HYDROGEL BIOMIMETIC FOR INVASIVE DISEASES
20220098547 · 2022-03-31
Inventors
- Molly Sandra SHOICHET (Toronto, Ontario, CA)
- William Lloyd STANFORD (Ottawa, Ontario, CA)
- Roger Yue Ting TAM (Ottawa, Ontario, CA)
- Julien YOCKELL-LELIEVRE (Gatineau, Quebec, CA)
- Laura Jean SMITH (Toronto, Ontario, CA)
Cpc classification
International classification
C12N5/00
CHEMISTRY; METALLURGY
Abstract
An extracellular biomimetic for assessing and analyzing cell invasion includes hydrogel matrix and a first peptide crosslinked to the hydrogel matrix, where the first peptide is responsive to a first substance released by diseased cells upon invasion into the biomimetic. The biomimetic further includes at least one modulating agent enabling cell invasion independent from said first substance. The hydrogel matrix can comprise hyaluronate modified with furanyl functional groups, and the modulating agent can be viscoelastic polymer forming reversible crosslinks within the hydrogel matrix. Examples of the viscoelastic polymer include methyl cellulose, or functionalized methyl cellulose, for example, with thiol functional groups. The first substance released by diseased cells is an enzyme, for example, matrix metalloproteinase (MMP). The biomimetic can be used for drug screening to identify compounds that reduce the invasion and viability of the diseased cells, for example, cells from the lung, brain, breast, prostate, and human pluripotent stem cells.
Claims
1. An extracellular biomimetic for culturing diseased cells, comprising: hydrogel matrix, a first extracellular matrix protein-mimetic peptide crosslinked to the hydrogel matrix, said first extracellular matrix protein-mimetic peptide being responsive to a first substance released by diseased cells upon invasion into the extracellular biomimetic, and at least one modulating agent enabling cell invasion independent from said first substance.
2. The extracellular biomimetic according to claim 1, wherein the hydrogel matrix comprises hyaluronate or hyaluronic acid, modified with furanyl functional groups.
3. The extracellular biomimetic according to claim 2, wherein the furanyl functional groups are furan, or furan substituted with alkyl-, aryl-, or electron-donating functional groups.
4. The extracellular biomimetic according to claim 1, wherein the modulating agent is at least one viscoelastic component forming reversible crosslinks within the hydrogel matrix.
5. The extracellular biomimetic according to claim 4, wherein the component comprises any one of methyl cellulose, alginate crosslinked with calcium cations, amphiphilic block polymers, amphiphilic block polypeptides, coiled-coil peptides, reconstituted basement membrane protein extract, laminin, or collagen, said methyl cellulose optionally having any one of aldehyde, and thiol functional groups.
6. (canceled)
7. The extracellular biomimetic according to claim 4, wherein the first extracellular matrix protein-mimetic peptide is further immobilized to the viscoelastic polymer.
8. The extracellular biomimetic according to claim 4, further comprising a second extracellular matrix protein-mimetic peptide immobilized to the hydrogel matrix and/or the viscoelastic polymer.
9. The extracellular biomimetic according to claim 8 wherein the second extracellular matrix protein-mimetic peptide is present in the amount of about 25 μM to 1000 μM.
10. (canceled)
11. The extracellular biomimetic according to claim 8, wherein the second extracellular matrix protein-mimetic peptide is any one or combination of vitronectin-mimetic peptide and fibronectin-mimetic peptide.
12. The extracellular biomimetic according to claim 1, wherein the first substance released by diseased cells is an enzyme.
13. The extracellular biomimetic according to claim 12, wherein the enzyme is matrix metalloproteinase (MMP).
14. The extracellular biomimetic according to claim 13, wherein the first extracellular matrix protein-mimetic peptide is maleimide-modified collagen I-derived peptide crosslinker degradable by the MMP.
15. A cell culture kit comprising the extracellular biomimetic according to claim 1 and cells.
16. The cell culture kit according to claim 15 wherein the cells are diseased cells from any invading cells, such as any one of the lung, brain, breast, prostate, skin, liver, colon, pancreas, thyroid, bone, muscle, human pluripotent stem cells and their subsequently differentiated cells.
17. The cell culture kit according to claim 15 wherein the cells are diseased cells isolated from lung cancer patients or derived from human pluripotent stem cells (hiPSCs) to model lymphangioleiomyomatosis (LAM), or derived from hiPSC smooth muscle cells (SMCs) that model lymphangioleiomyomatosis (LAM-SMCs).
18. (canceled)
19. The cell culture kit according to claim 15, wherein the cells are diseased cells treated with one or any combination of inhibitors selected from the group consisting of those that inhibit: ABL1 ADENOSINE DEAMINASE AKT3 ALK ANDROGEN AROMATASE AURORA KINASE BCL-2 BRAF BRD BTK CALCINEURIN CCR5 CDK CXCR CYTOCHROME P450 DAGK DNA METHYLTRANSFERASE DNA TOPOISOMERASE EGFR EPH ERK Fibroblast Growth Factor Receptors FARNESYLTRANSFERASE FLT FRAP GSK3 HDAC HEAT SHOCK PROTEIN HEDGEHOG IRE1 ITGB1 JAK2 KDR KINESIN-LIKE SPINDLE PROTEIN KIT LCK LIMK1 LYN MAP2K MDM2 P38B P70S6K PARP PDGFR PI3K PKC PLK1 PIM2 PROTEASOME RAF1 Rho-associated protein kinase RET Src SIRT2 SPHINGOSINE KINASE TANKYRASE TUBULIN WNT, or one or any combination of agonists selected from the group consisting of: GLUCOCORTICOID PKM2 PROGESTERONE RXR S1P RECEPTOR.
20. The cell culture kit according to claim 15, having 6, 24, 48, 96, 384 or 1536 well plates.
21. A drug screening method comprising: culturing diseased cells in the extracellular biomimetic according to any one of claim 1; quantifying invasion and viability of the diseased cells; administering candidate drug compounds to the biomimetic; and identifying compounds that reduce both the invasion and viability of the diseased cells.
22. The method according to claim 21, wherein the quantifying step comprises measuring the invasion of the diseased cells by staining cells with fluorescent dyes, automated confocal imaging, and automated analysis by an image analysis software program such as custom Image J macros.
23. The method according to claim 21, wherein the quantifying step comprises measuring the viability of the diseased cells by staining the dead cells with fluorescent dyes, automated microscopic imaging such as confocal imaging, and automated analysis by an image analysis software program such as custom Image J macros.
24-29. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0101] Embodiments will now be described, by way of example only, with reference to the drawings, in which:
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126] FIG. 3D shows active MMP-9 expression, assessed by zymography of conditioned media. (N=3, *p<0.05).
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150]
[0151]
[0152]
DETAILED DESCRIPTION
[0153] Various embodiments and aspects of the disclosure will be described with reference to details discussed below. The following description and drawings are illustrative of the disclosure and are not to be construed as limiting the disclosure. The Figures are not to scale. Numerous specific details are described to provide a thorough understanding of various embodiments of the present disclosure. However, in certain instances, well-known or conventional details are not described in order to provide a concise discussion of embodiments of the present disclosure.
[0154] As used herein, the terms, “comprises” and “comprising” are to be construed as being inclusive and open ended, and not exclusive. Specifically, when used in the specification and claims, the terms, “comprises” and “comprising” and variations thereof mean the specified features, steps or components are included. These terms are not to be interpreted to exclude the presence of other features, steps or components.
[0155] As used herein, the term “exemplary” means “serving as an example, instance, or illustration,” and should not be construed as preferred or advantageous over other configurations disclosed herein.
[0156] As used herein, the terms “about” and “approximately” are meant to cover variations that may exist in the upper and lower limits of the ranges of values, such as variations in properties, parameters, and dimensions. In one non-limiting example, the terms “about” and “approximately” mean plus or minus 10 percent or less.
[0157] As used herein, the term “a biomimetic” refers to an extracellular matrix platform that mimics the native microenvironment to model cell-matrix interactions.
[0158] As used herein, the term “a diseased cell” refers to a cell that is derived from the tissue or a human pluripotent stem cell that models any invasive disease, such as those of the immune system, lung, skin, brain, breast, prostate, liver, colon, pancreas, thyroid, bone, muscle, lymph, head or neck. The biomimetic platform according to the present disclosure can be used for cancer cells, or other invasive cells types in other diseases beyond cancer cells.
[0159] As used herein, the term “an adhesive peptide” refers to amino acid sequences that bind to cell-surface receptors, and are derived from extracellular matrix proteins, for example, vitronectin, fibronectin, laminin, collagen, VCAM, ICAM, NCAM.
[0160] As used herein, the term “a modulating agent” refers to any substance, structure or process that modifies the 3-D hydrogel matrix platform to permit cell invasion by a mechanism independent from a well-known effector of a disease, for example, an enzyme released by a diseased cell.
[0161] In one example according to an embodiment of the present disclosure, the modulating agent may include one or a combination of a substance, structure and process enabling cell invasion independent from the enzyme matrix metalloproteinase (MMP), secreted by the cells of a patient.
[0162] Other examples of modulating agent include at least one viscoelastic polymer forming reversible crosslinks within the hydrogel matrix. Another example is alginate crosslinked with calcium cations.
[0163] Unless defined otherwise, all technical and scientific terms used herein are intended to have the same meaning as commonly understood to one of ordinary skill in the art.
[0164] Cell behavior is highly dependent upon microenvironment. Thus, to identify drugs targeting invasive cells, such as cancer cells, of which metastatic cells are an example, screens need to be performed in tissue mimetic substrates that allow cell invasion and matrix remodeling. Recognizing the critical element and complexity of cell invasion to disease progression and therapeutic intervention, the present inventors developed a novel high content, 3D biomimetic hydrogel drug screening platform that permits cell invasion by multiple mechanisms (
[0165] To form stable HA hydrogels that can withstand the duration of drug screen, the HA polymer backbone is modified with furanyl motifs (FIG. 1B) that can form stable, covalent chemical bonds with bismaleimide-terminated peptides via Diels-Alder click chemistry (
[0166] For the purpose of illustrating exemplary embodiments, the following discussion is provided with reference to diseased lung and brain cells. However, the present disclosure can also be implemented with other cells, including immune and inflammatory cells and diseased cells from the breast, brain, skin, prostate, liver, colon, pancreas, thyroid, bone, muscle, lymph, ovarian, cervix, head and neck and human pluripotent stem cells (which includes both pluripotent stem cells and embryonic stem cells) that model these said diseases.
[0167] For lymphangioleiomyomatosis (LAM) used as an exemplary lung disease model, the hydrogel is crosslinked with a peptide that can be degraded by matrix metalloproteinase (MMPs), which is a proteases secreted by LAM cells.sup.[17]. In one embodiment, hyaluronic acid (HA) is crosslinked with bismaleimide-terminated collagen I—derived peptide crosslinkers (GPQG-IWGQ) that can be enzymatically degraded by MMPs, enabling MMP-mediated cell invasion into the hydrogels.
[0168] Native lung tissue exhibits viscoelastic behaviors, in which structural deformations of the tissue occur to dissipate energy (i.e. stress relaxation) in response to an applied stress force. This occurs via the reorganization of collagen and elastin fibers that comprise the lungs..sup.[18] Thus, we include a second polymer with well-characterized viscoelastic properties (such as methylcellulose) into our 3D hydrogel system that can form weak, reversible physical crosslinks (i.e. via hydrophobic interactions between the methoxy groups of the methylcellulose polysaccharide backbone) to permit cultured cells to remodel the material. To ensure that methylcellulose is retained for the duration of our assay, we chemically modified methylcellulose with reactive thiols (MC-SH, 5% degree of substitution) that form chemical crosslinks with maleimide-functionalized peptides via conjugate Michael addition chemistry (
[0169] The inventors further compared the mechanical properties of these hydrogels (which we optimized to enable cell invasion) to that of the rat lung (1.10±0.20 kPa for HA-MMP crosslinked hydrogel vs. 5.54±2.55 kPa for rat lung tissue,
[0170] To further enhance cell interaction with the matrix through other cancer-associated integrin receptors expressed on the cell surface (i.e., integrins αvβ3),.sup.[20] we immobilized the corresponding ligand (i.e. vitronectin peptide, maleimide-PQVTRGDVFTMP).sup.[21] into the gels via conjugation to the unreacted furanyls in the HA backbone.
[0171] The hyaluronan hydrogel-based platform favors cell invasion of TSC2.sup.+/− LAM-SMCs (
[0172] The small amount of MMP2 detected in the media-only control is attributed to the presence of 1% fetal bovine serum (FBS) used in the culture media..sup.[22] These data demonstrate that our 3D hydrogels differentiate the MMP-dependent invasive behaviors between patient-derived LAM-SMCs, control SMCs, and the angiomyolipoma TSC2.sup.−/− cell line, further validating this model to study LAM. Moreover, treatment of the invasive LAM-SMCs with the pan MMP inhibitor (GM6001, 10 μM) resulted in modest, yet statistically significant decrease in cell invasion (
[0173] The inventors questioned whether MMP-independent mechanisms are required for LAM-SMC hydrogel invasion given that viscoelastic matrices, which can be remodeled or deformed (by stress-relaxation), increase cell mobility and adhesion compared to elastic matrices..sup.[3c, 23] We show that LAM-SMCs, but not control cells, exhibit increased invasion (p<0.001) in the presence (vs. absence) of the viscoelastic polymer MC-SH (
[0174] To further assess MMP-independent cell invasion into our 3D hydrogels, cells were treated with the Src inhibitor, Saracatinib, and the ROCK inhibitor, Y-27632 (
In a further embodiment of the present disclosure, the cell can be treated with any one or a combination of the following agonists: [0232] GLUCOCORTICOID [0233] PKM2 [0234] PROGESTERONE [0235] RXR [0236] S1P RECEPTOR.
[0237] Together, HA and MC polysaccharides form a stable hydrogel for cell-mediated invasion that is both MMP-dependent—by degradation of MMP-cleavable crosslinks between HA chains, and MMP-independent—by physical displacement of reversible hydrophobic interactions between MC chains.
[0238] Immunocytochemistry of LAM lesions.sup.[25] suggests that in addition to TSC2.sup.−/− cells, TSC2.sup.+/− SMCs play a pathophysiological role in LAM lesions. We determined how TSC2 gene expression is affected by the substrate on which the cells are cultured and hypothesized that TSC2.sup.+/− LAM-SMCs cultured in our biomimetic hydrogel would behave more similarly to in vivo LAM cells. We previously reported that TSC2.sup.+/− LAM-SMCs express decreased levels of TSC2 at both mRNA and protein levels compared to TSC2.sup.+/+ control SMCs when cultured on 2D TCPS..sup.[12a]
[0239] To assess the impact of cell-substrate interactions, we quantified TSC2 levels by performing qRT-PCR of patient-derived TSC2.sup.+/− LAM-SMCs and TSC2.sup.+/+ control SMCs cultured on either stiff 2D TCPS or soft biomimetic 3D HA hydrogels (
[0240] To gain insight into the interactions between the 3D HA matrix and cells cultured therein, we assessed the cell surface abundance of CD44 and CD44v6 receptors that naturally bind to HA and are upregulated in many cancer cells,.sup.[26] including primary cells isolated from the lungs of LAM patients..sup.[14] TSC2.sup.+/− LAM-SMCs showed markedly increased expression of a variant of CD44 that is associated with LAM and cancer cell invasion (CD44v6) compared to control SMCs (
[0241] We demonstrate the role of vitronectin in our hydrogel platform by first confirming that LAM-SMCs express higher levels of the vitronectin-interacting integrin subunits αV, β1 and β3 compared to control SMCs (
[0242] To gain further insight into the differences between the percentage and number of invasive cells (
[0243] To test whether our hydrogel platform is optimized for performing high-content drug screening of cell invasion and viability, we compared our strategy to previously reported methods used to study LAM cell invasion, such as cell culture in conventional collagen I hydrogels and the use of angiomyolipoma (TSC2.sup.−/−) cells..sup.[11a, 27] In comparison to collagen I, we observed a greater difference in our HA hydrogels between TSC2.sup.+/− LAM-SMCs and TSC2.sup.+/+ control SMCs (
[0244] For invasive diseases, both cell viability and invasion are key outcome measures of drug therapies. Currently, the only approved therapeutic treatment for LAM is the mTORC1 inhibitor rapamycin,.sup.[28] which slows the decline in lung performance of LAM patients, but as a cytostatic and not cytotoxic agent, rapamycin has limited effectiveness. Upon withdrawal of rapamycin, lung function decreases comparably to placebo-treated control patients, emphasizing the need to discover more efficacious drugs. We tested the efficacy of rapamycin in our 3D hydrogel platform: treatment with rapamycin at 20 nM (and up to 1 μM) had little effect on the viability of either patient-derived TSC2.sup.+/− LAM-SMCs or TSC2.sup.+/+ control SMCs (
[0245] Next, we incorporated our hydrogel into a drug-screening platform and tested drug response between TSC2.sup.+/− LAM-SMCs and healthy TSC2.sup.+/+ control SMCs. We modified our culture system to a 384-well format to enable higher throughput screening and simultaneous quantification of cell invasion and cell viability. At the endpoint of the assay (4 days), cell viability is determined by staining with both Hoechst (for cell nuclei) and SyTox Green (for dead cells) while cell invasion is measured by automated confocal imaging: the hydrogel surface is demarcated using silica gel particles to accurately account for the gel-surface meniscus present in 384-well plates and z-stacked images are obtained for each well using an automated confocal high content imaging system (
[0246] The inventors have developed a novel algorithm in ImageJ to quantify cell invasion from the surface of the hydrogels by subtracting the Z-position of the cell nuclei from the Z-position of silica gel particles (i.e. at the gel surface) at the same XY coordinates. Together with identification of dead cells by staining with SyTox Green, this method enables independent quantification of viability and invasion of individual cells (
[0247] We used our 3D hydrogel platform to simultaneously and independently assess cell invasion and viability of a panel of 80 kinase inhibitors (
[0248] To test the broad utility of our hydrogel platform, multiple lung cancer cells were cultured on our HA hydrogels (
[0249] Confocal imaging analysis revealed different cell morphologies and levels of invasiveness, which cannot be assessed with conventional 2D cell culture or Boyden chamber/transwell assays. Cells isolated and cultured from three lung biopsies formed large cell clusters with spindle-like cells migrating away from these clusters; however, only cells from adenocarcinoma and squamous cell carcinoma biopsies showed high degrees of cell invasion (
[0250] The present disclosure also demonstrates its utility in a brain disease model, using glioblastomas (GBM) as an exemplary embodiment. As discussed in more detail under the “Example”, hydrogels were prepared by functionalizing relevant ECM molecules in the GBM microenvironment, namely hyaluronan, methylcellulose, adhesive peptides and enzymatically degradable peptides, with mutually reactive Diels-Alder functional groups. The biomimetic platform thus produced was then used to culture Patient-derived GBM cell lines and healthy human fetal neural stem cells (HFNSC's, a negative control).
[0251] Referring to
[0252] Integrin beta 1 (ITGB1) is involved in cellular binding to many extracellular matrix components, including fibronectin,[29] and ITGB1 gene knockdown has been shown to reduce invasion in cancer cells.[30] Thus, we hypothesized that ITGB1 knockdown would reduce the invasive behavior of glioblastoma stem cells (GSCs) isolated from brain cancer patients.
[0253] To knockdown the ITGB1 gene, we conjugated a Dicer-substrate siRNA against the gene target ITGB1 to an attenuated diphtheria toxin (aDT) delivery vehicle (to make aDT-ITGB1). We treated the GSCs with the aDT-ITGB1 conjugate and observed a significant reduction in the target mRNA compared to negative controls of siRNA only (without lipofectamine) and aDT conjugated to a non-targeting siRNA (aDT-NT) at 50 nM (
[0254] Non-limiting examples of furanyl groups include 2-methyl furan.
EXAMPLES
[0255] The following give detailed description of some non-limiting exemplary embodiments of the present disclosure, including material, but are not meant to be limiting.
Materials
[0256] Sodium hyaluronate (HA, 242 kDa) powder, was purchased from
[0257] Lifecore Biomedical (Chaska, Minn., USA). 4-(4,6-Dimeth-oxy-1,3,5-triazin-2-yl)-4-methyl-morpholinium chloride (DMTMM), dimethyl sulfoxide (DMSO), diisopropylcarbodiimide (DIC), borane dimethylamine complex, and triisopropylsilane were purchased from Sigma-Aldrich (St. Louis, Mo., USA). Tetrakis(triphenylphosphine)palladium was purchased from TCI America (Philadelphia, Pa., USA). Maleimide propanoic acid was purchased from Toronto Research Chemicals (Toronto, Canada). Amino acids and reagents for peptide synthesis were purchased from Anaspec (Fremont, Calif., USA). Furfurylamine was purchased from Acros Organics (New Jersey, N.J., USA). 2-(N-Morpholino)-ethanesulfonic acid (MES) was purchased from Bioshop Canada Inc. (Burlington, ON, Canada). Dulbecco's phosphate buffered saline (dPBS) was purchased from Multicell Technologies Inc. (Woonsocket, R.I., USA). Fluorescently labeled polystyrene microspheres (0.1 μM, orange) was purchased from Phosphorex (Hopkinton, Mass., USA). SiliFlash silica gel particles (40-63 μm, 230-400 mesh) were purchased from SiliCycle.
[0258] Phalloidin-AlexaFluor488, goat anti-mouse and anti-rabbit-AlexaFluor 488, and Hoescht 33342 were purchased from Life Technologies (Burlington, Canada). Dialysis membranes were purchased from Spectrum Laboratories Inc. (Rancho Dominguez, Calif., USA). M231 media, smooth muscle growth supplement (SMGS) and gentamycin were purchased from Thermo Fisher Scientific (Waltham, Mass. USA). Human bronchial epithelial cells were generously donated by Christine Bear (University of Toronto). NCI-H1299 (non-small cell lung cancer) and NCI-H446 (small cell lung cancer) cells, and RPMI-1640 media were purchased from ATCC. RPMI-1640 was purchased from CedarLane.
Peptide Synthesis
[0259] Vitronectin-mimetic peptide (maleimide)-KGGPQVTRGDVFTMPKG (1796 gmol.sup.−1), fibronectin (CS1 region)-mimetic peptide (maleimide)-DELPQLVTLPHPNLHGPEILDVPSTG (2940.6 gmol.sup.−1), MMP-degradable peptide crosslinker (maleimide)-KKGRGPQGIWGQKGPQGIWGQ- K(maleimide)S (2681 g mol.sup.−1) were synthesized using microwave-assisted Fmoc solid phase peptide synthesis with a CEM Liberty Blue automated peptide synthesizer.
[0260] For MMP-degradable peptide crosslinker, Fmoc-Lys(Alloc)-OH was first immobilized to Fmoc-Gly-Wang resin using manual solid phase peptide synthesis. Briefly, to 1.0 mmol of deprotected Gly-Wang resin, 3.0 mmol Fmoc-Lys(Alloc)-OH was pre-activated with HBTU (3.5 mmol) in a 3:1 mixture of dichloromethane (DCM):N-methyl pyrrolidinone (NMP) for 15 min. This mixture was then added to the pre-swollen Wang resin and 6.0 mmol diisopropylethylamine (DIPEA) was added and mixed overnight. Completion of the coupling reaction was monitored using the 2,4,6-trinitrobenzene sulfonic acid (TNBS) test. The remainder of the amino acids were coupled to the resin using standard Fmoc chemistry on a CEM solid phase peptide synthesizer. Following coupling of the final amino acid, the amine was kept protected with an Fmoc group. To functionalize the C-terminus of MMP-degradable peptides, further modifications were performed manually. The C-terminal allyloxycarbonyl (alloc) groups were cleaved using Pd(PPh.sub.3).sub.4 (cat.), borane dimethylamine complex (10 eq.) in DCM, under N.sub.2G overnight at room temperature. The resin was washed extensively with methanol and then DCM.
[0261] For both MMP-degradable, vitronectin- and fibronectin-mimetic peptides, the N-terminal Fmoc was deprotected using 20% piperidine in DMF. Maleimide propanoic acid (2.5 eq. relative to free amines) was diluted in a 3:1 mixture of DCM:NMP, and activated using diisopropylcarbodiimide (10.0 eq. relative to free amines) for 20 min. Diisopropyl urea byproducts were removed by filtration, and the resulting filtrate was then added to the peptide resin and mixed overnight. Reaction completion was monitored by performing a TNBS test. Finally, the peptide was cleaved from the resin using a cleavage cocktail comprising 9:1:0.5 (v/v/v) of TFA: triisopropylsilane: H.sub.2O and 10 eq. L-lysine. The resulting crude mixture was precipitated in cold diethyl ether. The resulting precipitate was centrifuged at 2200 RPM for 5 min. The ether washes were decanted and the precipitate was washed two more times with cold diethyl ether and allowed to dry overnight. The peptide was purified using C.sub.8 reversed phase HPLC (mobile phase: 15:85 to 50:50 (v:v) 0.1% TFA in acetonitrile:water gradient over 30 min). Peptides were characterized using mass spectrometry (electrospray ionization).
Hyaluronan Hydrogel Preparation
[0262] HA (230 kDa) was functionalized with furfurylamine as previously described.sup.[16] Furanyl-modified HA/MMPx-(maleimide).sub.2 hydrogels were prepared as previously described .sup.[16] with the following modifications: To prepare 1.0 mL of 0.9% HA hydrogel with 25 μM vitronectin peptide for SMC culture, HA-furanyl (65% furanyl substitution, 9.0 mg HA, 13.3 μmol furanyl) was dissolved in 450 μL of dPBS (adjusted to pH 6.5), and added to 357.7 μL of dPBS (pH 6.5). 150.1 μL of maleimide.sub.2-MMP-degradable crosslinker peptide dissolved in 0.1 M MES buffer (pH 5.5, 50 mg/mL, 2.8 μmol of peptide, 5.6 μmol of maleimide) and 3.75 μL of maleimide-vitronectin peptide dissolved in 0.1 M MES buffer (pH 5.5, 12 mg/mL, 25 nmol) were added to the HA-furanyl solution and carefully mixed to prevent the formation of air bubbles. 38.5 μL of a thiolated methyl cellulose solution (2.6 mg/mL MC-SH in DI H.sub.2O, 100 nmol.sub.free thiols/mg.sub.MC) was then added to this solution and mixed carefully with a pipette. Hydrogel formulations were tuned for lung cancer cells. For culturing primary cells from lung cancer tissue biopsies, 100 μM vitronectin peptides were used. For NCI-H1299, NCI-H446 and human bronchial epithelial cells, 100 μM vitronectin peptides and 100 μM fibronectin peptides were used. To prepare gels in 384-well plates, 15 μL of the hydrogel solutions were added to each well in a 384-well plate and placed in the incubator overnight at 37° C.
[0263] Excess sterile water was then added to wells lining the outside of the plates to prevent hydrogel evaporation. The next day, the gels were washed with PBS (75 μL each time, 2 times, 45 mins each), followed by equilibration in DMEM that does not contain FBS (75 μL, >45 mins). Gels were then equilibrated with either RPMI-1640 containing 1% FBS (for lung cancer cells) or M231 SMC media (75 μL, >45 mins). Media was then removed, and for SMC culture, 15 μL of M231 supplemented with 25% SMGS (containing a final FBS concentration of 1%) was added into each well for at least 1 h prior to cell seeding. For drug treatment assays, this 15 μL volume of M231 with 25% SMGS also includes a 5× concentration of the desired drug. For larger drug screening assays, Y-27632 (Rock inhibitor, 10 μM) was used as a negative control for cell invasion, and verteporfin (1 μM) was used as a positive control for cell toxicity (SyTox Green staining). For lung cancer cell culture, cells in RPMI media containing 1% FBS was added to each well.
Uncompressed Mechanical Testing
[0264] The Young's moduli were determined for HA hydrogels and healthy rat lungs. For HA hydrogels, 75 μL of gels comprising 1.1% HA and 4.18 mM of maleimide.sub.2-MMP-degradable crosslinker peptide were prepared with a 5 mm diameter. Gels were washed and pre-swollen in PBS prior to analysis. For rat lung tissue, lungs were soaked in PBS and then ethanol overnight prior to analysis. A 5 mm biopsy punch was used to isolate sections for mechanical testing. Samples were placed between two impermeable flat platens connected to a 150 g single axis load cell (ATI Industrial Automation) on a Mach-1 micro-mechanical system (Biomomentum), and an initial force of 0.01 N was applied to determine the surface of the sample. The initial sample height was determined as the platen-to-platen separation. An initial uniaxial, unconfined compression was applied at a strain of 10% of the gel height to even out surface defects. Sample analysis was performed by applying 2% strain for five steps, with a 60 second stress relaxation between each step. The Young's modulus was calculated from the slope of the resultant stress versus strain chart for each sample. Four separate samples were prepared and analyzed for each condition. For stress relaxation studies, hydrogels were compressed to 15% strain and maintained while the stress was measured as a function of time.
Cell Culture and Seeding on HA Hydrogels
[0265] Primary lung cancer cells were obtained from patient lung tumor tissues collected upon resection (lobectomy) following patient consent (Ottawa Hospital Research Ethics Board; Protocol # 20120559-01H). Areas containing tumor were identified by routine gross pathological examinations as: well differentiated neuroendocrine tumor, solid predominant adenocarcinoma or poorly differentiated squamous cell carcinoma. Cells were dissociated using collagenase and cultured on 6-well plates in 10% FBS in RPMI-1640 for 7 passages. 4000 cells in 60 μL of 1% FBS in RPMI-1640 was added to each well and cells were cultured on gels for 3 days prior to fixation with 49% PFA.
[0266] Commercial lung cancer cells (NCI-H446 and NCI-H1299) were cultured in 10% FBS in RPMI-1640 media. 4000 cells in 60 μL of 1% FBS in RPMI-1640 media was added to each well and cells were cultured on gels for 5 days prior to fixation with 4% PFA.
[0267] SMCs were cultured according to reported protocols..sup.[12a] In brief, cells were cultured in M231 media with Smooth Muscle Growth Supplement (SMGS) and gentamycin (ThermoFisher Scientific) at 37° C. with 5% CO.sub.2. Cells were passaged using 0.05% trypsin/EDTA for 3 min at 37° C., and inhibited using M231 media. 3000 cells in 45 μL of M231 without SMGS were added to each well of a 384-well plate containing 3D HA hydrogels.
Gelatin Zymography
[0268] After 1 day of culture, conditioned media from 384-well plates was collected from each well for gelatin zymography. 8% polyacrylamide (PA) gels were used, and were prepared as previously described.sup.[22] In general, the separating gel component of the zymography gels comprised 7.5 mL of 1.5 M Tris buffer (pH 8.8), 8.0 mL polyacrylamide solution (30%), 10.2 mL gelatin A (3 mg/mL), 2.7 mL water, 300 μL SDS, 300 μL 10% ammonium persulfate, and 36 μL TEMED. The separating gel was allowed to gel for 40 min at room temperature. The stacking gel was then prepared by mixing 5.0 mL of 0.5 M Tris buffer (pH 6.8), 2.6 mL polyacrylamide solution (30%), 12.2 mL water, 200 μL SDS, 150 μL 10% ammonium persulfate, and 30 μL TEMED. The stacking gel was poured on top of each gel and allowed to sit for 40 mins.
[0269] For each sample, 12 μL of conditioned media was mixed with 3 μL loading dye, and 12 μL was loaded into each lane. Running buffer comprising 25 mM Tris, 190 mM glycine and 0.1% SDS was used for gel electrophoresis. Following protein separation on the PA gels, gels were washed in 2.5% Triton X (3 times, 10 min each) to remove residual SDS, followed by DI water (5 times, 30 min each). Gels were then placed in an incubation buffer (50 mM Tris buffer pH 7.5 containing 5 mM CaCl.sub.2, 200 mM NaCl) and incubated at 37° C. overnight. The next day, zymography gels were stained with 0.4% Coumassie Blue for 2 h, followed by destaining in a mixture of 2.5:10:50 (acetic acid: methanol: water) until the white bands were visible.
Immunocytochemistry
[0270] To fix cells cultured in HA hydrogels, media was first carefully removed using a pipette, and 50 μL of 4% PFA (dissolved in PBS) was added for 1.5 h at room temperature. Gels were then carefully washed with 75 μL PBS (4 times, 20 min each with gentle agitation), and 1% BSA in PBS containing 0.1% TritonX was used to block non-specific interactions for at least 1 h.
[0271] Primary antibodies (1/100 dilution for each antibody) were diluted in 1% BSA/PBS containing 0.1% TritonX and 20 μL were added to each well, and incubated at 4° C. overnight with gentle agitation. The following primary antibodies were used: mouse anti-CD44 [F10-44-2] (ab6124, Abcam), rabbit anti-CD44v6 exon v6 (AB2080, Millipore), rabbit anti-integrin alpha 5 [EPR7854] (ab150361, Abcam), rabbit anti-integrin alpha V [EPR16800] (ab179475, Abcam), rabbit anti-integrin beta 1 (ab183666, Abcam), rabbit anti-integrin beta 3 (ab197662, Abcam), rabbit anti-integrin beta 5 (ab15459, Abcam). Gels were then washed extensively with 1% BSA/PBS containing 0.1% TritonX with gentle agitation (5 times, at least 1 h each time).
[0272] Secondary antibodies (goat anti-mouse-AlexaFluor488, donkey anti-mouse AlexaFluor555 or goat anti-rabbit-AlexaFluor 488, 1/100 dilution) and Hoechst (1/1000 dilutions) were diluted into the same solution in 1% BSA/PBS containing 0.1% TritonX and filtered through a 0.2 μm syringe filter. 20 μL was added into each well, and incubated at room temperature for 3 h. Gels were then washed using 1% BSA/PBS containing 0.1% TritonX extensively (5 times, at least 1 h each time with gentle agitation). Cells in the gels were then imaged in the 384-well plates.
Image Acquisition
[0273] Images were acquired using either an Olympus Fluoview (FV1000) inverted confocal microscope (for immunocytochemistry staining) or a Cellomics (VTI) high content imaging instrument equipped with a brightfield and an inverted confocal microscope (for quantification of cell invasion and viability). The same microscope settings were used for each set of analyses comprising multiple cell types. Negative controls were performed using samples stained with secondary antibodies only (i.e. without primary antibodies). Samples that contained multiple wavelengths were imaged using sequential irradiation of multiple lasers to prevent fluorescent crosstalk. 10× and 20× magnification (5-10 μm step size between Z-stacks) were used for immunocytochemistry staining (Olympus Fluoview) and 5× magnification (30 μm step size between Z-stacks) was used for quantification of cell invasion (Cellomics).
Quantification of Cell Invasion and Cell Viability
[0274] After 5 days of culture in 3D HA gels, 30 μL media was carefully removed. To each well, 20 μL of a solution containing SyTox Green (1/50,000) in PBS was added and incubated for 1.5 h at 37° C. Gels were then carefully washed with PBS twice. Cells were then fixed with 4% PFA for 1.5 h in the dark at room temperature. PFA was removed and gels were washed with PBS. A solution of Hoechst (1/1000, 20 μL) was then added to each well for at least 1.5 h in the dark, followed by washing with PBS (3 times). To label the gel surface, fluorescent microspheres (100 nm, orange, Phosphorex) were diluted in PBS (1/100) and centrifuged to separate larger, aggregated microspheres. 20 μL of the resulting supernatant were then added to each well and the 384-well plate was left undisturbed overnight. For drug screening experiments involving treatment with 80 drugs simultaneously, silica gel particles (40-63 μm, 230-400 mesh, SiliCycle) were used to label the cell surface. A slurry solution (5 mg/mL) of silica gel particles in PBS containing 0.01% sodium azide was mixed and immediately added to each well. Particles settled after 20 seconds and plates could be immediately imaged.
[0275] Z-stacked images were obtained using a Cellomics high content imaging instrument as described above. An algorithm was developed on ImageJ to quantify cell invasion and viability. Briefly, using the nuclear stain (Hoechst) channel, the three-dimensional Z-stack image is compressed into a 2D XY projection to identify the two-dimensional (X,Y) position of the cells. For each of these XY coordinates identified as cells, signal intensity peaks along the Z-axis corresponds to the Z-position of a cell, and the maximum peak intensity along that same Z-axis in the second channel (560 nm confocal laser for fluorescent beads or bright field for silica gel particles) corresponds to the top of the gel.
[0276] The difference between the Z-positions of the two channels (cell nuclei and fluorescent beads/silica gel particles) is equal to the distance of cell invasion. The signal intensity from the third channel (SyToxGreen) at each cell's three-dimensional position (X, Y, Z) is used to determine the cell viability. Viability is represented as SyToxGreen-negative cells (live cells).
Quantitative PCR Analysis
[0277] RNA was isolated using Trizol (Life Technologies). At least four wells in a 384-well plate were used for each condition. 8000 cells were seeded into each well and allowed to grow for 5 days prior to RNA isolation. Media was carefully removed from each well, 50 μL cold Trizol was added to each well, and the mixture was mixed several times using a pipette with a wide-orifice tip. The contents of at least four wells were pooled together for each condition, and vortexed until the gel was dissociated. RNA was extracted using manufacturer's protocol using 200 μL chloroform for for 1 mL trizol lysate. RNA was purified using a RNA Clean-up Kit (Macherey-Nagel NucleoSpin, Ref#: 740955.250) according to manufacturer's protocol. RNA was reverse transcribed into cDNA normalizing to 100 ng of template.
[0278] The primers were designed to span the exon-exon junction to prevent genomic DNA amplification. The primer pairs used were as follows: TSC2 FP ATGTGGTTCATCAGGTGCCG, TSC2 RP ACGTCTGTATCCTCTTGGGTC, gapdh FP AGGTCGGTGTGAACGGATTTG, gapdh RP TGTAGACCATGTAGTTGAGGTCA. Quantification was performed using Pfaffl's ΔΔCt method and GAPDH was used as the housekeeping gene.
[0279] Efficiency of the primers was derived by a relative standard curve using a positive template. Primer efficiencies were 1.932 (GAPDH) and 2.023 (TSC2).
Statistical Analysis
[0280] All statistical analyses were performed using GraphPad Prism version 6.00 for Mac (GraphPad Software, San Diego, Calif., USA). Differences amongst two treatments were assessed using an unpaired two-tailed t-test, while differences among groups of three or more treatments were assessed by one-way or two-way ANOVA with Tukey post hoc tests to identify statistical differences, unless otherwise stated in the figure captions. An α level of 0.05 was set as the criterion for statistical significance. Graphs are annotated with p values represented as *p≤0.05, **p≤0.01, ***p≤0.001, ****p≤0.0001. All data are presented as mean+standard deviation.
Development of a 3D Hydrogel Model of Glioblastoma (GBM) Invasion
[0281] Hydrogels are prepared by functionalizing relevant ECM molecules in the GBM microenvironment, namely hyaluronan, methylcellulose functionalized with thiols (MC-SH), adhesive peptides and enzymatically degradable peptides, with mutually reactive Diels-Alder functional groups. These are then combined to form a hydrogel comprising relevant tumour-mimetic ECM components. The final hydrogel formulation comprised 1 weight % methylfuran functionalized hyaluronan (HA-mF 242 kDa, 60% substitution), 2.3 mM bis-maleimide functionalized MMP-degradable peptide crosslinker (Mal-KKGGPQGIWGQKGPQGIWGQGK(Mal)S), 400 μM maleimide-functionalized fibronectin-mimetic peptide (Mal-SKAGPHSRNRGDSPG), and 0.1 mg/mL MC-SH. The hydrogels are washed once with PBS and thrice with cell culture media to remove unreacted components, and equilibrate the gels with the media.
[0282] Patient-derived GBM cell lines and healthy human fetal neural stem cells (HFNSC's, a negative control) are then cultured on top of the hydrogels. Cells were then treated with aDT-ITGB1 conjugates at a concentration of approximately 50 nM. Following this culture period, cells are fixed with 4% paraformaldehyde (PFA) and stained with Hoechst and phalloidin to visualize cell position and shape, or live/dead stains for cell viability readouts. The tops of the hydrogels are labelled with fluorescent beads and the cell-laden hydrogels are imaged using 3D z-stack confocal microscopy. A custom algorithm is used to analyse the relative depth of the cells compared to a threshold volume beneath the surface of the gels to quantify cell invasion.
[0283] One human fetal neural stem cell line and two patient derived GBM lines were cultured on the gels. The two patient derived cell lines tested invaded into the hydrogels, while the human fetal line grew as a non-invading monolayer on the hydrogel (
[0284] In summary, the modular design of the hydrogel system according to the present disclosure enables its physicochemical properties to be readily tuned to model disease and tissue-specific ECMs by independently modifying its biochemical composition, matrix stiffness and viscoelasticity. The present inventors hypothesize that this will allow other metastatic diseases involving tissue remodelling and invasion by protease-dependent and -independent mechanisms to be emulated. We demonstrate the breadth of our hydrogel platform to study LAM and lung cancer by culturing both primary human lung cancer cells and commercially-available lung cancer cells. These cancer cells invade into our hydrogels whereas healthy human bronchial epithelial cells do not, highlighting the application of our hydrogel platform to other diseases in addition to LAM.
[0285] The 3D hydrogel platform of the present disclosure, using the multi-well plate format, such as 6, 24, 48, 96, 384 or 1536 plates, with automated image acquisition and data analysis, can be readily scaled up using chemical synthesis and used by liquid handling automation to perform larger drug screens. With the ability to monitor invasion and viability at the individual cell level, more detailed analyses of cellular responses to drug treatments are possible, allowing for greater predictive capacity for efficacy than current strategies in drug discovery of anti-metastatic therapeutics.
[0286] To summarize, the present disclosure provides an extracellular biomimetic for culturing diseased cells, comprising:
[0287] hydrogel matrix,
[0288] a first extracellular matrix protein-mimetic peptide crosslinked to the hydrogel matrix, said first extracellular matrix protein-mimetic peptide being responsive to a first substance released by diseased cells upon invasion into the extracellular biomimetic, and
[0289] at least one modulating agent enabling cell invasion independent from said first substance.
[0290] In an embodiment, the hydrogel matrix comprises hyaluronate or hyaluronic acid, modified with furanyl functional groups.
[0291] In an embodiment, the furanyl functional groups are furan, or furan substituted with alkyl-, aryl-, or electron-donating functional groups.
[0292] In an embodiment, the modulating agent is at least one viscoelastic component forming reversible crosslinks within the hydrogel matrix.
[0293] In an embodiment, the viscoelastic component any one of comprises methyl cellulose, alginate crosslinked with calcium cations, amphiphilic block polymers, amphiphilic block polypeptides, coiled-coil peptides, reconstituted basement membrane protein extract, laminin, or collagen.
[0294] In an embodiment, the viscoelastic polymer is methyl cellulose having any one of aldehyde, ketone, hydrazine and thiol functional groups.
[0295] In an embodiment, the first extracellular matrix protein-mimetic peptide is further immobilized to the viscoelastic polymer.
[0296] In an embodiment, the extracellular biomimetic further comprises a second extracellular matrix protein-mimetic peptide immobilized to the hydrogel matrix and/or the viscoelastic polymer.
[0297] In an embodiment, the second extracellular matrix protein-mimetic peptide is present in the amount of less than about 1000 μM.
[0298] In an embodiment, the second extracellular matrix protein-mimetic peptide is present in the amount of about 25 μM to about 250 μM.
[0299] In an embodiment, the second extracellular matrix protein-mimetic peptide is any one or combination of vitronectin-mimetic peptide and fibronectin-mimetic peptide.
[0300] In an embodiment, the first substance released by diseased cells is an enzyme. In an embodiment, the enzyme is matrix metalloproteinase (MMP). In an embodiment, the first extracellular matrix protein-mimetic peptide is maleimide-modified collagen I-derived peptide crosslinker degradable by the MMP.
[0301] In an embodiment, the present disclosure also provides a cell culture kit comprising the extracellular biomimetic as disclosed above.
[0302] In an embodiment of the cell culture kit the diseased cells are from any invading cells, such as any one of the lung, brain, breast, prostate, skin, liver, colon, pancreas, thyroid, bone, muscle, human pluripotent stem cells and their subsequently differentiated cells.
[0303] In an embodiment of the cell culture kit, the diseased cells comprise cells isolated from lung cancer patients or derived from human pluripotent stem cells (hiPSCs) to model lymphangioleiomyomatosis (LAM).
[0304] In an embodiment of the cell culture kit,diseased cells comprise hiPSC-derived smooth muscle cells (SMCs) that model lymphangioleiomyomatosis (LAM-SMCs).
[0305] In an embodiment of the cell culture kit, the diseased cells comprise cells treated with one or any combination of inhibitors selected from the group consisting of those that inhibit: [0306] ABL1 [0307] ADENOSINE DEAMINASE [0308] AKT3 [0309] ALK [0310] ANDROGEN [0311] AROMATASE [0312] AURORA KINASE [0313] BCL-2 [0314] BRAF [0315] BRD [0316] BTK [0317] CALCINEURIN [0318] CCR5 [0319] CDK [0320] CXCR [0321] CYTOCHROME P450 [0322] DAGK [0323] DNA METHYLTRANSFERASE [0324] DNA TOPOISOMERASE [0325] EGFR [0326] EPH [0327] ERK [0328] Fibroblast Growth Factor Receptors [0329] FARNESYLTRANSFERASE [0330] FLT [0331] FRAP [0332] GS K3 [0333] HDAC [0334] HEAT SHOCK PROTEIN [0335] HEDGEHOG [0336] IRE1 [0337] ITGB1 [0338] JAK2 [0339] KDR [0340] KINESIN-LIKE SPINDLE PROTEIN [0341] KIT [0342] LCK [0343] LIMK1 [0344] LYN [0345] MAP2K [0346] MDM2 [0347] P38B [0348] P70S6K [0349] PARP [0350] PDGFR [0351] PI3K [0352] PKC [0353] PLK1 [0354] PIM2 [0355] PROTEASOME [0356] RAF1 [0357] Rho-associated protein kinase [0358] RET [0359] Src [0360] SIRT2 [0361] SPHINGOSINE KINASE [0362] TANKYRASE [0363] TUBULIN [0364] WNT,
or one or any combination of agonists selected from the group consisting of: [0365] GLUCOCORTICOID [0366] PKM2 [0367] PROGESTERONE [0368] RXR [0369] S1P RECEPTOR.
[0370] In an embodiment of the cell culture kit, the kit includes 6, 24, 48, 96, 384 or 1536 well plates.
[0371] In an embodiment the present disclosure provides a drug screening method comprising: [0372] culturing diseased cells in the extracellular biomimetic as disclosed above; [0373] quantifying invasion and viability of the diseased cells; [0374] administering candidate drug compounds to the biomimetic; and [0375] identifying compounds that reduce both the invasion and viability of the diseased cells.
[0376] In an embodiment of the method the quantifying step comprises measuring the invasion of the diseased cells by staining cells with fluorescent dyes, automated confocal imaging, and automated analysis by an image analysis software program such as custom Image J macros.
[0377] In an embodiment of the method the quantifying step comprises measuring the viability of the diseased cells by staining the dead cells with fluorescent dyes, automated microscopic imaging such as confocal imaging, and automated analysis by an image analysis software program such as custom Image J macros.
[0378] In an embodiment of the method, the diseased cells are from any one of the lung, brain, skin, breast, prostate, liver, colon, pancreas, thyroid, bone, muscle, human pluripotent stem cells and their subsequently differentiated cells.
[0379] In an embodiment of the method the diseased cells comprise cells isolated from lung cancer patients or derived from human pluripotent stem cells (hiPSCs) to model lymphangioleiomyomatosis (LAM).
[0380] In an embodiment of the method the diseased cells comprise hiPSC-derived smooth muscle cells (SMCs) that model lymphangioleiomyomatosis (LAM-SMCs).
[0381] In an embodiment of the method the diseased cells comprise cells treated with one or any combination of inhibitors selected from the group consisting of those that inhibit:
[0382] ABL1 [0383] ADENOSINE DEAMINASE [0384] AKT3 [0385] ALK [0386] ANDROGEN [0387] AROMATASE [0388] AURORA KINASE [0389] BCL-2 [0390] BRAF [0391] BRD [0392] BTK [0393] CALCINEURIN [0394] CCR5 [0395] CDK [0396] CXCR [0397] CYTOCHROME P450 [0398] DAGK [0399] DNA METHYLTRANSFERASE [0400] DNA TOPOISOMERASE [0401] EGFR [0402] EPH [0403] ERK [0404] Fibroblast Growth Factor Receptors [0405] FARNESYLTRANSFERASE [0406] FLT [0407] FRAP [0408] GSK3 [0409] HDAC [0410] HEAT SHOCK PROTEIN [0411] HEDGEHOG [0412] IRE1 [0413] ITGB1 [0414] JAK2 [0415] KDR [0416] KINESIN-LIKE SPINDLE PROTEIN [0417] KIT [0418] LCK [0419] LIMK1 [0420] LYN [0421] MAP2K [0422] MDM2 [0423] P38B [0424] P70S6K [0425] PARP [0426] PDGFR [0427] PI3K [0428] PKC [0429] PLK1 [0430] PIM2 [0431] PROTEASOME [0432] RAF1 [0433] RET [0434] Rho-associated protein kinase [0435] Src [0436] SIRT2 [0437] SPHINGOSINE KINASE [0438] TANKYRASE [0439] TUBULIN [0440] WNT,
or one or any combination of agonists selected from the group consisting of: [0441] GLUCOCORTICOID [0442] PKM2 [0443] PROGESTERONE [0444] RXR [0445] S1P RECEPTOR.
[0446] In an embodiment the method is carried out in a cell culture kit having 6, 24, 48, 96, 384 or 1536 well plates. In an embodiment each plate of the cell culture kit contains both diseased cells and control cells.
REFERENCES p0 [1] a) F. Sabeh, R. Shimizu-Hirota, S. J. Weiss, J. Cell Biol. 2009, 185, 11; b) P. Friedl, K. Wolf, Nat. Rev. Cancer 2003, 3, 362.
[0447] [2] J. F. de Groot, G. Fuller, A. J. Kumar, Y. Piao, K. Eterovic, Y. Ji, C. A. Conrad, Neuro-Oncology 2010, 12, 233. [0448] [3] a) M. J. Bissell, D. C. Radisky, A. Rizki, V. M. Weaver, O. W. Petersen, Differentiation 2002, 70, 537; b) C. Yang, M. W. Tibbitt, L. Basta, K. S. Anseth, Nat. Mater. 2014, 13, 645; c) O. Chaudhuri, L. Gu, M. Darnell, D. Klumpers, S. A. Bencherif, J. C. Weaver, N. Huebsch, D. J. Mooney, Nat. Commun. 2015, 6, 6364. [0449] [4] A. Glentis, P. Oertle, P. Mariani, A. Chikina, F. El Marjou, Y. Attieh, F. Zaccarini, M. Lae, D. Loew, F. Dingli, P. Sirven, M. Schoumacher, B. G. Gurchenkov, M. Plodinec, D. M. Vignjevic, Nat. Commun. 2017, 8, 924. [0450] [5] O. W. Petersen, L. Ronnov-Jessen, A. R. Howlett, M. J. Bissell, Proc. Natl. Acad. Sci. U. S. A. 1992, 89, 9064. [0451] [6] S. R. Caliari, J. A. Burdick, Nat. Methods 2016, 13, 405. [0452] [7] a) S. A. Fisher, R. Y. Tam, A. Fokina, M. M. Mahmoodi, M. D. Distefano, M. S. Shoichet, Biomaterials 2018, 178, 751; b) J. Patterson, J. A. Hubbell, Biomaterials 2010, 31, 7836. [0453] [8] M. Ehrbar, A. Sala, P. Lienemann, A. Ranga, K. Mosiewicz, A. Bittermann, S. C. Rizzi, F. E. Weber, M. P. Lutolf, Biophys. J. 2011, 100, 284. [0454] [9] A. Winer, S. Adams, P. Mignatti, Mol. Cancer Ther. 2018, 17, 1147. [0455] [10] a) H. A. Kenny, M. Lal-Nag, E. A. White, M. Shen, C. Y. Chiang, A. K. Mitra, Y. Zhang, M. Curtis, E. M. Schryver, S. Bettis, A. Jadhav, M. B. Boxer, Z. Li, M. Ferrer, E. Lengyel, Nat. Commun. 2015, 6, 6220; b) N. A. Evensen, J. Li, J. Yang, X. Yu, N. S. Sampson, S. Zucker, J. Cao, Plos One 2013, 8, e82811; c) Y. Fang, R. M. Eglen, SLAS Discovery 2017, 22, 456. [0456] [11] a) T. N. Darling, G. Pacheco-Rodriguez, A. Gorio, E. Lesma, C. Walker, J. Moss, Lymphatic Res. Biol. 2010, 8, 59; b) E. P. Henske, F. X. McCormack, J. Clin. Invest. 2012, 122, 3807. [0457] [12] a) L. M. Julian, S. P. Delaney, Y. Wang, A. A. Goldberg, C. Dore, J. Yockell-Lelievre, R. Y. Tam, K. Giannikou, F. McMurray, M. S. Shoichet, M. E. Harper, E. P. Henske, D. J. Kwiatkowski, T. N. Darling, J. Moss, A. S. Kristof, W. L. Stanford, Cancer Res. 2017, 77, 5491; b) S. P. Delaney, L. M. Julian, A. Pietrobon, J. Yockell-Lelièvre, C. Doré, T. T. Wang, V. C. Doyon, A. Raymond, D. A. Patten, M.-E. Harper, H. Sun, W. L. Stanford, BioRxiv. 2019, doi: https://doi.org/10.1101/683359 [0458] [13] C. J. Whatcott, H. Han, R. G. Posner, G. Hostetter, D. D. Von Hoff, Cancer Discov 2011, 1, 291. [0459] [14] G. Pacheco-Rodriguez, W. K. Steagall, D. M. Crooks, L. A. Stevens, H. Hashimoto, S. Li, J. A. Wang, T. N. Darling, J. Moss, Cancer Res. 2007, 67, 10573. [0460] [15] S. Misra, V. C. Hascall, R. R. Markwald, S. Ghatak, Front. Immunol. 2015, 6, 201. [0461] [16] S. C. Owen, S. A. Fisher, R. Y. Tam, C. M. Nimmo, M. S. Shoichet, Langmuir 2013, 29, 7393. [0462] [17] M. K. Glassberg, S. J. Elliot, J. Fritz, P. Catanuto, M. Potier, R. Donahue, W. Stetler-Stevenson, M. Karl, J. Clin. Endocrinol. Metab. 2008, 93, 1625. [0463] [18] B. Suki, J. H. Bates, Respir. Physiol. Neurobiol. 2008, 163, 33. [0464] [19] A. J. Booth, R. Hadley, A. M. Cornett, A. A. Dreffs, S. A. Matthes, J. L. Tsui, K. Weiss, J. C. Horowitz, V. F. Fiore, T. H. Barker, B. B. Moore, F. J. Martinez, L. E. Niklason, E. S. White, Am. J. Respir. Crit. Care Med. 2012, 186, 866. [0465] [20] M. Y. Hsu, D. T. Shih, F. E. Meier, P. Van Belle, J. Y. Hsu, D. E. Elder, C. A. Buck, M. Herlyn, Am. J. Pathol. 1998, 153, 1435. [0466] [21] S. Suzuki, A. Oldberg, E. G. Hayman, M. D. Pierschbacher, E. Ruoslahti, EMBO J. 1985, 4, 2519. [0467] [22] X. Hu, C. Beeton, J. Vis. Exp. 2010, 45, 2445. [0468] [23] A. R. Cameron, J. E. Frith, G. A. Gomez, A. S. Yap, J. J. Cooper-White, Biomaterials 2014, 35, 1857. [0469] [24] a) K. C. Williams, M. G. Coppolino, J. Cell Sci. 2014, 127, 1712; b) C. Albiges-Rizo, O. Destaing, B. Fourcade, E. Planus, M. R. Block, J. Cell Sci. 2009, 122, 3037. [0470] [25] D. Clements, A. Dongre, V. P. Krymskaya, S. R. Johnson, Plos One 2015, 10, e0126025. [0471] [26] a) C. Underhill, J. Cell Sci. 1992, 103, 293; b) K. H. Heider, H. Kuthan, G. Stehle, G. Munzert, Cancer lmmunol. Immunother. 2004, 53, 567. [0472] [27] C. Li, P. S. Lee, Y. Sun, X. Gu, E. Zhang, Y. Guo, C. L. Wu, N. Auricchio, C. Priolo, J. Li, A. Csibi, A. Parkhitko, T. Morrison, A. Planaguma, S. Kazani, E. Israel, K. F. Xu, E. P. Henske, J. Blenis, B. D. Levy, D. Kwiatkowski, J. J. Yu, J. Exp. Med. 2014, 211, 15. [0473] [28] F. X. McCormack, Y. Inoue, J. Moss, L. G. Singer, C. Strange, K. Nakata, A. F. Barker, J. T. Chapman, M. L. Brantly, J. M. Stocks, K. K. Brown, J. P. Lynch, 3rd, H. J. Goldberg, L. R. Young, B. W. Kinder, G. P. Downey, E. J. Sullivan, T. V. Colby, R. T. McKay, M. M. Cohen, L. Korbee, A. M. Taveira-DaSilva, H. S. Lee, J. P. Krischer, B. C. Trapnell, C. National Institutes of Health Rare Lung Diseases, M. T. Group, N. Engl. J. Med. 2011, 364, 1595. [0474] [29] J. D. Humphries, A. Byron, M. J. Humphries, J. Cell Sci. 2006, 119, 3901. [0475] [30] K. Koshizuka, N. Kikkawa, T. Hanazawa, Y. Yamada, A. Okato, T. Arai, K. Katada, Y. Okamoto, N. Seki, Oncotarget 2017, 9, 3663.