NOVEL DNA APTAMER AND USE THEREOF
20220090081 · 2022-03-24
Assignee
Inventors
- Yun Hee KIM (Goyang-si, KR)
- Kyun HEO (Seoul, KR)
- Sun II CHOI (Goyang-si, KR)
- In Hoo KIM (Goyang-si, KR)
Cpc classification
C12N15/111
CHEMISTRY; METALLURGY
C12N2320/13
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure relates to novel DNA aptamers and use thereof. In particular, the present disclosure relates to DNA aptamers selected from a DNA library using Cell-SELEX to bind specifically to cancer cells. The DNA aptamers of the present disclosure selected and optimized for high binding affinity to cancer cells can be effectively used for the diagnosis of cancer as they have enhanced targeting efficiencies for target cells and tissues as well as high serum stability.
Claims
1. A DNA aptamer comprising a nucleotide sequence having at least 90% homology to the nucleotide sequence of SEQ ID NO: 6.
2. The DNA aptamer of claim 1, comprising the nucleotide sequence of SEQ ID NO: 6.
3. The DNA aptamer of claim 1, wherein the aptamer has been modified to have resistance to DNase.
4. The DNA aptamer of claim 3, wherein the modification is substitution of —OH group at 2′ carbon of a sugar moiety in one or more nucleotides with -Me (methyl), —OMe, —NH2, —F (fluorine), —O-2-methoxyethyl-O-propyl, —O-2-methylthio ethyl, —O-3-aminopropyl, —O-3-dimethylaminopropyl, —O—N-methylacetamido or —O-dimethylamidoxyethyl.
5. The DNA aptamer of claim 3, wherein the modification is found in at least 10% of the nucleotides in SEQ ID NO: 6.
6. The DNA aptamer of claim 3, wherein the DNA aptamer has a nucleotide sequence of SEQ ID NOs: 8, 12, or 14.
7. The DNA aptamer of claim 1, consisting of a nucleotide sequence having at least 90% homology to the nucleotide sequence of SEQ ID NO: 4.
8. The DNA aptamer of claim 1, consisting of the nucleotide sequence of SEQ ID NO: 4.
9. A composition for targeting cancer tissues, comprising a DNA aptamer of claim 1.
10. A composition for diagnosing a cancer, comprising a DNA aptamer of claim 1.
11. A composition for treating a cancer, comprising a DNA aptamer of claim 1.
12. The composition of claim 11, wherein the cancer is pancreatic cancer, colon cancer, liver cancer, lung cancer, brain tumor, oral cavity cancer, ovary cancer or breast cancer.
13. The composition of claim 11, further comprising an anticancer agent conjugated with the DNA aptamer.
14. The composition of claim 13, wherein the anticancer agent is one or more selected from the group consisting of MMAE (monomethyl auristatin E), MMAF (monomethyl auristatin F), calicheamicin, mertansine, ravtansine, tesirine, doxorubicin, cisplatin, SN-38, duocarmycin, and pyrrolobenzodiazepine.
15. The composition of claim 11, wherein the DNA aptamer is conjugated with a polyethylene glycol (PEG) or its derivative, a diacylglycerol (DAG) or its derivative, a dendrimer, an antibody, or a phosphorylcholine-containing polymer.
16. A method of targeting cancer tissues, comprising administering the DNA aptamer of claim 1 to a subject in need thereof.
17. A method of diagnosing a cancer, comprising administering the DNA aptamer of claim 1 which is conjugated with an imaging agent to a subject in need thereof, and detecting a signal released by the imaging agent to diagnose the cancer.
18. A method of treating a cancer, comprising administering the DNA aptamer of claim 1 which is conjugated with an anticancer agent to a subject in need thereof.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
DETAILED DESCRIPTION
[0063] The present disclosure will be clearly understood from the aspects described above and Experimental Examples or Examples described below. In the following, the present disclosure will be explained in detail such that a person of ordinary skill in the art can easily understand and reproduce the disclosure, by way of working examples described in reference to accompanying tables. However, the Experimental Examples or Examples described below are given just to illustrate the present disclosure and the scope of the present disclosure is not limited to such Experimental Examples or Examples.
[Experimental Example 1] Aptamer Screening Using Cell-SELEX
[0064] Experimental procedures for screening of aptamers that specifically bind to pancreatic cancer cells using the Cell-SELEX technique are schematically illustrated in
[0065] Specifically, to obtain a cell line expressing cell membrane proteins characteristic of pancreatic cancer, pancreatic cancer cells were transplanted into an animal model and pancreatic cancer cell line CMLu-1 was isolated from a tissue to which the cancer had metastasized (
[0066] A ssDNA library was prepared and then screened using cells of the pancreatic cancer cell line CMLu-1 as the target cells (positive cells) and hTERT/HPNE cells (Human Pancreatic Nestin Expressing cells) as the control cells (negative cells). Selection of ssDNA molecules which bind only to the pancreatic cancer cells and not to the control cells was iterated for multiple rounds, and the resulting enriched ssDNA pool was cloned and sequenced, followed by clustering.
[0067] (1) Construction of a Metastatic Pancreatic Cancer Cell Line from a Xenograft Mouse Model of a Human Pancreatic Cancer Cell Line
[0068] The metastatic pancreatic cancer cell line CMLu-1 was obtained as described below. An orthotopic mouse model was built using NOD/SCID mouse. First, to construct an animal model that can mimic metastasis of pancreatic cancer, a pancreatic cancer cell line stably expressing the firefly luciferase (CFPAC-1-Luci) was established and used to enable non-invasive monitoring of tumorigenesis over time. CFPAC-1-Luci pancreatic cancer cells were transplanted orthotopically into a NOD/SCID mouse. After 43 days, tumor tissue was removed from the lung tissue of the mouse where pancreatic cancer had metastasized, and the isolated tumor tissue was genotyped, showing that the genetic attributes of the metastatic tumor cells are identical to those of the pancreatic cancer cells. Then, single cells were prepared from the tumor tissue and cultured. CMLu-1 cells isolated from the metastatic tumor tissue were cultured and maintained in RPMI-1640 medium (Hyclone, Logan, Utah, USA) plus 10% FBS (Thermo Fisher Scientific, USA) and 100 IU/mL of Anti-Anti (antibiotic-antimycotic; Gibco).
[0069] The resulting CMLu-1 cells were used as the cells for positive selection in Cell-SELEX, and human pancreatic duct normal epithelial cells (HPNE) purchased from ATCC Inc. were used as the control cells for negative selection.
[0070] (2) Preparation of a ssDNA Library and Primers for Cell-SELEX
[0071] The DNA library used in Cell-SELEX for pancreatic cancer-specific aptamers was a pool of DNA sequences that are composed of a combination of constant and unique nucleotides. The DNA sequences comprised 20 constant nucleotides at the 5′-terminus, 40 random nucleotides in the middle, and additional 20 constant nucleotides at the 3′-terminus. 5′-terminus of the DNA sequences was labeled with Cy5 in order to monitor enrichment of selection using a fluorescence-activated cell sorter (“FACS”; so-called “flow cytometer”), and the 3′-terminus was labeled with biotin for purification of the ssDNA molecules (
TABLE-US-00001 TABLE 1 Format of DNA 5′-ATA CCA GCT TAT TCA ATT-[nucleotides 40(N40)]-AGA TAG library nucleotides TAA GTG CAA TCT-3′ (SEQ ID NO: 1) Forward primer; 5′- 5′-Cy5-ATA CCA GCT TAT TCA ATT-3′ primer (SEQ ID NO: 2) Reverse primer; 3′- 5′-biotin-AGA TTG CAC TTA CTA TCT-3′ primer (SEQ ID NO: 3)
[0072] PCR was used to amplify eluted DNA pools. ssDNAs were isolated by capturing biotinylated complementary strands using the streptavidin-biotin bond and denaturing double-stranded DNAs with NaOH. PCR mixes were prepared, and PCR was carried out as instructed by the manufacturer.
[0073] (3) Library Screening Through Cell-SELEX
[0074] The ssDNA library prepared as described above was screened using CMLu-1 cells as the target cells (positive cells) and hTERT/HPNE cells as the control cells (negative cells). 10 nmol of the DNA library was dissolved in 1,000 μL of a binding buffer (Dulbecco's PBS (Hyclone, USA) with 5 mM MgCl.sub.2, 0.1 mg/mL tRNA, and 1 mg/mL BSA). The DNA library or enriched pool was denatured at 95° C. for 10 min and cooled on ice for 10 min, followed by incubation with CMLu-1 cells in an orbital shaker at 4° C. for 1 hour.
[0075] The CMLu-1 cells were then washed 3 times to remove unbound DNA sequences, and the bound DNA molecules were eluted via centrifuge using 1,000 μL of a binding buffer at 95° C. for 15 min. To carry out a counter selection, an aptamer pool was incubated with hTERT/HPNE cells for 1 hour, after which the supernatant was collected for negative selection. The enriched pools were monitored using FACS, and Quiagen's cloning kit for sequencing (Quiagen, Germany) was used for cloning into Escherichia coli to identify aptamer candidates.
[0076] (4) Cloning and Sequencing of Enriched ssDNA Pool and Multiple Sequence Alignment
[0077] For selection of candidate sequences, the enriched ssDNA pool after 5 rounds was cloned and sequenced. The ssDNA pool was amplified by PCR using unmodified primers, ligated to pGEM-T easy vector (Promega, USA), and then cloned into HIT™-DH5a competent cells (Promega, USA). Thereafter, 200 cloned sequences were analyzed by Cosmogenetech Inc. (Seoul, Korea) and aligned using ClustalX 1.83.
[0078] The extent of enrichment according to the number of rounds of selection is as illustrated in
[0079] The process described above in (1) to (4) is schematically illustrated in
TABLE-US-00002 TABLE 2 Aptamer family Content in enriched DNA pool (%) SQ1 14.09 SQ2 13.42 SQ3 5.37 SQ4 4.70 SQ5 4.70 SQ6 3.36 SQ7 2.01 SQ8 2.68 SQ9 1.34 SQ10 1.34 SQ11 1.34
[Experimental Example 2] Determination of Target Cell Binding Specificity of Enriched Aptamer Family Candidates
[0080] The CMLu-1 target cell binding specificities of the enriched aptamer family candidates obtained in (4) of Experimental Example 1 were determined with flow cytometry (FACS).
[0081] Each Cy5-labeled aptamer family candidate was incubated, along with 3×10.sup.5 CMLu-1 cells and hTERT/HPNE cells, in the binding buffer used for Cell-SELEX at 4° C. for 1 hour. The cells were washed 3 times with binding buffer containing 0.1% NaN.sub.3, and the pellets having bound sequences were resuspended in the binding buffer. Fluorescence-based assay was carried out on 10,000 cells using BD FACSCallibur™ and FACSVerse™ (BD Biosciences, USA), and the data were analyzed using FlowJo software v10.0.7.
[0082] The results from the determination of target cell binding affinity of individual Cy5-labeled aptamer family candidates are shown in
TABLE-US-00003 *SQ7 aptamer sequence (SEQ ID NO: 4) 5′-AGCAGCACAGAGGTCAGATGATGTTGGTATATACTTCTTTAGCTTG GAACCAACTCTTGCCCTATGCGTGCTACCGTGAA-3′
[0083] The aptamer sequences included in the SQ7 family are listed in the following table.
TABLE-US-00004 TABLE 3 Sequences of SQ7 and SQ7-subtypes Aptamer Sequence Number % SQ7 AGCAGCACAGAGGTCAGATGATGTTGGTATATACTT 3 4.03 CTTTAGCTTGGAACCAACTCTTGCCCTATGCGTGCTA CCGTGAA SQ7a AGCAGCACAGAGGTCAGATGATGTTGGTATATACTT 1 CTTTAGCTTGGAACCAACTCTTCTCCTATGCGTGCTA CCGTGA (SEQ ID NO: 15) SQ7b AGCAACACAGAGGTCAGATGATGTTGGTATATACTT 2 CTTTAGCTTGGAACCCACTCTTGTCCTATGCGTGCTA CCGTGAA (SEQ ID NO: 16)
[Experimental Example 3] Analysis of SQ7 Aptamer and Functional Characterization of Aptamer Fragments
[0084] The secondary structure determined for the SQ7 aptamer selected in Example 2 is as shown in
[0085] In order to determine whether some portions of the SQ7 aptamer are critical for the pancreatic cancer-specific binding, various aptamers comprising parts of the SQ7 aptamer were prepared and their binding affinity to the target cell was investigated. If the length of an aptamer can be reduced while retaining its cell binding affinity, it is likely that aptamer production costs are reduced while cell penetration is enhanced. The results demonstrated that the SQ7-1 aptamer having the sequence indicated in Table 4 below is superior in terms of endocytosis while almost fully retaining the target cell binding affinity. Given the above results, target cell binding affinities of the SQ7 aptamer, the SQ7-1 aptamer, NT, the DNA pool library, and the SQ8-Comp aptamer were determined in the same manner as in Experimental Example 2 using FACS. As demonstrated in
[0086] The nucleotide sequence of the SQ7-1 aptamer is shown below (SEQ ID NO: 6), and the corresponding secondary structure is shown in
TABLE-US-00005 TABLE 4 Aptamer Sequence SQ7 5′- AGCAGCACAGAGGTCAGATGATGTTGGTATATACTTCTTTAGCTT GGAACCAACTCTTGCCCTATGCGTGCTACCGTGAA-3′ SQ7-1 5′-GTTGGTATATACTTCTTTAGCTTGGAACCAAC-3′ (SEQ ID NO: 6) SQ7-1-Rev 5′-CAACCATATATGAAGAAATCGAACCTTGGTTG-3′ (SEQ ID NO: 7)
[Experimental Example 4] Determination of Efficient Targeting of the Selected Aptamer into Cells and Tissues
[0087] (1) Endocytosis efficiencies of selected aptamers were determined by confocal microscopy imaging.
[0088] 1×10.sup.4 cells/well of control cells (HPNE) and target cells (CMLu-1) were plated on 8-well chamber slides (Thermo scientific, USA) coated with poly-L-lysine (Sigma, USA) 4 hours prior to the experiment. Upon washing with a washing buffer, Cy5-labeled aptamer (250 nM) or DNA pool library in 200 μl of binding buffer at 4° C. was added and incubated. After washing twice, the cells were fixed using 4% paraformaldehyde, followed by staining of the nucleus with Hoechst33342. Thereafter, the cells were subjected to imaging by confocal microscopy (LSM780, Carl Zeiss, Germany), and the images thus obtained were analyzed with Zen blue edition software.
[0089] Results of confocal microscopy on the SQ7 and SQ7-1 aptamers are as shown in
[0090] (2) Determination of Pancreatic Cancer Targeting by Aptamers Through In Vivo and Ex Vivo Fluorescence Imaging
[0091] Female Hsd: Athymic nude-Foxn1 nude mice aged 6 weeks were purchased from Harlan Laboratories, Inc. (France). The mice were housed in a specific pathogen free (SPF) environment under controlled conditions of light and humidity, with their food and water supplied by the NCC animal facility. All animal studies were reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of the National Cancer Center Research Institute (NCCRI) (NCC-16-247). The NCCRI is a facility accredited by the Association for Assessment and Accreditation of Laboratory Animal Care International (AAALAC International).
[0092] An orthotopic xenograft mouse model of pancreatic cancer was constructed by injecting CFPAC-1 cells (1×10.sup.6 cells) purchased from the ATCC into the tail of mouse pancreas. At 3 weeks after inoculation, mice were divided into two groups according to the treatment to be given (Cy5.5-SQ8-Comp aptamer vs Cy5.5-SQ7 aptamer or Cy5.5-SQ7-1-Rev aptamer vs Cy5.5-SQ7-1 aptamer), followed by intravenous administration of a Cy5.5-labeled aptamer (300 pmol/50 μl PBS) mentioned above.
[0093] For ex vivo experiments, mice were sacrificed 15 min or 3 hours after administration and then dissected. Tumor tissues were removed and subjected to bioluminescence imaging using IVIS Lumina (Caliper Life Science, Hopkinton, Mass., USA). All image data were analyzed using Living Image Acquisition and Analysis software.
[0094] The gray-scale pictures in
[0095] In the imaging results presented at the top of the above drawings, the brighter (whiter) a region appears, the greater the amount of aptamers bound to the cells in that region is. It can be seen that imaging results for the SQ7 and SQ7-1 aptamers appear whiter than those for other aptamers.
[0096] Thus, it has been demonstrated that the aptamers of the present disclosure move towards and bind specifically to pancreatic cancer tissue compared with other, control aptamers (SQ1 aptamer (SEQ ID NO: 17), SQ8-Comp aptamer, and SQ7-1-Rev aptamer) and have remarkably superior targeting efficiencies for pancreatic cancer tissues.
[Experimental Example 5] Preparation and Identification of Modifications for Enhanced Serum Stability of Aptamers
[0097] Based on the SQ7-1 aptamer prepared in the experimental example described above, internal 2′-O-methyl-modified aptamers were prepared in order to enhance serum stability of the aptamer. Specifically, SQ7-1(1), SQ7-1(2), SQ7-1(3), SQ7-1(4), SQ7-1(5), SQ7-1(6), and SQ7-1(1, 5) aptamers were prepared by modifying different regions in the secondary structure of the SQ7-1 aptamer (
[0098] The nucleotide sequences of the resulting internal 2′-O-methyl-modified aptamers are summarized in Table 5 below.
TABLE-US-00006 TABLE 5 Number of 2′- O-methyl- modified Aptamer Sequence [A, G, C, U] SQ7-1 5′-GTTGGTATATACTTCTTTAGCTTGGAACCAAC-3′ 0 (SEQ ID NO: 6) SQ7-1(1) 5′-[2′-O-Methyl(G)][2′-O-Methyl(U)][2′-O-Methyl(U)][2′-O- 6 Methyl(G)][2′-O-Methyl(G)][2′-O- Methyl(U)]ATATACTTCTTTAGCTTGGAACCAAC-3′ (SEQ ID NO: 8) SQ7-1(2) GTTGGT[2′-O-Methyl(A)][2′-O-Methyl(U)][2′-O- 5 Methyl(A)][2′-O-Methyl(U)][2′-O- Methyl(A)]CTTCTTTAGCTTGGAACCAAC (SEQ ID NO: 9) SQ7-1(3) GTTGGTATATACT[2′-O-Methyl(U)][2′-O-Methyl(C)][2′-O- 5 Methyl(U)][2′-O-Methyl(U)][2′-O- Methyl(U)]AGCTTGGAACCAAC (SEQ ID NO: 10) SQ7-1(4) GTTGGTATATACTTCTTTAG[2′-O-Methyl(C)][2′-O- 6 Methyl(U)][2′-O-Methyl(U)][2′-O-Methyl(G)][2′-O- Methyl(G)][2′-O-Methyl(A)]ACCAAC (SEQ ID NO: 11) SQ7-1(5) GTTGGTATATACTTCTTTAGCTTGGA[2′-O- 6 Methyl(A)][2′-O-Methyl(C)][2′-O-Methyl(C)][2′-O- Methyl(A)][2′-O-Methyl(A)][2′-O-Methyl(C)] (SEQ ID NO: 12) SQ7-1(6) GTTGGT[2′-O-Methyl(A)][2′-O-Methyl(U)][2′-O- 20 Methyl(A)][2′-O-Methyl(U)][2′-O-Methyl(A)][2′-O- Methyl(C)][2′-O-Methyl(U)][2′-O-Methyl(U)][2′-O- Methyl(C)][2′-O-Methyl(U)][2′-O-Methyl(U)][2′-O- Methyl(U)][2′-O-Methyl(A)][2′-O-Methyl(G)][2′-O- Methyl(C)][2′-O-Methyl(U)][2′-O-Methyl(U)][2′-O- Methyl(G)][2′-O-Methyl(G)][2′-O-Methyl(A)]ACCAAC (SEQ ID NO: 13) SQ7-1(1,5) [2′-O-Methyl(G)][2′-O-Methyl(U)][2′-O-Methyl(U)][2′-O- 12 Methyl(G)][2′-O-Methyl(G)][2′-O- Methyl(U)]ATATACTTCTTTAGCTTGGA[2′-O- Methyl(A)][2′-O-Methyl(C)][2′-O-Methyl(C)][2′-O- Methyl(A)][2′-O-Methyl(A)][2′-O-Methyl(C)] (SEQ ID NO: 14)
[0099] 5 μg each of the internal 2′-O-methyl-modified aptamers thus prepared were incubated at 37° C. in mouse serum for 0, 0.1, 0.5, 2, 6, and 24 hours. At respective time points mentioned above, 0.5 M EDTA was added to the samples to inhibit DNase activity, followed by addition of EtOH—NaOAc to effect precipitation. Samples of DNA-aptamer-precipitates were analyzed with HPLC.
[0100] Chromatography was carried out with Waters e2695 HPLC system (MA, USA) equipped with the variable wavelength detector (VWD) QuatPump. A personal computer installed with Empower3 personal single system software for LC was used for processing of chromatographic data. Analysates were separated using Venusil, XBP C18 column (250 mm×4.6 mm, 5 μm) purchased from Agela Technologies Inc. (Beijing, China). The mobile phase was a methanol-water (55:45, by volume) mixture, and the flow rate was 0.5 mL/min. The column temperature was 30° C., and the wavelength for measurement was 260 nm. 15 μL LC microsyringes purchased from Shanghai GaoGe Industrial and Trading Co., Ltd. (Shanghai, China) were used for injection.
[0101] The results showed that the SQ7-1(1), SQ7-1(5), and SQ7-1(1,5) aptamers have significantly increased half-lives. Specifically, as seen in
[0102] To summarize, as described above, the DNA aptamers according to the present disclosure specifically bind to pancreatic cancer with high binding affinities. It was demonstrated that targeting efficiencies for the target cell or tissue can be increased by reducing the size of the selected aptamers, and serum stability can be increased through modifications enhancing resistance to DNase.
[Experimental Example 6] Determination of Targeting in a Mouse Orthotopic Xenograft Model for Human Patient Pancreatic Cancer Tissue (Patient-Derived Orthotopic Xenograft Model; PDOX Model)
[0103] In order to determine whether the aptamers of the present disclosure exhibit excellent targeting efficiencies even in a PDOX model which can recapitulate the complexity and heterogeneity of patient tumor tissue, in vivo verification experiments were carried out using fluorescence imaging.
[0104] With the approval of the Institutional Review Board (“IRB”) of the NCC, a patient-derived orthotopic xenograft (PDOX) model was established by collecting specimens from patients who submitted informed consent and directly transplanting them into the pancreas of a nude mouse (purchased from Harlan Laboratories, Inc. (France)). As for primary tumor specimens from pancreatic cancer patients (called “HPTs” below), right upon surgical resection, and in the case of patients with inoperable advanced pancreatic cancer, right after collection of specimens for liver metastasis tissue biopsy (called “GUNs” below) from the patients, specimens were transported in tubes containing a medium and transplanted as soon as possible into female Hsd: Athymic nude-Foxn1 nude mice (obtained from the same source as in Experimental Example 4), by making an incision in the tail of pancreas and then closing the incision after transplantation (PDOX 1.sup.st generation, F1). Thereafter, the size of tumor was measured periodically using abdominal palpation and MRI, and when the tumor attains a volume of 3000 mm.sup.3, the mouse was sacrificed to obtain tumor tissue. Tumor tissue fragments of a certain size (3 mm*3 mm*3 mm) were then orthotopically re-implanted into multiple nude mice subjects to generate subsequent generations (F2, F3, F4.) and increase the number of subjects.
[0105] At the 4th generation (F4), the established PDOX mouse model was divided into two groups of three subjects, and the individual groups were given intravenously either the SQ7-1 aptamer or the SQ7-1-Rev aptamer, in the form of Cy5.5-labeled aptamer (300 pmol/50 μl PBS). 15 min after the administration, the mice were sacrificed and dissected to remove tumor tissues, which were then subjected to bioluminescence imaging using IVIS Lumina (Caliper Life Science, Hopkinton, Mass., USA). All image data were analyzed using Living Image Acquisition and Analysis software. The gray-scale picture in
[0106] As in
[0107] Thus, it has been demonstrated that the aptamers of the present disclosure have remarkably superior targeting efficiencies even in a PDOX model which retains the complexity and heterogeneity of patient tumor tissue.
[Experimental Example 7] Determination of Binding Affinity in Various Pancreatic Cancer Cell Lines
[0108] Additional flow cytometry (FACS) assays were carried out to determine the binding affinity of the aptamers of the present disclosure to various pancreatic cancer cell lines.
[0109] [Preparation of an Antibody Binding Aptamer]
[0110] To prepare an antibody binding aptamer, 250 nM digoxigenin-labeled SQ7-1 aptamer and 125 nM anti-digoxigenin antibody (Abcam; Cat. No. ab420, USA) were admixed at room temperature for 30 min.
[0111] Flow cytometry was carried out in the same manner as in Experimental Example 2, with the exception that the antibody binding aptamer prepared as describe above was used, and Alexa 488-labeled anti-mouse IgG (Invitrogen, USA) was used as the secondary antibody, at a concentration of 4 μg/ml. Cells from CFPAC-1 cell line, SNU-213 cell line, SNU-410 cell line, Capan-2 cell line, HPAF-II cell line, AsPC-1 cell line, Capan-1 cell line, MIA PaCa cell line, BxPC-3 cell line, and PANC-1 cell line were used. All of the above-mentioned cell lines were purchased from the ATCC.
[0112] Results from the determination of binding affinity of the aptamers to various pancreatic cancer cell lines are shown in
[0113] According to the results shown in
[0114] In addition, the SQ7 aptamer similarly would specifically bind to various types of pancreatic cancer cells as it comprises the SQ7-1 aptamer sequence.
[Experimental Example 8] Determination of Binding Affinity in Various Tumor Cell Lines
[0115] Additional flow cytometry (FACS) assays were carried out to determine the binding affinity of the aptamers of the present disclosure to various tumor cell lines.
[0116] Flow cytometry was carried out in the same manner as in Experimental Example 2, with the exception that the same antibody binding aptamer and secondary antibody as used in Experimental Example 7 were used. Cells from U87 cell line, U251 cell line, CAL27 cell line, HEP3B cell line, A549 cell line, HCT116 cell line, SK-OV3 cell line, ES-2 cell line, MCF7 cell line, SK-BR3 cell line, NCI-N87 cell line, KPL4 cell line, BT-474 cell line, MDA-MB231 cell line, and HCC1938 cell line were used. All of the above-mentioned cell lines were purchased from the ATCC.
[0117] Results from the determination of binding affinity of the aptamers to various cancer cell lines are shown in
[0118] According to the results shown in
[0119] In addition, the SQ7 aptamer similarly would specifically bind to various types of cancer cells as it comprises the SQ7-1 aptamer sequence.
[Experimental Example 9] Determination of Binding Affinity in Pancreatic Ductal Adenocarcinoma PDOX-Derived Cell Lines
[0120] Additional flow cytometry (FACS) assays were carried out to determine whether the aptamers of the present disclosure are likely to bind specifically to pancreatic cancer cells of clinical patients.
[0121] Unlike normal cells, which only have a limited number of cell divisions before death, cancer cells have the characteristic of infinite divisions. Accordingly, cancer cells isolated from tumor tissue are believed to be able to form a cell line capable of proliferating infinitely even in the absence of transfection and recapitulate clinical and molecular biological characteristics of the patient. In this experiment, tumor tissue removed from a pancreatic cancer PDOX mouse was divided into 3 mm*4 mm fragments, mixed with a human cell dissociation kit (Miltenyi Biotech Inc.) comprising collagenase, and reacted in a tissue dissociator (Gentle Macs, Miltenyi Biotech Inc) for 1 hour to separate the cells from connective tissue. Upon completion of the reaction, RPMI medium containing fetal bovine serum (FBS) was added to inhibit enzymatic activities, followed by centrifugation, to give precipitates of cells dissociated from tissue. The precipitates were suspended in RPMI medium containing FBS, and the cells were then plated evenly on 10 cm petri dishes to a level of 2×10.sup.6 cells. The medium was replaced every other day while removing normal fibroblasts and dead cell, thereby establishing a PDOX-derived cancer cell line for each pancreatic cancer patient. The established cell lines were named in the same manner as the PDOX from which they were derived.
[0122] On cancer cell lines isolated from tumor tissues of PDOX models using liver metastasis patient biopsy tissues (GUN#13, GUN#16, GUN#20, GUN#34, GUN#38, GUN#41, and GUN#46), a PDOX model using endoscopic ultrasound-guided fine needle biopsy specimens (EUS#16), and PDOX models using surgical resection specimens (HPT#19, HPT#22, HPT#43, HPT#45, and HPT#48), flow cytometry was carried out in the same manner as in Experimental Example 2, with the exception that the same antibody binding aptamer as used in Experimental Example 7 was used.
[0123] Results from the determination of binding affinity of the aptamers to various PDOX-derived cell lines are shown in
[0124] According to the results shown in
[0125] In addition, the SQ7 aptamer similarly would specifically bind to pancreatic cancer tissue of patients as it comprises the SQ7-1 aptamer sequence.
[0126] Although the technical idea of the present disclosure has been described above by referring to embodiments described in working examples and illustrated in the accompanying drawings, it should be noted that various substitutions, modifications, and changes can be made without departing from the technical idea and scope of the present disclosure which can be understood by a person of ordinary skill in the art to which the present disclosure pertains. In addition, it should be noted that that such substitutions, modifications and changes are intended to be encompassed by the scope of the appended claims.