,4]triazolo[4,3-d][1,4]oxazepane, 6,7-dihydro-5H,9H-[1,2,4]triazolo[3,4-c][1,4]oxazepane, tetrahydro-712-[1,2,4]triazolo[4,3-d][1,4]diazepine, 8,9-dihydro-5H-[1,2,4]triazolo[4,3-a]azepine, 6,9-dihydro-5H-[1,2,4]triazolo[4,3-a]azepine, 5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-a]pyridine, 5,6-dihydro-8H-[1,2,4]triazolo[3,4-c][1,4]oxazine, 5,6,7,8-tetrahydroimidazo[1,2-a]pyridine, and 5H,9H-[1,2,4]triazolo[3,4-c][1,4]oxazepine.

    [0031] The terms “hydroxy” and “hydroxyl” as used herein refers to the radical —OH.

    [0032] The term “hydroxyalkyl” as used herein refers to an alkyl group substituted with one or more hydroxy groups. Examples include, but are not limited to, HOCH.sub.2—, HOCH.sub.2CH.sub.2—, CH.sub.3CH(OH)CH.sub.2— and HOCH.sub.2CH(OH)CH.sub.2—.

    [0033] The term “hydroxyalkoxy” as used herein refers to an alkoxy group substituted with one or more hydroxy groups. Examples include but are not limited to HOCH.sub.2O—, HOCH.sub.2CH.sub.2O—, CH.sub.3CH(OH)CH.sub.2O— and HOCH.sub.2CH(OH)CH.sub.2O—.

    [0034] The term “R.sup.aR.sup.bN—C.sub.1-6alkyl-,” as used herein refers to an alkyl group substituted with a R.sup.aR.sup.bN— group, as defined herein. Examples include but are not limited to NH.sub.2CH.sub.2—, NH(CH.sub.3)CH.sub.2—, N(CH.sub.3).sub.2CH.sub.2CH.sub.2— and CH.sub.3CH(NH.sub.2)CH.sub.2—.

    [0035] The term “R.sup.aR.sup.bN—C.sub.1-6alkoxy,” as used herein refers to an alkoxy group substituted with one or more R.sup.aR.sup.bN— groups, as defined herein. Examples include but are not limited to NH.sub.2CH.sub.2—, NH(CH.sub.3)CH.sub.2O—, N(CH.sub.3).sub.2CH.sub.2CH.sub.2O— and CH.sub.3CH(NH.sub.2)CH.sub.2O—.

    [0036] The term “oxo” as used herein refers to the radical ═O.

    [0037] As used herein, when a bicyclic ring is shown with a floating point of attachment and/or floating substituents, for example as in

    ##STR00002##

    it signifies that the bicyclic ring can be attached via a carbon atom on either ring, and that the substituents (e.g., the R.sup.33 group(s)) can be independently attached to either or both rings.

    [0038] The terms “Individual,” “patient,” or “subject” are used interchangeably and include any animal, including mammals, preferably mice, rats, other rodents, rabbits, dogs, cats, swine, cattle, sheep, horses, or primates, and most preferably humans. The compounds or pharmaceutical compositions of the disclosure can be administered to a mammal, such as a human, but can also be administered to other mammals such as an animal in need of veterinary treatment, e.g., domestic animals (e.g., dogs, cats, and the like), farm animals (e.g., cows, sheep, pigs, horses, and the like) and laboratory animals (e.g., rats, mice, guinea pigs, and the like). The mammal treated in the methods of the disclosure is desirably a mammal in which treatment of HBV infection is desired.

    [0039] The term “modulation” includes antagonism (e.g., inhibition), agonism, partial antagonism and/or partial agonism.

    [0040] The term “Pharmaceutically acceptable” include molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, or a human, as appropriate. For human administration, preparations should meet sterility, pyrogenicity, and general safety and purity standards as required by FDA Office of Biologics standards.

    [0041] The term “pharmaceutically acceptable carrier” or “pharmaceutically acceptable excipient” as used herein refers to any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. The compositions may also contain other active compounds providing supplemental, additional, or enhanced therapeutic functions.

    [0042] The term “pharmaceutical composition” as used herein refers to a composition comprising at least one compound as disclosed herein formulated together with one or more pharmaceutically acceptable excipients.

    [0043] The term “pharmaceutically acceptable salt(s)” as used herein refers to salts of acidic or basic groups that may be present in compounds used in the compositions. Compounds included in the present compositions that are basic in nature are capable of forming a wide variety of salts with various inorganic and organic acids. The acids that may be used to prepare pharmaceutically acceptable acid addition salts of such basic compounds are those that form non-toxic acid addition salts, i.e., salts containing pharmacologically acceptable anions, including, but not limited to, malate, oxalate, chloride, bromide, iodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate and pamoate (i.e., 1,1′-methylene-bis-(2-hydroxy-3-naphthoate)) salts. Compounds included in the present compositions that are acidic in nature are capable of forming base salts with various pharmacologically acceptable cations. Examples of such salts include alkali metal or alkaline earth metal salts, particularly calcium, magnesium, sodium, lithium, zinc, potassium, and iron salts. Compounds included in the present compositions that include a basic or acidic moiety may also form pharmaceutically acceptable salts with various amino acids. The compounds of the disclosure may contain both acidic and basic groups; for example, one amino and one carboxylic acid group. In such a case, the compound can exist as an acid addition salt, a zwitterion, or a base salt.

    [0044] The term “therapeutically effective amount” or “effective amount” as used herein refers to the amount of the subject compound that will elicit the biological or medical response of a tissue, system or animal, (e.g. mammal or human) that is being sought by the researcher, veterinarian, medical doctor or other clinician. The compounds or pharmaceutical compositions of the disclosure are administered in therapeutically effective amounts to treat a disease. Alternatively, a therapeutically effective amount of a compound is the quantity required to achieve a desired therapeutic and/or prophylactic effect.

    [0045] The term “treating” includes any effect, e.g., lessening, reducing, modulating, or eliminating, via disruption of HBV core protein assembly, that results in the improvement of the disease. “Disruption” includes inhibition of HBV viral assembly and infection.

    [0046] The compounds of the disclosure may contain one or more chiral centers and, therefore, exist as stereoisomers. The term “stereoisomers” when used herein consist of all enantiomers or diastereomers. These compounds may be designated by the symbols “(+),” “(−),” “R” or “S,” depending on the configuration of substituents around the stereogenic carbon atom, but the skilled artisan will recognize that a structure may denote a chiral center implicitly. The present disclosure encompasses various stereoisomers of these compounds and mixtures thereof. Mixtures of enantiomers or diastereomers may be designated “(±)” in nomenclature, but the skilled artisan will recognize that a structure may denote a chiral center implicitly.

    [0047] The compounds of the disclosure may contain one or more double bonds and, therefore, exist as geometric isomers resulting from the arrangement of substituents around a carbon-carbon double bond. The symbol custom-character denotes a bond that may be a single, double or triple bond as described herein. Substituents around a carbon-carbon double bond are designated as being in the “Z” or “E” configuration wherein the terms “Z” and “E” are used in accordance with IUPAC standards. Unless otherwise specified, structures depicting double bonds encompass both the “E” and “Z” isomers. Substituents around a carbon-carbon double bond alternatively can be referred to as “cis” or “trans,” where “cis” represents substituents on the same side of the double bond and “trans” represents substituents on opposite sides of the double bond.

    [0048] Compounds of the disclosure may contain a carbocyclic or heterocyclic ring and therefore, exist as geometric isomers resulting from the arrangement of substituents around the ring. The arrangement of substituents around a carbocyclic or heterocyclic ring are designated as being in the “Z” or “E” configuration wherein the terms “Z” and “E” are used in accordance with IUPAC standards. Unless otherwise specified, structures depicting carbocyclic or heterocyclic rings encompass both “Z” and “E” isomers. Substituents around a carbocyclic or heterocyclic rings may also be referred to as “cis” or “trans”, where the term “cis” represents substituents on the same side of the plane of the ring and the term “trans” represents substituents on opposite sides of the plane of the ring. Mixtures of compounds wherein the substituents are disposed on both the same and opposite sides of plane of the ring are designated “cis/trans.”

    [0049] Individual enantiomers and diasteriomers of compounds of the present disclosure can be prepared synthetically from commercially available starting materials that contain asymmetric or stereogenic centers, or by preparation of racemic mixtures followed by resolution methods well known to those of ordinary skill in the art. These methods of resolution are exemplified by (1) attachment of a mixture of enantiomers to a chiral auxiliary, separation of the resulting mixture of diastereomers by recrystallization or chromatography and liberation of the optically pure product from the auxiliary, (2) salt formation employing an optically active resolving agent, (3) direct separation of the mixture of optical enantiomers on chiral liquid chromatographic columns or (4) kinetic resolution using stereoselective chemical or enzymatic reagents. Racemic mixtures can also be resolved into their component enantiomers by well known methods, such as chiral-phase liquid chromatography or crystallizing the compound in a chiral solvent. Stereoselective syntheses, a chemical or enzymatic reaction in which a single reactant forms an unequal mixture of stereoisomers during the creation of a new stereocenter or during the transformation of a pre-existing one, are well known in the art. Stereoselective syntheses encompass both enantio- and diastereoselective transformations, and may involve the use of chiral auxiliaries. For examples, see Carreira and Kvaerno, Classics in Stereoselective Synthesis, Wiley-VCH: Weinheim, 2009.

    [0050] The compounds disclosed herein can exist in solvated as well as unsolvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like, and it is intended that the disclosure embrace both solvated and unsolvated forms. In one embodiment, the compound is amorphous. In one embodiment, the compound is a single polymorph. In another embodiment, the compound is a mixture of polymorphs. In another embodiment, the compound is in a crystalline form.

    [0051] The disclosure also embraces isotopically labeled compounds of the disclosure which are identical to those recited herein, except that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes that can be incorporated into compounds of the disclosure include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine and chlorine, such as .sup.2H, .sup.3H, .sup.13C, .sup.14C, .sup.15N, .sup.18O, .sup.17O, .sup.31P, .sup.32P, .sup.35S, .sup.18F, and .sup.36Cl, respectively. For example, a compound of the disclosure may have one or more H atom replaced with deuterium.

    [0052] Certain isotopically-labeled disclosed compounds (e.g., those labeled with .sup.3H and .sup.14C) are useful in compound and/or substrate tissue distribution assays. Tritiated (i.e., .sup.3H) and carbon-14 (i.e., .sup.14C) isotopes are particularly preferred for their ease of preparation and detectability. Further, substitution with heavier isotopes such as deuterium (i.e., .sup.2H) may afford certain therapeutic advantages resulting from greater metabolic stability (e.g., increased in vivo half-life or reduced dosage requirements) and hence may be preferred in some circumstances. Isotopically labeled compounds of the disclosure can generally be prepared by following procedures analogous to those disclosed in the examples herein by substituting an isotopically labeled reagent for a non-isotopically labeled reagent.

    [0053] The term “prodrug” refers to compounds that are transformed in vivo to yield a disclosed compound or a pharmaceutically acceptable salt, hydrate or solvate of the compound. The transformation may occur by various mechanisms (such as by esterase, amidase, phosphatase, oxidative and or reductive metabolism) in various locations (such as in the intestinal lumen or upon transit of the intestine, blood or liver). Prodrugs are well known in the art (for example, see Rautio, Kumpulainen, et al, Nature Reviews Drug Discovery 2008, 7, 255).

    I. CYCLIC SULFAMIDE COMPOUNDS

    [0054] In one aspect, the disclosure provides a compound of Formula I:

    ##STR00003##

    [0055] or a pharmaceutically acceptable salt thereof, wherein:

    [0056] R.sup.1 is a phenyl, naphthyl or heteroaryl, wherein: the phenyl, naphthyl or heteroaryl is optionally substituted with one, two, or three independently selected R.sup.32 groups;

    [0057] R.sup.2 is hydrogen or C.sub.1-6alkyl;

    [0058] R.sup.3 is a phenyl optionally substituted with one, two or three substituents independently selected from the group consisting of R.sup.32, R.sup.34 and R.sup.7a;

    [0059] R.sup.7a is a phenyl or heteroaryl, wherein: the phenyl or heteroaryl is optionally substituted with one, two or three independently selected R.sup.32 groups;

    [0060] R.sup.4 is hydrogen or C.sub.1-6alkyl optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, —OH, —CN, —S(O).sub.q—C.sub.1-6alkyl, —NR.sup.aR.sup.b, —NR.sup.c—S(O).sub.t—C.sub.1-6alkyl, —S(O).sub.t—NR.sup.aR.sup.b, C.sub.2-6alkenyl, C.sub.2-6alkynyl, haloC.sub.1-6alkyl, C.sub.1-6alkoxy, haloC.sub.1-6alkoxy, —C(O)NR.sup.aR.sup.b, —C(O)—C.sub.1-6alkyl, formyl, —C(O)OH, a —C(O)O—C.sub.1-6alkyl, benzyloxy, C.sub.1-4alkoxyphenyl, pyrrolidinyl, morpholinyl, tetrahydrofuranyl and triazolyl;

    [0061] R.sup.5 is hydrogen or C.sub.1-6alkyl optionally substituted with one, two or three substituents independently selected from the group consisting of halogen, —OH, C.sub.1-6alkoxy, —NR.sup.aR.sup.b, and R.sup.aR.sup.bN—C.sub.1-6alkyl;

    [0062] R.sup.6 is hydrogen or C.sub.1-6alkyl;

    [0063] R.sup.32 is halo, —OH, —CN, —NO.sub.2, oxo, hydrazino, formyl, azido, silyl, siloxy, —S(O).sub.q—C.sub.1-6alkyl, —NR.sup.aR.sup.b, —NR.sup.e—S(O).sub.t—C.sub.1-6alkyl, —S(O).sub.t—NR.sup.aR.sup.b, C.sub.1-6alkyl, C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.3-6cycloalkyl, haloC.sub.1-6alkyl, hydroxyC.sub.1-6alkyl, R.sup.aR.sup.bN—C.sub.1-6alkyl-, C.sub.1-6alkoxy, haloC.sub.1-6alkoxy, hydroxyC.sub.1-6alkoxy-, R.sup.aR.sup.bN—C.sub.1-6alkoxy-, C.sub.1-6alkoxyC.sub.1-6alkyl, —C(O)NR.sup.aR.sup.b, —C(O)—C.sub.1-6alkyl, —C(O)OH, or —C(O)O—C.sub.1-6alkyl;

    [0064] R.sup.34 is hydrogen or C.sub.1-4alkyl;

    [0065] R.sup.a and R.sup.b are independently selected for each occurrence from the group consisting of hydrogen and C.sub.1-6alkyl; or

    [0066] R.sup.a and R.sup.b may be taken together with the nitrogen to which R.sup.a and R.sup.b are attached to form:

    ##STR00004##

    [0067] R.sup.c is independently selected for each occurrence from the group consisting of hydrogen and C.sub.1-6 alkyl;

    [0068] for each occurrence, q is independently 0, 1 or 2;

    [0069] for each occurrence, t is independently 1 or 2; and

    [0070] w is 0, 1 or 2.

    [0071] In another aspect, the disclosure provides a compound of Formula I:

    ##STR00005##

    [0072] or a pharmaceutically acceptable salt thereof, wherein:

    [0073] R.sup.1 is a phenyl, naphthyl or heteroaryl, wherein: the phenyl, naphthyl or heteroaryl is optionally substituted with one, two, or three independently selected R.sup.32 groups;

    [0074] R.sup.2 is hydrogen or C.sub.1-6alkyl;

    [0075] R.sup.3 is a phenyl or 5-6 membered monocyclic heteroaryl, wherein: the phenyl or 5-6 membered monocyclic heteroaryl is optionally substituted with one, two or three substituents independently selected from the group consisting of R.sup.32, R.sup.34 and -L-R.sup.7a;

    [0076] L is a bond or C.sub.1-6alkylene;

    [0077] R.sup.7a is a phenyl, heteroaryl, cycloalkyl, heterocycloalkyl or heterocycloalkenyl, wherein: the phenyl, heteroaryl, cycloalkyl, heterocycloalkyl or heterocycloalkenyl is optionally substituted with one, two or three independently selected R.sup.32 groups;

    [0078] R.sup.4 is hydrogen or C.sub.1-6alkyl optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, —OH, —CN, —S(O).sub.q—C.sub.1-6alkyl, —NR.sup.aR.sup.b, —NR.sup.c—S(O).sub.t—C.sub.1-6alkyl, —S(O).sub.t—NR.sup.aR.sup.b, C.sub.2-6alkenyl, C.sub.2-6alkynyl, haloC.sub.1-6alkyl, C.sub.1-6alkoxy, haloC.sub.1-6alkoxy, —C(O)NR.sup.aR.sup.b, —C(O)—C.sub.1-6alkyl, formyl, —C(O)OH, a —C(O)O—C.sub.1-6alkyl, benzyloxy, C.sub.1-4alkoxyphenyl, pyrrolidinyl, morpholinyl, tetrahydrofuranyl and triazolyl;

    [0079] R.sup.5 is hydrogen or C.sub.1-6alkyl optionally substituted with one, two or three substituents independently selected from the group consisting of halogen, —OH, C.sub.1-6alkoxy, —NR.sup.aR.sup.b, and R.sup.aR.sup.bN—C.sub.1-6alkyl;

    [0080] R.sup.6 is hydrogen or C.sub.1-6alkyl;

    [0081] R.sup.32 is halo, —OH, —CN, —NO.sub.2, oxo, hydrazino, formyl, azido, silyl, siloxy, —S(O).sub.q—C.sub.1-6alkyl, —NR.sup.aR.sup.b, —NR.sup.c—S(O).sub.t—C.sub.1-6alkyl, —S(O).sub.t—NR.sup.aR.sup.b, C.sub.1-6alkyl, C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.3-6cycloalkyl, haloC.sub.1-6alkyl, hydroxyC.sub.1-6alkyl, R.sup.aR.sup.bN—C.sub.1-6alkyl-, C.sub.1-6alkoxy, haloC.sub.1-6alkoxy, hydroxyC.sub.1-6alkoxy-, R.sup.aR.sup.bN—C.sub.1-6alkoxy-, C.sub.1-6alkoxyC.sub.1-6alkyl, —C(O)NR.sup.aR.sup.b, —C(O)—C.sub.1-6alkyl, —C(O)OH, or —C(O)O—C.sub.1-6alkyl;

    [0082] R.sup.34 is hydrogen or C.sub.1-4alkyl;

    [0083] R.sup.a and R.sup.b are independently selected for each occurrence from the group consisting of hydrogen and C.sub.1-6alkyl; or

    [0084] R.sup.a and R.sup.b may be taken together with the nitrogen to which R.sup.a and R.sup.b are attached to form:

    ##STR00006##

    [0085] R.sup.c is independently selected for each occurrence from the group consisting of hydrogen and C.sub.1-6alkyl;

    [0086] for each occurrence, q is independently 0, 1 or 2;

    [0087] for each occurrence, t is independently 1 or 2; and

    [0088] w is 0, 1 or 2.

    [0089] In another aspect, the disclosure provides a compound of Formula I:

    ##STR00007##

    or a pharmaceutically acceptable salt thereof, wherein:

    [0090] R.sup.1 is a phenyl, naphthyl or heteroaryl, wherein: the phenyl, naphthyl or heteroaryl is optionally substituted with one, two, or three independently selected R.sup.32 groups;

    [0091] R.sup.2 is hydrogen or C.sub.1-6alkyl;

    [0092] R.sup.3 is a 5-6 membered monocyclic heteroaryl or 8-12 membered bicyclic heteroaryl selected from the group consisting of:

    ##STR00008## ##STR00009## ##STR00010##

    [0093] R.sup.4 is hydrogen or C.sub.1-6alkyl optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, —OH, —CN, —S(O).sub.q—C.sub.1-6alkyl, —NR.sup.aR.sup.b, —NR.sup.c—S(O).sub.t—C.sub.1-6alkyl, —S(O).sub.t—NR.sup.aR.sup.b, C.sub.2-6alkenyl, C.sub.2-6alkynyl, haloC.sub.1-6alkyl, C.sub.1-6alkoxy, haloC.sub.1-6alkoxy, —C(O)NR.sup.aR.sup.b, —C(O)—C.sub.1-6alkyl, formyl, —C(O)OH, a —C(O)O—C.sub.1-6alkyl, benzyloxy, C.sub.1-4alkoxyphenyl, pyrrolidinyl, morpholinyl, tetrahydrofuranyl and triazolyl;

    [0094] R.sup.5 is hydrogen or C.sub.1-6alkyl optionally substituted with one, two or three substituents independently selected from the group consisting of halogen, —OH, C.sub.1-6alkoxy, —NR.sup.aR.sup.b, and R.sup.aR.sup.bN—C.sub.1-6alkyl;

    [0095] R.sup.6 is hydrogen or C.sub.1-6alkyl;

    [0096] R.sup.7a is a phenyl or heteroaryl, wherein: the phenyl or heteroaryl is optionally substituted with one, two or three independently selected R.sup.32 groups;

    [0097] R.sup.32 is halo, —OH, —CN, —NO.sub.2, oxo, hydrazino, formyl, azido, silyl, siloxy, —S(O).sub.q—C.sub.1-6alkyl, —NR.sup.aR.sup.b, —NR.sup.c—S(O).sub.t—C.sub.1-6alkyl, —S(O).sub.t—NR.sup.aR.sup.b, C.sub.1-6 alkyl, C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.3-6cycloalkyl, haloC.sub.1-6alkyl, hydroxyC.sub.1-6alkyl, R.sup.aR.sup.bN—C.sub.1-6alkyl-, C.sub.1-6alkoxy, haloC.sub.1-6alkoxy, hydroxyC.sub.1-6alkoxy-, R.sup.aR.sup.bN—C.sub.1-6alkoxy-, C.sub.1-6alkoxyC.sub.1-6alkyl, —C(O)NR.sup.aR.sup.b, —C(O)—C.sub.1-6alkyl, —C(O)OH, or —C(O)O—C.sub.1-6alkyl;

    [0098] R.sup.33 is independently selected for each occurrence from the group consisting of R.sup.32 and R.sup.7a;

    [0099] R.sup.34 is hydrogen or C.sub.1-4alkyl;

    [0100] R.sup.a and R.sup.b are independently selected for each occurrence from the group consisting of hydrogen and C.sub.1-6alkyl; or

    [0101] R.sup.a and R.sup.b may be taken together with the nitrogen to which R.sup.a and R.sup.b are attached to form:

    ##STR00011##

    [0102] R.sup.c is independently selected for each occurrence from the group consisting of hydrogen and C.sub.1-6alkyl;

    [0103] for each occurrence, q is independently 0, 1 or 2;

    [0104] for each occurrence, t is independently 1 or 2;

    [0105] r is 0, 1 or 2; and

    [0106] r2 is 0, 1, 2 or 3; and

    [0107] w is 0, 1 or 2;

    [0108] In another aspect, the disclosure provides a compound of Formula I:

    ##STR00012##

    [0109] or a pharmaceutically acceptable salt thereof, wherein:

    [0110] R.sup.1 is a phenyl, naphthyl or heteroaryl, wherein: the phenyl, naphthyl or heteroaryl is optionally substituted with one, two, or three independently selected R.sup.32 groups;

    [0111] R.sup.2 is hydrogen or C.sub.1-6alkyl;

    [0112] R.sup.3 is a C.sub.8-12cycloalkyl, C.sub.8-12cycloalkenyl, carbocyclyl, heterocycloalkyl, heterocycloalkenyl or heterocyclyl, wherein: the C.sub.8-12cycloalkyl, C.sub.8-12cycloalkenyl, carbocyclyl, heterocycloalkyl, heterocycloalkenyl or heterocyclyl is optionally substituted with one, two or three substituents independently selected from the group consisting of R.sup.32, R.sup.34 and R.sup.7a;

    [0113] R.sup.7a is a phenyl or heteroaryl, wherein: the phenyl or heteroaryl is optionally substituted with one, two or three independently selected R.sup.32 groups;

    [0114] R.sup.4 is hydrogen or C.sub.1-6alkyl optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, —OH, —CN, —S(O).sub.q—C.sub.1-6alkyl, —NR.sup.aR.sup.b, —NR.sup.c—S(O).sub.t—C.sub.1-6alkyl, —S(O).sub.t—NR.sup.aR.sup.b, C.sub.2-6alkenyl, C.sub.2-6alkynyl, haloC.sub.1-6alkyl, C.sub.1-6alkoxy, haloC.sub.1-6alkoxy, —C(O)NR.sup.aR.sup.b, —C(O)—C.sub.1-6alkyl, formyl, —C(O)OH, a —C(O)O—C.sub.1-6alkyl, benzyloxy, C.sub.1-4alkoxyphenyl, pyrrolidinyl, morpholinyl, tetrahydrofuranyl and triazolyl;

    [0115] R.sup.5 is hydrogen or C.sub.1-6alkyl optionally substituted with one, two or three substituents independently selected from the group consisting of halogen, —OH, C.sub.1-6alkoxy, —NR.sup.aR.sup.b, and R.sup.aR.sup.bN—C.sub.1-6alkyl;

    [0116] R.sup.6 is hydrogen or C.sub.1-6alkyl;

    [0117] R.sup.32 is halo, —OH, —CN, —NO.sub.2, oxo, hydrazino, formyl, azido, silyl, siloxy, —S(O).sub.q—C.sub.1-6alkyl, —NR.sup.aR.sup.b, —NR.sup.c—S(O).sub.t—C.sub.1-6alkyl, —S(O).sub.t—NR.sup.aR.sup.b, C.sub.1-6 alkyl, C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.3-6cycloalkyl, haloC.sub.1-6alkyl, hydroxyC.sub.1-6alkyl, R.sup.aR.sup.bN—C.sub.1-6alkyl-, C.sub.1-6alkoxy, haloC.sub.1-6alkoxy, hydroxyC.sub.1-6alkoxy-, R.sup.aR.sup.bN—C.sub.1-6alkoxy-, C.sub.1-6alkoxyC.sub.1-6alkyl, —C(O)NR.sup.aR.sup.b, —C(O)—C.sub.1-6alkyl, —C(O)OH, or —C(O)O—C.sub.1-6alkyl

    [0118] R.sup.34 is hydrogen or C.sub.1-4alkyl;

    [0119] R.sup.a and R.sup.b are independently selected for each occurrence from the group consisting of hydrogen and C.sub.1-6alkyl; or

    [0120] R.sup.a and R.sup.b may be taken together with the nitrogen to which R.sup.a and R.sup.b are attached to form:

    ##STR00013##

    [0121] R.sup.c is independently selected for each occurrence from the group consisting of hydrogen and C.sub.1-6alkyl;

    [0122] for each occurrence, q is independently 0, 1 or 2;

    [0123] for each occurrence, t is independently 1 or 2; and

    [0124] w is 0, 1 or 2.

    [0125] In certain embodiments, the compound of Formula I is a compound of Formula II or III:

    ##STR00014##

    or a pharmaceutically acceptable salt thereof.

    [0126] In certain embodiments, the compound of Formula I is a compound of Formula II:

    ##STR00015##

    or a pharmaceutically acceptable salt thereof.

    [0127] In certain embodiments, the compound of Formula I is a compound of Formula III:

    ##STR00016##

    or a pharmaceutically acceptable salt thereof.

    [0128] In certain embodiments, the compound of Formula I is a compound of Formula IV or V:

    ##STR00017##

    or a pharmaceutically acceptable salt thereof.

    [0129] In certain embodiments, the compound of Formula I is a compound of Formula IV:

    ##STR00018##

    or a pharmaceutically acceptable salt thereof.

    [0130] In certain embodiments, the compound of Formula I is a compound of Formula V:

    ##STR00019##

    or a pharmaceutically acceptable salt thereof.

    [0131] In certain embodiments, w is 0.

    [0132] In certain embodiments, w is 1.

    [0133] In certain embodiments, w is 2.

    [0134] In certain embodiments, R.sup.1 is a phenyl optionally substituted with one, two, or three independently selected R.sup.32 groups.

    [0135] In certain embodiments, R.sup.1 is

    ##STR00020##

    wherein:

    [0136] R.sup.32 is independently selected for each occurrence from the group consisting of hydrogen, halo, cyano, C.sub.1-6alkyl and C.sub.1-6haloalkyl; and

    [0137] r2 is 0, 1, 2 or 3.

    [0138] In certain embodiments, R.sup.1 is

    ##STR00021##

    wherein: R.sup.32a, R.sup.32b and R.sup.32c are independently selected from the group consisting of hydrogen, cynano, F, Cl and Br.

    [0139] In certain embodiments, R.sup.1 is

    ##STR00022##

    [0140] In certain embodiments, R.sup.1 is a heteroaryl optionally substituted with one, two, or three independently selected R.sup.32 groups.

    [0141] In certain embodiments, R.sup.1 is a 5-6 membered monocyclic heteroaryl optionally substituted with one, two, or three independently selected R.sup.32 groups.

    [0142] In certain embodiments, R.sup.1 is a 5-6 membered monocyclic heteroaryl optionally substituted with one, two, or three independently selected R.sup.32 groups; wherein:

    [0143] the 5-6 membered monocyclic heteroaryl is selected from the group consisting of: furanyl, thienyl, pyrrolyl, thiazolyl, oxazolyl, isothiazolyl, isoxazolyl, imidazolyl, pyrazolyl, 1H-1,2,3-triazolyl, 2H-1,2,3-triazolyl, 1,2,4-triazolyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, 1,3,5-triazinyl, 1,2,4-triazinyl, 1,2,3-triazinyl, 1,2,4-oxadiazolyl, 1,3,4-oxadiazolyl, 1,2,5-oxadiazolyl, 1,2,4-thiadiazolyl, 1,3,4-thiadiazolyl and 1,2,5-thiadiazolyl.

    [0144] In certain embodiments, R.sup.1 is a pyridyl optionally substituted with one, two, or three substituents independently selected from the group consisting of halo, cyano, C.sub.1-6alkyl and C.sub.1-6haloalkyl.

    [0145] In certain embodiments, R.sup.1 is a 8-12 membered bicyclic heteroaryl optionally substituted with one, two, or three independently selected R.sup.32 groups.

    [0146] In certain embodiments, R.sup.1 is a 8-12 membered bicyclic heteroaryl optionally substituted with one, two, or three independently selected R.sup.32 groups, wherein:

    [0147] the 8-12 membered bicyclic heteroaryl is selected from the group consisting of: benzofuranyl, isobenzofuranyl, benzo[b]thiophenyl, benzo[c]thiophenyl, indolyl, isoindolyl, benzo[d]isoxazolyl, benzo[c]isoxazolyl, benzo[d]oxazolyl, benzo[d]isothiazolyl, benzo[c]isothiazolyl, benzo[d]thiazolyl, indazolyl, benzo[d]imidazolyl, benzo[d]imidazolyl, and benzo[d][1,2,3]triazolyl.

    [0148] In certain embodiments, R.sup.2 is hydrogen or methyl.

    [0149] In certain embodiments, R.sup.2 is hydrogen.

    [0150] In certain embodiments, R.sup.3 is a C.sub.8-12cycloalkyl, C.sub.8-12cycloalkenyl or carbocyclyl, wherein: the C.sub.8-12cycloalkyl, C.sub.8-12cycloalkenyl or carbocyclyl is optionally substituted with one, two or three substituents independently selected from the group consisting of R.sup.32, R.sup.34 and R.sup.7a.

    [0151] In certain embodiments, R.sup.3 is a C.sub.8-12cycloalkyl optionally substituted with one, two or three substituents independently selected from the group consisting of R.sup.32, R.sup.34 and R.sup.7a.

    [0152] In certain embodiments, R.sup.3 is a C.sub.8-12cycloalkenyl optionally substituted with one, two or three substituents independently selected from the group consisting of R.sup.32, R.sup.34 and R.sup.7a.

    [0153] In certain embodiments, R.sup.3 is a carbocyclyl optionally substituted with one, two or three substituents independently selected from the group consisting of R.sup.32, R.sup.34 and R.sup.7a.

    [0154] In certain embodiments, R.sup.3 is a heterocyclkoalkyl optionally substituted with one, two or three substituents independently selected from the group consisting of R.sup.32, R.sup.34 and R.sup.7a.

    [0155] In certain embodiments, R.sup.3 is a heterocyclkoalkyl, heterocyclkoalkyl or heterocyclyl, wherein: the heterocyclkoalkyl, heterocyclkoalkyl or heterocyclyl is optionally substituted with one, two or three substituents independently selected from the group consisting of R.sup.32, R.sup.34 and R.sup.7a.

    [0156] In certain embodiments, R.sup.3 is a 4-7 membered monocyclic heterocyclkoalkyl optionally substituted with one, two or three substituents independently selected from the group consisting of R.sup.32, R.sup.34 and R.sup.7a, wherein:

    [0157] the 4-7 membered monocyclic heterocyclkoalkyl is selected form the group consisting of: aziridinyl, oxiranyl, thiiranyl 1,1-dioxide, oxetanyl, azetidinyl, thietanyl 1,1-dioxide, pyrrolidinyl, tetrahydrofuranyl, piperidinyl, tetrahydro-2H-pyranyl, morpholinyl, thiomorpholinyl and piperazinyl.

    [0158] In certain embodiments, R.sup.3 is a heterocyclkoalkenyl optionally substituted with one, two or three substituents independently selected from the group consisting of R.sup.32, R.sup.34 and R.sup.7a.

    [0159] In certain embodiments, R.sup.3 is a heterocyclyl optionally substituted with one, two or three substituents independently selected from the group consisting of R.sup.32, R.sup.34 and R.sup.7a.

    [0160] In certain embodiments, R.sup.7a is a phenyl optionally substituted with one, two or three independently selected R.sup.32 groups.

    [0161] In certain embodiments, R.sup.7a is a heteroaryl optionally substituted with one, two or three independently selected R.sup.32 groups.

    [0162] In certain embodiments, R.sup.7a is a 5-6 membered monocyclic heteroaryl optionally substituted with one, two or three independently selected R.sup.32 groups.

    [0163] In certain embodiments, R.sup.4 is hydrogen, C.sub.1-6alkyl, C.sub.2-6alkenyl or C.sub.2-6alkynyl, wherein: the C.sub.1-4alkyl, C.sub.2-6alkenyl or C.sub.2-6alkynyl is optionally substituted with hydroxy, cyano, C.sub.1-4alkoxy, haloC.sub.1-4alkoxy, methylsulfonyl, diethylamino, carboxy, carbamoyl, benzyloxy, formyl, methoxyphenyl, pyrrolidinyl, morpholinyl, tetrahydrofuranyl or triazolyl.

    [0164] In certain embodiments, R.sup.4 is hydrogen or C.sub.1-6alkyl optionally substituted with C.sub.1-6alkoxy, —NR.sup.aR.sup.b, C.sub.2-6alkenyl, —OH, —COOH or C.sub.1-6haloalkoxy.

    [0165] In certain embodiments, R.sup.4 is C.sub.1-6alkyl optionally substituted with C.sub.1-6alkoxy, —NR.sup.aR.sup.b, C.sub.2-6alkenyl, —OH, —COOH or C.sub.1-6haloalkoxy.

    [0166] In certain embodiments, R.sup.4 is —CH.sub.2CH.sub.2OCH.sub.3.

    [0167] In certain embodiments, R.sup.4 is methyl.

    [0168] In certain embodiments, R.sup.5 is hydrogen, C.sub.1-4alkyl, C.sub.1-4alkoxy, or R.sup.aR.sup.bN—C.sub.1-4alkyl-.

    [0169] In certain embodiments, R.sup.5 is hydrogen, methyl, methoxymethyl-, methoxyethyl- or dimethylaminoethyl-.

    [0170] In certain embodiments, R.sup.5 is hydrogen or methyl.

    [0171] In certain embodiments, R.sup.5 is hydrogen.

    [0172] In certain embodiments, R.sup.6 is hydrogen or C.sub.1-6alkyl.

    [0173] In certain embodiments, R.sup.6 is hydrogen.

    [0174] In certain embodiments, R.sup.2 and R.sup.6 are hydrogen.

    [0175] In certain embodiments, R.sup.2 and R.sup.6 are hydrogen, and w is 2.

    [0176] In certain embodiments, R.sup.2, R.sup.5 and R.sup.6 are hydrogen.

    [0177] In certain embodiments, R.sup.2, R.sup.5 and R.sup.6 are hydrogen, and w is 2.

    [0178] In certain embodiments, R.sup.2, R.sup.5 and R.sup.6 are hydrogen, and R.sup.4 is methyl.

    [0179] In certain embodiments, R.sup.2, R.sup.5 and R.sup.6 are hydrogen, R.sup.4 is methyl, and w is 2.

    [0180] In certain embodiments, R.sup.1 is 3-chloro-4-fluourophenyl, R.sup.2 is hydrogen, and R.sup.6 is hydrogen.

    [0181] In certain embodiments, R.sup.1 is 3-chloro-4-fluourophenyl, R.sup.2 is hydrogen, R.sup.6 is hydrogen, and w is 2.

    [0182] In certain embodiments, R.sup.1 is 3-chloro-4-fluourophenyl, R.sup.2 is hydrogen, R.sup.5 is hydrogen, and R.sup.6 is hydrogen.

    [0183] In certain embodiments, R.sup.1 is 3-chloro-4-fluourophenyl, R.sup.2 is hydrogen, R.sup.5 is hydrogen, R.sup.6 is hydrogen, and w is 2.

    [0184] In certain embodiments, R.sup.1 is 3-chloro-4-fluourophenyl, R.sup.2 is hydrogen, R.sup.5 is hydrogen, R.sup.6 is hydrogen, and R.sup.4 is methyl.

    [0185] In certain embodiments, R.sup.1 is 3-chloro-4-fluourophenyl, R.sup.2 is hydrogen, R.sup.5 is hydrogen, R.sup.6 is hydrogen, R.sup.4 is methyl, and w is 2.

    [0186] It will be appreciated that all chemically allowable combinations of the embodiments described above, and elsewhere in this disclosure, are envisioned as further embodiments of the invention.

    II. PHARMACEUTICAL COMPOSITIONS AND KITS

    [0187] In another aspect, the disclosure provides pharmaceutical compositions comprising a compound of Formula I, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient. In particular, the present disclosure provides pharmaceutical compositions comprising compounds as disclosed herein formulated together with one or more pharmaceutically acceptable carriers. These formulations include those suitable for oral, rectal, topical, buccal, parenteral (e.g., subcutaneous, intramuscular, intradermal, or intravenous), rectal, vaginal, or aerosol administration, although the most suitable form of administration in any given case will depend on the degree and severity of the condition being treated and on the nature of the particular compound being used. For example, disclosed compositions may be formulated as a unit dose, and/or may be formulated for oral or subcutaneous administration.

    [0188] In another aspect, the disclosure provides a pharmaceutical composition comprises a compound of Table 3, 4, 5, 6 or 7, or a pharmaceutically acceptable salt and/or stereoisomer thereof.

    [0189] Exemplary pharmaceutical compositions of this disclosure may be used in the form of a pharmaceutical preparation, for example, in solid, semisolid or liquid form, which contains one or more of the compound of the disclosure, as an active ingredient, in admixture with an organic or inorganic carrier or excipient suitable for external, enteral or parenteral applications. The active ingredient may be compounded, for example, with the usual non-toxic, pharmaceutically acceptable carriers for tablets, pellets, capsules, suppositories, solutions, emulsions, suspensions, and any other form suitable for use. The active object compound is included in the pharmaceutical composition in an amount sufficient to produce the desired effect upon the process or condition of the disease.

    [0190] For preparing solid compositions such as tablets, the principal active ingredient may be mixed with a pharmaceutical carrier, e.g., conventional tableting ingredients such as corn starch, lactose, sucrose, sorbitol, talc, stearic acid, magnesium stearate, dicalcium phosphate or gums, and other pharmaceutical diluents, e.g., water, to form a solid preformulation composition containing a homogeneous mixture of a compound of the disclosure, or a non-toxic pharmaceutically acceptable salt thereof. When referring to these preformulation compositions as homogeneous, it is meant that the active ingredient is dispersed evenly throughout the composition so that the composition may be readily subdivided into equally effective unit dosage forms such as tablets, pills and capsules.

    [0191] In solid dosage forms for oral administration (capsules, tablets, pills, dragees, powders, granules and the like), the subject composition is mixed with one or more pharmaceutically acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any of the following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and/or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose and/or acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) wetting agents, such as, for example, acetyl alcohol and glycerol monostearate; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such a talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof; and (10) coloring agents. In the case of capsules, tablets and pills, the compositions may also comprise buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.

    [0192] A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using binder (for example, gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (for example, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the subject composition moistened with an inert liquid diluent. Tablets, and other solid dosage forms, such as dragees, capsules, pills and granules, may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical-formulating art.

    [0193] Compositions for inhalation or insufflation include solutions and suspensions in pharmaceutically acceptable, aqueous or organic solvents, or mixtures thereof, and powders. Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the subject composition, the liquid dosage forms may contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, cyclodextrins and mixtures thereof.

    [0194] Suspensions, in addition to the subject composition, may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.

    [0195] Formulations for rectal or vaginal administration may be presented as a suppository, which may be prepared by mixing a subject composition with one or more suitable non-irritating excipients or carriers comprising, for example, cocoa butter, polyethylene glycol, a suppository wax or a salicylate, and which is solid at room temperature, but liquid at body temperature and, therefore, will melt in the body cavity and release the active agent.

    [0196] Dosage forms for transdermal administration of a subject composition include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The active component may be mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants which may be required.

    [0197] The ointments, pastes, creams and gels may contain, in addition to a subject composition, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.

    [0198] Powders and sprays may contain, in addition to a subject composition, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances. Sprays may additionally contain customary propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.

    [0199] Compositions and compounds of the present disclosure may alternatively be administered by aerosol. This is accomplished by preparing an aqueous aerosol, liposomal preparation or solid particles containing the compound. A non-aqueous (e.g., fluorocarbon propellant) suspension could be used. Sonic nebulizers may be used because they minimize exposing the agent to shear, which may result in degradation of the compounds contained in the subject compositions. Ordinarily, an aqueous aerosol is made by formulating an aqueous solution or suspension of a subject composition together with conventional pharmaceutically acceptable carriers and stabilizers. The carriers and stabilizers vary with the requirements of the particular subject composition, but typically include non-ionic surfactants (Tweens, Pluronics, or polyethylene glycol), innocuous proteins like serum albumin, sorbitan esters, oleic acid, lecithin, amino acids such as glycine, buffers, salts, sugars or sugar alcohols. Aerosols generally are prepared from isotonic solutions.

    [0200] Pharmaceutical compositions of this disclosure suitable for parenteral administration comprise a subject composition in combination with one or more pharmaceutically-acceptable sterile isotonic aqueous or non-aqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain antioxidants, buffers, bacteriostats, solutes which render the formulation isotonic with the blood of the intended recipient or suspending or thickening agents.

    [0201] Examples of suitable aqueous and non-aqueous carriers which may be employed in the pharmaceutical compositions of the disclosure include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate and cyclodextrins. Proper fluidity may be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants

    [0202] In another aspect, the disclosure provides enteral pharmaceutical formulations including a disclosed compound and an enteric material; and a pharmaceutically acceptable carrier or excipient thereof. Enteric materials refer to polymers that are substantially insoluble in the acidic environment of the stomach, and that are predominantly soluble in intestinal fluids at specific pHs. The small intestine is the part of the gastrointestinal tract (gut) between the stomach and the large intestine, and includes the duodenum, jejunum, and ileum. The pH of the duodenum is about 5.5, the pH of the jejunum is about 6.5 and the pH of the distal ileum is about 7.5. Accordingly, enteric materials are not soluble, for example, until a pH of about 5.0, of about 5.2, of about 5.4, of about 5.6, of about 5.8, of about 6.0, of about 6.2, of about 6.4, of about 6.6, of about 6.8, of about 7.0, of about 7.2, of about 7.4, of about 7.6, of about 7.8, of about 8.0, of about 8.2, of about 8.4, of about 8.6, of about 8.8, of about 9.0, of about 9.2, of about 9.4, of about 9.6, of about 9.8, or of about 10.0. Exemplary enteric materials include cellulose acetate phthalate (CAP), hydroxypropyl methylcellulose phthalate (HPMCP), polyvinyl acetate phthalate (PVAP), hydroxypropyl methylcellulose acetate succinate (HPMCAS), cellulose acetate trimellitate, hydroxypropyl methylcellulose succinate, cellulose acetate succinate, cellulose acetate hexahydrophthalate, cellulose propionate phthalate, cellulose acetate maleate, cellulose acetate butyrate, cellulose acetate propionate, copolymer of methylmethacrylic acid and methyl methacrylate, copolymer of methyl acrylate, methylmethacrylate and methacrylic acid, copolymer of methylvinyl ether and maleic anhydride (Gantrez ES series), ethyl methyacrylate-methylmethacrylate-chlorotrimethylammonium ethyl acrylate copolymer, natural resins such as zein, shellac and copal collophorium, and several commercially available enteric dispersion systems (e.g., Eudragit L30D55, Eudragit FS30D, Eudragit L100, Eudragit 5100, Kollicoat EMM30D, Estacryl 30D, Coateric, and Aquateric). The solubility of each of the above materials is either known or is readily determinable in vitro. The foregoing is a list of possible materials, but one of skill in the art with the benefit of the disclosure would recognize that it is not comprehensive and that there are other enteric materials that would meet the objectives of the present disclosure.

    [0203] Advantageously, the disclosure also provides kits for use by a e.g. a consumer in need of HBV infection treatment. Such kits include a suitable dosage form such as those described above and instructions describing the method of using such dosage form to mediate, reduce or prevent HBV infection. The instructions would direct the consumer or medical personnel to administer the dosage form according to administration modes known to those skilled in the art. Such kits could advantageously be packaged and sold in single or multiple kit units. An example of such a kit is a so-called blister pack. Blister packs are well known in the packaging industry and are being widely used for the packaging of pharmaceutical unit dosage forms (tablets, capsules, and the like). Blister packs generally consist of a sheet of relatively stiff material covered with a foil of a preferably transparent plastic material. During the packaging process recesses are formed in the plastic foil. The recesses have the size and shape of the tablets or capsules to be packed. Next, the tablets or capsules are placed in the recesses and the sheet of relatively stiff material is sealed against the plastic foil at the face of the foil which is opposite from the direction in which the recesses were formed. As a result, the tablets or capsules are sealed in the recesses between the plastic foil and the sheet. Preferably the strength of the sheet is such that the tablets or capsules can be removed from the blister pack by manually applying pressure on the recesses whereby an opening is formed in the sheet at the place of the recess. The tablet or capsule can then be removed via said opening.

    [0204] It may be desirable to provide a memory aid on the kit, e.g., in the form of numbers next to the tablets or capsules whereby the numbers correspond with the days of the regimen which the tablets or capsules so specified should be ingested. Another example of such a memory aid is a calendar printed on the card, e.g., as follows “First Week, Monday, Tuesday, . . . etc. . . . Second Week, Monday, Tuesday, . . . ” etc. Other variations of memory aids will be readily apparent. A “daily dose” can be a single tablet or capsule or several pills or capsules to be taken on a given day. Also, a daily dose of a first compound can consist of one tablet or capsule while a daily dose of the second compound can consist of several tablets or capsules and vice versa. The memory aid should reflect this.

    III. METHODS

    [0205] In a further aspect, a method for treating a hepatitis B infection in a patient in need thereof is provided, comprising administering to a subject or patient an effective amount of a disclosed compound, and/or administering a first disclosed compound and optionally, an additional, different disclosed compound(s). In another embodiment, a method for treating a hepatitis B infection in a patient in need thereof is provided, comprising administering to a subject or patient a therapeutically effective amount of a disclosed pharmaceutical composition or a pharmaceutical composition comprising a disclosed compound, or two or more disclosed compounds, and a pharmaceutically acceptable excipient.

    [0206] For use in accordance with this aspect, the appropriate dosage is expected to vary depending on, for example, the particular compound employed, the mode of administration, and the nature and severity of the infection to be treated as well as the specific infection to be treated and is within the purview of the treating physician. Usually, an indicated administration dose may be in the range between about 0.1 to about 1000 μg/kg body weight. In some cases, the administration dose of the compound may be less than 400 μg/kg body weight. In other cases, the administration dose may be less than 200 μg/kg body weight. In yet other cases, the administration dose may be in the range between about 0.1 to about 100 μg/kg body weight. The dose may be conveniently administered once daily, or in divided doses up to, for example, four times a day or in sustained release form.

    [0207] A compound of the present disclosure may be administered by any conventional route, in particular: enterally, topically, orally, nasally, e.g. in the form of tablets or capsules, via suppositories, or parenterally, e.g. in the form of injectable solutions or suspensions, for intravenous, intra-muscular, sub-cutaneous, or intra-peritoneal injection. Suitable formulations and pharmaceutical compositions will include those formulated in a conventional manner using one or more physiologically acceptable carriers or excipients, and any of those known and commercially available and currently employed in the clinical setting. Thus, the compounds may be formulated for oral, buccal, topical, parenteral, rectal or transdermal administration or in a form suitable for administration by inhalation or insufflation (either orally or nasally).

    [0208] For oral administration, pharmaceutical compositions may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g. pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g. lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g. magnesium stearate, talc or silica); disintegrants (e.g. potato starch or sodium starch glycollate); or wetting agents (e.g. sodium lauryl sulphate). Tablets may be coated by methods well known in the art. Liquid preparations for oral administration may take the form of, for example, solutions, syrups or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g. sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g. lecithin or acacia); non-aqueous vehicles (e.g. almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g. methyl or propyl-p-hydroxybenzoates or sorbic acid). Preparations may also contain buffer salts, flavoring, coloring and sweetening agents as appropriate.

    [0209] Preparations for oral administration may also be suitably formulated to give controlled-release or sustained release of the active compound(s) over an extended period. For buccal administration the compositions may take the form of tablets or lozenges formulated in a conventional manner known to the skilled artisan.

    [0210] A disclosed compound may also be formulated for parenteral administration by injection e.g. by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form e.g. in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain additives such as suspending, stabilizing and/or dispersing agents. Alternatively, the compound may be in powder form for constitution with a suitable vehicle, e.g. sterile pyrogen-free water, before use. Compounds may also be formulated for rectal administration as suppositories or retention enemas, e.g. containing conventional suppository bases such as cocoa butter or other glycerides.

    [0211] Also contemplated herein are methods and compositions that include a second active agent, or administering a second active agent. For example, in addition to being infected with HBV, a subject or patient can further have HBV infection-related co-morbidities, i.e., diseases and other adverse health conditions associated with, exacerbated by, or precipitated by being infected with HBV. Contemplated herein are disclosed compounds in combination with at least one other agent that has previously been shown to treat these HBV-infection-related conditions.

    [0212] In some cases, a disclosed compound may be administered as part of a combination therapy in conjunction with one or more antivirals. Example antivirals include nucleoside analogs, interferon α, and other assembly effectors, for instance heteroaryldihydropyrimidines (HAPs) such as methyl 4-(2-chloro-4-fluorophenyl)-6-methyl-2-(pyridin-2-yl)-1,4-dihydropyrimidine-5-carboxylate (HAP-1). For example, provided herein is a method of treating a patient suffering from hepatitis B infection comprising administering to the patient a first amount of a disclosed compound and a second amount of an antiviral, or other anti HBV agent, for example a second amount of a second compound selected from the group consisting of: a HBV capsid assembly promoter (for example, GLS4, BAY 41-4109, AT-130, DVR-23 (e.g., as depicted below),

    ##STR00023##

    NVR 3-778, NVR1221 (by code); and N890 (as depicted below):

    ##STR00024##

    other CpAMs such as those disclosed in the following patent applications hereby incorporated by reference: WO2014037480, WO2014184328, WO2013006394, WO2014089296, WO2014106019, WO2013102655, WO2014184350, WO2014184365, WO2014161888, WO2014131847, WO2014033176, WO2014033167, and WO2014033170; Nucleoside analogs interfering with viral polymerase, such as entecavir (Baraclude), Lamivudine, (Epivir-HBV), Telbivudine (Tyzeka, Sebivo), Adefovir dipivoxil (Hepsera), Tenofovir (Viread), Tenofovir alafenamide fumarate (TAF), prodrugs of tenofavir (e.g. AGX-1009), L-FMAU (Clevudine), LB80380 (Besifovir) and:

    ##STR00025##

    viral entry inhibitors such as Myrcludex B and related lipopeptide derivatives; HBsAg secretion inhibitors such as REP 9AC′ and related nucleic acid-based amphipathic polymers, HBF-0529 (PBHBV-001), PBHBV-2-15 as depicted below:

    ##STR00026##

    and BM601 as depicted below:

    ##STR00027##

    disruptors of nucleocapsid formation or integrity such as NZ-4/W28F:

    ##STR00028##

    cccDNA formation inhibitors such as BSBI-25, CCC-0346, CCC-0975 (as depicted below):

    ##STR00029##

    HBc directed transbodies such as those described in Wang Y, et al, Transbody against hepatitis B virus core protein inhibits hepatitis B virus replication in vitro, Int. Immunopharmacol (2014), located at //dx.doi.org/10.1016/j.intimp.2015.01.028; antiviral core protein mutant (such as Cp183-V124W and related mutations as described in WO/2013/010069, WO2014/074906, each incorporated by reference); inhibitors of HBx-interactions such as RNAi, antisense and nucleic acid based polymers targeting HBV RNA; e.g., RNAi (for example ALN-HBV, ARC-520, TKM-HBV, ddRNAi), antisense (ISIS-HBV), or nucleic acid based polymer: (REP 2139-Ca); immunostimulants such as Interferon alpha 2a (Roferon), Intron A (interferon alpha 2b), Pegasys (peginterferon alpha 2a), Pegylated IFN 2b, IFN lambda la and PEG IFN lambda la, Wellferon, Roferon, Infergen, lymphotoxin beta agonists such as CBE11 and BS1); Non-Interferon Immune enhancers such as Thymosin alpha-1 (Zadaxin) and Interleukin-7 (CYT107); TLR-7/9 agonists such as GS-9620, CYT003, Resiquimod; Cyclophilin Inhibitors such as NVP018; OCB-030; SCY-635; Alisporivir; NIM811 and related cyclosporine analogs; vaccines such as GS-4774, TG1050, Core antigen vaccine; SMAC mimetics such as birinapant and other IAP-antagonists; Epigenetic modulators such as KMT inhibitors (EZH1/2, G9a, SETD7, Suv39 inhibitors), PRMT inhibitors, HDAC inhibitors, SIRT agonists, HAT inhibitors, WD antagonists (e.g. OICR-9429), PARP inhibitors, APE inhibitors, DNMT inhibitors, LSD1 inhibitors, JMJD HDM inhibitors, and Bromodomain antagonists; kinase inhibitors such as TKB1 antagonists, PLK1 inhibitors, SRPK inhibitors, CDK2 inhibitors, ATM & ATR kinase inhibitors; STING Agonists; Ribavirin; N-acetyl cysteine; NOV-205 (BAM205); Nitazoxanide (Alinia), Tizoxanide; SB 9200 Small Molecule Nucleic Acid Hybrid (SMNH); DV-601; Arbidol; FXR agonists (such as GW 4064 and Fexaramin); antibodies, therapeutic proteins, gene therapy, and biologics directed against viral components or interacting host proteins.

    [0213] In some embodiments, the disclosure provides a method of treating a hepatitis B infection in a patient in need thereof, comprising administering a first compound selected from any one of the disclosed compounds, and one or more other HBV agents each selected from the group consisting of HBV capsid assembly promoters, HBF viral polymerase interfering nucleosides, viral entry inhibitors, HBsAg secretion inhibitors, disruptors of nucleocapsid formation, cccDNA formation inhibitors, antiviral core protein mutant, HBc directed transbodies, RNAi targeting HBV RNA, immunostimulants, TLR-7/9 agonists, cyclophilin inhibitors, HBV vaccines, SMAC mimetics, epigenetic modulators, kinase inhibitors, and STING agonists. In some embodiments, the disclosure provides a method of treating a hepatitis B infection in a patient in need thereof, comprising administering an amount of a disclosed compound, and administering another HBV capsid assembly promoter.

    [0214] In some embodiments, the first and second amounts together comprise a pharmaceutically effective amount. The first amount, the second amount, or both may be the same, more, or less than effective amounts of each compound administered as monotherapies. Therapeutically effective amounts of a disclosed compound and antiviral may be co-administered to the subject, i.e., administered to the subject simultaneously or separately, in any given order and by the same or different routes of administration. In some instances, it may be advantageous to initiate administration of a disclosed compound first, for example one or more days or weeks prior to initiation of administration of the antiviral. Moreover, additional drugs may be given in conjunction with the above combination therapy.

    [0215] In another embodiment, a disclosed compound may be conjugated (e.g., covalently bound directly or through molecular linker to a free carbon, nitrogen (e.g. an amino group), or oxygen (e.g. an active ester) of a disclosed compound), with a detection moiety, for e.g., a fluorophore moiety (such a moiety may for example re-emit a certain light frequency upon binding to a virus and/or upon photon excitation). Contemplated fluorophores include AlexaFluor® 488 (Invitrogen) and BODIPY FL (Invitrogen), as well as fluorescein, rhodamine, cyanine, indocarbocyanine, anthraquinones, fluorescent proteins, aminocoumarin, methoxycoumarin, hydroxycoumarin, Cy2, Cy3, and the like. Such disclosed compounds conjugated to a detection moiety may be used in e.g. a method for detecting HBV or biological pathways of HBV infection, e.g., in vitro or in vivo; and/or methods of assessing new compounds for biological activity.

    IV. EXAMPLES

    [0216] The compounds described herein can be prepared in a number of ways based on the teachings contained herein and synthetic procedures known in the art. In the description of the synthetic methods described below, it is to be understood that all proposed reaction conditions, including choice of solvent, reaction atmosphere, reaction temperature, duration of the experiment and workup procedures, can be chosen to be the conditions standard for that reaction, unless otherwise indicated. It is understood by one skilled in the art of organic synthesis that the functionality present on various portions of the molecule should be compatible with the reagents and reactions proposed. Substituents not compatible with the reaction conditions will be apparent to one skilled in the art, and alternate methods are therefore indicated. The starting materials for the examples are either commercially available or are readily prepared by standard methods from known materials.

    [0217] At least some of the compounds identified as “intermediates” herein are contemplated as compounds of the disclosure.

    Abbreviations:

    [0218] DCM Dichloromethane [0219] EtOAC Ethyl acetate [0220] MeOH Methanol [0221] DMSO Dimethyl sulfoxide [0222] NMO N-Methylmorpholine N-oxide [0223] LiHMDS Lithium bis(trimethylsilyl)amide [0224] p-TSA p-Toluenesulfonic acid [0225] DMF N,N-Dimethylformamide [0226] THF Tetrahydrofuran [0227] TLC Thin-layer chromatography [0228] LCMS Liquid chromatography-mass spectrometry [0229] HPLC High performance liquid chromatography

    Synthetic Methods

    [0230] The compounds described herein can be prepared by various methods based on the teachings contained herein and synthetic procedures known in the art. The variables shown in the synthetic schemes are distinct from and should not be confused with the variables in the claims or the rest of the specification. In the description of the synthetic methods described below, it is to be understood that all proposed reaction conditions, including choice of solvent, reaction atmosphere, reaction temperature, duration of the experiment and workup procedures, can be chosen to be the conditions standard for that reaction, unless otherwise indicated. It is understood by one skilled in the art of organic synthesis that the functionality present on various portions of the molecule should be compatible with the reagents and reactions proposed. Substituents not compatible with the reaction conditions will be apparent to one skilled in the art, and alternate methods are therefore indicated. The starting materials for the examples are either commercially available or are readily prepared by standard methods from known materials

    [0231] Methods useful for the prepation of compounds of this invention are illustrated in the following schemes. In Scheme I, an appropriately substituted methyl ketone (I-1) can be reacted with a bis-ester of oxalic acid (I-2) in the presence of a suitable base such as, EtONa, t-BuOK, LiHMDS or LDA to form diketoester I-3. Synthesis of the corresponding 2H-1,2,6-thiadiazine, 1,1-dioxide derivative I-4 can be accomplished by condensing intermediate I-2 with sulfuric diamide (H.sub.4N.sub.2O.sub.2S) under acidic (eg. HCl) conditions similar to those described in Bioorganic & Medicinal Chemistry Letters, (2007), 7, 7480. This intermediate can be reacted with an appropriate alcohol (R.sup.4OH) under Mitsunobu reaction conditions (Mitsunobu, O. et al. Bulletin of the Chemical Society of Japan, (1967). 40, 935) or an alkyl halide (R.sup.4X where X═I, Br or Cl) in the presence of a base (eg. NaOH, KOH, K.sub.2CO.sub.3, NaH, LiHMDS, NaHMDS) to selectively form intermediate I-5. Intermediate I-5 can be taken on to the final product (I-9) by a number of different pathways. In one of these pathways, intermediate I-5 is treated under hydrolytic conditions (eg. NaOH or Et.sub.3N/H.sub.2O) to form carboxylic acid I-6. This intermediate can be treated with a reducing agent such as NaBH.sub.4 to form I-8. Alternatively, I-8 can be formed by the hydrogenation of I-6 using a Ni, Pd, Pt, Ru, Rh or Ir based-catalyst and H.sub.2 or a hydrogen-donating reagent (eg. N.sub.2H.sub.4, H.sub.2N.sub.2, dihydronaphthalene, dihydroanthracene, isopropanol, formic acid, H.sub.2O, etc.). Following this, I-8 is coupled with an appropriate amine (R.sup.1R.sup.2NH) using an amide bond forming reagent (eg. DCC, PyBOP, PyBrop, TDBTU, HATU) and base (Et.sub.3N, iPr.sub.2NEt) to yield the final product. In a alternative pathway, ester I-5 can be directly converted to amide I-7 using an appropriate amine (R.sup.1R.sup.2NH) and a reagent such as Me.sub.3Al, which mediates ester-amide exchange. Intermediate I-7 can be reduced to form the final product, I-9, using methods similar to those described for the conversion of I-6 to I-8.

    [0232] It will be understood by one skilled in the art that the 3,5-disubstituted 1,2,6-thiadiazinane 1,1, dioxide I-9 can exist as two different configurational isomers referred to as cis or trans depending on whether substituents at the 3- and 5-positions lie on the same- or opposite-face of the ring, respectively. In the current invention the 3,5-cis stereoisomer can be selectively produced by the reduction or hydrogenation reactions of I-6 to form I-8 or by the reduction of I-7 to form I-9.

    ##STR00030##

    [0233] It will be appreciated by one skilled I the art that, cis-isomer of I-9 can exist as a mixture of enantiomers, 3R, 5S and 3S, 5R. The individual enantiomers can be produced from racemic I-8 or isolated from racemic I-9 according to methods illustrated in Scheme II. In one method, intermediate 1-8 can be resolved using chiral chromatography or selective salt-formation and crystallization using an enantiomerically pure chiral amine. The purified enantiomers, II-1a and II-1b can then be individually converted to the corresponding amides II-2a and II-2b. Alternatively, racemic I-8 can be converted to racemic I-9 which can then be separated into its individual enantiomers II-2a and II-2b using chiral chromatography. The isolated enantiomers are referred to as Isomer I and Isomer II based on their order of elution from the chiral column regardless of the absolute stereochemistry. The first eluting isomer is designated as Isomer I and the second is referred to as Isomer II.

    ##STR00031##

    [0234] Scheme III illustrates the direct synthesis of enantiomers II-2a or II-2b from prochiral intermediate I-7. For example, this can be accomplished by asymmetric transfer hydrogenation, as described in Accounts of Chemical Research (1997) 30, 97 or Angewandte Chemie International Edition (1998) 12, 41.

    ##STR00032##

    [0235] Certain compounds of the invention can be synthesized using the method shown in Scheme IV. In this scheme, IV-1 can be converted to IV-8 using the procedures described for the synthesis of I-7 in Scheme I. Intermediate IV-8 contains a bromine atom which can be displaced by reaction with an appropriate Y—X (X═H, halide Zn, Mg, B(OH).sub.2, B(OZ).sub.2, SnZ.sub.3, or SiZ.sub.3 (Z═ alkyl or aryl)) under palladium, nickel, copper, platinum, iron or cobalt catalysis to form racemic IV-9 (Kambe N. et al. Chemical Society Reviews (2011) 40, 4937. Phapale, V. B. and Cardena, D. J. Chemical Society Reviews (2009), 38, 1598.). Compound IV-9 can be separated into its individual enantiomers, IV-10a and IV-10b as described in Scheme II.

    ##STR00033## ##STR00034##

    [0236] Scheme V illustrates the synthesis of 19-Isomer I and 19-Isomer II. Compound V-1 can be saponified under basic conditions to yield carboxylic acid V-2. 19-Isomer I and 19-Isomer II can then be isolated by chiral chromatography.

    ##STR00035##

    [0237] Scheme VI illustrates another method for the synthesis of certain compound of this invention. In the first step, intermediate IV-8 can be converted to the corresponding boronic acid ester, VI-1, via a palladium catalyzed coupling reaction with pinacol diborane. Intermediate VI-1 can then be used as a coupling partner with an appropriate substituted reactant, Y-X (X=halide, OTf) using reaction conditions similar to those described for Scheme IV to yield VI-2.

    ##STR00036##

    [0238] In Scheme VII, treatment of intermediate IV-8 with an amine (R.sup.aR.sup.bNH) in the presence of a Palladium, Nickel or Copper based catalyst can yield compound VII-1 (Ruiz-Castillo, P. and Buchwald, S. L. Chemical Reviews (2016), 116, 12564).

    ##STR00037##

    [0239] Scheme VIII illustrates the preparation of advanced intermediate VIII-7. Intermediate VIII-6 can be synthesized using the methods described in Scheme I. Intermediate VIII-6 can then be treated with a suitable oxidizing reagent such as KMnO.sub.4 to form carboxylic acid VIII-7.

    ##STR00038##

    [0240] Certain compounds of this invention can be synthesized according to the methods provided in Scheme IX. In Scheme IX, advanced intermediate IX-6 can be synthesized using the methods described in Scheme I. The Bromine atom of IX-6 can then be displaced with an appropriate Y—X X (X═H, halide —Zn, —Mg, —B(OH).sub.2, —B(OZ).sub.2, —SnZ.sub.3, or —SiZ.sub.3 (Z═ alkyl or aryl)) under palladium, nickel, copper, platinum, iron or cobalt catalysis to provide IX-7. Formation of intermediate IX-8 can be achieved by coupling IX-7 with R.sup.1R.sup.2NH under standard amide bond forming conditions. The furan ring of this intermediate can be reduced using Me.sub.3SiH/TFA or hydrogenated using Hz, Pd/C to yield IX-9.

    ##STR00039## ##STR00040##

    [0241] As illustrated in Schemes X through XIV, intermediate VIII-7 can be used directly or indirectly via initial modification, to synthesize a wide range of 5-membered ring heteroaryls. In Scheme X, intermediate VIII-7 can be esterified under standard conditions to provide methyl ester X-1. Following this, the corresponding hydrazide X-2 can be synthesized by treating X-1 with hydrazine at elevated temperature. Reaction with X-3 forms the triazole analogue X-4. It will be understood by one skilled in the art that the carboxylic acid group of VIII-7 can be directly or indirectly converted to a triazole ring using various protocols. Examples include those described in, Castendo, G. M. J. Org. Chem., (2011) 76, 1177; Bechara, W. S. Org. Lett. (2015), 17, 1184 and Nakka, M. Synthesis (2015), 47, 517;

    ##STR00041##

    [0242] Scheme XI illustrates the reaction of X-2 with an appropriate substituted isocyanate (YNCO) to form intermediate XI-1. This intermediate can be converted to the corresponding product XI-2 using conditions similar to those described in Gauther, D. R. Organic Letters (2015), 17, 1353.

    ##STR00042##

    [0243] 1,3,4-Oxidiazoles such as XII-2 can also be obtained from intermediate X-2. In one method X-2 is treated with a suitable activated carboxylic acid (YCOCl, or ((YCO).sub.2O) to form XII-1. The 1,3,4-oxadiazole ring can then be formed by treating XII-1 with Burgess reagent (methyl N-(triethylammoniumsulfonyl)carbamate). In an alternative method, reaction of intermediate X-2 with a carboxylic acid (YCOOH) in the presence of POCl.sub.3, at elevated temperature yields XII-2. 1,3,4-Oxadiazoles are also readily available using the methods described in Kumar, D. Synlett (2014), 25, 1137 and Yu, W. J. Org. Chem. (2013), 78, 10337.

    ##STR00043##

    [0244] The synthesis of 1,2,4-oxadiazoles is shown in Scheme XIII. According to this method, intermediate VIII-7 is converted to the corresponding ethyl-ester XIII-1 which is used to form the amide XIII-2. The amide is then converted to XIII-3 using trifluoroacetic anhydride and triethylamine. Addition of hydroxyl amine provides XIII-4 which can be converted to XIII-5 via treatment with an appropriate acid chloride (YCOCl) in the presence of pyridine at elevated temperature. Alternative routes can be used to synthesize the oxadiazole group of XIII-5 including; Augustine, J. K. The Journal of Organic Chemistry (2009), 74, 5640.

    ##STR00044##

    [0245] Scheme XIV illustrates the conversion of carboxylic acid VIII-7 into the corresponding imidazole derivative, XIV-2. In the first step, VIII-7 is coupled to an appropriately substituted aminoketone to form intermediate XIV-I. The imidazole ring of XIV-2 can be formed by heating XIV-1 in the presence of a suitable amine (ZNH.sub.2) and acetic acid at elevated temperature.

    ##STR00045##

    [0246] In Scheme XV the synthesis of intermediate XV-4 can be accomplished by coupling aminoketone XV-3 with VIII-7. Intermediate XV-4 can then be treated with Lawesson's reagent (phosphorous pentasulfide) to yield thiazole XV-5.

    ##STR00046## ##STR00047##

    [0247] Certain compounds of this invention can be synthesized according to the method illustrated in Scheme XVI. Starting from ketone XVI-1, intermediate XVI-10 can be synthesized according to the methods described in Scheme I. The Boc protecting group of XVI-10 can be removed by acid treatment (trifluoroacetic acid, HCl, etc. . . . ) to provide XVI-11. The final product XVI-12 can then be prepared by treating XVI-11 with a suitable alkylating agent R—X (X═ halide, OTs, OMs, or OTf) and base.

    ##STR00048## ##STR00049##

    Methods for Chiral Separation

    [0248] Isolation of the individual enantiomers of compounds can be accomplished using one or more of the following chromatography methods, Separation Method A, Separation Method B and Separation Method C described below. In the following examples, the compound eluting first is referred to as Isomer I, while the second eluting compound is referred to as Isomer II.

    Separation Method A

    [0249] Column: YMC chiral Amylose-SA, 250 mm×20 mm, 5 micron

    Mobile Phase:

    [0250] A: n-Hexane+0.1% DEA

    B: DCM: MeOH (1:1)

    Isocratic: 30-90% B

    [0251] Flow rate: 18 mL/Min

    Separation Method B

    [0252] Column: DIACEL CHIRALPACK-IA, 250 mm×20 mm, 5 micron

    Mobile Phase:

    [0253] A: n-Hexane+0.1% DEA

    B: DCM: MeOH (1:1)

    [0254] Gradient: Hold 50% B till 4 min then 100% B at 5 min & hold up to 15 min
    Flow rate: 18 mL/Min

    Separation Method C

    [0255] Column: CHIRALPACK-IA, 250 mm×30 mm, 5 micron

    Mobile Phase:

    [0256] A: n-Hexane+0.1% DEA

    B: DCM: MeOH (1:1)

    Isocratic: 30-90% B

    [0257] Flow rate: 30 mL/Min

    Chiral Purity Determination

    [0258] Analysis of the level of chiral purity of the compounds can be evaluated using one or more the chromatography methods Chiral Purity Method A, Chiral Purity Method B and Chiral Purity Method C described below.

    Chiral Purity Method A

    [0259] Column: YMC chiral Amylose-SA, 250 mm×4.6 mm, 5 micron

    Mobile Phase:

    [0260] A: n-Hexane+0.1% DEA

    B: DCM: MeOH (1:1)

    Isocratic: 30-90% B

    [0261] Flow rate: 1 mL/Min

    Chiral Purity Method B

    [0262] Column: YMC chiral art cellulose-SC, 250 mm×4.6 mm, 5 micron

    Mobile Phase:

    [0263] A: n-Hexane+0.1% DEA

    B: DCM: MeOH (1:1)

    Isocratic: 30-90% B

    [0264] Flow rate: 1 mL/Min

    Chiral Purity Method C

    [0265] Column: CHIRALPACK-IA, 250 mm×4.6 mm, 5 micron

    Mobile Phase:

    [0266] A: n-Hexane+0.1% DEA

    B: DCM: MeOH (1:1)

    Isocratic: 30-90% B

    [0267] Flow rate: 30 mL/Min

    General Synthetic Methods

    Method A

    [0268] To a stirred solution of 1 equivalent of methyl ketone (I-1), in dry THF (10 volumes per gram of methyl ketone) at −78° C. under an Argon atmosphere, was added lithium hexamethyldisilazide (1M in THF, 1.3 eq.). The mixture was stirred for 1 h, following which dimethyl oxalate (1.5 eq.) dissolved in dry THF (5 volumes per gram of dimethyl oxalate) was added dropwise and the resulting reaction mixture stirred at room temperature overnight. After completion, the mixture was concentrated under reduced pressure. The residue was diluted with water and the resulting was collected by filtration. The solid was washed with ethyl acetate followed by diethyl ether and dried under reduced pressure. The resulting diketoester (I-3) was used in the next step without further purification.

    Method B

    [0269] In a sealable tube, a stirred solution consisting of 1 equivalent of the 2, 4-diketoester, I-3 and 1 equivalent of sulfuric diamide in MeOH (10 volumes per gram of 2,4-diketoester) was purged with HCl gas for 2 h at 0° C. The tube was sealed, and the reaction stirred at 80° C. 24 h. After completion, the reaction mixture was cooled to 0° C. and the resulting precipitated solid was filtered, washed with water, cold methanol then dried in vacuo to afford 2H-1,2,6-thiadiazine 1,1-dioxide, 1-4.

    Method C

    [0270] In a round bottom flask fitted with reflux condenser, 2, 4-diketoester, 1-3, (1 eq.) and sulfuric diamide (1 eq.) was taken up in 4 N methanolic HCl (10 volumes per gram of I-3). The resulting reaction mixture was stirred at 60° C. for 16 h after which was cooled to 0° C., to form a precipitate. The precipitated solid was filtered, washed with water followed by diethyl ether and dried in vacuo to afford 2H-1,2,6-thiadiazine 1,1-dioxide, I-4.

    Method D

    [0271] To a stirred solution of 2H-1,2,6-thiadiazine 1,1-dioxide, I-4 (1 eq.) in dry DMF (8 volumes per gram of 2H-1,2,6-thiadiazine 1,1-dioxide, I-4) at 0° C. under an atmosphere of Ar, NaH (60% w/w in mineral oil, 1.5 eq.) was added and the resulting mixture stirred at 0° C. 45 min. MeI (1.1 eq.) was added slowly and the resulting reaction mixture stirred at room temperature for 12 h. After completion, the reaction mixture was diluted with ice cold water; to afford a solid which was collected by filtration. The solid was washed with diethyl ether and dried in vacuo to yield 2-methyl-2H-1,2,6-thiadiazine 1,1-dioxide, I-5, after silica gel column chromatography.

    Method E

    [0272] To a stirred solution of 2H-1,2,6-thiadiazine 1,1-dioxide, I-4 (1 eq.) in dry THF (4 volumes per gram of 2H-1,2,6-thiadiazine 1,1-dioxide, I-4) at 0° C. under an Ar atmosphere was added triphenyl phosphine (2 eq.) and methanol (10 eq.). The solution was stirred at 0° C. for 15 min. To this solution was added diethyl azodicarboxylate or diisopropyl azodicarboxylate (2 eq.) and the resulting reaction mixture was stirred at RT for 16 h. After completion, the reaction mixture was concentrated under vacuum and the resulting residue taken up in diethyl ether. The suspension was stirred for 30 min. and the solid isolated by filtration. The solid was stirred in methanol for 30 min., filtered and dried in vacuo to afford 2-methyl-2H-1,2,6-thiadiazine 1,1-dioxide, I-5. This intermediate could be further purified by column chromatography.

    Method F

    [0273] To a stirred solution of HN.sup.1R.sup.2 (3 eq.) in dichloromethane or toluene at 0° C. under Ar atmosphere, was added AlMe.sub.3 (2M in toluene, 3 eq.) and the reaction mixture was stirred at 0° C. for 10 min. The reaction was allowed to warm to RT and stirring continued for 1 h. To this solution, was added 2-methyl-2H-1,2,6-thiadiazine 1,1-dioxide, I-5 (1 eq.), at 0° C. under Ar atmosphere. The resulting mixture was heated to refluxed and stirred overnight. After completion, the reaction mixture was cooled to 0° C. then slowly quenched by the addition of 1N HCl. The mixture was extracted with dichloromethane and the combined organic layers were collected, dried over anhydrous sodium sulphate and concentrated in vacuo. The crude compound was purified by silica gel column chromatography followed by trituration with diethyl ether to afford intermediate I-7.

    Method G

    [0274] To a solution of 2-methyl-2H-1,2,6-thiadiazine 1,1-dioxide, I-5 (1 eq.) in 1:1 CH.sub.3CN: H.sub.2O (10 volumes per gram of 2-methyl-2H-1,2,6-thiadiazine 1,1-dioxide, 1-5) at 0° C. was added triethylamine (5 eq.) and the resulting reaction mixture was stirred until a clear solution was observed (4-6 h). After completion, the mixture was concentrated under reduced pressure, and the resulting residue treated with 6N HCl followed by extraction with ethyl acetate. The combined organic layers were dried over anhydrous sodium sulphate, filtered and concentrated under reduced pressure to afford carboxylic acid I-6 which was used in the next step after trituration with diethyl ether. To a stirred solution of carboxylic acid, I-6 (1 eq.) in CH.sub.2Cl.sub.2 or DMF (10 volumes per gram of I-6) at 0° C. was added diisopropylethylamine (2 eq.). After stirring for 15 min, 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium-3-oxide hexafluorophosphate (2 eq.), was added and stirring continued for 15 min after which HNR.sup.1R.sup.2 (1.2 eq.) was added. The reaction mixture was then stirred at room temperature overnight. After completion, the reaction mixture was diluted with ice cold water and extracted with CH.sub.2Cl.sub.2. The combined organic layers were dried over anhydrous sodium sulphate and concentrated under reduced pressure to afford the crude product. The crude compound was taken up in methanol (10 volumes per gram of crude product), stirred for 15 min., filtered and dried under reduced pressure to yield compound desired I-7.

    Method H

    [0275] To a stirred solution of compound intermediate I-7 (1 eq.) in EtOH/MeOH at 0° C. under Ar atmosphere was added NaBH.sub.4 (2 eq.) and the reaction stirred at room temperature for 1-2 h. After completion, the reaction mixture was concentrated in vacuo, the residue obtained was diluted with water and extracted using ethyl acetate. The combined organic layers were collected, dried over anhydrous sodium sulphate, filtered, concentrated in vacuo and purified by silica gel column chromatography to afford the 1-9.

    Method I

    [0276] A mixture of a bromine substituted compound (1 eq.), boronic acid/boronate ester (1 eq.) in 1, 4-dioxane, and 2.5 eq. of 2M solution of potassium phosphate, was purged with Ar for 15 min, after which tetrakistriphenyl phosphine palladium (0.06 eq.) was added and the reaction stirred at 90° C. overnight. After completion, the reaction mixture was filtered through Celite and evaporated to dryness. The residue was taken up in ethyl acetate, washed with water, followed by brine, then dried over anhydrous sodium sulfate and the solvent removed under reduced pressure. The crude product was purified by column chromatography or preparative HPLC to afford IV-9.

    Method J

    [0277] A mixture of 5-(3-bromophenyl)-N-(3-chloro-4-fluorophenyl)-2-methyl-2H-1,2,6-thiadiazine-3-carboxamide 1,1-dioxide (1 eq.), HNR.sup.aR.sup.b (1.2 eq) in DMSO (10 volumes per gram of 5-(3-bromophenyl)-N-(3-chloro-4-fluorophenyl)-2-methyl-2H-1,2,6-thiadiazine-3-carboxamide 1,1-dioxide), K.sub.3PO.sub.4 (3 eq), CuI (0.2 eq) and L-proline (0.4 eq) was purged with Ar for 15 min. The reaction mixture was then stirred at 80° C. overnight. After completion, the reaction mixture was concentrated in vacuo, the residue obtained was diluted with water and extracted using ethyl acetate. The combined organic layers were collected, dried over anhydrous sodium sulphate, filtered, concentrated in vacuo and purified by silica gel column chromatography to afford VII-1.

    Intermediates 1-6

    [0278] The compounds in Table 1 were synthesized according to the method listed in the column titled Method.

    TABLE-US-00001 TABLE 1 Intermediate Method Structure, 1 A [00050]embedded image   Methyl 4-(3-bromophenyl)-2,4- dioxobutanoate' LCMS Calculated for C.sub.11H.sub.9BrO.sub.4; 283.97. Found: 286.8 (M + 2). 2 C [00051]embedded image   Methyl 5-(3-bromophenyl)-2H-1,2,6- thiadiazine-3-carboxylate 1,1-dioxide. LCMS Calculated for C.sub.11H.sub.9BrN.sub.2O.sub.4S; 343.95. Found: 344.9 (M + 1). 3 E [00052]embedded image   Methyl 5-(3-bromophenyl)-2-methyl- 2H-1,2,6-thiadiazine-3- carboxylate 1,1-dioxide. LCMS Calculated for C.sub.12H.sub.11BrN.sub.2O.sub.4S: 357.96. Found; (M + 1). 4 A [00053]embedded image   Methyl 4-(furan-2-yl)-2,4- dioxobutanoate. LCMS Calculated for C.sub.9H.sub.8O.sub.5: 196.04; Found: 197 (M + 1). 5 C [00054]embedded image   Methyl 5-(furan-2-yl)-2H-1,2,6- thiadiazine-3-carboxylate 1,1-dioxide. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ 8.03 (s, 1H), 7.49 (d, J = 4.0 Hz, 1H), 7.19- 7.05 (m, 1H), 6.83 (s, 1H), 6.77- 6.75 (m, 1H), 3.86 (s, 3H); LCMS Calculated for C.sub.9H.sub.8N.sub.2O.sub.5S: 256.02. Found 256.9 (M + 1). 6 E [00055]embedded image   Methyl 5-(furan-2-yl)-2-methyl- 2H-1,2,6-thiadiazine-3-carboxylate 1,1-dioxide. .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ 8.17 (s, 1H), 7.75 (d, J = 3.6 Hz, 1H), 7.75 (d, J = 1.2 Hz, 1H), 6.86-6.85 (m, 1H), 3.93 (s, 3H), 3.51 (s, 3H); LCMS Calculated for C.sub.10H.sub.10N.sub.2O.sub.5S; 270.03. Found 270.9 (M + 1).

    Intermediates 7-8

    [0279] Intermediate 7, in Table 2 was synthesized according from methyl 5-(3-bromophenyl)-2-methyl-2H-1,2,6-thiadiazine-3-carboxylate 1,1-dioxide and methanol using method F. Intermediates 8 and 9 were isolated by chiral separation of racemic intermediate 7.

    TABLE-US-00002 TABLE 2 Inter- mediate Structure, 7 [00056]embedded image   5-(3-Bromophenyl)-N-(3-chloro-4-fluorophenyl)-2-methyl- 2H-1,2,6-thiadiazine-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.56 (s, 1H), 7.97-7.94 (m, 1H), 7.67 (s, 1H), 7.58-7.52 (m, 3H), 7.48-7.46 (m, 1H), 7.42-7.33 (m, 2H), 4.61-4.59 (m, 1H), 4.30-4.26 (m, 1H), 2.64 (s, 3H), 2.13- 2.02 (m, 2H). LCMS Calculated for C.sub.17H.sub.16BrClFN.sub.3O.sub.3S; 474.98. Found; 477.95 (M + 2) 8 [00057]embedded image   (3S,5R)-5-(3-bromophenyl)-N-(3-chloro-4-fluorophenyl)- 2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.56 (s, 1H), 7.96 (dd, J = 7.2, 2.8 Hz, 1H), 7.69-7.67 (m, 1H), 7.58-7.51 (m, 3H), 7.48- 7.45 (m, 1H), 7.42-7.33 (m, 2H), 4.63-4.58 (m, 1H), 4.29-4.25 (m, 1H), 2.64 (s, 3H), 2.13-1.98 (m, 2H). LCMS Calculated for C.sub.17H.sub.16BrClFN.sub.3O.sub.3S; 474.98. Found; 478.45 (M + 2) 9 [00058]embedded image   (3R,5S)-5-(3-bromophenyl)-N-(3-chloro-4-fluorophenyl)- 2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.56 (s, 1H), 7.96 (dd, J = 6.8, 2.4 Hz, 1H), 7.69-7.67 (m, 1H), 7.56-7.52 (m, 3H), 7.48- 7.46 (m, 1H), 7.42-7.33 (m, 2H), 4.61-4.58 (m, 1H), 4.30-4.26 (m, 1H), 2.64 (s, 3H), 2.13-1.99 (m, 2H). LCMS Calculated for C.sub.17H.sub.16BrClFN.sub.3O3S; 474.98. Found; 476.55 (M + 1)

    Intermediate 10

    [0280] ##STR00059##

    N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide

    [0281] To a mixture of 5-(3-bromophenyl)-N-(3-chloro-4-fluorophenyl)-2-methyl-2H-1,2,6-thiadiazine-3-carboxamide 1,1-dioxide (3 g, 6.29 mmol) and bis(pinacolato) diboron (1.91 g, 7.54 mmol) in 1,4-dioxane (30 mL), was added potassium acetate (1.82 g, 18.87 mmol) and the mixture purged with Ar for 15 min. To this was added [1,1′-bis(diphenylphosphino)ferrocene]dichloropalladium(II) CH.sub.2Cl.sub.2 complex, PdCl.sub.2(dppf)-CH.sub.2Cl.sub.2, (0.506 g, 0.629 mmol) was added and the reaction mixture stirred at 90° C. overnight. After completion, the reaction mixture was filtered through a pad of Celite and evaporated to dryness. The residue was diluted with water and extracted with ethyl acetate. The combined organic layers were dried over anhydrous sodium sulphate and concentrated under reduced pressure to afford 2.12 grams of the title compound which was used in the next step after trituration with pentane and diethyl ether.

    Stereochemistry of the Examples

    [0282] The absolute stereochemistry of all other sets of enantiomers were assigned based on the crystal structure determination of HBV-CSU-016 Isomer I. In each case one of the stereoisomers of the pair was significantly more active activity and was assigned the same absolute stereochemistry (3S,5R) as HBV-CSU-016-Isomer-I.

    [0283] The synthesis of HBV-CSU-016 Isomer I is illustrated in Scheme XII. Advanced intermediate XII-6 was synthesized using the general synthetic methods provided above and listed in the Scheme. HBV-CSU-016 Isomer I was isolated by chiral chromatography.

    ##STR00060## ##STR00061##

    [0284] Intermediate XII-2

    ##STR00062##

    Methyl 2, 4-dioxo-4-(thiophen-2-yl)butanoate

    [0285] TLC: 10% MeOH/DCM (R.sub.f. 0.1); .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ 7.68 (d, J=5.2 Hz, 1H), 7.61 (d, J=4.4 Hz, 1H), 7.10 (t, J=5.2 Hz, 1H), 6.34 (s, 1H), 3.69 (s, 3H); LCMS Calculated for C.sub.9H.sub.8O.sub.4S: 212.01; Observed: 212.95 (M+1)

    Intermediate XII-3

    [0286] ##STR00063##

    Methyl 5-(thiophen-2-yl)-2H-1,2,6-thiadiazine-3-carboxylate 1,1-dioxide

    [0287] TLC: 20% MeOH/DCM (R.sub.f. 0.1); .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ 11.50 (br.s, 1H), 8.06 (d, J=4.0 Hz, 1H), 7.93 (d, J=5.2 Hz, 1H), 7.23 (t, J=4.0 Hz, 1H), 6.99 (s, 1H), 3.87 (s, 3H); LCMS Calculated for C.sub.9H.sub.8N.sub.2O.sub.4S.sub.2: 271.99; LCMS observed: 272.85 (M+1).

    Intermediate XII-4

    [0288] ##STR00064##

    Methyl 2-methyl-5-(thiophen-2-yl)-2H-1,2,6-thiadiazine-3-carboxylate 1,1-dioxide

    [0289] TLC: 40% EtOAc/hexanes (R.sub.f. 0.4); .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ 8.23 (d, J=4.0 Hz, 1H), 8.10 (d, J=4.8 Hz, 1H), 7.32-7.30 (m, 2H), 3.94 (s, 3H), 3.50 (s, 3H); LCMS Calculated for C.sub.10H.sub.10N.sub.2O.sub.4S.sub.2: 286.01; LCMS observed: 286.94 (M+1).

    Intermediate XII-5

    [0290] ##STR00065##

    N-(3-Bromo-4-fluorophenyl)-2-methyl-5-(thiophen-2-yl)-2H-1,2,6-thiadiazine-3-carboxamide 1,1-dioxide

    [0291] .sup.1H-NMR (DMSO-d6, 400 MHz): δ 11.29 (s, 1H), 8.25 (d, J=3.6 Hz, 1H), 8.11-8.09 (m, 2H), 7.71-7.67 (m, 1H), 7.47 (t, J=8.0 Hz, 1H), 7.34-7.32 (m, 1H), 7.19 (s, 1H), 3.45 (s, 3H). LCMS Calculated for C.sub.15H.sub.11BrFN.sub.3O.sub.3S.sub.2: 442.94; LCMS observed: 445.65 (M+2)

    Intermediate XII-6

    [0292] ##STR00066##

    N-(3-Bromo-4-fluorophenyl)-2-methyl-5-(thiophen-2-yl)-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide

    [0293] .sup.1H-NMR (DMSO-d6, 400 MHz): δ 10.55 (s, 1H), 8.10 (dd, J=6.4, 2.6 Hz, 1H), 7.71-7.54 (m, 2H), 7.52 (d, J=5.3 Hz, 1H), 7.37 (t, J=8.8 Hz, 1H), 7.15-7.14 (m, 1H), 7.03-7.01 (m, 1H), 4.85-4.74 (m, 1H), 4.30 (dd, J=11.7, 3.0 Hz, 1H), 2.61 (s, 3H), 2.29-2.08 (m, 2H). LCMS Calculated for C.sub.15H.sub.15BrFN.sub.3O.sub.3S.sub.2: 446.97; LCMS observed: 449.90 (M+1)

    HBV-CSU-016 Isomer I

    [0294] ##STR00067##

    (3S,5R)—N-(3-Bromo-4-fluorophenyl)-2-methyl-5-(thiophen-2-yl)-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide

    [0295] .sup.1H-NMR (DMSO-d.sub.6, 400 MHz): δ 10.55 (s, 1H), 8.09-8.06 (m, 1H), 7.68-7.66 (m, 1H), 7.62-7.58 (m, 1H), 7.51-7.49 (m, 1H), 7.36 (t, J=8.8 Hz, 1H), 7.14-7.13 (m, 1H), 7.02-7.00 (m, 1H), 4.80-4.76 (m, 1H), 4.29-4.25 (m, 1H), 2.60 (s, 3H), 2.31-2.08 (m, 2H). LCMS Calculated for C.sub.15H.sub.15BrFN.sub.3O.sub.3S.sub.2: 446.97; LCMS observed: 449.90 (M+1)

    Single Crystal X-Ray Structure of HBV-CSU-016 Isomer I

    [0296] The Crystal structure of HBV-CSU-016-Isomer-I is shown in FIG. 1. Displacement ellipsoids are drawn at the 30% probability level and H atoms are shown as small spheres of arbitrary radii. Dashed line indicates hydrogen bond. The Crystal data and structure refinement for HBV-CSU-016-Isomer-I are as follows:

    TABLE-US-00003 Identification code SAP-MA1703-08(isomer-1) (IICT file code: KA84_0m) Empirical formula C.sub.15H.sub.15BrF N.sub.3O.sub.3S.sub.2 Formula weight 448.33 Temperature 100(2) K Wavelength 0.71073 Å Crystal system Monoclinic Space group P2.sub.1 Unit cell dimensions a = 5.001(6) Å α = 90° b = 25.63(3) Å β = 94.240(19)° c = 13.390(16) Å γ = 90° Volume 1712(4) Å.sup.3 Z 4 Density (calculated) 1.740 Mg/m.sup.3 Absorption coefficient 2.676 mm.sup.−1 F(000) 904 Crystal size 0.310 × 0.240 × 0.190 mm.sup.3 θ range for data collection 2.830 to 28.374°. Index ranges −6 <= h <= 6, −34 <= k <= 34, −17 <= l <= 17 Reflections collected 50333 Independent reflections 8467 [R(int) = 0.0361] Completeness to θ = 25.242° 99.8% Refinement method Full-matrix least-squares on F.sup.2 Data/restraints/parameters 8467/1/469 Goodness-of-fit on F.sup.2 1.022 Final R indices [I > 2σ(I)] R1 = 0.0265, wR2 = 0.0596 R indices (all data) R1 = 0.0313, wR2 = 0.0610 Absolute structure parameter 0.034 (2) Largest diff. peak and hole 0.311 and −0.513 e.Å.sup.−3 Measurement Bruker D8 QUEST PHOTON-100 Detector Software Used SHELXTL-PLUS

    [0297] The absolute stereochemistry at each chiral center was assigned using the PLATON computer application as described by A. L. Spek in J. APPL. CRYST. 36, 7-13, 2003. The designated chiral centers are: [0298] C(1A) Chiral: R [0299] C(1B) Chiral: R [0300] C(3A) Chiral: S [0301] C(3B) Chiral: S

    [0302] The absolute stereochemistry of all other sets of enantiomers were assigned based on this crystal structure determination. In each case only one of the stereoisomers of the pair had significant activity and the active isomer was assigned the same stereochemistry as HBV-CSU-016-Isomer-I.

    Example 1

    [0303] ##STR00068##

    N-(3-Chloro-4-fluorophenyl)-5-(furan-2-yl)-2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide

    [0304] The title compound was synthesized from N-(3-chloro-4-fluorophenyl)-5-(furan-2-yl)-2-methyl-2H-1,2,6-thiadiazine-3-carboxamide 1,1-dioxide (intermediate 7) via Method H provided 5.7 g (70.54%, yield) of product as a white solid. TLC: 50% EtOAc/hexanes (R.sub.f. 0.7); .sup.1H NMR (DMSO-d.sub.6, 400 MHz): δ 10.55 (s, 1H), 7.97 (dd, J=6.9, 2.6 Hz, 1H), 7.66 (s, 1H), 7.63-7.51 (m, 2H), 7.40 (t, J=9.1 Hz, 1H), 6.46-6.45 (m, 2H), 4.65-4.64 (m, 1H), 4.30-4.26 (m, 1H), 2.60 (s, 3H), 2.23-2.02 (m, 2H); LCMS Calculated for C.sub.15H.sub.15ClFN.sub.3O.sub.4S; 387.05. Found: 387.90 (M+1).

    Intermediate 11

    [0305] ##STR00069##

    Cis-5-((3-Chloro-4-fluorophenyl)carbamoyl)-6-methyl-1,2,6-thiadiazinane-3-carboxylic acid 1,1-dioxide

    [0306] To a stirred solution of N-(3-chloro-4-fluorophenyl)-5-(furan-2-yl)-2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide (5.6 g, 14.43 mmol) in acetone:water (1:1,200 mL), was added KMnO.sub.4 (15.96 g, 101.01 mmol) (exotherm observed) slowly and the mixture heated at 60° C. for 3 h. Following this, the reaction mixture was cooled to ambient temperature and isopropyl alcohol (100 mL) added. This mixture was stirred for 18 h and then filtered through a Celite pad and washed with isopropyl alcohol. The filtrate was evaporated, the residue was dissolved in 1N NaOH and the solution was washed with diethyl ether. The basic layer was acidified with 1N HCl and solid NaCl was added. The resulting suspension was extracted with ethyl acetate. The organic extracts were collected, dried over anhydrous sodium sulphate and concentrated in vacuo. The solid was washed with CH.sub.2Cl.sub.2 and dried in vacuo to afford 3 grams of the title compound (57.03%) as a white solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 13.00 (br.s, 1H), 10.52 (s, 1H), 7.95 (dd, J=6.8, 2.4 Hz, 1H), 7.57-7.52 (m, 1H), 7.41-7.36 (m, 2H), 4.25-4.21 (m, 1H), 4.15-4.10 (m, 1H), 2.55 (s, 3H), 2.07-2.03 (m, 1H), 1.96-1.86 (m, 1H). LCMS Calculated for C.sub.12H.sub.13ClFN.sub.3O.sub.5S; 365.02. Found; 366 (M+1.).

    Examples 2-18

    [0307] The compounds in Table 3 were synthesized from 5-(3-bromophenyl)-N-(3-chloro-4-fluorophenyl)-2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide (Intermediate 7) and readily available boronic acid or boronate ester using the procedure described in Method I. Isomers I and II were isolated from the racemic parent using the chiral separation procedures. Alternatively, Isomers I and II can be directly synthesized from Intermediate 8 and Intermediate 9 using Method I.

    TABLE-US-00004 TABLE 3 Example Structure, .sup.1H NMR and Mass Spec.  2 [00070]embedded image 5-([1,1-Biphenyl]-3-yl)-N-(3-chloro-4-fluorophenyl)-2-methyl-1,2,6- thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1 H NMR (400 MHz, DMSO-d.sub.6): δ 10.57 (s, 1H), 7.97-7.95 (m, 1H), 7.78 (s, 1H), 7.72-7.70 (m, 2H), 7.64-7.61 (m, 2H), 7.56-7.52 (m, 1H), 7.48-7.41 (m, 4H), 7.40-7.36 (m, 2H), 4.69-4.67 (m, 1H), 4.31-4.27 (m, 1H), 2.66 (s, 3H), 2.17-2.07 (m, 2H). LCMS calculated for, C.sub.23H.sub.21ClFN.sub.3O.sub.2; 473.10. Found: 474.1 (M + 1). 2-Isomer I [00071]embedded image (3S,5R)-5-([1,1′-Biphenyl]-3-yl)-N-(3-chloro-4-fluorophenyl)-2-methyl- 1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.56 (s, 1H), 7.97-7.95 (m, 1H), 7.79-7.75 (m, 1H), 7.73-7.30 (m, 2H), 7.64-7.60 (m, 2H), 7.57-7.53 (m, 1H), 7.50-7.43 (m, 4H), 7.42-7.36 (m, 2H), 4.69-4.66 (m, 1H), 4.31-4.26 (m, 1H), 2.66 (s, 3H), 2.17-2.12 (m, 2H). LCMS calculated for, C.sub.23H.sub.21ClFN.sub.3O.sub.3S; 473.10. Found: 472.1 (M − 1). 2-Isomer II [00072]embedded image (3R,5S)-5-([1,1′-Biphenyl]-3-yl)-N-(3-chloro-4-fluorophenyl)-2-methyl- 1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): 10.57 (s, 1H), 7.97-7.94 (m, 1H), 7.79-7.78 (m, 1H), 7.72-7.70 (m, 2H), 7.63-7.60 (m, 2H), 7.57-7.53 (m, 1H), 7.50-7.53 (m, 4H), 7.42-7.36 (m, 2H), 4.69-4.66 (m, 1H), 4.31-4.27 (m, 1H), 2.66 (s, 3H), 2.17-2.12 (m, 2H). LCMS calculated for, C.sub.23H.sub.21ClFN.sub.3O.sub.3S; 473.10. Found: 474.1 (M + 1).  3 [00073]embedded image N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(3-(2-methylpyridin-4- yl)phenyl)-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.59 (s, 1H), 8.50 (d, J = 5.2 Hz 1H), 7.98-7.95 (m, 1H), 7.90-7.88 (m, 1H), 7.76-7.74 (m, 1H), 7.65-7.63 (m, 2H), 7.54-7.50 (m, 4H), 7.39 (t, J = 9.2 Hz, 1H), 4.70-4.68 (m, 1H), 4.30-4.26 (m, 1H), 2.67 (s, 3H), 2.54 (s, 3H), 2.17-2.13 (m, 2H). LCMS calculated for, C.sub.23H.sub.22ClFN.sub.4O.sub.3S; 488.11. Found: (M + 1). 3-Isomer I [00074]embedded image (3S,5R)-N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(3-(2-methylpyridin-4- yl)phenyl)-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.58 (s, 1H), 8.51 (d, J = 5.2 Hz, 1H), 7.97-7.95 (m, 1H), 7.90-7.88 (m, 1H), 7.76-7.74 (m, 1H), 7.63-7.62 (m, 2H), 7.54-7.50 (m, 4H), 7.42-7.37 (m, 1H), 4.70-4.68 (m, 1H), 4.30-4.26 (m, 1H), 2.66 (s, 3H), 2.54 (s, 3H), 2.17-2.15 (m, 2H). LCMS calculated for, C.sub.23H.sub.22ClFN.sub.4O.sub.3S; 488.11. Found: (M + 1). 3-Isomer II [00075]embedded image (3R,5S)-N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(3-(2-methylpyridin-4- yl)phenyl)-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.58 (s, 1H), 8.51 (d, J = 5.2 Hz, 1H), 7.97-7.94 (m, 1H), 7.90-7.88 (m, 1H), 7.76-7.74 (m, 1H), 7.63-7.62 (m, 2H), 7.54-7.50 (m, 4H), 7.40 (t, J = 9.2 Hz, 1H), 4.70-4.68 (m, 1H), 4.30-4.26 (m, 1H), 2.67 (s, 3H), 2.54 (s, 3H), 2.17-2.15 (m, 2H). LCMS calculated for, C.sub.23H.sub.22ClFN.sub.4O.sub.3S; 488.11. Found: (M + 1).  4 [00076]embedded image N-(3-Chloro-4-fluorophenyl)-5-(4′-cyano-[1,1′-biphenyl]-3-yl)-2-methyl- 1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.56 (s, 1H), 7.97-7.94 (m, 5H), 7.88 (s, 1H), 7.73-7.72 (m, 1H), 7.63-7.60 (m, 1H), 7.56-7.52 (m, 3H), 7.39 (t, J = 9.2 Hz, 1H), 4.70-4.68 (m, 1H), 4.30-4.27 (m, 1H), 2.66 (s, 3H), 2.17-2.12 (m, 2H). LCMS calculated for, C.sub.24H.sub.20ClFN.sub.4O.sub.3S; 498.09. Found: 499.2 (M + 1). 4-Isomer I [00077]embedded image (3S,5R)-N-(3-Chloro-4-fluorophenyl)-5-(4′-cyano-[1,1′-biphenyl]-3-yl)-2- methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.58 (s, 1H), 7.97-7.94 (m, 5H), 7.88-7.87 (m, 1H), 7.73- 7.71 (m, 1H), 7.65-7.62 (m, 1H), 7.56-7.52 (m, 3H), 7.39 (t, J = 8.8 Hz, 1H), 4.72-4.66 (m, 1H), 4.30-4.26 (m, 1H), 2.66 (s, 3H), 2.17-2.11 (m, 2H). LCMS calculated for, C.sub.24H.sub.20ClFN.sub.4O.sub.3S; 498.09. Found: 499.1 (M + 1). 4-Isomer II [00078]embedded image (3R,5S)-N-(3-Chloro-4-fluorophenyl)-5-(4′-cyano-[1,1′-biphenyl]-3-yl)-2- methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.58 (s, 1H), 7.97-7.94 (m, 5H), 7.88-7.87 (m, 1H), 7.73- 7.71 (m, 1H), 7.65-7.62 (m, 1H), 7.56-7.52 (m, 3H), 7.39 (t, J = 8.8 Hz, 1H), 4.70-4.66 (m, 1H), 4.30-4.26 (m, 1H), 2.66 (s, 3H), 2.17-2.12 (m, 2H). LCMS calculated for, C.sub.24H.sub.20ClFN.sub.4O.sub.3S; 498.09. . Found: 497.2 (M − 1).  5 [00079]embedded image 5-(2′-Chloro-4′-fluoro-[1,1′-biphenyl]-3-yl)-N-(3-Chloro-4-fluorophenyl)- 2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.57 (s, 1H), 7.97-7.95 (m, 1H), 7.59-7.45 (m, 7H), 7.42- 7.31 (m, 3H), 4.66-4.63 (m, 1H), 4.31-4.27 (m, 1H), 2.64 (s, 3H), 2.17-2.11 (m, 2H). LCMS calculated for, C.sub.23H.sub.19Cl.sub.2F.sub.2N.sub.3O.sub.3S; 525.05. Found: 524.1 (M − 1). 5-Isomer I [00080]embedded image (3S,5R)-5-(2′-Chloro-4′-fluoro-[1,1′-biphenyl]-3-yl)-N-(3-Chloro-4- fluorophenyl)-2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.56 (s, 1H), 7.97-7.94 (m, 1H), 7.59-7.45 (m, 6H), 7.42-7.30 (m, 4H), 4.66-4.65 (m, 1H), 4.30-4.27 (m, 1H), 2.64 (s, 3H), 2.17-2.11 (m, 2H). LCMS calculated for, C.sub.23H.sub.19Cl.sub.2F.sub.2N.sub.3O.sub.3S; 525.05. Found: 526.1 (M + 1). 5-Isomer II [00081]embedded image (3R,5S)-5-(2′-Chloro-4′-fluoro-[1,1′-biphenyl]-3-yl)-N-(3-Chloro-4- fluorophenyl)-2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.56 (s, 1H), 7.97-7.94 (m, 1H), 7.59-7.45 (m, 6H), 7.42-7.30 (m, 4H), 4.66-4.65 (m, 1H), 4.31-4.27 (m, 1H), 2.64 (s, 3H), 2.17-2.05 (m, 2H). LCMS calculated for, C.sub.23H.sub.19Cl.sub.2F.sub.2N.sub.3O.sub.3S; 525.05. Found: 526.1 (M + 1).  6 [00082]embedded image 5-(2′-Chloro-4′-methyl-[1,1′-biphenyl]-3-yl)-N-(3-Chloro-4- fluorophenyl)-2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H-NMR (DMSO-d.sub.6, 400 MHz): δ 10.55 (s, 1H), 7.97-7.94 (m, 1H), 7.58- 7.52 (m, 2H), 7.50-7.44 (m, 3H), 7.42-7.37 (m, 3H), 7.34-7.31 (m, 1H), 7.26- 7.23 (m, 1H), 4.65-4.63 (m, 1H), 4.31-4.27 (m, 1H), 2.64 (s, 3H), 2.35 (s, 3H), 2.18-2.08 (m, 2H). LCMS calculated for, C.sub.24H.sub.22Cl.sub.2FN.sub.3O.sub.3S; 521.07. Found: 522.1 (M + 1). 6-Isomer 1 [00083]embedded image (3S,5R)-5-(2′-chloro-4′-methyl-1,6-dihydro-[1,1′-biphenyl]-3-yl)-N-(3- Chloro-4-fluorophenyl)-2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1- dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.55 (s, 1H), 7.96 (dd, J = 6.8, 2.4 Hz, 1H), 7.59-7.52 (m, 2H), 7.50-7.44 (m, 3H), 7.42-7.37 (m, 3H), 7.34- 7.32 (m, 1H), 7.26-7.23 (m, 1H), 4.70-4.60 (m, 1H), 4.30-4.27 (m, 1H), 2.64 (s, 3H), 2.35 (s, 3H), 2.14-2.12 (m, 2H). LCMS calculated for, C.sub.24H.sub.22Cl.sub.2FN.sub.3O.sub.3S; 521.07. Found: 522.1 (M + 1). 6-Isomer II [00084]embedded image (3R,5S)-5-(2′-chloro-4′-methyl-[1,1′-biphenyl]-3-yl)-N-(3-Chloro-4- fluorophenyl)-2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.55 (s, 1H), 7.96 (dd, J = 6.8, 3.2 Hz, 1H), 7.59-7.52 (m, 2H), 7.50-7.44 (m, 3H), 7.42-7.37 (m, 3H), 7.34-7.32 (m, 1H), 7.25-7.23 (m, 1H), 4.66-4.60 (m, 1H), 4.31-4.27 (m, 1H), 2.64 (s, 3H), 2.36 (s, 3H), 2.14-2.11 (m, 2H). LCMS calculated for, C.sub.24H.sub.22Cl.sub.2FN.sub.3O.sub.3S; 521.07. Found: 522.1 (M + 1).  7 [00085]embedded image N-(3-Chloro-4-fluorophenyl)-5-(4′-isopropyl-[1,1′-biphenyl]-3-yl)-2- methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): 10.57 (s, 1H), 7.97-7.94 (m, 1H), 7.75 (s, 1H), 7.63-7.53 (m, 5H), 7.47-7.33 (m, 5H), 4.69-4.63 (m, 1H), 4.30-4.26 (m, 1H), 2.97-2.89 (m, 1H), 2.66 (s, 3H), 2.16-2.13 (m, 2H), 1.23 (d, J = 6.8 Hz, 6H). LCMS calculated for, C.sub.26H.sub.27ClFN.sub.3O.sub.3S; 515.14. Found: 516.1 (M + 1). 7-Isomer I [00086]embedded image (3S,5R)-N-(3-Chloro-4-fluorophenyl)-5-(4′-isopropyl-[1,1′-biphenyl]-3- yl)-2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.57 (s, 1H), 7.97-7.95 (m, 1H), 7.75 (s, 1H), 7.63-7.53 (m, 5H), 7.50-7.33 (m, 5H), 4.67-4.65 (m, 1H), 4.30-4.26 (m, 1H), 2.97-2.89 (m, 1H), 2.66 (s, 3H), 2.16-2.14 (m, 2H), 1.23 (d, J = 6.4 Hz, 6H). LCMS calculated C.sub.26H.sub.27ClFN.sub.3O.sub.3S; 515.14. Found: 516.1 (M + 1). 7-Isomer II [00087]embedded image (3R,5S)-N-(3-Chloro-4-fluorophenyl)-5-(4′-isopropyl-[1,1′-biphenyl]-3- yl)-2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.57 (s, 1H), 7.97-7.95 (m, 1H), 7.75 (s, 1H), 7.64-7.52 (m, 5H), 7.47-7.33 (m, 5H), 4.69-4.63 (m, 1H), 4.31-4.27 (m, 1H), 2.97-2.90 (m, 1H), 2.66 (s, 3H), 2.19-2.11 (m, 2H), 1.23 (d, J = 6.8 Hz, 6H). LCMS calculated for, C.sub.26H.sub.27ClFN.sub.3O.sub.3S; 515.14. Found: 516.1 (M + 1).  8 [00088]embedded image N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(3′-(trifluoromethyl)-[1,1′- biphenyl]-3-yl)-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.58 (s, 1H), 8.05-8.03 (m, 2H), 7.97-7.94 (m, 1H), 7.88 (s, 1H), 7.76-7.72 (m, 3H), 7.63 (d, J = 9.2 Hz, 1H), 7.56-7.50 (m, 3H), 7.39 (t, J = 8.8 Hz, 1H), 4.71-4.67 (m, 1H), 4.29-4.25 (m, 1H), 2.67 (s, 3H), 2.17-2.14 (m, 2H). LCMS calculated for, C.sub.24H.sub.20ClF.sub.4N.sub.3O.sub.3S; 541.09. Found: 542 (M + 1). 8-Isomer I [00089]embedded image (3S,5R)-N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(3′-trifluoromethyl)- [1,1′-biphenyl]-3-yl)-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.58 (s, 1H), 8.05-8.03 (m, 2H), 7.96 (dd, J = 6.8, 2.4 Hz, 1H), 7.88-7.87 (m, 1H), 7.76-7.70 (m, 3H), 7.65-7.62 (m, 1H), 7.56-7.50 (m, 3H), 7.39 (t, J = 8.8 Hz, 1H), 4.74-4.67 (m, 1H), 4.29-4.25 (m, 1H), 2.66 (s, 3H), 2.17-2.13 (m, 2H). LCMS calculated for, C.sub.24H.sub.20ClF.sub.4N.sub.3O.sub.3S; 541.09. Found: 542 (M + 1). 8-Isomer II [00090]embedded image (3R,5S)-N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(3′-(trifluoromethyl)- [1,1′-biphenyl]-3-yl)-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.58 (s, 1H), 8.05-8.03 (m, 2H), 7.96 (dd, J = 6.8, 2.4 Hz, 1H), 7.88-7.87 (m, 1H), 7.76-7.71 (m, 3H), 7.65-7.61 (m, 1H), 7.56-7.50 (m, 3H), 7.39 (t, J = 9.2 Hz, 1H), 4.73-4.67 (m, 1H), 4.29-4.25 (m, 1H), 2.66 (s, 3H), 2.17-2.13 (m, 2H). LCMS calculated for, C.sub.24H.sub.20ClF.sub.4N.sub.3O.sub.3S; 541.09. Found: 542.1 (M + 1).  9 [00091]embedded image N-(3-Chloro-4-fluorophenyl)-5-(3′,4′-dichloro-[1,1′-biphenyl]-3-yl)-2- methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.59 (s, 1H), 8.02 (s, 1H), 7.97-7.94 (m, 1H), 7.84 (s, 1H), 7.74-7.69 (m, 3H), 7.63-7.61 (m, 1H), 7.55-7.49 (m, 3H), 7.40 (t, J = 8.8 Hz, 1H), 4.69-4.67 (m, 1H), 4.29-4.25 (m, 1H), 2.66 (s, 3H), 2.16-2.14 (m, 2H). LCMS calculated for, C.sub.23H.sub.19Cl.sub.3FN.sub.3O.sub.3S; 541.02. Found: 543.90 (M + 2). 9-Isomer I [00092]embedded image (3S,5R)-N-(3-Chloro-4-fluorophenyl)-5-(3′,4′-dichloro-[1,1′-biphenyl]-3- yl)-2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.58 (s, 1H), 8.02 (s, 1H), 7.97-7.94 (m, 1H), 7.85 (s, 1H), 7.74-7.68 (m, 3H), 7.62-7.60 (m, 1H), 7.56-7.49 (m, 3H), 7.39 (t, J = 8.8 Hz, 1H), 4.70-4.67 (m, 1H), 4.29-4.25 (m, 1H), 2.66 (s, 3H), 2.20-2.07 (m, 2H). LCMS calculated for, C.sub.23H.sub.19Cl.sub.3N.sub.3O.sub.3S; 541.02. Found: 544 (M + 2). 9-Isomer II [00093]embedded image (3R,5S)-N-(3-Chloro-4-fluorophenyl)-5-(3′,4′-dichloro-[1,1′-biphenyl]-3- yl)-2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.58 (s, 1H), 8.02 (s, 1H), 7.97-7.95 (m, 1H), 7.85 (s, 1H), 7.74-7.69 (m, 3H), 7.62-7.60 (m, 1H), 7.55-7.49 (m, 3H), 7.39 (t, J = 8.8 Hz, 1H), 4.69-4.67 (m, 1H), 4.29-4.25 (m, 1H), 2.66 (s, 3H), 2.20-2.07 (m, 2H). LCMS calculated for, C.sub.23H.sub.19Cl.sub.3FN.sub.3O.sub.3S; 541.02. Found: 544 (M + 2). 10 [00094]embedded image N-(3-Chloro-4-fluorophenyl)-5-(4′-fluoro-3′-methyl-[1,1′-biphenyl]-3-yl)- 2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.57 (s, 1H), 7.96 (dd, J = 6.8, 2.4 Hz, 1H), 7.75-7.74 (m, 1H), 7.65-7.52 (m, 5H), 7.48-7.37 (m, 3H), 7.22 (t, J = 8.8 Hz, 1H), 4.70-4.65 (m, 1H), 4.30-4.26 (m, 1H), 2.66 (s, 3H), 2.31 (s, 3H), 2.16-2.12 (m, 2H). LCMS calculated for, C.sub.24H.sub.22ClF.sub.2N.sub.3O.sub.3S; 505.10. Found: 506.2 (M + 1). 10-Isomer I [00095]embedded image (3S,5R)-N-(3-Chloro-4-fluorophenyl)-5-(4′-fluoro-3′-methyl-[1,1′- biphenyl]-3-yl)-2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.58 (s, 1H), 7.96 (dd, J = 6.8, 2.4 Hz, 1H), 7.75-7.74 (m, 1H), 7.65-7.53 (m, 5H), 7.48-7.37 (m, 3H), 7.23 (t, J = 9.2 Hz, 1H), 4.70-4.63 (m, 1H), 4.29-4.25 (m, 1H), 2.66 (s, 3H), 2.31 (s, 3H), 2.16- 2.13 (m, 2H). LCMS calculated for, C.sub.24H.sub.22ClF.sub.2N.sub.3O.sub.3S; 505.10. Found: 506.1 (M + 1). 10 Isomer II [00096]embedded image (3R,5S)-N-(3-Chloro-4-fluorophenyl)-5-(4′-fluoro-3′-methyl-[1,1′- biphenyl]-3-yl)-2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.58 (s, 1H), 7.97-7.95 (m, 1H), 7.75-7.74 (m, 1H), 7.65-7.52 (m, 5H), 7.47-7.37 (m, 3H), 7.25-7.20 (m, 1H), 4.67-4.65 (m, 1H), 4.29-4.25 (m, 1H), 2.65 (s, 3H), 2.31 (s, 3H), 2.16-2.13 (m, 2H);. LCMS calculated for, C.sub.24H.sub.22ClF.sub.2N.sub.3O.sub.3S; 505.10. Found: 506.2 (M + 1). 11 [00097]embedded image N-(3-Chloro-4-fluorophenyl)-5-(3-(3,6-dihydro-2H-pyran-4-yl)phenyl)-2- methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.55 (s, 1H), 7.96 (dd, J = 6.8, 2.4 Hz, 1H), 7.56-7.51 (m, 3H), 7.42-7.35 (m, 4H), 6.30 (s, 1H), 4.61-4.59 (m, 1H), 4.27-4.22 (m, 3H), 3.82 (t, J = 5.6 Hz, 2H), 2.65 (s, 3H), 2.49-2.46 (m, 2H), 2.12-2.07 (m 2H). LCMS calculated for, C.sub.22H.sub.23ClFN.sub.3O.sub.4S; 497.11. Found: 480.1 (M + 1). 12 [00098]embedded image Methyl 3′-(5-((3-Chloro-4-fluorophenyl)carbamoyl)-6-methyl-1,1- dioxido-1,2,6-thiadiazinan-3-yl)-[1,1′-biphenyl]-3-carboxylate. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.57 (s, 1H), 8.26-8.25 (m, 1H), 8.02-7.94 (m, 3H), 7.84 (s, 1H), 7.67-7.63 (m, 3H), 7.56-7.49 (m, 3H), 7.39 (t, J = 8.8 Hz, 1H), 4.73-4.67 (m, 1H), 4.30-4.26 (m, 1H), 3.90 (s, 3H), 2.66 (s, 3H), 2.18-2.07 (m, 2H). LCMS calculated for, C.sub.25H.sub.23ClFN.sub.3O.sub.5S; 531.10. Found: 532.1 (M + 1). 13 [00099]embedded image N-(3-Chloro-4-fluorophenyl)-5-(3-cyclopropylphenyl)-2-methyl-1,2,6- thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.55 (s, 1H), 7.97-7.95 (m, 1H), 7.55-7.47 (m, 2H), 7.39 (t, J = 8.8 Hz, 1H), 7.26-7.15 (m, 3H), 7.03 (d, J = 8.8 Hz, 1H), 4.56-4.50 (m, 1H), 4.26-4.22 (m, 1H), 2.64 (s, 3H), 2.08-2.03 (m, 2H), 1.95-1.88 (m, 1H), 0.95-0.93 (m, 2H), 0.70-0.69 (m, 2H). LCMS calculated for, C.sub.20H.sub.21ClFN.sub.3O.sub.3S; 437.10. Found: 438.1 (M + 1). 14 [00100]embedded image N-(3-Chloro-4-fluorophenyl)-5-(4′-methoxy-3′-(trifluoromethyl)-[1,1′- biphenyl]-3-yl)-2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H-NMR (DMSO-d.sub.6, 400 MHz): δ 10.58 (s, 1H), 8.00-7.95 (m, 2H), 7.90 (s, 1H), 7.80 (s, 1H), 7.64-7.61 (m, 2H), 7.55-7.52 (m, 1H), 7.49-7.45 (m, 2H), 7.42-7.36 (m, 2H), 4.71-4.65 (m, 1H), 4.28-4.24 (m, 1H), 3.91 (s, 3H), 2.66 (s, 3H), 2.15-2.12 (m, 2H). LCMS calculated for, C.sub.25H.sub.22ClF.sub.4N.sub.3O.sub.4S; 571.10. Found: 572.1 (M + 1). 15 [00101]embedded image Methyl 2-(3′-(5-((3-chloro-4-fluorophenyl)carbamoyl)-6-methyl-1,1- dioxido-1,2,6-thiadiazinan-3-yl)-[1,1′-biphenyl]-4-yl)acetate. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.57 (s, 1H), 7.96 (dd, J = 6.8, 2.4 Hz, 1H), 7.78-7.76 (m, 1H), 7.66 (d, J = 8.4 Hz, 2H), 7.63-7.61 (m, 2H), 7.57-7.52 (m, 1H), 7.49-7.42 (m, 2H), 7.39-7.35 (m, 3H), 4.70-4.64 (m, 1H), 4.31-4.27 (m, 1H), 3.73 (s, 2H), 3.63 (s, 3H), 2.66 (s, 3H), 2.17-2.12 (m, 2H). LCMS calculated for, C.sub.26H.sub.25ClFN.sub.3O.sub.5S; 454.12. Found: 544.1 (M − 1). 16 [00102]embedded image N-(3-Chloro-4-fluorophenyl)-5-(3-(1,3-dimethyl-1H-pyrazol-4-yl)phenyl)- 2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.56 (s, 1H), 7.96 (dd, J = 6.4, 2.4 Hz, 1H), 7.90 (s, 1H), 7.64-7.50 (m, 3H), 7.42-.37 (m, 3H), 7.31-7.29 (m, 1H), 4.64-4.57 (m, 1H), 4.30-4.26 (m, 1H), 3.78 (s, 3H), 2.65 (s, 3H), 2.30 (s, 3H), 2.17-2.09 (m, 2H). LCMS calculated for, C.sub.22H.sub.23ClFN.sub.5O.sub.3S; 491.12. Found: 492.1 (M + 1). 17 [00103]embedded image 2-(4-(3-(5-((3-Chloro-4-fluorophenyl)carbamoyl)-6-methyl-1,1-dioxido- 1,2,6-thiadiazinan-3-yl)phenyl)-1H-pyrazol-1-yl)acetic acid. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 13.10 (br. s, 1H), 10.57 (s, 1H), 8.18-8.17 (m, 1H), 7.97- 7.92 (m, 2H), 7.70-7.69 (m, 1H), 7.57-7.52 (m, 3H), 7.42-7.35 (m, 2H), 7.27 (d, J = 7.2 Hz, 1H), 4.95 (s, 2H), 4.61-4.59 (m, 1H), 4.29-4.25 (m, 1H), 2.66 (s, 3H), 2.15-2.10 (m, 2H). LCMS calculated for, C.sub.22H.sub.21ClFN.sub.5O.sub.5S; 521.09. Found: 522 (M + 1). 18 [00104]embedded image N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(3-(1-methyl-1,2,3,6- tetrahydropyridin-4-yl)phenyl)-1,2,6-thiadiazinane-3-carboxamide 1,1- dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.58 (s, 1H), 7.97-7.94 (m, 1H), 7.55-7.50 (m, 3H), 7.42-7.33 (m, 4H), 6.22 (s, 1H), 4.62-4.56 (m, 1H), 4.46- 4.50 (m, 1H), 4.39-4.36 (m, 1H), 4.28-4.24 (m, 1H), 2.64 (s, 3H), 2.37-2.33 (m, 2H), 2.10-2.07 (m, 2H), 5H merged in solvent peak. LCMS calculated for, C.sub.23H.sub.26ClFN.sub.4O.sub.3S; 492.14. Found: 493.1 (M + 1).

    Example 19

    [0308] The compounds in Table 4 were synthesized via the saponification of the methyl ester of methyl 3′-(5-((3-chloro-4-fluorophenyl)carbamoyl)-6-methyl-1,1-dioxido-1,2,6-thiadiazinan-3-yl)-[1,1′-biphenyl]-3-carboxylate followed by chiral separation to yield Isomer I and Isomers II

    TABLE-US-00005 TABLE 4 Example Structure, .sup.1H NMR and Mass Spec. 19 [00105]embedded image 3′-(5-((3-Chloro-4-fluorophenyl)carbamoyl)-6-methyl-1,1-dioxido-1,2,6- thiadiazinan-3-yl)-[1,1′-biphenyl]-3-carboxylic acid. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 13.00 (br. s, 1H), 10.59 (s, 1H), 8.25 (s, 1H), 7.97-7.94 (m, 3H), 7.84 (s, 1H), 7.68-7.60 (m, 3H), 7.55-7.49 (m, 3H), 7.39 (t, J = 8.8 Hz, 1H), 4.70-4.68 (m, 1H), 4.30-4.26 (m, 1H), 2.66 (s, 3H), 2.18-2.16 (m, 2H). MW calculated for, C.sub.24H.sub.21ClFN.sub.3O.sub.5S; 517.09. Found: 518 (M + 1). 19-Isomer I [00106]embedded image 3′-((3R,5S)-5-((3-Chloro-4-fluorophenyl)carbamoyl)-6-methyl-1,1- dioxido-1,2,6-thiadiazinan-3-yl)-[1,1′-biphenyl]-3-carboxylic acid. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 13.05 (bs, 1H), 10.58 (s, 1H), 8.25 (s, 1H), 7.97-7.94 (m, 3H), 7.84 (s, 1H), 7.70-7.60 (m, 3H), 7.53-7.49 (m, 3H), 7.39 (t, J = 8.8 Hz, 1H), 4.70-4.65 (m, 1H), 4.30-4.26 (m, 1H), 2.66 (s, 3H), 2.18- 2.16 (m, 2H). LCMS calculated for, C.sub.24H.sub.21ClFN.sub.3O.sub.5S; 517.09. Found: 518.1 (M + 1). 19-Isomer II [00107]embedded image 3′-((3S,5R)-5-((3-Chloro-4-fluorophenyl)carbamoyl)-6-methyl-1,1- dioxido-1,2,6-thiadiazinan-3-yl)-[1,1′-biphenyl]-3-carboxylic acid. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 13.13 (br. s, 1H), 10.58 (s, 1H), 8.25 (s, 1H), 7.97-7.94 (m, 3H), 7.84 (s, 1H), 7.68-7.60 (m, 3H), 7.55-7.48 (m, 3H), 7.39 (t, J = 8.8 Hz, 1H), 4.75-4.65 (m, 1H), 4.30-4.26 (m, 1H), 2.66 (s, 3H), 2.18- 2.13 (m, 2H). LCMS calculated for, C.sub.24H.sub.21ClFN.sub.3O.sub.5S; 517.09. Found: 518.1 (M + 1).

    Examples 20-22

    [0309] The compounds in Table 5 were synthesized from N-(3-chloro-4-fluorophenyl)-2-methyl-5-(3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide, intermediate 10 and readily available bromine substituted derivative using the procedure described in Method I.

    TABLE-US-00006 TABLE 5 Example Structure, .sup.1H NMR and Mass Spec. 20 [00108]embedded image N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(3-(1-methyl-1H-imidazol-5- yl)phenyl)-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.57 (s, 1H), 7.98-7.94 (m, 1H), 7.71 (s, 1H), 7.62-7.49 (m, 5H), 7.46 (s, 1H), 7.43-7.37 (m, 1H), 7.09-7.08 (m, 1H), 4.68-4.62 (m, 1H), 4.30-4.25 (m, 1H), 3.70 (s, 3H), 2.65 (s, 3H), 2.14-2.06 (m, 2H). LCMS calculated for, C.sub.21H.sub.21ClFN.sub.5O.sub.3S; 477.10. Found: 478.1 (M + 1). 21 [00109]embedded image N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(4′-(trifluoromethyl)-[1,1′- biphenyl]-3-yl)-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.57 (s, 1H), 7.97-7.94 (m, 3H), 7.86-7.82 (m, 3H), 7.72-7.70 (m, 1H), 7.65-7.62 (m, 1H), 7.55-7.52 (m, 3H), 7.42-7.37 (m, 1H), 4.75-4.65 (m, 1H), 4.30-4.28 (m, 1H), 2.66 (s, 3H), 2.17-2.15 (m, 2H). LCMS calculated for, C.sub.24H.sub.20ClF.sub.4N.sub.3O.sub.3S; 541.09. Found: 542.1 (M + 1). 22 [00110]embedded image N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(3-(pyridin-2-yl)phenyl)-1,2,6- thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.58 (s, 1H), 8.69-8.67 (m, 1H), 8.20 (s, 1H), 8.05-7.88 (m, 4H), 7.64-7.61 (m, 1H), 7.57-7.48 (m, 3H), 7.42-7.35 (m, 2H), 4.72-4.66 (m, 1H), 4.33-4.29 (m, 1H), 2.66 (s, 3H), 2.19-2.14 (m, 2H). LCMS calculated for, C.sub.22H.sub.20ClFN.sub.4O.sub.3S; 474.09. Found: 475.1 (M + 1).

    Examples 23-27

    [0310] The compounds in Table 6 were synthesized from 5-(3-bromophenyl)-N-(3-chloro-4-fluorophenyl)-2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide (Intermediate 7) and readily available amine containing heterocycle or heteroaryl reactants using the procedure described in Method J. Isomers I and II were isolated from the racemic parent using the chiral separation procedures. Alternatively, Isomers I and II can be directly synthesized from Intermediate 8 and Intermediate 9 using Method J.

    TABLE-US-00007 TABLE 6 Example Structure, .sup.1H NMR and Mass Spec. 23 [00111]embedded image N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(3-(piperidin-1-yl)phenyl)- 1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.58 (s, 1H), 7.97-7.95 (m, 1H), 7.61-7.50 (m, 2H), 7.42-7.35 (m, 3H), 7.28-6.98 (m, 2H), 4.60-4.55 (m, 1H), 4.28-4.24 (m, 1H), 3.35-3.32 (m, 4H), 2.65 (s, 3H), 2.15-2.07 (m, 2H), 1.74-1.72 (m, 4H), 1.60-1.58 (m, 2H). LCMS calculated for, C.sub.22H.sub.26ClFN.sub.4O.sub.3S; 480.14. Found: 481.1 (M + 1). 24 [00112]embedded image N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(3-morpholinophenyl)-1,2,6- thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.54 (s, 1H), 7.96-7.94 (m, 1H), 7.55-7.47 (m, 2H), 7.39 (t, J = 8.8 Hz, 1H), 7.21 (t, J = 7.6 Hz, 1H), 7.05 (s, 1H), 6.89-6.85 (m, 2H), 4.52-4.50 (m, 1H), 4.24-4.20 (m, 1H), 3.73 (t, J = 4.4 Hz, 4H), 3.12 (t, J = 4.4 Hz, 4H), 2.63 (s, 3H), 2.12-2.03 (m, 2H). LCMS calculated for, C.sub.21H.sub.24ClFN.sub.4O.sub.4S; 482.12. Found: 483.1 (M + 1). 24-Isomer I [00113]embedded image (3S,5R)-N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(3-morpholinophenyl)- 1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.55 (s, 1H), 7.97-7.94 (m, 1H), 7.55-7.47 (m, 2H), 7.39 (t, J = 8.8 Hz, 1H), 7.21 (t, J = 8.0 Hz, 1H), 7.05 (s, 1H), 6.89-6.85 (m, 2H), 4.54- 4.48 (m, 1H), 4.24-4.20 (m, 1H), 3.73 (t, J = 4.4 Hz, 4H), 3.12 (t, J = 4.4 Hz, 4H), 2.64 (s, 3H), 2.08-2.01 (m, 2H). LCMS calculated for, C.sub.21H.sub.24ClFN.sub.4O.sub.4S; 482.12. Found: 483.1 (M + 1). 24-Isomer II [00114]embedded image (3R,5S)-N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(3-morpholinophenyl)- 1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.55 (s, 1H), 7.97-7.94 (m, 1H), 7.55-7.48 (m, 2H), 7.39 (t, J = 9.2 Hz, 1H), 7.21 (t, J = 8.0 Hz, 1H), 7.05 (s, 1H), 6.89- 6.85 (m, 2H), 4.52-4.48 (m, 1H), 4.24-4.20 (m, 1H), 3.73 (t, J = 4.4 Hz, 4H), 3.12 (t, J = 4.0 Hz, 4H), 2.64 (s, 3H), 2.08-2.03 (m, 2H). LCMS calculated for, C.sub.21H.sub.24ClFN.sub.4O.sub.4S; 482.12. Found: 483.1 (M + 1). 25-Isomer I [00115]embedded image (3S,5R)-N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(3-(4-methylpiperazin- 1-yl)phenyl)-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.54 (s, 1H), 7.96-7.94 (m, 1H), 7.55-7.51 (m, 1H), 7.49-7.46 (m, 1H), 7.39 (t, J = 9.2 Hz, 1H), 7.18 (t, J = 8.0 Hz, 1H), 7.04 (s, 1H), 6.88-6.81 (m, 2H), 4.54-4.47 (m, 1H), 4.23-4.19 (m, 1H), 3.16-3.00 (m, 4H), 2.50 (s, 3H), 2.46-2.44 (m, 4H), 2.21 (s, 3H), 2.08-2.00 (m, 2H). LCMS calculated for, C.sub.22H.sub.27ClFN.sub.5O.sub.3S; 495.15. Found: 496.1 (M + 1). 25-Isomer II [00116]embedded image (3R,5S)-N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(3-(4-methylpiperazin- 1-yl)phenyl)-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.54 (s, 1H), 7.97-7.94 (m, 1H), 7.55-7.51 (m, 1H), 7.49-7.46 (m, 1H), 7.39 (t, J = 8.8 Hz, 1H), 7.18 (t, J = 8.0 Hz, 1H), 7.04 (s, 1H), 6.88-6.82 (m, 2H), 4.54-4.47 (m, 1H), 4.23-4.20 (m, 1H), 3.16-3.14 (m, 4H), 2.63 (s, 3H), 2.46-2.44 (m, 4H), 2.22 (s, 3H), 2.08-2.03 (m, 2H). LCMS calculated for, C.sub.22H.sub.27ClFN.sub.5O.sub.3S; 495.15. Found: 496.1 (M + 1). 26 [00117]embedded image 5-(3-(1H-Pyrazol-1-yl)phenyl)-N-(3-chloro-4-fluorophenyl)-2-methyl- 1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.59 (s, 1H), 8.53-8.51 (m, 1H), 7.98-7.94 (m, 2H), 7.81-7.78 (m, 1H), 7.76-7.75 (m, 1H),7.63-7.61 (m, 1H), 7.57-7.48 (m, 2H), 7.42-7.38 (m, 2H), 6.57-6.55 (m, 1H), 4.68-4.66 (m, 1H), 4.33-4.28 (m, 1H), 2.66 (s, 3H), 2.17-2.12 (m, 2H). LCMS calculated for, C.sub.20H.sub.19ClFN.sub.5O.sub.3S; 463.09. Found: 464.1 (M + 1). 27-Isomer I [00118]embedded image (3S,5R)-5-(3-(1H-Imidazol-1-yl)phenyl)-N-(3-chloro-4-fluorophenyl)-2- methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.57 (s, 1H), 8.28 (s, 1H), 7.96 (dd, J = 6.8, 2.4 Hz, 1H), 7.72-7.75 (m, 2H), 7.63-7.50 (m, 4H), 7.46-7.37 (m, 2H), 7.12 (s, 1H), 4.69- 4.66 (m, 1H), 4.30-4.26 (m, 1H), 2.66 (s, 3H), 2.16-2.11 (m, 2H). LCMS calculated for, C.sub.20H.sub.19ClFN.sub.5O.sub.3S; 463.09. Found: 464 (M + 1). 27-Isomer II [00119]embedded image (3R,5S)-5-(3-(1H-Imidazol-1-yl)phenyl)-N-(3-chloro-4-fluorophenyl)-2- methyl-1,2,6-thiaidiazinane-3-carboxamide 1,1-dioxide. .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 10.58 (s, 1H), 8.27 (s, 1H), 7.96 (dd, J = 6.8, 2.4 Hz, 1H), 7.76-7.74 (m, 2H), 7.61-7.49 (m, 4H), 7.45-7.36 (m, 2H), 7.11 (s, 1H), 4.67- 4.65 (m, 1H) 4.29-4.24 (m, 1H), 2.65 (s, 3H), 2.15-2.05 (m, 2H). LCMS calculated for, C.sub.20H.sub.19ClFN.sub.5O.sub.3S; 463.09. Found: 464 (M + 1).

    Examples 28-39

    [0311] The compounds in Table 7 were synthesized using the methods described above.

    TABLE-US-00008 TABLE 7 Example Structure, .sup.1H NMR and Mass Spec. 28 [00120]embedded image N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(5-phenyl-1,2,4-oxadiazol-3-yl)- 1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide .sup.1H NMR (400 MHz, DMSO-d6): δ 10.60 (s, 1H), 8.13-8.09 (m, 2H), 7.96- 7.91 (m, 1H), 7.86-7.84 (m, 1H), 7.73-7.69 (m, 1H), 7.65-7.60 (m, 2H), 7.56- 7.52 (m, 1H), 7.38 (t, J = 8.8 Hz, 1H), 4.89-4.87 (m, 1H), 4.44-4.39 (m, 1H), 2.60 (s, 3H), 2.27-2.20 (m, 2H). LCMS calcd for; C.sub.19H.sub.17ClFN.sub.5O.sub.4S. Found; 466.15 (M + 1). 29 [00121]embedded image N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(5-methyl-1,3,4-oxadiazol-2-yl)- 1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide .sup.1H NMR (400 MHz, DMSO-d6): δ 10.61 (s, 1H), 7.97 (d, J = 4.8 Hz, 1H), 7.87 (d, J = 9.5 Hz, 1H), 7.58-7.56 (m, 1H), 7.40 (t, J = 9.0 Hz, 1H), 4.98-4.86 (m, 1H), 4.44-4.41 (m, 1H), 2.60 (s, 3H), 2.53 (s, 3H), 2.33-2.12 (m, 2H). LCMS calcd for; C.sub.14H.sub.15ClFN.sub.5O.sub.4S. Found; 404.35 (M + 1). 30 [00122]embedded image N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(5-phenyl-1,3,4-oxadiazol-2-yl)- 1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide .sup.1H NMR (400 MHz, DMSO-d6): δ 10.64 (s, 1H), 8.06-8.04 (m, 2H), 7.99- 7.97 (m, 2H), 7.67-7.57 (m, 4H), 7.41 (t, J = 9.2 Hz, 1H), 5.08-5.06 (m, 1H), 4.47-4.44 (m, 1H), 2.64 (s, 3H), 2.41-2.27 (m, 2H). LCMS calcd for; C.sub.19H.sub.17ClFN.sub.5O.sub.4S. Found; 465.85 (M + 1). 31 [00123]embedded image N-(3-Chloro-4-fluorophenyl)-5-(4-(4-fluorobenzyl)-5-oxo-4,5-dihydro- 1H-1,2,4-triazol-3-yl)-2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1- dioxide .sup.1H NMR (400 MHz, DMSO-d6): δ 11.95 (s, 1H), 10.52 (s, 1H), 7.95-7.92 (m, 1H), 7.77 (d, J = 10.4 Hz, 1H), 7.54-7.50 (m, 1H), 7.41-7.32 (m, 3H), 7.21-7.16 (m, 2H), 4.91-4.75 (m, 2H), 4.50-4.43 (m, 1H), 4.26-4.22 (m, 1H), 2.56 (s, 3H), 2.25-2.21 (m, 1H), 1.99-1.95 (m, 1H). LCMS calcd for; C.sub.20H.sub.19ClF.sub.2N.sub.6O.sub.4S. Found; 513.5 (M + 1). 32 [00124]embedded image N-(3-Chloro-4-fluorophenyl)-5-(4,5-dimethyl-4H-1,2,4-triazol-3-yl)-2- methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide .sup.1H NMR (400 MHz, DMSO-d6): δ 10.59 (s, 1H), 8.01-7.94 (m, 1H), 7.64-7.58 (m, 2H), 7.41 (t, J = 9.1 Hz, 1H), 4.81 (t, J = 10.4 Hz, 1H), 4.42-4.33 (m, 1H), 3.55 (s, 3H), 2.60 (s, 3H), 2.34 (s, 3H), 2.11-2.07 (m, 1H). LCMS calcd for; C.sub.15H.sub.18ClFN.sub.6O.sub.3S. Found; 417 (M + 1). 33 [00125]embedded image 5-(5-Benzyl-4-methyl-4H-1,2,4-triazol-3-yl)-N-(3-chloro-4-fluorophenyl)- 2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide .sup.1H NMR (400 MHz, DMSO-d6): δ 10.60 (s, 1H), 7.98 (dd, J = 6.8, 2.7 Hz, 1H), 7.70-7.54 (m, 2H), 7.43-7.38 (m, 1H), 7.35-7.31 (m, 2H), 7.26-7.21 (m, 3H), 4.83 (t, J = 10.4 Hz, 1H), 4.39-4.36 (m, 1H), 4.18 (s, 2H), 3.48 (s, 3H), 2.59 (s, 3H), 2.11-2.07 (m, 1H). LCMS calcd; C.sub.21H.sub.22ClFN.sub.6O.sub.3S. Found; 493.45 (M + 1). 34 [00126]embedded image N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(1-methyl-5-phenyl-1H- imidazol-2-yl)-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide .sup.1H NMR (400 MHz, DMSO-d6): δ 10.10 (s, 1H), 7.98 (dd, J = 6.8, 2.4 Hz, 1H), 7.64-7.60 (m, 1H), 7.50-7.45 (m, 5H), 7.42-7.36 (m, 2H), 7.04 (s, 1H), 5.00-4.95 (m, 1H), 4.60-4.58 (m, 1H), 3.63 (s, 3H), 2.93 (s, 3H), 2.40-2.23 (m, 2H). LCMS calcd for; C.sub.21H.sub.21ClFN.sub.5O.sub.3S. Found; 478.25 (M + 1). 35 [00127]embedded image 5-(5-Benzyl-1-methyl-1H-imidazol-2-yl)-N-(3-chloro-4-fluorophenyl)-2- methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide .sup.1H NMR (400 MHz, DMSO-d6): δ 10.08 (s, 1H), 7.98-7.96 (m, 1H), 7.62- 7.58 (m, 1H), 7.40-7.30 (m, 4H), 7.24-7.18 (m, 3H), 6.64 (s, 1H), 4.88-4.86 (m, 1H), 4.56 (t, J = 4.0 Hz, 1H), 3.96 (s, 2H), 3.41 (s, 3H), 2.89 (s, 3H), 2.34- 2.26 (m, 1H), 2.19-2.15 (m, 1H). LCMS calcd for; C.sub.22H.sub.23ClFN.sub.5O.sub.3S. Found; 492.20 (M + 1). 36 [00128]embedded image N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(5-(1-methyl-1H-imidazol-4- yl)furan-2-yl)-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide .sup.1H NMR (400 MHz, DMSO-d6): δ 10.50 (s, 1H), 7.94 (dd, J = 6.8, 3.2 Hz, 1H), 7.64-7.62 (m, 1H), 7.58 (d, J = 9.2 Hz, 1H), 7.55-7.50 (m, 1H), 7.41-7.34 (m, 2H), 6.45-6.42 (m, 2H), 4.66-4.60 (m, 1H), 4.27-4.23 (m, 1H), 3.64 (s, 3H), 2.58 (s, 3H), 2.21-2.03 (m, 2H). LCMS calcd for; C.sub.19H.sub.19ClFN.sub.5O.sub.4S. Found; 468 (M + 1). 37 [00129]embedded image N-(3-Chloro-4-fluorophenyl)-2-methyl-5-(5-oxo-4-phenyl-4,5-dihydro- 1H-1,2,4-triazol-3-yl)-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide .sup.1H NMR (400 MHz, DMSO-d6): δ 12.03 (s, 1H), 10.47 (s, 1H), 7.93-7.90 (m, 1H), 7.61-7.59 (m, 1H), 7.53-7.48 (m, 3H), 7.45-7.39 (m, 3H), 7.38-7.33 (m, 1H), 4.48-4.46 (m, 1H), 4.20-4.16 (m, 1H), 2.34-2.24 (m, 1H), 1.93-1.89 (m, 1H). LCMS calcd for; C.sub.19H.sub.18ClFN.sub.6O.sub.4S. Found; 481 (M + 1). 38 [00130]embedded image 5-(4-Benzyl-5-oxo-4,5-dihydro-1H-1,2,4-triazol-3-yl)-N-(3-chloro-4-fluorophenyl)- 2-methyl-1,2,6-thiadiazinane-3-carboxamide 1,1-dioxide .sup.1H NMR (400 MHz, DMSO-d6): δ 11.96 (s, 1H), 10.55 (s, 1H), 7.94 (dd, J = 6.8, 2.5 Hz, 1H), 7.82 (d, J = 10.3 Hz, 1H), 7.55-7.51 (m, 1H), 7.44-7.24 (m, 6H), 4.98-4.74 (m, 2H), 4.61-4.41 (m, 1H), 4.25-4.21 (m, 1H), 2.57 (s, 3H), 2.33-2.20 (m, 1H), 2.00-1.93 (m, 1H). LCMS calcd for; C.sub.20H.sub.20ClFN.sub.6O.sub.4S. Found; 495.30 (M + 1).

    Biological Methods

    Assay Measuring Activity of Test Compounds on Viral Production from HepAD38 Cells

    [0312] HepAD38 cells grown in a T-150 flask (Corning, cat#: 430825) with Growth Medium (DMEM/F12 (1:1) (Hyclone, cat#: SH30023.02), 1× Pen/Strep (Invitrogen, cat#: 15140-122), 10% FBS (Tissue Culture Biologics, cat#: 101), 250 μg/mL G418 (Alfa Aesar, cat#: J62671), 1 μg/mL Tetracycline (Teknova, cat#: T3320)) were detached with 0.25% trypsin-EDTA (Invitrogen, cat#: 25200-056). Tetracycline-free treatment medium (15 mL DMEM/F12 (1:1) 1×Pen/step, with 2% FBS, Tet-system approved (Clontech, cat#: 631106) were then added to mix, transferred into a 50 ml conical tube (Falcon, cat#: 21008-918) and spun at 1300 rpm for 5 min. Pelleted cells were then re-suspended/washed with 50 mL of 1×DPBS (Invitrogen, cat#: 14190-136) 2 times and 50 mL treatment medium twice. HepAD38 cells were then re-suspended with 10 mL of treatment medium, syringed and counted. Wells of 96-well clear bottom TC plate (Corning, cat#: 3904) were seeded at 50,000 cells/well in 180 μL of treatment medium, and 20 μL of either 10% DMSO (Sigma, cat#: D4540) as controls or a 10× solution of test compounds in 10% DMSO in treatment media was added for a final compound concentration starting at 10 μM, and plates were incubated in 5% CO.sub.2 incubator at 37° C. for 5 days.

    [0313] Subsequently viral load production was assayed by quantitative PCR (qPCR) of the HBV core sequence. PCR reaction mixture containing forward primers HBV-f 5′-CTGTGCCTTGGGTGGCTTT-3′ (IDT DNA), Reverse primers HBV-r 5′-AAGGAAAGAAGTCAGAAGGCAAAA-3′ (IDT DNA), Fluorescent TaqMan™ Probes HBV-probe 5′-FAM/AGCTCCAAA/ZEN/TTCTTTATAAGGGTCGATGTC/3IABkFQ-3′ (IDT DNA), 10 μL/well of PerfeCTa® qPCR ToughMix® (Quanta Biosciences, Cat#: 95114-05K), and 6 μL/well of DEPC water (Alfa Aesar, cat#: J62087) was prepared. Four μL of supernatant was added to 16 μL of the reaction mixture in a qPCR plate (Applied Biosytems, Cat#: 4309849), sealed with a film (Applied Biosystems, Cat#: 4311971), centrifuged for a few seconds, and subsequently run on an Applied Biosystems VIIA7. The PCR mixture was incubated at 45° C. for 5 min, then 95° C. for 10 min, followed by 40 cycles of 10 seconds at 95° C. and 20 seconds at 60° C. Viral load was quantified against known HBV DNA standards by using ViiA™ 7 Software. Viral load in the supernatant from wells with treated cells were compared against viral load in supernatant from DMSO control wells (≥ 3 per plate). Cell viability assay was performed with CellTiter-Glo Luminescent Cell Viability Assay (Promega, cat#: G7573) with modification. Mixed appropriate amount of CellTiter-Glo (CTG) 1×DPBS in a 1:1 ratio, added 100 uL of the mixture to each well followed completely removal of all supernatant in each well without touching cell surface. Incubated the plate at room temperature for 10 min on an orbital shaker, and then read the plate with a plate reader (TECAN M1000 or Envision). EC.sub.50 or CC.sub.50 values were calculated through curve-fitting of the four-parameter nonlinear-logistic-regression model (GraphPad Prism or Dotmatics). CC.sub.50 values were all >10 μM.

    [0314] Table 8 gives the viral load lowering EC.sub.50 values grouped in the following ranges: A indicates EC.sub.50<1 μM; B indicates EC.sub.50 1-5 μM; C indicates 5<EC.sub.50<10 μM.

    TABLE-US-00009 TABLE 8 Example Activity  2 A  2-Isomer I A  2-Isomer II C  3 A  3-Isomer I A  3-Isomer II C  4 A  4-Isomer I A  4-Isomer II B  5 A  5-Isomer I A  5-Isomer II B  6 A  6-Isomer I A  6-Isomer II B  7 A  7-Isomer I A  7-Isomer II B  8 A  8-Isomer I A  8-Isomer II C  9 B  9-Isomer I A  9-Isomer II C 10 A 10-Isomer I A 10 Isomer II C 11 A 12 A 13 A 14 B 15 A 16 A 17 C 18 A 19 B 19-Isomer I A 19-Isomer II C 20 A 21 A 22 A 23 A 24 A 24-Isomer I A 24-Isomer II C 25-Isomer I A 25-Isomer II B 26 A 27-Isomer I A 27-Isomer II C 29 B 32 C 33 C 34 C 36 A 37 B 38 C

    INCORPORATION BY REFERENCE

    [0315] All publications and patents mentioned herein, including those items listed below, are hereby incorporated by reference in their entirety for all purposes as if each individual publication or patent was specifically and individually incorporated by reference. In case of conflict, the present application, including any definitions herein, will control.

    EQUIVALENTS

    [0316] While specific embodiments of the subject disclosure have been discussed, the above specification is illustrative and not restrictive. Many variations of the disclosure will become apparent to those skilled in the art upon review of this specification. The full scope of the disclosure should be determined by reference to the claims, along with their full scope of equivalents, and the specification, along with such variations.

    [0317] Unless otherwise indicated, all numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about.” Accordingly, unless indicated to the contrary, the numerical parameters set forth in this specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained by the present disclosure.