LIVE-ATTENUATED LISTERIA MONOCYTOGENES AND METHODS FOR USING THE SAME

Abstract

The present invention provides a construction method and application of a live-attenuated Listeria monocytogenes, in which a wild-type strain of Listeria monocytogenes EGD-e is used as construction parental strains, and the residues N478 and V479 of LLO are respectively mutated into plasmid free alanine. The live-attenuated strain of Listeria monocytogenes in the present invention can be used as a live vaccine vector and an immunologic adjuvant.

Claims

1. A live-attenuated Listeria monocytogenes, wherein wild-type strain of Listeria monocytogenes EGD-e is used as a construction parental strain, and residues N478 and V479 of the cytolysin lysteriolysin O (LLO) are respectively mutated into alanine without containing plasmids; finally obtained live-attenuated strain is named as Lemo-C07, the preservation number of the live-attenuated strain is CGMCC 18647, and the preservation institution is China General Microbiological Culture Collection Center.

2. An antibody, wherein the antibody is produced by immunity to the live-attenuated Listeria monocytogenes of claim 1.

3. A vaccine, wherein the vaccine contains the live-attenuated Listeria monocytogenes of claim 1.

4. The live-attenuated Listeria monocytogenes according to claim 1, wherein the live-attenuated Listeria monocytogenes can be used as a live vaccine vector, a prophylactic vaccine vector or a therapeutic vaccine vector.

5. A construction method of the live-attenuated Listeria monocytogenes of claim 1, including following steps: (1) constructing homologous recombinant plasmids, (2) preparing competent EDG-e cells; (3) employing the recombinant plasmids obtained in Step (1) to electroporate into the competent EDG-e cells obtained in Step (2); and (4) screening the recombinant plasmids (Lemo-C07).

6. The construction method of the live-attenuated Listeria monocytogenes according to claim 5, wherein Step (1) specifically includes following process: constructing a recombination homology arm of amino acids 257 to 259 of LLO of Listeria monocytogenes EGD-e, using Sal I and BamH I as restriction enzymes, inserting into pKSV7 by the restriction enzymes and DNA ligase, designing primers for site-directed mutagenesis, and constructing the recombinant plasmids for homologous recombination.

7. The construction method of the live-attenuated Listeria monocytogenes according to claim 5, wherein Step (2) specifically includes following process: inoculating the Listeria monocytogenes wild-type strain EGD-e in fresh and sterile brain-heart infusion (BHI) broth of 100 mL (containing 0.5 M sucrose), culturing by shaking at 37° C. until an OD.sub.600 nm value is approximately 0.18-0.25; adding penicillin G (filtered for sterilization) to make a final concentration at 20 μg/mL, culturing by shaking at 37° C. for 2 hours; collecting cultures, adding an appropriate amount of washing buffer (pre-cooled) containing 1 mM HEPES and 0.5 M sucrose for washing twice; discarding the supernatant, adding the washing buffer of 1 mL to the precipitate, re-suspending the cultures; separating and placing in a refrigerator at −80° C. for later use.

8. The construction method of the live-attenuated Listeria monocytogenes according to claim 5, wherein Step (3) specifically includes following process: electroporating the recombinant plasmids obtained in Step (1) into the live-attenuated Listeria monocytogenes competent EGD-e cells obtained in Step (2), adding to a pre-warmed 1 mL BHI broth (containing 0.5 M sucrose), and mixing thoroughly, placing all cultures in a constant temperature incubator at 30° C. for 2-3 h; plating a transfer solution on a chloramphenicol-resistant BHI solid medium and culturing at 37° C.

9. The construction method of the live-attenuated Listeria monocytogenes according to claim 5, wherein the Step (4) specifically includes following process: taking colonies obtained in Step (3) and amplifying cultures thereof in a BHI broth for verification by a polymerase chain reaction (PCR) assay, placing verified positive strains at 42° C. for homologous recombination and passaging successively for plasmid excision and curing at 30° C., and finally confirming by PCR screening and DNA sequencing to obtain the recombinant live-attenuated Listeria monocytogenes (Lemo-C07), adding 60% glycerol at a ratio of 1:1 and storing in a refrigerator at −80° C.

Description

DESCRIPTION OF DRAWINGS

[0022] In order to make objectives, technical solutions and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration:

[0023] FIG. 1 is a plasmid map of the homologous recombination of Listeria monocytogenes containing a recombination homology arm of amino acids 257 to 259 of the hly gene of EGD-e, wherein the 221st and 222nd sites of this segment (corresponding to amino acids 478 to 479 of EGD-e hly, respectively) are alanine, and a chloramphenicol resistance gene CAT is further contained;

[0024] FIG. 2 is a verification diagram shows that the recombinant plasmids are electroporated into Listeria, wherein M refers to a DNA ladder, 1 and 2 refer to target fragments amplified after electroporation, EGD-e hly 257-529aa, and 1 and 2 are derived from different monoclonals.

[0025] FIG. 3 shows a comparison of growth capacity of EGD-e and Lemo-C07 in BHI:

[0026] FIG. 4 shows verification of protein expression of EGD-e and Lemo-C07 by western blotting;

[0027] FIG. 5 is an evaluation of a hemolytic ability of EGD-e and Lemo-C07 secreted proteins;

[0028] FIG. 6 shows a comparison of migration ability between EGD-e and Lemo-C07 cells;

[0029] FIG. 7 shows a comparison of a proliferation ability of EGD-e and Lemo-C07 in macrophages;

[0030] FIG. 8 shows an LD50 (median lethal dose) of EGD-e and Lemo-C07 in ICR mice;

[0031] FIG. 9 shows a bacterial load ratio of EGD-e and Lemo-C07 in liver and spleen of ICR mice;

[0032] FIG. 10 shows determination of the transcription level of inflammatory factors in mouse macrophages compared with Lemo-C07.

SPECIFIC EMBODIMENTS

[0033] A detailed description of preferred embodiments of the present invention is given below in conjunction with the accompanying drawings.

[0034] The strains, reagents and instruments used in embodiments of the present invention are introduced firstly:

[0035] Main bacterial strains: a wild-type strain of Listeria monocytogenes. EGD-e, which is purchased from the ATCC standard strain, and can be obtained by the public as per national regulations. The live-attenuated Listeria monocytogenes of the present invention is named Lemo-C07, its preservation number is: CGMCC 18647, and the preservation institution is the General Microbiology Center of the China General Microbiological Culture Collection Center. (Address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing: Zip code 100101).

[0036] Main Reagents: LB Culture Medium, Agarose H, and AGAR (which are all purchased from Sangon Biotech (Shanghai) Co., Ltd.,); BHI Culture Medium (purchased from Oxoid Microbiology Products); PCR and Gel Extraction Kit (purchased from Favorgen Biotech Corp.,); Plasmid Extraction Kit and Cell Total RNA Extraction Kit (purchased from Tiangen Biotech (Beijing) Co. Ltd.); PCR Related Reagents (purchased from Vazyme Biotech Co., Ltd.); DNA Ligase (Ligation High Ver. 2) (purchased from Toyobo Co. Ltd.); Restriction Enzymes (purchased from NEB Inc.); Ampicillin and Kanamycin (purchased from Sangon Biotech (Shanghai) Co., Ltd.): Reverse Transcription Kit (Purchased from Toyobo Co. Ltd.); DMEM. FBS, PBS and Protein Maker (which are all purchased from Thermo Fisher Scientific).

[0037] Key instruments: Shaker (HZ-9211K); Vortex Oscillator (Zealway GI 541); Multi-functional Microplate Instrument (Bio Tek Synergy™ H1); Gradient PCR Instrument (Ependort); Gel Imaging System (UVP); Metal Bath (Thermo); Biosafety Cabinet (BSC-II); Electroshock Conversion Instrument (BTX ECM 630); Protein Electrophoresis Instrument (Biorad); and Cell Carbon Dioxide Incubator (Thermo).

Embodiment 1

Construction of a Live-Attenuated Vaccine Vector

1. Construction of Recombinant Plasmids

[0038] The desired fragment is directly cloned from a wild-type strain of Listeria monocytogenes, EGD-e (ATCC standard strain), and, Vector NTI Explorer is applied to design the amplification primers pSL279-Sal I-F and pSL279-BamH I-R, which have a length of 819 bp as shown in SEQ ID NO 0.1, and the related primers are shown in Table 1.

TABLE-US-00001 TABLE 1 primers for gene amplification and verification of EGD-e hly. Primers Sequences (5′-3′) pSL279-SalI-F ACGCGTCGACAACGTGAATGTTAATGAACCTACAAGAC (as shown in SEQ ID NO. 2) pSL279-BamHI-R CGCGGATCCTTCGATTGGATTATCTACTTTATTACTATATTTC (as shown in SEQ ID NO. 3) homoarm front ATTTAAAGCTGTAAATAATAGCTTGAATGTA (as shown in SEQ ID NO. 4) M13-F TGTAAAACGACGGCCAGT (as shown in SEQ ID NO. 5) M13-R AGCGGATAACAATTTCACACAGGA (as shown in SEQ ID NO. 6) pSL282-F AACGCGAGAAATATTGCTGCTTACGCTAAAGAATGCACT (as shown in SEQ ID NO. 7) pSL282-R ATGCATTCTTTAGCGTAAGCAGCAATATTTCTCGCGTT (as shown in SEQ ID NO. 8) Note: pSL279-SalI-F is an upstream primer; pSL279-BamH1-R is a downstream primer; Homoarms front is a primer used for verification at a distance of 63 bp from the homology arm on the Listeria genome; M13-F is an upstream verification primer on the pKSV7 plasmid; M13-R is a downstream verification primer on the pKSV7 plasmid; pSL282-F is an upstream primer for constructing point mutations; PSL282-R is a downstream primer for constructing point mutations.

[0039] Specific operations comprising: taking a standard strain EGD-e as a template, using primers pSL279-NdeI-few and pSL279-XhoI-rev to amplify amino acids 257 to 529 of hly of EGD-e to obtain a fragment of 819 bp for PCR product purification, then conducting a double enzyme digestion on the purified fragment and vector (pKSV7) with Sail and BamH I, purifying the product with PCR Clean-UP Kit and Gel Extraction Kit according to their instructions to obtain the purified product, mixing 6 μL of PCR product, 4 μL of vector and 10 μL of DNA ligase and placing the mixture in a metal bath of 16° C. for a ligase chain reaction about 40 min to obtain the intermediate plasmids, performing a full-length amplification on the intermediate plasmids with pSL282-F (pSL282-R primers contain mutations at key sites), then adding Dpn I restriction enzyme and placing the mixture in a 37° C. metal bath for 3 hours to eliminate the intermediate plasmids and obtain the recombinant plasmids pSL282 containing the mutation site. (The plasmid construction map is shown in FIG. 1)

2. Preparation of EGD-e Competent Cells

[0040] The wild-type strains of Listeria monocytogenes, EGD-e are inoculated in 100 mL BHI (containing 0.5M sucrose) broth and cultured with shaking at 37° C. till an OD.sub.600nm value of 0.2, then 20 μg/mL penicillin G (filter sterilized) is added, the mixture is cultured with shaking at 37° C. for 2 h; then the bacterial cells are collected after taking a centrifugation at 3500 rpm, 4° C. for 10 min and discarding the supernatant, after that, a mixed liquid containing about 15 mL of 1 mM HEPES and 0.5M sucrose (pre-cooled) is added to re-suspend the bacterial cells; a mixed liquid containing 1 mL of 1 mM HEPES and 0.5M sucrose is added to the precipitate, then the bacterial cells are re-suspended, separated and stored in a refrigerator at −80° C. for later use.

3. Electroporation of Listeria

[0041] Introducing 1 μg of recombinant plasmids (pSL282) into the competent cells prepared above by an electroporator (conditions: 2500V, 2000, 25 μF), after electroporation, 1 mL of pre-warmed BHI broth (containing 0.5 M sucrose) is quickly added, the liquid is pipetted and mixed well before be transferred into a new 1.5 mL EP tube and placed in a 30° C. constant temperature incubator for 2-3 hours, then the centrifugation is taken (at 6000 rpm for 2 min), 150 μL of supernatant is saved to re-suspend the bacterial liquid which is plated on the chloramphenicol-resistant BHI agar containing chloramphenicol, and then placed in a constant temperature incubator at 37° C. for 24-48 h to obtain monoclonal colonies.

4. Culturing and Screening of Lemo-C07 by Homologous Recombination

[0042] Monoclonal colonies are picked to be inoculated in BHI (Cm10 resistant) liquid medium which is grown overnight at 37° C. with shaking, M13F/R primers are used to verify the obtained plasmids, when there is an obvious bar at 961 bp, it indicates that the electro-transformation is successful; the corresponding colonies is placed at 42° C. for homologous recombination and the genome is extracted every 5 generations, then homo-arm front and pSL282-BamHI-R are used to perform PCR amplification (as shown in FIG. 2, the PCR verification map shows that there is a clear bar at 882 bp) and the sequencing; when amino acids at positions 221 and 222 (corresponding to amino acids 478 to 479 of EGD-e hly, respectively) of the fragment are alanine, a continuous passage at 30° C. without resistance is conducted, and a resistance screening and gene sequencing are performed every 10 generations until the plasmids are totally lost, the recombinant live-attenuated Listeria monocytogenes Lemo-C07 are obtained, the bacteria liquid with correct sequencing and 80% glycerol 1:1 are mixed and stored in a refrigerator at −80° C.

Embodiment 2

Phenotypic Analysis of Live-Attenuated Strains and Biological Analysis of Infection

1. Growth Capacity Analysis:

[0043] A single colony in 5 mL BHI broth is picked and then grown overnight at 37° C. in 5 mL BHI broth with shaking, 1 mL of bacterial liquid is taken to make the OD.sub.600nm value 0.2 and diluted 100 times with fresh BHI broth, and 200 μL of that is taken into 98-well microtiter plate so that there are three in parallel for each bacterium; the value of OD.sub.600nm thereof is measured by the microplate reader before putting it in a constant temperature incubator at 37° C., the measurement is taken every 1 h and kept for 12 h continuously. As shown in FIG. 3, compared with the wild strain EGD-e, the growth ability of Lemo-C07 in BHI medium is not affected.

2. Cell Fractionation and Protein Localization of LLO

[0044] A single colony in 5 mL BHI broth is picked and placed in a shaker at 37° C. overnight, and 1 mL of overnight culture broth is transferred into 100 mL of BHI broth with shaking at 37° C. for 8-9 h, the centrifugation is taken to filter the supernatant;

the filtered supernatant is precipitated with trichloroacetic acid overnight, after that, the solution is centrifuged at 12000 rpm, 4° C. for 20 minutes and the supernatant is discarded, 1 mL of DAB is used to re-suspend the precipitate, the liquid is centrifuged to take the supernatant and the secretory protein is obtained; the centrifuged deposit is washed with 50 mM PBS, re-suspended with 1 mL of Listeria Lysate, broken by a homogenizer and centrifuged to take the supernatant, then the cytoplasmic protein is obtained. After measuring and quantifying the secreted protein and cytoplasmic protein with the BCA protein concentration determination kit, protein loading buffer (4×Loading Buffer) is added, and the mixture is boiled for 6-7 minutes to complete the preparation of protein samples, then Western blotting is conducted to detect protein expression. As shown in FIG. 4, compared with that of the wild strain EGD-e, the protein expression level of Lemo-C07 is unchanged, indicating that Lemo-C07 could be used as a specific vaccine vector to carry specific antigen expression.

3. LLO-Mediate Hemolytic Assay

[0045] Sheep red blood cells are centrifuged at 1000 rpm, 4° C. for 10 minutes, and the supernatant and white blood cell layer are removed, saline is added to gently resuspend the red blood cells and centrifugation is performed to remove the supernatant, the red blood cells are repeatedly washed for 2-3 times, and the washed red blood cells and saline are prepared into a 5% sheep red blood cell-saline suspension (SRBC-0.9% NaCl), strains are cultivated till the OD.sub.600nm value is 0.6 then centrifuged at 12000 rpm for 1 min, the culture supernatant (the secreted proteins containing mature LLO proteins) is collected, and 200 μL of the culture supernatant and an equal volume of 10 mM PBS (pH=5.5) are taken to be mixed and incubated at 37° C. for 10 minutes, then the same volume of 5% SRBC-0.9% NaCl as the supernatant is added into the mixture so that each group has three parallel ones; at the same time, a negative control for the test is arranged, that is 100 μL of 10 mM PBS and the same volume of 5% SRBC-0.9% NaCl as the supernatant are added into the mixture to cultivate together; furthermore a positive control is set up, that is, 2 μL of Triton X-100 on the basis of the negative control is added; the mixture is stood at 37° C. for 30 minutes' cultivation, then it is centrifuged at 12000 rpm for 1 min, 200 μL of supernatant is taken to be measured the light absorption value at OD.sub.600nm. As shown in FIG. 5, the hemolytic activity of Lemo-C07 is greatly reduced and has good safety, and mean comparison between two samples is conducted by Student's t test, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. Results represent at least two individual experiments.

4. Plaque Assay in L929 Fibroblast Cells

[0046] L929 cells is laid on a 6-well cell culture plate overnight, the cells are infected with Lemo-C07 and wild-type strains at MOI=1:2.5 and placed in a cell culture incubator (conditions: 37° C., 5% CO.sub.2), with shaking the culture plate every 15 minutes to make bacterium evenly distributed, after 1 h, 10 mM PBS (pH=7.4) is used to wash them 2-3 times, phenol red-free DMEM medium containing 100 μg/mL gentamicin is added for further cultivation, after 1 h, 10 mM PBS (pH=7.4) is used to wash the mixture 2-3 times, 3 mL of a mixed liquid of low melting-point agarose with a final concentration of 0.7% and phenol red-free DMEM medium (containing 10 μg/mL gentamicin and 10% FBS) are added, the mixture is placed in a cell culture incubator (conditions:37° C., 5% CO.sub.2) for 48 h; 600 μL of formaldehyde solution is added to each well and placed in a 37° C. incubator for 1-2 h, then the agar is removed, 0.5% crystal violet solution is used to stain for 5-7 min, and the size and number of plaques can be observed. As shown in FIG. 6, compared to the wild-type strains, Lemo-C07 has no reduction in the number of plaques, indicating that its ability of intercellular migration is not affected.

5. Proliferation in RAW264.7 Macrophages

[0047] Raw 264.7 cells are plated on a 12-well cell culture plate overnight, the cells are infected with Lemo-C07 and the wild-type strains at MOI=1:20, and incubated in a cell culture incubator (conditions: 37° C., 5% CO.sub.2) for 30 minutes, 10 mM PBS (pH=7.4) is used to wash them 2-3 times, 50 μg/mL gentamicin DMEM is added for a further cultivation for 30 minutes, 10 mM PBS (pH=7.4) is used to wash 2-3 times, DMEM medium containing 10% FBS and 5 μg/mL gentamicin is added to continue culture for 2 h, 6 h, 12 h and 24 h, 0.25% pancreatin and sterilized and pre-cooled ddH.sub.2O (A total amount of 1 mL) are used at each time point to lyse cells. Consequently, the bacterial liquid is diluted to a suitable gradient by multiple times, then spotted onto plate and placed at 37° C. for 24 h, and then the bacterial colonies are counted, and the number of intracellular bacterial proliferation is calculated (presented in log.sub.10CFU). As shown in FIG. 7, Lemo-C07 has a weaker proliferation ability in macrophages than the wild strain. There are two parallels in each group, and mean comparison between two samples is performed by t test, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. The results represent at least two independent experiments.

6. Proliferation Test of Mouse Organs

[0048] The Lemo-C07 and wild strains are injected intraperitoneally to infect 18-22 g female ICR mice (10 per group, the amount of infection is about 10.sup.6 CFU), the mice are killed at 24 and 48 h postinfection, the liver and spleen are separated, and added 10 mM PBS (pH=7.4) is fully ground and diluted to a suitable concentration, drawing up the plate and placing at 37° C. for 24 hours, and then bacterial colonies are counted. The results are presented in log.sub.10CFU. As shown in FIG. 8, Lemo-C07 is completely unable to proliferate in organs compared to the wild strain, indicating that Lemo-C07 is of good safety. There are 8 ICR mice in each group, and mean comparison between two samples is conducted by Student's t test, *P<0.05, **P<0.01, **P<0.001, ****P<0.0001. Results represent at least two independent experiments.

7. Half Lethal Dose (LD50) Comparison

[0049] Lemo-C07 and wild strain are injected intraperitoneally to infect 18-22 g female ICR mice (10 per group). The infection amount between groups is increased by 10 times. From the day of bacterial injection, the death of mice is recorded every day until no more mice died and the result is presented in log.sub.1CFU. As shown in FIG. 9, the log.sub.10LD50 of EGD-e is 5.28, and the log.sub.10LD50 of Lemo-C07 is 9.07, and its median lethal dose is reduced by 3.79 logs, which further proves that the toxicity of Lemo-C07 is greatly reduced and it is very saft, and mean comparison between two samples is conducted by Student's t test, *P<0.05. **P<0.01, ***P<0.001, ****P<0.0001. The results are representative of two independent experiments.

Embodiment 3

Evaluation of Immune Effect of Attenuated Strain

1. Transcription of Immune Factors in Macrophages of Mice

[0050] Raw 264.7 cells are placed on a B-well cell culture plate overnight, cells are infected with Lemo-C07 and wild strain at MOI=10:1, with using PBS as a blank control, incubated in a cell culture incubator (conditions 37° C., 5% CO.sub.2) for 30 minutes and washed with 10 mM PBS (pH=7.4) for 2-3 times, and DMEM containing 50 μg/mL gentamicin is added for further incubation, after 30 min, 10 mM PBS (pH=7.4) is used to wash them for 2-3 times; and DMEM containing 10% FBS and 5 μg/mL gentamicin is added to continue incubate for 3 h, 6 h, the cells are digested with 0.25% trypsin at each time point, then centrifuged to take the cells, and the cell RNA are extracted with the cell total RNA extraction kit, and then the reverse transcription kit is used to reverse them into cDNA, RT-PCR is used to detect related inflammatory factors.

TABLE-US-00002 TABLE 2 Relative primers Primers Sequences (5′-3′) Actinb-F TCACCCACACTGTGCCCATCTACGA (As shown in SEQ ID NO. 9) Actinb-R GGATGCCACAGGATTCCATACCCA (As shown in SEQ ID NO. 10) IL-1b-F GCCTTGGGCCTCAAAGGAAAGAATC (As shown in SEQ ID NO. 11) IL-1b-R GGAAGACACAGATTCCATGGTGAAG (As shown in SEQ ID NO. 12) TNF-a-F ATAGCTCCCAGAAAAGCAAGC (As shown in SEQ ID NO. 13) TNF-a-R CACCCCGAAGTTCAGTAGACA (As shown in SEQ ID NO. 14) IL-10-F GTGAAGACTTTCTTTCAAACAAAG (As shown in SEQ ID NO. 15) IL-10-R CTGCTCCACTGCCTTGCTCTTATT (As shown in SEQ ID NO. 16) IL-6-F TGGAGTCACAGAAGGAGTGGCTAAG (As shown in SEQ ID NO. 17) IL-6-R TCTGACCACAGTGAGGAATGTCCAC (As shown in SEQ ID NO. 18) Note: F represents the upstream primer and R represents the downstream primer

[0051] As shown in FIG. 10, compared with PBS. Lemo-C07 stimulated cytokine TNF-α. IL-1β, IL-6, IL-10 transcription levels greatly increased, using the 2.sup.−ΔΔCT method, indicating that Lemo-C07 can causes a strong immune response in cells.

CONCLUSION

[0052] The live-attenuated strain according to the present invention can be used as a live vaccine therapeutic vector or an immune adjuvant; by mutating the key sites N478 and V479 of Listeria monocytogenes virulence, toxin of the Listeria monocytogenes is greatly reduced (reaching a safety level), while a very good immunogenicity is still maintained.

[0053] In addition, the hly gene (encoding hemolysin LLO) is conserved in most Listeria strains; with these strains as a construction parent, mutation of asparagine at the 478th site and valine at the 479th site of an hly gene respectively into plasmid-free alanine can be realized with the method according to the present invention. Therefore, all other conserved Listeria strains containing the hly gene are also suitable for the modification method described in the present invention.

[0054] The inventor has carried out several experiments to verify that Listeria ovii, Listeria ingnoxii and Listeria grayeri are used as the constructed parents, and the corresponding live-attenuated Listeria monocytogenes could be obtained after treatment according to steps described in Embodiment 1. According to phenotype analysis and infection biology analysis of the live-attenuated strain in Embodiment 2 and the immune effect evaluation of the live-attenuated strain in Embodiment 3, it is shown that the in vitro growth ability and protein expression level are not affected, but no hemolytic activity occurs in the secreted protein. And while the migration ability of the live-attenuated strain between cells remains unchanged, it cannot proliferate in macrophages, nor can it colonize in mouse organs, and its virulence is greatly reduced. Since the biological characteristics of Listeria strains are basically the same, the treatment based on the present invention will not lead to changes in other characteristics. Therefore, it can be determined that all conserved Listeria strains containing hly gene can be used in the present invention.