ANTIMICROBIAL PEPTIDES

20220089661 · 2022-03-24

    Inventors

    Cpc classification

    International classification

    Abstract

    Antimicrobial OeDef1-, MtDef6-, or OeDef7-type peptides and proteins are disclosed along with compositions comprising the OeDef1-, MtDef6-, or OeDef7-type peptides and proteins and transgenic or genetically edited plants or microorganisms that express the OeDef1-, MtDef6-, or OeDef7-type peptides and proteins to inhibit growth of pathogenic microbes. Such OeDef1-, Mt-Def6-, or OeDef7-type peptides and proteins, compositions, plants, and microorganisms can provide for inhibition of microbial growth.

    Claims

    1. A recombinant polynucleotide comprising a polynucleotide encoding a first antimicrobial peptide comprising: (i) an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 38; (ii) an amino acid sequence of SEQ ID NO: 33 or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; (iii) an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:47; or (iv) an amino acid sequence having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 54; wherein the first antimicrobial peptide comprises a defensin gamma core peptide, and wherein the polynucleotide encoding the first antimicrobial peptide is operably linked to a polynucleotide comprising a promoter which is heterologous to the polynucleotide encoding the first antimicrobial peptide.

    2. The recombinant polynucleotide of claim 1, wherein the first antimicrobial peptide comprises: (a) an amino acid sequence of (i) comprising any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 36; SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO:44, or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; (b) an amino acid sequence of (ii) comprising any one of SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; or (c) an amino acid sequence of (ii) comprising any one of SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively.

    3. The recombinant polynucleotide of claim 1, wherein the defensin gamma core peptide comprises the amino acid sequence of any one of SEQ ID NO: 3, 4, 31, 32, 34, 37, 51, or 59.

    4. The recombinant polynucleotide of any one of claims 1 to 3, wherein the first antimicrobial peptide contains: (i) at least seven of the basic amino acid residues set forth in SEQ ID NO: 1, 47, or 54; (ii) at least one substitution of a hydrophobic amino acid residue of SEQ ID NO: 1, 33, 35, 36, 38, 39, 44, 47, or 54 with another hydrophobic amino acid residue; (iii) at least one substitution of a basic amino acid residue of SEQ ID NO: 1, 33, 35, 36, 38, 39, 44, 47, or 54 with another basic amino acid residue; (iv) at least one substitution of an acidic amino acid residue of SEQ ID NO: 1, 33, 35, 36, 38, 39, 44, 47, or 54 with another acidic amino acid residue or with a basic amino acid residue; or (v) any combination of (i), (ii),(iii), and (iv).

    5. The recombinant polynucleotide of any one of claims 1 to 3, wherein the first antimicrobial peptide contains 4, 5, 6, 7, 8, 9, 10, or 11 to 12, 13, 14, or 15 basic amino acid residues.

    6. The recombinant polynucleotide of any one of claims 1 to 3, wherein the recombinant polynucleotide further comprises a polynucleotide encoding: (i) a transit peptide, a vacuolar targeting peptide, and/or an endoplasmic reticulum targeting peptide; (ii) a plastid targeting peptide; and/or (iii) a polyadenylation or transcriptional termination signal, wherein the polynucleotides of (i), (ii), and/or (iii) are operably linked to the polynucleotide encoding the first antimicrobial peptide.

    7. The recombinant polynucleotide of any one of claims 1 to 3, wherein the promoter provides for expression of the first antimicrobial peptide in a plant, yeast, bacterial, or mammalian cell, or the like when the polynucleotide is located in the plant, yeast, bacterial, or mammalian cell.

    8. The recombinant polynucleotide of any one of claims 1 to 3, wherein the polynucleotide encoding the first antimicrobial peptide is inserted into a heterologous nuclear or plastid genome of a cell and operably linked to an endogenous promoter located in the heterologous nuclear or plastid genome.

    9. The recombinant polynucleotide of claim 8, wherein the heterologous nuclear or plastid genome is a monocot crop plant or a dicot crop plant nuclear or plastid genome.

    10. The recombinant polynucleotide of claim 9, wherein said dicot crop plant nuclear or plastid genome is not a chickpea plant nuclear or plastid genome.

    11. The recombinant polynucleotide of claim 9, wherein the monocot crop plant nuclear or plastid genome is selected from the group consisting of a corn, barley, oat, pearl millet, rice, sorghum, sugarcane, turf grass, and wheat plant nuclear or plastid genome.

    12. The recombinant polynucleotide of claim 9, wherein the dicot crop plant nuclear or plastid genome is selected from the group consisting of alfalfa, a Brassica sp., cotton, potato, sugar beet, and soybean nuclear or plastid genome.

    13. The recombinant polynucleotide of claim 9, wherein the dicot crop plant nuclear or plastid genome is selected from the group consisting of an apple, cucurbit, strawberry, and tomato nuclear or plastid genome.

    14. The recombinant polypeptide of any one of claims 1 to 3, wherein the polynucleotide encoding the first antimicrobial peptide further comprises a polynucleotide encoding a second antimicrobial peptide; optionally wherein the second antimicrobial peptide is a defensin; or optionally wherein the defensin comprises and antimicrobial peptide having at least 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 47, SEQ ID NO: 54, or SEQ ID NO: 63.

    15. The recombinant polynucleotide of claim 14, wherein the first antimicrobial peptide and/or the second antimicrobial peptide comprise: (i) an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 38; (ii) an amino acid sequence of SEQ ID NO: 33 or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; wherein both the first antimicrobial peptide and the second antimicrobial peptide comprise a defensin gamma core peptide; (iii) an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:47; or (iv) an amino acid sequence having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 54; optionally wherein said second antimicrobial peptide has an amino acid sequence that is identical to said first antimicrobial peptide, or wherein said second antimicrobial peptide has an amino acid sequence that is not identical to said first antimicrobial peptide.

    16. The recombinant polynucleotide of claim 14, wherein the polynucleotides encoding the first antimicrobial peptide and second antimicrobial peptide are operably linked to each other by a polynucleotide encoding a spacer peptide.

    17. The recombinant polynucleotide of claim 16, wherein the spacer peptide comprises the amino acid sequence of any one of SEQ ID NO: 9 or 18-28, or a variant of any one of the amino acids sequences of SEQ ID NO: 9 or 18-28, having 1, 2, or 3 conservative and/or semi-conservative amino acid substitutions.

    18. An edited polynucleotide comprising a variant polynucleotide encoding a first antimicrobial peptide comprising: (i) an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 38; (ii) an amino acid sequence of SEQ ID NO: 33 or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; (iii) an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:47; or (iv) an amino acid sequence having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 54; wherein the first antimicrobial peptide comprises a defensin gamma core peptide, wherein the variant polynucleotide is operably linked to a polynucleotide comprising a promoter, wherein the variant polynucleotide sequence comprises at least one nucleotide insertion, deletion, and/or substitution in comparison to the corresponding wild type polynucleotide sequence, and wherein the corresponding unedited wild type polynucleotide sequence does not encode the antimicrobial peptide comprising the amino acid sequence of SEQ ID NO: 1 or 54.

    19. A plant nuclear or plastid genome comprising a polynucleotide encoding a first antimicrobial peptide comprising: (i) an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 38; (ii) an amino acid sequence of SEQ ID NO: 33 or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; (iii) an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:47; or (iv) an amino acid sequence having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 54; wherein the first antimicrobial peptide comprises a defensin gamma core peptide, and wherein the polynucleotide is heterologous to the nuclear or plastid genome and wherein the polynucleotide is operably linked to an endogenous promoter of the nuclear or plastid genome.

    20. The edited polynucleotide of claim 18, or nuclear or plastid genome of claim 19, wherein the first antimicrobial peptide comprises: (a) an amino acid sequence of (i) comprising any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO:44, or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; (b) an amino acid sequence of (ii) comprising any one of SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; or (c) an amino acid sequence of (ii) comprising any one of SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively.

    21. The edited polynucleotide of claim 18 or the nuclear genome or the plastid genome of claim 19, wherein the defensin gamma core peptide comprises the amino acid sequence of any one of SEQ ID NO: 3, 4, 31, 32, 34, 37, 51, or 59.

    22. The edited polynucleotide of claim 18 or the nuclear genome or the plastid genome genome of claim 19, wherein the first antimicrobial peptide contains: (i) at least seven of the basic amino acid residues set forth in SEQ ID NO: 1, 47, or 54; (ii) at least one substitution of a hydrophobic amino acid residue of SEQ ID NO: 1, 33, 35, 36, 38, 39, 44, 47, or 54 with another hydrophobic amino acid residue; (iii) at least one substitution of a basic amino acid residue of SEQ ID NO: 1, 33, 35, 36, 38, 39, 44, 47, or 54 with another basic amino acid residue; (iv) at least one substitution of an acidic amino acid residue of SEQ ID NO: 1, 33, 35, 36, 38, 39, 44, 47, or 54 with another acidic amino acid residue or with a basic amino acid residue; or (v) any combination of (i), (ii),(iii), and (iv).

    23. The edited polynucleotide or genome of claim 22, wherein the first antimicrobial peptide contains 4, 5, 6, 7, 8, 9, 10, or 11 to 12, 13, 14, or 15 basic amino acid residues.

    24. The edited polynucleotide of claim 18 or the nuclear genome or the plastid genome genome of claim 19, further comprising a polynucleotide encoding: (i) a transit peptide, a vacuolar targeting peptide, and/or an endoplasmic reticulum targeting peptide; (ii) a plastid targeting peptide; and/or (iii) a polyadenylation or transcriptional termination signal, wherein the polynucleotide or sequences encoding (i), (ii), and/or (iii) are operably linked to the polynucleotide encoding the first antimicrobial peptide.

    25. The edited polynucleotide of claim 18 or the nuclear genome or the plastid genome genome of claim 19, wherein the polynucleotide comprising the promoter contains at least one nucleotide insertion, deletion, and/or substitution in comparison to the corresponding wild type polynucleotide.

    26. The edited polynucleotide of claim 18, wherein the polynucleotide encoding the first antimicrobial peptide is integrated into the nuclear or plastid genome of a cell.

    27. The the nuclear genome or the plastid genome genome of claim 19, wherein the nuclear or plastid genome is a monocot crop plant or a dicot crop plant nuclear or plastid genome.

    28. The genome of claim 27, wherein said dicot crop plant nuclear or plastid genome is not a chickpea plant nuclear genome.

    29. The genome of claim 27, wherein the monocot crop plant nuclear or plastid genome is selected from the group consisting of a corn, barley, oat, pearl millet, rice, sorghum, sugarcane, turf grass, and wheat plant nuclear or plastid genome.

    30. The genome of claim 27, wherein the dicot crop plant nuclear or plastid genome is selected from the group consisting of alfalfa, a Brassica sp., cotton, potato, sugar beet, and soybean nuclear or plastid genome.

    31. The genome of claim 27, wherein the dicot crop plant nuclear or plastid genome is selected from the group consisting of an apple, cucurbit, strawberry, and tomato nuclear or plastid genome.

    32. The edited polynucleotide of claim 18 or the nuclear genome or the plastid genome genome of claim 19, wherein the polynucleotide encoding the first antimicrobial peptide further comprises a polynucleotide encoding a second antimicrobial peptide; optionally wherein the second antimicrobial peptide is a defensin; or optionally wherein the defensin comprises an antimicrobial peptide having at least 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 10, SEQ ID NO :11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 47, SEQ ID NO: 54, or SEQ ID NO: 63.

    33. The edited polynucleotide or genome of claim 32, wherein the first antimicrobial peptide and/or the second antimicrobial peptide comprise: (i) an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 38; (ii) an amino acid sequence of SEQ ID NO: 33 or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; (iii) an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:47; or (iv) an amino acid sequence having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 54; wherein both the first antimicrobial peptide and the second antimicrobial peptide comprise a defensin gamma core peptide; optionally wherein said second antimicrobial peptide has an amino acid sequence that is identical to said first antimicrobial peptide, or wherein said second antimicrobial peptide has an amino acid sequence that is not identical to said first antimicrobial peptide.

    34. The edited polynucleotide or genome of claim 32, wherein the polynucleotides encoding the first antimicrobial peptide and second antimicrobial peptide are operably linked to each other by a polynucleotide encoding a spacer peptide.

    35. The edited polynucleotide or genome of claim 34, wherein the spacer peptide comprises the amino acid sequence of any one of SEQ ID NO: 9 or 18-28, or a variant of any one of the amino acids sequences of SEQ ID NO: 9 or 18-28, having 1, 2, or 3 conservative and/or semi-conservative amino acid substitutions.

    36. A cell comprising the recombinant polynucleotide of any one of claims 1 to 3 or the edited polynucleotide or genome of any one of claims 18 to 21.

    37. The cell of claim 36, wherein the cell is a plant, yeast, bacterial, or mammalian cell.

    38. The cell of claim 37, wherein the cell is a plant cell that is non-regenerable.

    39. A plant comprising the recombinant polynucleotide of any one of claims 1 to 3 or the edited polynucleotide or genome of any one of claims 18 to 21.

    40. The plant of claim 39, wherein said plant or any part thereof contains a plant pathogenic microbe inhibitory concentration of the antimicrobial peptide.

    41. The plant of claim 40, wherein the plant pathogenic microbe inhibitory concentration of the antimicrobial peptide is at least 0.005, 0.05, 0.5, or 1 parts per million (PPM) in a tissue or part of the plant.

    42. The plant of claim 39, wherein the recombinant polynucleotide, edited polynucleotide, or genome confers to the plant resistance to infection by a plant pathogenic microbe in comparison to a control plant that lacks the recombinant polynucleotide, edited polynucleotide, or genome.

    43. The plant of claim 42, wherein the plant pathogenic microbe is a Fusarium sp., Alternaria sp., Verticillium sp., Phytophthora sp., Colletotrichum sp., Botrytis sp., Cercospora sp., Phakopsora sp. Rhizoctonia sp., Sclerotinia sp., Pythium sp., Phoma sp., Leptosphaeria sp., Gaeumannomyces sp., or Puccinia sp.

    44. The plant of claim 39, wherein the plant is a monocot crop plant or a dicot crop plant.

    45. The plant of claim 44, wherein said dicot crop plant is not a chickpea plant.

    46. The plant of claim 44, wherein the monocot crop plant is selected from the group consisting of a corn, barley, oat, pearl millet, rice, sorghum, sugarcane, turf grass, and wheat.

    47. The plant of claim 44, wherein the dicot crop plant is selected from the group consisting of alfalfa, a Brassica sp., cotton, cucurbit, potato, strawberry, sugar beet, soybean, and tomato.

    48. A plant part of the plant of claim 39, where the plant part comprises the recombinant polynucleotide, edited polynucleotide, or genome.

    49. The plant part of claim 48, wherein the plant part is a seed, stem, leaf, root, tuber, flower, or fruit.

    50. A processed plant product of the plant part of claim 48, wherein the processed plant product comprises the recombinant polynucleotide, the edited polynucleotide, or a fragment of the recombinant polynucleotide or the edited polynucleotide.

    51. The processed plant product of claim 50, wherein the product is non-regenerable.

    52. The processed plant product of claim 50, wherein the product is a meal or flour.

    53. The processed plant product of claim 50, wherein the fragment comprises a recombinant polynucleotide encoding a junction of the polynucleotide encoding the first antimicrobial peptide with the polynucleotide comprising the promoter which is heterologous to the polynucleotide encoding the first antimicrobial peptide.

    54. The processed plant product of claim 50, wherein the fragment comprises an edited polynucleotide which is heterologous to the genome of the plant from which the product was obtained.

    55. The processed plant product of claim 50, wherein the processed plant product is characterized by having reduced levels of microbial toxins in comparison to processed plant products obtained from corresponding control plant crops.

    56. A method for obtaining a plant comprising the recombinant polynucleotide of any one of claims 1 to 3 or plant nuclear or plastid genome of claim 19 that is resistant to infection by a plant pathogenic microbe, comprising the steps of: (i) introducing the recombinant polynucleotide, the polynucleotide encoding the first antimicrobial peptide, the polynucleotide comprising the promoter, a fragment of said polynucleotides, or a combination of said polynucleotides, into a plant cell, tissue, plant part, or whole plant; (ii) obtaining a plant cell, tissue, part, or whole plant wherein the recombinant polynucleotide, the polynucleotide encoding the first antimicrobial peptide, the polynucleotide comprising the promoter, a fragment of said polynucleotides, or a combination of said polynucleotides has integrated into the plant nuclear or plastid genome; and (iii) selecting a plant obtained from the plant cell, tissue, part or whole plant of step (ii) for expression of a plant pathogenic microbe inhibitory amount of the first antimicrobial peptide, thereby obtaining a plant that is resistant to infection by a plant pathogenic microbe.

    57. The method of claim 56, wherein the recombinant polynucleotide is introduced into the plant cell, tissue, part, or whole plant by Agrobacterium-, electroporation-, transfection-, or particle-mediated transformation.

    58. The method of claim 56, wherein the recombinant polynucleotide, the polynucleotide encoding the first antimicrobial peptide, the polynucleotide comprising the promoter, a fragment of said polynucleotides, or a combination of said polynucleotides is introduced in step (i) with: (a) a clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas)-guide RNA or source thereof and a Cas endonuclease or source thereof, wherein the guide RNA and Cas endonuclease can form a complex that can introduce a double strand break at a target site in a nuclear genome of the plant cell, tissue, part, or whole plant; and (b) a template polynucleotide comprising the recombinant polynucleotide, the polynucleotide encoding the first antimicrobial peptide, the polynucleotide comprising the promoter, a fragment of said polynucleotides, or a combination of said polynucleotides.

    59. The method of claim 58, wherein said template comprises sequences at its 5′ and 3′ terminus with sequence identity to sequences on both sides of the double strand break that permit integration of the template by homologous recombination.

    60. The method of claim 56, wherein the recombinant polynucleotide is introduced in step (i) with: (a) an endonuclease or an endonuclease and a guide RNA, wherein the endonuclease or the endonuclease and guide RNA can form a complex that can introduce a double strand break at a target site in a nuclear genome of the plant cell, tissue, part, or whole plant; and (b) a template polynucleotide comprising the recombinant polynucleotide, the polynucleotide encoding the first antimicrobial peptide, the polynucleotide comprising the promoter, a fragment of said polynucleotides, or a combination of said polynucleotides.

    61. A method for obtaining a plant comprising the edited polynucleotide or genome of any one of claims 18 to 21 that is resistant to infection by a plant pathogenic microbe comprising the steps of: (i) providing: (a) a template polynucleotide comprising the polynucleotide encoding the first antimicrobial peptide; and (b) an endonuclease or an endonuclease and a guide RNA to a plant cell, tissue, part, or whole plant, wherein the endonuclease or guide RNA and endonuclease can form a complex that can introduce a double strand break at a target site in a nuclear or plastid genome of the plant cell, tissue, part, or whole plant; (ii) obtaining a plant cell, tissue, part, or whole plant wherein at least one nucleotide insertion, deletion, and/or substitution has been introduced into the corresponding wild type polynucleotide; and (iii) selecting a plant obtained from the plant cell, tissue, part or whole plant of step (ii) comprising the edited polynucleotide for expression of a plant pathogenic microbe inhibitory amount of the first antimicrobial peptide, thereby obtaining a plant that is resistant to infection by a plant pathogenic microbe.

    62. The method of claim 61, further comprising the step of introducing at least one nucleotide insertion, deletion, and/or substitution in the promoter that is operably linked to variant polynucleotide encoding the first antimicrobial peptide.

    63. The method of claim 61, wherein the endonuclease is a Cas endonuclease and the guide RNA is a clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas)-guide RNA.

    64. The method of claim 63, wherein the Cas endonuclease is a Cas9 or Cpf1 endonuclease.

    65. The method of claim 56, wherein the polynucleotide encoding the first antimicrobial peptide further comprises a polynucleotide encoding a spacer peptide and a second antimicrobial peptide; optionally wherein the second antimicrobial peptide is a defensin; or optionally wherein the defensin comprises an antimicrobial peptide having at least 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 47, SEQ ID NO: 54, or SEQ ID NO: 63.

    66. The method of claim 65, wherein the first antimicrobial peptide and/or the second antimicrobial peptide comprise: (i) an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 38; (ii) an amino acid sequence of SEQ ID NO: 33 or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; (iii) an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:47; or (iv) an amino acid sequence having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 54; wherein both the first antimicrobial peptide and the second antimicrobial peptide comprise a defensin gamma core peptide; optionally wherein said second antimicrobial peptide has an amino acid sequence that is identical to said first antimicrobial peptide, or wherein said second antimicrobial peptide has an amino acid sequence that is not identical to said first antimicrobial peptide.

    67. The method of claim 65, wherein the spacer peptide comprises the amino acid sequence of any one of SEQ ID NO: 9 or 18-28, or a variant of any one of the amino acids sequences of SEQ ID NO: 9 or 18-28, having 1, 2, or 3 conservative and/or semi-conservative amino acid substitutions.

    68. A method for producing plant seed that provide plants resistant to infection by a plant pathogenic microbe that comprises the steps of: (i) selfing or crossing the plant of claim 40; and (ii) harvesting seed that comprises the recombinant polynucleotide of the plant from the self or cross, thereby producing plant seed that provide plants resistant to infection by a plant pathogenic microbe.

    69. The method of claim 68, wherein the plant is used as a pollen donor in the cross and the seed are harvested from a pollen recipient.

    70. A method for preventing or reducing crop damage by a plant pathogenic microbe comprising the steps of: (i) placing seeds or cuttings of the plants of claim 40 in a field where control plants are susceptible to infection by at least one plant pathogenic microbe; and (ii) cultivating a crop of plants from the seeds or cuttings, thereby reducing crop damage by the plant pathogenic microbe.

    71. The method of claim 70, wherein the method further comprises the step of harvesting seed, fruit, leaves, tubers, stems, roots, or any combination thereof from the crop.

    72. The method of claim 71, wherein said seed, fruit, leaves, tubers, stems, roots, or any combination thereof have reduced levels of microbial toxins in comparison to seed, fruit, leaves, tubers, stems, roots, or any combination thereof obtained from corresponding control plant crops.

    73. A composition comprising a first antimicrobial peptide comprising: (i) an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 38; (ii) an amino acid sequence of SEQ ID NO: 33 or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; (iii) an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:47; or (iv) an amino acid sequence having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 54; wherein the first antimicrobial peptide comprises a defensin gamma core peptide, said composition further comprising an agriculturally, pharmaceutically, or veterinarily acceptable carrier, diluent, or excipient.

    74. The composition of claim 73, wherein the first antimicrobial peptide comprises: i. an amino acid sequence of any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO:44, SEQ ID NO: 47, SEQ ID NO: 54, or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; ii. any one of the amino acid sequences of (i), further comprising an N-terminal alanine residue; or iii. a chemically modified peptide comprising an amino acid sequence having; (a) at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 33, a variant of SEQ ID NO: 33 wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues respectively, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 39, or SEQ ID NO:44; (b) an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:47; or (c) an amino acid sequence having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 54; wherein said chemically modified peptide comprises at least one non-naturally occurring amino acid residue.

    75. The composition of claim 74, wherein the defensin gamma core peptide comprises the amino acid sequence of any one of SEQ ID NO: 3, 4, 31, 32, 34, 37, 51, or 59.

    76. The composition of any one of claims 73 to 75, wherein the first antimicrobial peptide contains: (i) at least seven of the basic amino acid residues set forth in SEQ ID NO: 1, 47, or 54; (ii) at least one substitution of a hydrophobic amino acid residue of SEQ ID NO: 1, 33, 35, 36, 38, 39, 44, 47, or 54 with another hydrophobic amino acid residue; (iii) at least one substitution of a basic amino acid residue of SEQ ID NO: 1, 33, 35, 36, 38, 39, 44, 47, or 54 with another basic amino acid residue; (iv) at least one substitution of an acidic amino acid residue of SEQ ID NO: 1, 33, 35, 36, 38, 39, 44, 47, or 54 with another acidic amino acid residue or with a basic amino acid residue; or (v) any combination of (i), (ii),(iii), and (iv).

    77. The composition of claim 76, wherein the first antimicrobial peptide contains 4, 5, 6, 7, 8, 9, 10, or 11 to 12, 13, 14, or 15 basic amino acid residues.

    78. The composition of any one of claims 73 to 75, further comprising a second antimicrobial peptide and/or a non-peptidic antimicrobial agent; optionally wherein the second antimicrobial peptide is a defensin; and optionally wherein the defensin comprises an antimicrobial peptide having at least 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 47, SEQ ID NO: 54, or SEQ ID NO: 63.

    79. The composition of claim 73, wherein the first antimicrobial peptide further comprises a spacer peptide and a second antimicrobial peptide, both being operably linked to said first antimicrobial peptide; optionally wherein the spacer peptide comprises the amino acid sequence of any one of SEQ ID NO: 9 or 18-28, or a variant of any one of the amino acids sequences of SEQ ID NO: 9 or 18-28, having 1, 2, or 3 conservative and/or semi-conservative amino acid substitutions.

    80. The composition of claim 79, wherein the first antimicrobial peptide and/or the second antimicrobial peptide comprise: (i) an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 38; (ii) an amino acid sequence of SEQ ID NO: 33 or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; (iii) an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:47; or (iv) an amino acid sequence having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 54; wherein both the first antimicrobial peptide and the second antimicrobial peptide comprise a defensin gamma core peptide; optionally wherein said second antimicrobial peptide has an amino acid sequence that is identical to said first antimicrobial peptide, or wherein said second antimicrobial peptide has an amino acid sequence that is not identical to said first antimicrobial peptide.

    81. The composition of claim 79, wherein the first antimicrobial peptide or the second antimicrobial peptide comprises a defensin.

    82. The composition of claim 81, wherein the defensin comprises: (i) a peptide having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of any one of SEQ ID NO: 1, 10, 11, 12, 13, 14, 15, 16, 17; a peptide having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% amino acid sequence identity to SEQ ID NO:47; or a peptide having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% amino acid sequence identity to SEQ ID NO: 54; (ii) any one of the peptides of (i), further comprising an N-terminal alanine residue; or (iii) a chemically modified peptide comprising an amino acid sequence having; (a) at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 10, 11, 12, 13, 14, 15, 16, or 17; (b) an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:47; or (c) an amino acid sequence having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 54; wherein said chemically modified peptide comprises at least one non-naturally occurring amino acid residue.

    83. The composition of claim 78, wherein the first antimicrobial peptide and/or the second antimicrobial peptide is/are provided at a concentration of about 0.1, 0.5, 1.0, or 5 μg/ml to about 1, 5, 20, 50, or 100 mg/ml for a liquid composition or at a concentration of about 0.1, 0.5, 1.0, or 5 μg/gram to about 1, 5, 20, 50, or 100 mg/gram for a powder or solid composition.

    84. A method for preventing or reducing crop damage by a plant pathogenic microbe comprising the step of contacting a plant, a plant seed, or other part of said plant with an effective amount of the composition of any one of claims 73 to 75.

    85. The method of claim 84, wherein the plant pathogenic microbe is a Fusarium sp., Alternaria sp., Verticillium sp., Phytophthora sp., Colletotrichum sp., Botrytis sp., Cercospora sp., Phakopsora sp. Rhizoctonia sp., Sclerotinia sp., Pythium sp., Phoma sp., Leptosphaeria sp., Gaeumannomyces sp., or Puccinia sp.

    86. A medical device comprising the device and the composition of any one of claims 73 to 75, wherein the device comprises at least one surface that is topically coated and/or impregnated with the composition.

    87. The medical device of claim 86, wherein said device is a stent, a catheter, a contact lens, a condom, a patch, or a diaphragm.

    88. A method for treating, preventing, or inhibiting a microbial infection in a subject in need thereof comprising administering to said subject an effective amount of the composition of any one of claims 73 to 75.

    89. The method of claim 88, wherein said administration comprises topical, enteral, parenteral, and/or intravenous introduction of the composition.

    90. The method of claim 89, wherein the subject is a human, livestock, poultry, fish, or a companion animal.

    91. The method of claim 90, wherein the microbial infection is of a mucosal membrane, eye, skin, and/or a nail and the composition is applied to the mucosal membrane, eye, skin, and/or nail.

    92. The method of claim 91, wherein the microbial infection is by a dermatophyte.

    93. The method of claim 92, wherein the dermatophyte is selected from the group consisting of Trichophyton rubrum, Trichophyton interdigitale, Trichophyton violaceum, Trichophyton tonsurans, Trichophyton soudanense, Trichophyton mentagrophytes, Microsporum flavum, Epidermophyton floccosum, and Microsporum gypseum.

    94. The method of claim 91, wherein the microbial infection is by an Aspergillus, Cryptococcus, Penicillium, Rhizopus, Apophysomyces, Cunninghamella, Saksenaea, Rhizomucor, Syncephalostrum, Cokeromyces, Actinomucor, Pythium, Fusarium, Histoplasmosis, or Blastomyces species.

    95. The method of claim 88, wherein the microbial infection is by a Candida species.

    96. The method of claim 95, wherein the Candida species is Candida albicans, C. glabrata, C parasilosis, C. tropicalis, or C. krusei.

    97. The composition of any one of claims 73 to 75 for use in a method of treating, preventing, or inhibiting microbial infection in a subject in need thereof.

    98. The composition of claim 97, wherein the subject is a human, livestock, poultry, fish, or a companion animal.

    99. The composition of claim 98, wherein the microbial infection is of a mucosal membrane, eye, skin, or a nail and the composition is applied to the mucosal membrane, eye, skin, or nail.

    100. The composition of claim 99, wherein the microbial infection is by a dermatophyte.

    101. The composition of claim 100, wherein the dermatophyte is selected from the group consisting of Trichophyton rubrum, Trichophyton interdigitale, Trichophyton violaceum, Trichophyton tonsurans, Trichophyton soudanense, Trichophyton mentagrophytes, Microsporum flavum, Epidermophyton floccosum, and Microsporum gypseum.

    102. The composition of claim 99, wherein the microbial infection is by an Aspergillus, Cryptococcus, Penicillium, Rhizopus, Apophysomyces, Cunninghamella, Saksenaea, Rhizomucor, Syncephalostrum, Cokeromyces, Actinomucor, Pythium, Fusarium, Histoplasmosis, or Blastomyces species.

    103. The composition of claim 97, wherein the microbial infection is by a Candida species.

    104. The composition of claim 103, wherein the Candida species is Candida albicans, C. glabrata, C parasilosis, C. tropicalis, or C. krusei.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0027] FIG. 1A. FIG. 1A shows representative conservative amino acid substitutions in OeDef1a (SEQ ID NO: 1).

    [0028] FIG. 1B. FIG. 1B shows representative conservative amino acid substitutions in the OeDef1a Deletion Variant 1(SEQ ID NO: 35).

    [0029] FIG. 1C. FIG. 1C shows representative conservative amino acid substitutions in OeDef1a Deletion Variant 3 (SEQ ID NO: 38).

    [0030] FIG. 2 shows the predicted three-dimensional structural of OeDef1a (SEQ ID NO:1) based on modeling of the OeDef1a sequence with the known structural coordinates of PDB NO. 2KPY from Artemisia vulgaris using the I-TASSER (Iterative Threading ASSEmbly Refinement) programs for protein structure and function predictions (https site “zhanglab.ccmb.med.umich.edu/I-TASSER/”; Zhang et al., 2008; Roy et al., 2010; Yang et al., 2015).

    [0031] FIG. 3 shows the antifungal activity of OeDef1a (SEQ ID NO:1) in a detached lettuce leaf assay.

    [0032] FIG. 4 shows the effects of OeDef1a (SEQ ID NO:1) treatment on permeabilization of Botrytis cinerea spore membranes as assayed by SYTOX green uptake and fluorescence.

    [0033] FIG. 5 shows internalization of DyLight550-labeled OeDef1a (SEQ ID NO:1) in hyphae of Botrytis cinerea.

    [0034] FIG. 6 shows internalization of DyLight550-labeled OeDef1a (SEQ ID NO:1) in overnight cultured spores of Botrytis cinerea.

    [0035] FIG. 7 shows Botrytis cinerea cell death after OeDef1a (SEQ ID NO:1) challenge as assayed by propidium iodide.

    DETAILED DESCRIPTION

    Definitions

    [0036] The term “and/or” where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term and/or” as used in a phrase such as “A and/or B” herein is intended to include “A and B,” “A or B,” “A” (alone), and “B” (alone). Likewise, the term “and/or” as used in a phrase such as “A, B, and/or C” is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone). As used herein, the terms “include,” “includes,” and “including” are to be construed as at least having the features to which they refer while not excluding any additional unspecified features.

    [0037] Where a term is provided in the singular, other embodiments described by the plural of that term are also provided.

    [0038] As used herein, a polynucleotide is said to be “endogenous” to a given cell when it is found in a naturally occurring form and genomic location in the cell.

    [0039] The phrases “antimicrobial peptide” or “antimicrobial protein” as used herein refer to peptides or proteins which exhibit any one or more of the following characteristics of inhibiting the growth of microbial cells, killing microbial cells, disrupting or retarding stages of the microbial life cycle such as spore germination, sporulation, or mating, and/or disrupting microbial cell infection, penetration or spread within a plant or other susceptible subject, including a human, livestock, poultry, fish, or a companion animal (e.g., dog or cat).

    [0040] As used herein, the terms “acidic” or “anionic” are used interchangeably to refer to amino acids such as aspartic acid and glutamic acid.

    [0041] As used herein, the terms “basic” and “cationic” are used interchangeably to refer to amino acids such as arginine, histidine, and lysine.

    [0042] As used herein, the phrase “cation-tolerant” refers to a defensin peptide or protein which exhibits equivalent in vitro antifungal or antimicrobial activity or no more than about a 1.5-, 2- , 3-, or 4-fold decrease in in vitro antifungal or antimicrobial activity in the presence of 100 mM KCl as compared to the antifungal activity of the defensin peptide or protein in the absence of KCl.

    [0043] As used herein, the phrase “consensus sequence” refers to an amino acid, DNA or RNA sequence created by aligning two or more homologous sequences and deriving a new sequence having either the conserved or set of alternative amino acid, deoxyribonucleic acid, or ribonucleic acid residues of the homologous sequences at each position in the created sequence.

    [0044] The phrases “combating microbial damage”, “combating or controlling microbial damage” or “controlling microbial damage” as used herein refer to reduction in damage to a crop plant or crop plant product due to infection by a microbial pathogen. More generally, these phrases refer to reduction in the adverse effects caused by the presence of a pathogenic microbe in the crop plant. Adverse effects of microbial growth are understood to include any type of plant tissue damage or necrosis, any type of plant yield reduction, any reduction in the value of the crop plant product, and/or production of undesirable microbial metabolites or microbial growth by-products including to mycotoxins.

    [0045] The phrase “defensin peptide” is used herein to refer to a peptide comprising a conserved gamma core peptide. Plant defensins have been previously characterized as comprising a conserved GXCX3-9C gamma core peptide sequence (SEQ ID NO: 34), where X is any amino acid residue (Lacerda et al.). Plant defensins and variants thereof are presently described herein, however, comprising a conserved GXCX3-10C variant gamma core peptide sequence (SEQ ID NO: 3), where X is any amino acid residue. Therefore, as used in this disclosure, a plant defensin or defensin can comprise a conserved GXCX3-9C or GXCX3-10C gamma core peptide sequence, where X is any amino acid residue. Defensin peptides include proteins that are antimicrobial, that can permeabilize plasma membranes, that can bind phospholipids, that can bind sphingolipids, or that exhibit any combination of those properties. A defensin peptide can be naturally occurring or non-naturally occurring (e.g., synthetic and/or chimeric).

    [0046] As used herein, the terms “edit,” “editing,” “edited” and the like refer to processes or products where insertions, deletions, and/or nucleotide substitutions are introduced into a genome. Such processes include methods of inducing homology directed repair and/or non-homologous end joining of one or more sites in the genome.

    [0047] As used herein, the term “peptide” refers to a molecule of 2 to 55 amino acid residues joined by peptide bonds.

    [0048] As used herein, the term “protein” refers to a molecule of 56 or more amino acid residues joined by peptide bonds.

    [0049] As used herein, the term “OeDef1-type” peptide refers to any peptide with antimicrobial activity related by any amino acid sequence conservation to a peptide comprising the amino acid sequence of SEQ ID NO: 1, 2, 3, 4, 8, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 44; to peptides or proteins comprising a variant of the amino acid sequence of SEQ ID NO: 1, 2, 3, 4, 8, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 44; to homologs of peptides or proteins comprising the amino acid sequence of SEQ ID NO: 1, 2, 3, 4, 8, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 44; or to a fragment of a peptide or protein comprising the amino acid sequence of SEQ ID NO: 1, 2, 3, 4, 8, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 44, a variant thereof, or a homolog thereof; or to any peptide, or fragment thereof set forth in the claims, embodiments, figures, or other disclosure provided herein. An OeDef1-type peptide of this disclosure can comprise the variant gamma core sequence (GXCX3-10C) of SEQ ID NO: 3 or a canonical gamma core sequence (GXCX3-9C) of SEQ ID NO: 34.

    [0050] As used herein, the term “MtDef6-type” peptide refers to any peptide with antimicrobial activity related by any amino acid sequence conservation to a peptide comprising the amino acid sequence of SEQ ID NO: 47, 48, 49, or 50; to peptides or proteins comprising a variant of the amino acid sequence of SEQ ID NO: 47, 48, 49, or 50; to homologs of peptides or proteins comprising the amino acid sequence of SEQ ID NO: 47, 48, 49, or 50; or to a fragment of a peptide or protein comprising the amino acid sequence of SEQ ID NO: 47, 48, 49, or 50, a variant thereof, or a homolog thereof; or to any peptide, or fragment thereof set forth in the claims, embodiments, figures, or other disclosure provided herein. An MtDef6-type peptide of this disclosure can comprise the gamma core sequence of SEQ ID NO: 4, 31, 32, 34, 37, 51, or 59, a variant gamma core sequence (GXCX3-10C) of SEQ ID NO: 3, or a canonical gamma core sequence (GXCX3-9C) of SEQ ID NO: 34.

    [0051] As used herein, the term “OeDef7-type” peptide refers to any peptide with antimicrobial activity related by any amino acid sequence conservation to a peptide comprising the amino acid sequence of SEQ ID NO: 54, 55, 56, 57, or 58; to peptides or proteins comprising a variant of the amino acid sequence of SEQ ID NO: 54, 55, 56, 57, or 58; to homologs of peptides or proteins comprising the amino acid sequence of SEQ ID NO: 54, 55, 56, 57, or 58; or to a fragment of a peptide or protein comprising the amino acid sequence of SEQ ID NO: 54, 55, 56, 57, or 58, a variant thereof, or a homolog thereof; or to any peptide, or fragment thereof set forth in the claims, embodiments, figures, or other disclosure provided herein. An OeDef7-type peptide of this disclosure can comprise the gamma core sequence of SEQ ID NO: 4, 31, 32, 34, 37, 51, or 59, a variant gamma core sequence (GXCX3-10C) of SEQ ID NO: 3, or a canonical gamma core sequence (GXCX3-9C) of SEQ ID NO: 34.

    [0052] An “OeDef1-type protein” can refer to any protein comprising an OeDef1-type peptide and additional amino acid residues, where such amino acid residues can include a spacer peptide, a linker peptide, an additional OeDef1-type peptide, a defensin peptide, or any combination thereof.

    [0053] An “MtDef6-type protein” can refer to any protein comprising an MtDef6-type peptide and additional amino acid residues, where such amino acid residues can include a spacer peptide, a linker peptide, an additional MtDef6-type peptide, a defensin peptide, an anti-microbial peptide, or any combination thereof.

    [0054] An “OeDef7-type protein” can refer to any protein comprising an OeDef1-type peptide and additional amino acid residues, where such amino acid residues can include a spacer peptide, a linker peptide, an additional OeDef7-type peptide, a defensin peptide, an anti-microbial peptide, or any combination thereof.

    [0055] The term “endoproteinase” is used herein to refer to a peptidase capable of cleaving a peptide bond between two internal amino acid residues in a peptide sequence. Endoproteinases can also be referred to as “endoproteases” or “endopeptidases.” The proteolytic activity of an endoproteinase, endoprotease, or endopeptidase is thus different than the proteolytic activity of an “exopeptidase” which cleaves peptide bonds of terminal amino acid residues in a peptide.

    [0056] The phrases “genetically edited plant” or “edited plant” are used herein to refer to a plant comprising one or more nucleotide insertions, deletions, substitutions, or any combination thereof in the genomic DNA of the plant. Such genetically edited plants can be constructed by techniques including CRISPR/Cas endonuclease-mediated editing, meganuclease-mediated editing, engineered zinc finger endonuclease-mediated editing, and the like.

    [0057] The term “heterologous”, as used herein in the context of a second polynucleotide that is operably linked to a first polynucleotide, refers to: (i) a second polynucleotide that is derived from a source distinct from the source of the first polynucleotide; (ii) a second polynucleotide derived the same source as the first polynucleotide, where the first, second, or both polynucleotide sequence(s) is/are modified from its/their original form; (iii) a second polynucleotide arranged in an order and/or orientation or in a genomic position or environment with respect to the first polynucleotide that is different than the order and/or orientation in or genomic position or environment of the first and second polynucleotides in a naturally occurring cell; or (iv) the second polynucleotide does not occur in a naturally occurring cell that contains the first polynucleotide. Heterologous polynucleotides include polynucleotides that promote transcription (e.g., promoters and enhancer elements), transcript abundance (e.g., introns, 5′UTR, and 3′UTR), translation, or a combination thereof as well as polynucleotides encoding OeDef1-, MtDef6-, or OeDef7-type peptides or defensin peptides, spacer peptides, or localization peptides. In certain embodiments, a nuclear or plastid genome can comprise the first polynucleotide, where the second polynucleotide is heterologous to the nuclear or plastid genome. A “heterologous” polynucleotide that promotes transcription, transcript abundance, translation, or a combination thereof as well as polynucleotides encoding OeDef1-, MtDef6-, or OeDef7-type peptides or defensin peptides, spacer peptides, or localization peptides can be autologous to the cell but, however, arranged in an order and/or orientation or in a genomic position or environment that is different than the order and/or orientation in or genomic position or environment in a naturally occurring cell. A polynucleotide that promotes transcription, transcript abundance, translation, or a combination thereof as well as polynucleotides encoding OeDef1-, MtDef6-, or OeDef7-type peptides or defensin peptides, spacer peptides, or localization can be heterologous to another polynucleotide when the polynucleotides are not operably linked to one another in a naturally occurring cell. Heterologous peptides or proteins include peptides or proteins that are not found in a cell or organism as the cell or organism occurs in nature. As such, heterologous peptides or proteins include peptides or proteins that are localized in a subcellular location, extracellular location, or expressed in a tissue that is distinct from the subcellular location, extracellular location, or tissue where the peptide or protein is found in a cell or organism as it occurs in nature. Heterologous polynucleotides include polynucleotides that are not found in a cell or organism as the cell or organism occurs in nature.

    [0058] The term “homolog” as used herein refers to a gene related to a second gene by identity of either the DNA sequences or the encoded protein sequences. Genes that are homologs can be genes separated by the event of speciation (see “ortholog”). Genes that are homologs can also be genes separated by the event of genetic duplication (see “paralog”). Homologs can be from the same or a different organism and can in certain embodiments perform the same biological function in either the same or a different organism.

    [0059] The phrases “inhibiting growth of a plant pathogenic microbe”, “inhibit microbial growth”, and the like as used herein refers to methods that result in any measurable decrease in microbial growth, where microbial growth includes any measurable decrease in the numbers and/or extent of microbial cells, spores, conidia, or mycelia. As used herein, “inhibiting growth of a plant pathogenic microbe” is also understood to include any measurable decrease in the adverse effects cause by microbial growth in a plant. Adverse effects of microbial growth in a plant include any type of plant tissue damage or necrosis, any type of plant yield reduction, any reduction in the value of the crop plant product, and/or production of undesirable microbial metabolites or microbial growth by-products including mycotoxins. As used herein, the phrase “inhibition of microbial growth” and the like, unless otherwise specified, can include inhibition in a plant, human or animal.

    [0060] As used herein, the phrase “junction sequence,” when used in the context of a OeDef1-, MtDef6-, or OeDef7-type protein, refers to an amino acid sequence of about six residues where at least three (3) residues are contributed by a spacer peptide and at least three (3) residues are contributed by an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide. In certain embodiments, 3 amino acids at the N-terminus of the junction sequence are contributed by the final 3 C-terminal residues of the OeDef1-, MtDef6-, or OeDef7-type peptide or defensin sequence and 3 amino acids at the C-terminus of the junction sequence are contributed by the first 3 N-terminal residues of the spacer peptide sequence. In certain embodiments, 3 amino acids at the N-terminus of the junction sequence are contributed by the final 3 C-terminal residues of the spacer peptide sequence and 3 amino acids at the C-terminus of the junction sequence are contributed by the first 3 N-terminal residues of the OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide sequence.

    [0061] As used herein, the phrase “linker peptide” refers to any peptide that joins at least one OeDef1-, MtDef6-, or OeDef7-type peptide and another peptide (including an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide) in a single encoded OeDef1-, MtDef6-, or OeDef7-type protein. In certain embodiments, a linker peptide can be susceptible to cleavage by an endoproteinase. In certain alternative embodiments, a linker peptide can be a spacer peptide that is resistant to endoproteinase cleavage. One embodiment where a linker peptide can be (e.g., function as) a spacer peptide is when the linker peptide that joins at least one OeDef1-, MtDef6-, or OeDef7-type peptide and another peptide (including an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide) in a single encoded OeDef1-, MtDef6-, or OeDef7-type protein is localized in an extracellular or sub-cellular location that is deficient in endogenous endoproteinases that can cleave that linker peptide. One embodiment where a linker peptide can be (e.g., function as) a spacer peptide is when the linker peptide is joined to one or more heterologous peptide (including an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide) that render the linker peptide resistant to endoproteinase cleavage. Another embodiment where a linker peptide can be (e.g., function as) a spacer peptide is when the linker peptide is joined to a peptide(s) (including OeDef1-, MtDef6-, or OeDef7-type peptides and another peptide) via a heterologous junction sequence or sequences that render the linker peptide resistant to endoproteinase cleavage. A linker peptide can be naturally occurring or non-naturally occurring (e.g., synthetic).

    [0062] As used herein, the phrase “linker peptide that is susceptible to cleavage by a endoproteinase”, when used in the context of a linker peptide sequence that joins at least one OeDef1-, MtDef6-, or OeDef7-type peptide and another peptide (including an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide) in a single encoded OeDef1-, MtDef6-, or OeDef7-type protein, refers to a linker peptide sequence that permits less than 50% of an OeDef1-, MtDef6-, or OeDef7-type peptide containing OeDef1-, MtDef6-, or OeDef7-type protein in a transgenic or genetically edited organism or cell, an extracellular space of the organism or cell, a sub-cellular location of the organism or cell, or any combination thereof to accumulate as a protein comprising the linker peptide and at least one OeDef1-, MtDef6-, or OeDef7-type peptide and another peptide (including an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide) that are covalently linked thereto. The phrase “linker peptide that is susceptible to cleavage by a plant endoproteinase”, when used in the context of a linker peptide sequence that joins at least one OeDef1-, MtDef6-, or OeDef7-type peptide and another peptide (including an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide) in a single encoded OeDef1-, MtDef6-, or OeDef7-type protein, refers to a linker peptide sequence that permits less than 50% of an OeDef1-, MtDef6-, or OeDef7-type peptide containing OeDef1-, MtDef6-, or OeDef7-type protein in a transgenic or genetically edited plant or cell, an extracellular space of the plant or cell, a sub-cellular location of the plant or cell, or any combination thereof to accumulate as a protein comprising the linker peptide and at least one OeDef1-, MtDef6-, or OeDef7-type peptide and another peptide (including an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide) that are covalently linked thereto. In certain embodiments, the endoproteinase is an endogenous plant, yeast, or mammalian endoproteinase.

    [0063] As used herein, the terms “microbe,” “microbes,” and “microbial” are used to refer to fungi (including yeast, mold, and dimorphic fungi) and oomycetes.

    [0064] The phrase “operably linked” as used herein refers to the joining of nucleic acid or amino acid sequences such that one sequence can provide a function to a linked sequence. In the context of a promoter, “operably linked” means that the promoter is connected to a sequence of interest such that the transcription of that sequence of interest is controlled and regulated by that promoter. When the sequence of interest encodes a protein that is to be expressed, “operably linked” means that the promoter is linked to the sequence in such a way that the resulting transcript will be efficiently translated. If the linkage of the promoter to the coding sequence is a transcriptional fusion that is to be expressed, the linkage is made so that the first translational initiation codon in the resulting transcript is the initiation codon of the coding sequence. Alternatively, if the linkage of the promoter to the coding sequence is a translational fusion and the encoded protein is to be expressed, the linkage is made so that the first translational initiation codon contained in the 5′ untranslated sequence associated with the promoter and the coding sequence is linked such that the resulting translation product is in frame with the translational open reading frame that encodes the protein. Nucleic acid sequences that can be operably linked include sequences that provide gene expression functions (e.g., gene expression elements such as promoters, 5′ untranslated regions, introns, protein coding regions, 3 untranslated regions, polyadenylation sites, and/or transcriptional terminators), sequences that provide DNA transfer and/or integration functions (e.g., T-DNA border sequences, site specific recombinase recognition sites, integrase recognition sites), sequences that provide for selective functions (e.g., antibiotic resistance markers, biosynthetic genes), sequences that provide scoreable marker functions (e.g., reporter genes), sequences that facilitate in vitro or in vivo manipulations of the sequences (e.g., polylinker sequences, site specific recombination sequences) and sequences that provide replication functions (e.g., bacterial origins of replication, autonomous replication sequences, centromeric sequences). In the context of an amino acid sequence encoding a localization, spacer, linker, or other peptide, “operably linked” means that the peptide is connected to the polyprotein sequence(s) of interest such that it provides a function. Functions of a localization peptide include localization of a protein or peptide of interest (e.g., an OeDef1-, MtDef6-, or OeDef7-type protein or peptide) to an extracellular space or subcellular compartment. Functions of a spacer peptide include linkage of two peptides of interest (e.g., two OeDef1-, MtDef6-, or OeDef7-type peptides or at least one OeDef1-, MtDef6-, or OeDef7-type peptide and another peptide (including an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide)) such that the peptides will be expressed as a single protein (e.g., an OeDef1-, MtDef6-, or OeDef7-type protein homo-dimer or OeDef1-, MtDef6-, or OeDef7-type protein hetero-dimer).

    [0065] The phrases “percent identity” or “sequence identity” as used herein refer to the number of elements (i.e., amino acids or nucleotides) in a sequence that are identical within a defined length of two DNA, RNA or protein segments in an alignment resulting in the maximal number of identical elements, and is calculated by dividing the number of identical elements by the total number of elements in the defined length of the aligned segments and multiplying by 100.

    [0066] As used herein, the phrase “resistant to cleavage by an endoproteinase,” when used in the context of a spacer peptide sequence that joins at least one OeDef1-, MtDef6-, or OeDef7-type peptide and another peptide (including an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide) in a single encoded OeDef1-, MtDef6-, or OeDef7-type protein, refers to a spacer peptide sequence that permits more than 50%, 60%, 70%, 80%, 90%, or 95% of the OeDef1-, MtDef6-, or OeDef7-type protein in a transgenic or genetically edited organism, cell, extracellular space of the organism or cell, sub-cellular location of the organism or cell, or any combination thereof to accumulate as a OeDef1-, MtDef6-, or OeDef7-type protein that comprises the spacer peptide, the OeDef1-, MtDef6-, or OeDef7-type peptide and other peptide that is covalently linked thereto. The phrase “resistant to cleavage by a plant endoproteinase”, when used in the context of a spacer peptide sequence that joins at least one OeDef1-, MtDef6-, or OeDef7-type peptide to another peptide (including an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide) in a single encoded protein, refers to a spacer peptide sequence that permits more than 50%, 60%, 70%, 80%, 90%, or 95% of the OeDef1-, MtDef6-, or OeDef7-type peptide containing OeDef1-, MtDef6-, or OeDef7-type protein in a transgenic or genetically edited plant or plant cell, an extracellular space of the plant or cell, a sub-cellular location of the plant or cell, or any combination thereof to accumulate as a OeDef1-, MtDef6-, or OeDef7-type protein that comprises the spacer peptide and the OeDef1-, MtDef6-, or OeDef7-type peptide and other peptide (including an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide) that are covalently linked thereto.

    [0067] As used herein, the phrase “spacer peptide” refers to any peptide that joins at least one OeDef1-, MtDef6-, or OeDef7-type peptide and another peptide (including an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide) in a single encoded OeDef1-, MtDef6-, or OeDef7-type protein that is resistant to cleavage by an endoproteinase. In certain embodiments, the endoproteinase is an endogenous plant, yeast, or mammalian endoproteinase. A spacer peptide can be naturally occurring or non-naturally occurring (e.g., synthetic).

    [0068] The terms “susceptible microbe (or microbes)”, “susceptible microbial infection”, and the like refer to microbes that infect plants, or human or animal patients or subjects, or microbial infections thereof, that are subjection to inhibition of microbial growth by the OeDef1-, MtDef6-, or OeDef7-type peptides or proteins disclosed herein.

    [0069] The phrase “transgenic” refers to an organism or progeny thereof wherein the organism's or progeny organism's DNA of the nuclear or organellar genome contains an inserted exogenous DNA molecule of 10 or more nucleotides in length. The phrase “transgenic plant” refers to a plant or progeny thereof wherein the plant's or progeny plant's DNA of the nuclear or plastid genome contains an introduced exogenous DNA molecule of 10 or more nucleotides in length. Such introduced exogenous DNA molecules can be naturally occurring, non-naturally occurring (e.g., synthetic and/or chimeric), from a heterologous source, or from an autologous source.

    [0070] To the extent to which any of the preceding definitions is inconsistent with definitions provided in any patent or non-patent reference incorporated herein by reference, any patent or non-patent reference cited herein, or in any patent or non-patent reference found elsewhere, it is understood that the preceding definition will be used herein.

    Further Description

    [0071] Antimicrobial peptides and proteins referred to as OeDef1-, MtDef6-, or OeDef7-type peptides and OeDef1-, MtDef6-, or OeDef7-type proteins are provided herein. In certain embodiments, the OeDef1-, MtDef6-, or OeDef7-type peptides are linked by a spacer peptide that is resistant to plant endoproteinase cleavage to provide an OeDef1-, MtDef6-, or OeDef7-type protein. The antimicrobial peptides and proteins can be applied directly to a plant, applied to a plant in the form of microorganisms that produce the OeDef1-, MtDef6-, or OeDef7-type peptide or protein, or the plants can be genetically edited to produce the OeDef1-, MtDef6-, or OeDef7-type peptide or protein. The present disclosure also relates to recombinant or edited polynucleotides, microorganisms and plants transformed with the recombinant or edited polynucleotides, plants comprising genetically edited nuclear or plastid genomes encoding the OeDef1-, MtDef6-, or OeDef7-type peptides and proteins and compositions comprising the OeDef1-, MtDef6-, or OeDef7-type peptides and proteins useful in controlling pathogenic microbes including plant pathogenic microbes. In certain embodiments, the OeDef1-, MtDef6-, or OeDef7-type protein comprising two OeDef1-, MtDef6-, or OeDef7-type peptides or an OeDef1-, MtDef6-, or OeDef7-type peptide and another peptide (including an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide) can provide for improved inhibition of microbial growth when compared to a protein containing only one of the antimicrobial peptides found in the OeDef1-, MtDef6-, or OeDef7-type protein. In certain embodiments, the OeDef1-, MtDef6-, or OeDef7-type peptides and proteins provided herein are cation-tolerant. Such cation-tolerant defensins can be more effective than cation-sensitive defensins in providing effective control of plant pathogenic microbes in transgenic crops. Cation-tolerant defensins provided herein can function (e.g., inhibit plant pathogenic microbes including fungal pathogens) in the normal cation-rich physiological environment of plant tissues. Cation-tolerant defensins provided herein can also function (e.g., inhibit pathogenic microbes including fungal pathogens) in the normal cation-rich physiological environment of a subject (e.g., a human or animal) infected with pathogenic microbes.

    [0072] Provided herein are recombinant polynucleotides comprising a polynucleotide encoding a first antifungal peptide operably linked to a polynucleotide comprising a promoter that is heterologous to the polynucleotide encoding the first antifungal protein. In certain embodiments, the first antifungal peptide is an OeDef1-, MtDef6-, or OeDef7-type peptide.

    [0073] SEQ ID NO: 1 is the amino acid sequence of an endogenous olive tree (Olea europaea subsp. europaea) defensin antifungal peptide designated herein as OeDef1a:

    TABLE-US-00001 (SEQ ID NO: 1) KPC.sub.1TKLSKGWRGLC.sub.2APHKC.sub.3SSYC.sub.4IHHEGAYHGAC.sub.5LKNRHSKHYG C.sub.6YC.sub.7YYRHC.sub.8Y

    [0074] The underlined cysteines (C.sub.1-8) can form disulfide bonds.

    [0075] OeDef1-, MtDef6-, or OeDef7-type peptides of this disclosure are characterized as containing a defensin gamma-core peptide that is involved in the antifungal activity of plant defensins. A gamma-core peptide typically contains a net positive charge and has at least one hydrophobic amino acid. In certain embodiments, an OeDef1-, MtDef6-, or OeDef7-type peptide comprises a gamma-core peptide having a variant gamma-core consensus sequence of GXCX3-10C where X is any amino acid (SEQ ID NO: 3). In certain embodiments, an OeDef1-, MtDef6-, or OeDef7-type peptide can comprise the gamma-core consensus sequence of GXCX3-9C where X is any amino acid (SEQ ID NO: 34). In certain embodiments, an OeDef1-, MtDef6-, or OeDef7-type peptide comprises the gamma-core consensus sequence of GXCX3-9C (SEQ ID NO: 34) or GXCX3-10C (SEQ ID NO:3); wherein X is preferentially selected from cationic and/or hydrophobic amino acids. In certain embodiments, an OeDef1-, MtDef6-, or OeDef7-type peptide comprises the gamma-core sequence of SEQ ID NO: 4, 31, 32, 34, 37, 51, or a variant thereof that maintains or increases the number of cationic and/or hydrophobic amino acids. It is believed that the gamma-core peptide is involved in phospholipid- and/or sphingolipid-binding while specific amino acids outside the gamma-core motif are also involved in phospholipid- and sphingolipid-binding. With respect to SEQ ID NO: 1, the sequence between the first cysteine (C.sub.1) and the second cysteine (C2) (or in certain embodiments a corresponding region in an OeDef1-, MtDef6-, or OeDef7-type peptide) also contributes to antifungal activity. In addition, cationicity and hydrophobicity also factor into the potency of antifungal activity.

    [0076] Variants of OeDef1-, MtDef6-, or OeDef7-type peptides and proteins provided herein can also comprise substitutions of one or more of the conserved cysteine residues (e.g., C.sub.1-C.sub.8 in SEQ ID NO: 1). In certain embodiments, one or more of the conserved cysteine residues can be substituted with another amino acid residue including a glycine, serine, threonine, cysteine, cystine, tyrosine, asparagine, or glutamine residue. In certain embodiments, one or more of the conserved cysteine residues can be substituted with a serine residue. While not being limited by theory, it is believed that OeDef1-, MtDef6-, or OeDef7-type peptide cysteine variants that lack one or more disulfide linkages may be desirable for use in transgenic or gene edited plants that are ultimately used as animal feed or as food for human consumption as such variants are predicted to be more readily digested by animals or humans that consume the plant products. OeDef1-, MtDef6-, or OeDef7-type variant peptides and proteins that have shorter half-lives in the digestive tracts of animals or humans are in theory anticipated to have less potential to become food allergens.

    [0077] In certain embodiments, an OeDef1-type peptide comprises an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, which is a full length endogenous olive plant defensin peptide. In certain embodiments, an OeDef1-type peptide comprises an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 36, which is a 37 amino acid long C-terminal fragment of SEQ ID NO: 1 encompassing the gamma-core peptide. In certain embodiments, an OeDef1-type peptide comprises an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 38, which is a 31 amino acid long C-terminal fragment of SEQ ID NO: 1 encompassing the gamma-core peptide. In certain embodiments, an OeDef1-type peptide comprises an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 35, which is a 22 amino acid long fragment of SEQ ID NO: 1 consisting of the gamma-core peptide sequence and eight (8) additional adjacent C-terminal amino acid residues. In certain embodiments, OeDef1-type peptides of as little as 10-20 amino acids in length exhibit antifungal activity when they carry a net positive charge and their amino acid sequence comprises 20% or higher of hydrophobic amino acids and comprise a gamma-core peptide sequence.

    [0078] In certain embodiments, an OeDef1-type peptide comprises the OeDef1-type peptide consensus sequence of SEQ ID NO: 33 prepared from an alignment of SEQ ID NO: 1 (OeDef1a), SEQ ID NO: 5 (OeDef1_V1), SEQ ID NO: 6 (OeDef1_V2), SEQ ID NO: 7 (OeDef1_V3), and SEQ ID NO: 8 (OeDef1b). In certain embodiments, conservative and/or semi-conservative amino acid substitutions can be made in one OeDef1-type peptide to create a variant OeDef1-type peptide. In certain embodiments, an OeDef1-type peptide comprises a variant of SEQ ID NO: 33 with one or more conservative and/or semi-conservative amino acid substitutions. In certain embodiments, an OeDef1-type peptide comprises a variant of SEQ ID NO: 33, wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively. After substitution, the variant OeDef1-type peptide maintains a defensin gamma-core peptide sequence, although not necessarily the gamma-core peptide of OeDef1a having the amino acid of SEQ ID NO: 4. For example, in certain embodiments, an OeDef1-type peptide disclosed herein comprises: the variant gamma-core consensus sequence GXCX3-10C, where X is any amino acid (SEQ ID NO: 3); the canonical gamma-core consensus sequence GXCX3-9C, where X is any amino acid (SEQ ID NO: 34); the OeDef1a gamma-core peptide of SEQ ID NO: 4; the OeDef1b gamma-core peptide of SEQ ID NO: 31; the OeDef1-type gamma-core consensus peptide of SEQ ID NO: 37; or the MtDef4 gamma-core peptide of SEQ ID NO: 32.

    [0079] In certain embodiments, an OeDef1-type peptide comprises an amino acid sequence of any one of: [0080] SEQ ID NO: 1 (OeDef1a endogenous Oe defensin peptide); [0081] SEQ ID NO: 2 (OeDef1_V1 variant peptide in which the endogenous gamma-core peptide is replaced with the canonical MtDef4 gamma-core peptide); [0082] SEQ ID NO: 5 (OeDef1_V2 variant peptide comprising amino acid substitutions resulting in a more cationic peptide as compared to SEQ ID NO: 1); [0083] SEQ ID NO: 6 (OeDef1_V3 variant comprising amino acid substitutions that enhance hydrophobicity as compared to SEQ ID NO: 1); [0084] SEQ ID NO: 7 (OeDef1_V4 variant comprising amino acid substitutions creating a more cationic and hydrophobic peptide as compare to SEQ ID NO: 1); [0085] SEQ ID NO: 8 (another endogenous Oe defensin peptide designated herein as OeDef1b); [0086] SEQ ID NO: 33 (OeDef1-type peptide consensus sequence prepared from the alignment of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8); [0087] SEQ ID NO: 35 (OeDef1 Deletion Variant 1 consisting of the gamma-core and eight adjacent C-terminal residues of SEQ ID NO: 1); [0088] SEQ ID NO: 36 (OeDef1 Deletion Variant 2 consisting of the C-terminal 37 amino acid residues of SEQ ID NO: 1); [0089] SEQ ID NO: 38 (OeDef1 Deletion Variant 3 consisting of the C-terminal 31 amino acid residues of SEQ ID NO: 1); or [0090] SEQ ID NO: 39 (OeDef1 with substitution of Dahlia DmAMP1 defensin gamma core).

    [0091] In certain embodiments, an OeDef1-type peptide contains (i) at least seven of the basic amino acid residues set forth in SEQ ID NO: 1. In certain embodiments, an OeDef1-type peptide contains (ii) at least one substitution of a hydrophobic amino acid residue of SEQ ID NO: 1, SEQ ID NO: SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 39, or SEQ ID NO: 44 with another hydrophobic amino acid residue. In certain embodiments, an OeDef1-type peptide contains (iii) at least one substitution of a basic amino acid residue of SEQ ID NO: 1, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 39, or SEQ ID NO: 44 with another basic amino acid residue. In certain embodiments, an OeDef1-type peptide contains (iv) at least one substitution of an acidic amino acid residue of SEQ ID NO: 1, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 39, or SEQ ID NO: 44 with another acidic amino acid residue or with a basic amino acid residue. In certain embodiments, an OeDef1-type peptide contains (v) any combination of (i), (ii), (iii), and (iv) above. In certain embodiments, an OeDef1-type peptide contains 7, 8, 9, 10, 11, 12, 13, 14, or 15 basic amino acid residues.

    [0092] FIG. 1A shows representative examples of cationic, anionic, and hydrophobic amino acid substitutions to the OeDef1a peptide of SEQ ID NO: 1 (top, middle, and bottom, respectively). FIG. 1B shows representative examples of cationic and hydrophobic amino acid substitutions to the gamma-core peptide region of OeDef1a (top and bottom, respectively). FIG. 1C shows representative examples of cationic, anionic, and hydrophobic amino acid substitutions to the OeDef1-C31 Deletion Variant 3 (C-terminal 31 amino acids of SEQ ID NO: 1) (top, middle, and bottom, respectively). One of ordinary skill in the art will understand that similar and/or corresponding cationic, anionic, and/or hydrophobic amino acid substitutions can be made in other OeDef1-type peptide sequences not limited to SEQ ID NO: 1, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 39, or SEQ ID NO: 44.

    [0093] In certain embodiments, an MtDef6-type peptide comprises an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 47, which is a full length defensin peptide. In certain embodiments, an MtDef6-type peptide comprises an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 48, 49, or 50, which are variants of the MtDef6 peptide of SEQ ID NO: 47. In certain embodiments, any of the aforementioned MtDef6-type peptides can exhibit antifungal activity when: (i) they carry a net positive charge of +9, +10, +11, or more; (ii) their amino acid sequence comprises 38% or higher of hydrophobic amino acids; and (iii) the peptides comprise a gamma-core peptide sequence.

    [0094] In certain embodiments, an MtDef6-type peptide comprises the MtDef6-type peptide consensus sequence prepared from an alignment of SEQ ID NO: 47 (MtDef6), SEQ ID NO: 48 (MtDef6_v1), SEQ ID NO: 49 (MtDef6_v2), and SEQ ID NO: 50 (MtDef6_v3). In certain embodiments, conservative and/or semi-conservative amino acid substitutions can be made in one MtDef6-type peptide to create a variant MtDef6-type peptide. In certain embodiments, an MtDef6-type peptide comprises a variant of SEQ ID NO: 47, 48, 49, or 50 with one or more conservative and/or semi-conservative amino acid substitutions. In certain embodiments, an MtDef6-type peptide comprises a variant of SEQ ID NO: 47, 48, 49, or 50, wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively. After substitution, the variant MtDef6-type peptide maintains a defensin gamma-core peptide sequence, although not necessarily the gamma-core peptide of MtDef6 (SEQ ID NO:47) having the amino acid of SEQ ID NO: 51. For example, in certain embodiments, an MtDef6-type peptide disclosed herein comprises: the variant gamma-core consensus sequence GXCX3-10C, where X is any amino acid (SEQ ID NO: 3); the canonical gamma-core consensus sequence GXCX3-9C, where X is any amino acid (SEQ ID NO: 34); the OeDef1a gamma-core peptide of SEQ ID NO: 4; the OeDef1b gamma-core peptide of SEQ ID NO: 31; the OeDef1-type gamma-core consensus peptide of SEQ ID NO: 37; the MtDef4 gamma-core peptide of SEQ ID NO: 32, or the OeDef7 gamma core of SEQ ID NO:59.

    [0095] In certain embodiments, an MtDef6-type peptide comprises an amino acid sequence of any one of: SEQ ID NO: 47 (MtDef6 defensin peptide); SEQ ID NO: 48 (MtDef6_v1 variant comprising an additional disulfide bond, 38% hydrophobic AA, +9 net charge); SEQ ID NO: 49 (MtDef6_v2 variant having 38% hydrophobic AA, +10 net charge); SEQ ID NO: 50 (MtDef6_v3 variant having 38% hydrophobic AA, +10 net charge); or an MtDef6 variant of SEQ ID NO: 47 comprising any combination of 2 or moreamino acid changes set forth in SEQ ID NO: 48, 49, and/or 50.

    [0096] In certain embodiments, an MtDef6-type peptide contains (i) at least seven, eight, nine , ten or more of the basic amino acid residues set forth in SEQ ID NO: 47, 48, 49, or 50. In certain embodiments, an MtDef6-type peptide contains (ii) at least one substitution of a hydrophobic amino acid residue of SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, or SEQ ID NO: 50 with another hydrophobic amino acid residue. In certain embodiments, an MtDef6-type peptide contains (iii) at least one substitution of a basic amino acid residue of SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, or SEQ ID NO: 50 with another basic amino acid residue. In certain embodiments, an MtDef6-type peptide contains (iv) at least one substitution of an acidic amino acid residue of SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, or SEQ ID NO: 50 with another acidic amino acid residue or with a basic amino acid residue. In certain embodiments, an OeDef1-type peptide contains (v) any combination of (i), (ii), (iii), and (iv) above. In certain embodiments, an MtDef6-type peptide contains 7, 8, 9, 10, 11, 12, 13, 14, or 15 basic amino acid residues.

    [0097] In certain embodiments, an OeDef7-type peptide comprises an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 54, which is a full length defensin peptide. In certain embodiments, an OeDef7-type peptide comprises an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, or SEQ ID NO: 58, which are variants of the OeDef7 peptide of SEQ ID NO: 54. In certain embodiments, any of the aforementioned OeDef7-type peptides can exhibit antifungal activity when: (i) they carry a net positive charge of +8, +9, +10, +11, or more; (ii) their amino acid sequence comprises 38% or higher of hydrophobic amino acids; and (iii) the peptides comprise a gamma-core peptide sequence.

    [0098] In certain embodiments, an OeDef7-type peptide comprises the OeDef7-type peptide consensus sequence prepared from an alignment of SEQ ID NO: 54 (OeDef7), SEQ ID NO: 55 (OeDef7_v1), SEQ ID NO:56 (OeDef7_v2), SEQ ID NO: 57 (OeDef7_v3), and/or SEQ ID NO: 58 (OeDef7 v4). In certain embodiments, conservative and/or semi-conservative amino acid substitutions can be made in one OeDef7-type peptide to create a variant OeDef7-type peptide. In certain embodiments, an OeDef7-type peptide comprises a variant of SEQ ID NO: 54, 55, 56, 57, or 58 with one or more conservative and/or semi-conservative amino acid substitutions. In certain embodiments, an OeDef7-type peptide comprises a variant of SEQ ID NO: 54, 55, 56, 57, or 58, wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively. After substitution, the variant OeDef7-type peptide maintains a defensin gamma-core peptide sequence, although not necessarily the gamma-core peptide of OeDef7 (SEQ ID NO:54) having the amino acid of SEQ ID NO: 59. For example, in certain embodiments, an OeDef7-type peptide disclosed herein comprises: the variant gamma-core consensus sequence GXCX3-10C, where X is any amino acid (SEQ ID NO: 3); the canonical gamma-core consensus sequence GXCX3-9C, where X is any amino acid (SEQ ID NO: 34); the OeDef1a gamma-core peptide of SEQ ID NO: 4; the OeDef1b gamma-core peptide of SEQ ID NO: 31; the OeDef1-type gamma-core consensus peptide of SEQ ID NO: 37; the MtDef4 gamma-core peptide of SEQ ID NO: 32, or the MtDef6 gamma core of SEQ ID NO:51.

    [0099] In certain embodiments, an OeDef7-type peptide comprises an amino acid sequence of any one of: SEQ ID NO: 54 (OeDef7 defensin peptide comprising 40% hydrophobic AA and a +8 net charge); SEQ ID NO: 55 (OeDef7_v1 variant comprising an additional disulfide bond, 42% hydrophobic AA, and a +8 net charge); SEQ ID NO: 56 (OeDef7_v2 variant having 40% hydrophobic AA and a +9 net charge); SEQ ID NO: 57 (OeDef7_v3 variant having 40% hydrophobic AA and a +9 net charge); SEQ ID NO: 58 (OeDef7_v4 variant having 40% hydrophobic AA and a +9 net charge);or an OeDef7 variant of SEQ ID NO: 54 comprising any combination of 2 or more amino acid changes set forth in SEQ ID NO: 55, 56, 57, and/or 58.

    [0100] In certain embodiments, an OeDef7-type peptide contains (i) at least seven, eight, nine , ten or more of the basic amino acid residues set forth in SEQ ID NO: 54, 55, 56, 57, or 58. In certain embodiments, an OeDef7-type peptide contains (ii) at least one substitution of a hydrophobic amino acid residue of SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, or SEQ ID NO: 58 with another hydrophobic amino acid residue. In certain embodiments, an OeDef7-type peptide contains (iii) at least one substitution of a basic amino acid residue of SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, or SEQ ID NO: 58 with another basic amino acid residue. In certain embodiments, an OeDef7-type peptide contains (iv) at least one substitution of an acidic amino acid residue of SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, or SEQ ID NO: 58 with another acidic amino acid residue or with a basic amino acid residue. In certain embodiments, an OeDef1-type peptide contains (v) any combination of (i), (ii), (iii), and (iv) above. In certain embodiments, an OeDef7-type peptide contains 7, 8, 9, 10, 11, 12, 13, 14, or 15 basic amino acid residues.

    [0101] OeDef1-, MtDef6-, or OeDef7-type peptides or proteins provided and used in various embodiments disclosed herein can comprise one or more of the following structural features.

    [0102] In certain embodiments, a first structural feature of the OeDef1-, MtDef6-, or OeDef7-type peptides is a net positive charge at neutral pH. In certain embodiments, the OeDef1-, MtDef6-, or OeDef7-type peptides will have a net positive charge at neutral pH of at least +5, +6, +7, +8, +9, or +10. In certain embodiments, the OeDef1-, MtDef6-, or OeDef7-type peptides will have a net positive charge at neutral pH of at least +4, +5, +6, +7, +8, +9, or +10 to +12, +13, +14, or +15. In certain embodiments, such net positive charges in OeDef1-type peptides can be achieved by methods that include: (i) maintaining basic amino acid residues found in OeDef1-type peptides including SEQ ID NO: 1, 2, 8, 33, 35, 36, 38, 39, or 44, in MtDef6-type peptides including SEQ ID NO: 47, 48, 49, or 50, and in OeDef7-type peptides including SEQ ID NO: 54, 55, 56, or 57; or substituting such residues with another basic amino acid residue; (ii) substituting acidic or polar amino acid residues found in OeDef1-type peptides including SEQ ID NO: 1, 2, 8, 33, 35, 36, 38, 39, or 44, in MtDef6-type peptides including SEQ ID NO: 47, 48, 49, or 50, and in OeDef7-type peptides including SEQ ID NO: 54, 55, 56, or 57 with a basic amino acid residue; or a combination of (i) and (ii). Examples of such substitutions of basic amino acid residues in certain OeDef1-type peptides include those set forth in FIG. 1A, B, and C. In certain embodiments, such net positive charges in OeDef1-type peptides can be achieved by preferentially selecting or substituting a basic amino acid residue at variable positions in the OeDef1-type peptide that correspond to a variable position of SEQ ID NO: 33. For example, a basic amino acid can be preferentially selected or substituted for any of the variable amino acids at any position X of SEQ ID NO: 33. In certain embodiments, such selections or substitutions of basic amino acid residues can be as exemplified in FIG. 1A, B, or C. Substitutions of cationic amino acid residues set forth in FIGS. 1A, B, and C for the OeDef1-type peptides of SEQ ID NO: 1, 4, 35, and 38 can also be made in the corresponding amino acid residues of other OeDef1-type peptides.

    [0103] In certain embodiments, a second structural feature of the OeDef1-, MtDef6-, or OeDef7-type peptides is a significant percentage of hydrophobic amino acid residues. In certain embodiments, the OeDef1-, MtDef6-, or OeDef7-type peptides will comprise at least about 25%, 26%, 28% 30%, 32%, 34%, 36%, 37%, or 38% hydrophobic amino acid residues. In certain embodiments, the OeDef1-, MtDef6-, or OeDef7-type peptides will comprise at least about 25%, 26%, 28% 30%, 32%, 34%, or 36% to 37%, 38%, 40%, 42%, or 45% hydrophobic amino acid residues. In certain embodiments, such percentages of hydrophobic amino acids in OeDef1-type peptides can be achieved by methods that include: (i) maintaining hydrophobic amino acid residues found in OeDef1-type peptides including SEQ ID NO: 1, 2, 8, 33, 35, 36, 38, 39, or 44, in MtDef6-type peptides including SEQ ID NO: 47, 48, 49, or 50, and in OeDef7-type peptides including SEQ ID NO: 54, 55, 56, or 57; or substituting such residues with another hydrophobic amino acid residue; (ii) substituting polar amino acid residues found in OeDef1-type peptides including SEQ ID NO: 1, 2, 8, 33, 35, 36, 38, 39, or 44, in MtDef6-type peptides including SEQ ID NO: 47, 48, 49, or 50, and in OeDef7-type peptides including SEQ ID NO: 54, 55, 56, or 57 with a hydrophobic amino acid residue; (iii) substituting neutral polar amino acids found in OeDef1-type peptides including SEQ ID NO: 1, 2, 8, 33, 35, 36, 38, 39, or 44, in MtDef6-type peptides including SEQ ID NO: 47, 48, 49, or 50, and in OeDef7-type peptides including SEQ ID NO: 54, 55, 56, or 57 for hydrophobic amino acids; or a combination of (i), (ii), and (iii). Examples of such substitutions of hydrophobic amino acid residues in certain OeDef1-type peptides include those set forth in FIG. 1A, B, and C. In certain embodiments, such percentages of hydrophobic amino acids in OeDef1-type peptides can be achieved by preferentially selecting or substituting a hydrophobic amino acid residue at variable positions in the OeDef1-type peptide that correspond to a variable position of SEQ ID NO: 33. For example, a hydrophobic amino acid can be preferentially selected or substituted for any of the variable amino acids at any position X of SEQ ID NO: 33. In certain embodiments, such selections or substitutions of percentages of hydrophobic amino acids can be as exemplified in FIG. 1A, B, or C. Substitutions of hydrophobic amino acid residues set forth in FIGS. 1A, B, and C for the OeDef1-type peptides of SEQ ID NO: 1, 4, 35, and 38 can also be made in the corresponding amino acid residues of other OeDef1-type peptides.

    [0104] Nucleic acid molecules encoding any of the aforementioned OeDef1-type, MtDef6-type, and OeDef7-type peptides or proteins are also provided herein. Such nucleic acids that encode OeDef1-type peptides include a synthetic DNA of SEQ ID NO: 40, 41, 42, and variants thereof having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 40, 41, or 42. Such nucleic acids that encode MtDef6-type peptides include a synthetic DNA of SEQ ID NO: 52 and variants thereof having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 52. Such nucleic acids that encode OeDef7-type peptides include a synthetic DNA of SEQ ID NO: 60 and variants thereof having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 60. Recombinant DNA molecules comprising the aforementioned nucleic acid molecules are also provided herein and in particular recombinant DNA molecules comprising a heterologous promoter that is operably linked to the aforementioned nucleic acid molecules are also provided herein.

    [0105] In certain embodiments, spacer peptide domains that can be used to join at least one OeDef1-, MtDef6-, or OeDef7-type peptide and another peptide (including an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide) in a single encoded OeDef1-, MtDef6-, or OeDef7-type protein can be obtained from a variety of sources. Examples of spacer peptides that can be used as is or in a mutagenized form include the MtDef5 spacer peptide (SEQ ID NO: 9) as well as SEQ ID NO: 20, 21, 22, 23, 24, 25, and 26. Mutagenesis of any of the aforementioned spacer peptides can entail the insertion, deletion, or substitution of at least one, two, three, four, five, six, or seven amino acid residues in the linker peptide sequence that render the mutagenized linker peptide resistant to cleavage by a plant endoproteinase. Spacer peptides for use in OeDef1-, MtDef6-, or OeDef7-type proteins that comprise mutagenized linker peptide sequences having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of SEQ ID NO: 9, 20, 21, 22, 23, 24, 25, or 26 are provided herein. Spacer peptides for use in the OeDef1-, MtDef6-, or OeDef7-type proteins can also be obtained from multimeric- or multi-domain proteins that do not contain OeDef1-, MtDef6-, or OeDef7-type peptide, defensin or other antimicrobial peptides. Such peptide linker sequences that join peptides in multimeric or multi-domain proteins have been disclosed (Argos, 1990; George RA, Heringa (2002)). Examples of suitable peptide sequences from multimeric or multi-domain proteins that can be used as spacer domains include immunoglobulin hinge regions from immunoglobulins, a linker between the lipoyl and E3 binding domain in pyruvate dehydrogenase (Turner et al., 1993), a linker between the central and C-terminal domains in cysteine proteinase (P9; Mottram et al., 1989), and functional variants thereof. Spacer peptides for use in the OeDef1-, MtDef6-, or OeDef7-type proteins can also be wholly or partially synthetic peptide sequences. Such synthetic spacer peptides are designed to provide for a flexible linkage between the at least one OeDef1-, MtDef6-, or OeDef7-type peptide and another peptide (including an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide) and to be resistant to cleavage by endogenous plant or other endoproteinases. In certain embodiments, the length of the synthetic spacer peptide can be between about 3, 4, 8, 10, 12, or 16 and about 20, 24, 28, 30, 40, or 50 amino acid residues in length. In certain embodiments, the synthetic spacer peptide can comprise a glycine-rich or glycine/serine containing peptide sequence. Such sequences can include a (Gly4)n sequence, a (Gly4Ser)n sequence of SEQ ID NO: 18, a Ser(Gly4Ser)n sequence of SEQ ID NO: 19, combinations thereof, and variants thereof, wherein n is a positive integer equal to 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In certain embodiments, such glycine-rich or glycine/serine containing synthetic peptide sequences can also contain threonyl and/or alanyl residues for flexibility as well as polar lysyl and/or glutamyl residues. Additional synthetic linker sequences that can be used as spacer peptides include combinations thereof, and variants thereof. Such variants of synthetic linker sequences include insertions, deletions, and substitutions of amino acid residues. Variants of any of the aforementioned synthetic peptide spacers also include insertions and/or substitutions of one or more residues that frequently occur in peptides that join domains in proteins such as prolyl, arginyl, phenylalanyl, threonyl, glutamyl, glutaminyl, and combinations thereof. In certain embodiments, such glycine-rich, glycine/serine containing peptide sequence, or other synthetic peptide spacer sequence can be used to mutagenize a linker peptide sequence. In certain embodiments, mutagenesis of a linker peptide sequence by insertion and/or substitution of a glycine-rich or glycine/serine containing peptide sequence can be used to disrupt a peptide sequence recognized by a plant endoproteinase such as a set of diacidic and/or dibasic residues or a site that is cleaved by a cysteine, serine, threonine, metallo-, or aspartic plant endoproteinase. The composition and design of peptides suitable for flexible linkage of protein domains described in the literature (Chen et al., 2013) can be adapted for use as spacer peptides in the OeDef1-, MtDef6-, or OeDef7-type proteins provided herein. Spacer peptides useful for joining defensin monomers described in WO/2017/156457 and WO2017127558, which are each incorporated herein by reference in their entireties, can also be used to join OeDef1-, MtDef6-, or OeDef7-type peptides disclosed herein to other OeDef1-, MtDef6-, or OeDef7-type peptides, defensins, antimicrobial peptides, or other peptides.

    [0106] Since the at least one OeDef1-, MtDef6-, or OeDef7-type peptide and another peptide (including an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide) peptides are joined to one another in the OeDef1-, MtDef6-, or OeDef7-type protein, the spacer peptide sequences and the junction sequences formed by joining either the amino- or carboxy-terminus of an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin to a spacer peptide are in certain embodiments also designed or engineered to be free of amino acid sequences that are susceptible to cleavage by plant or other endoproteinases. In designing OeDef1-, MtDef6-, or OeDef7-type proteins for expression in plant or other hosts including bacteria, yeast, mammalian cells, and the like, the spacer peptide and junction sequences will typically lack diacidic (aspartyl residues, glutamyl residues, and any combination thereof), dibasic (arginyl residues, lysyl residues, and any combination thereof), or combinations of diacidic and dibasic residues in certain embodiments provided herein. Spacer peptide and junction sequences will typically be resistant to cleavage by at least one of a cysteine, serine, threonine, metallo-, or aspartic plant endoproteinase in certain embodiments provided herein. Amino acid sequences identified as plant endoproteinase substrates (Tsiatsiani et al., 2012) will also typically be absent from spacer peptide and junction sequences in certain embodiments provided herein.

    [0107] In certain embodiments, the OeDef1-, MtDef6-, or OeDef7-type proteins provided herein can comprise a spacer peptide or junction sequence that is susceptible to cleavage by a plant endoproteinase when the OeDef1-, MtDef6-, or OeDef7-type protein is expressed in a plant, plant cell, yeast cell, or mammalian cell in a manner that that will prevent such cleavage. In one such embodiment, the OeDef1-, MtDef6-, or OeDef7-type protein that comprises a spacer peptide or junction sequence that is susceptible to cleavage by a plant endoproteinase is targeted to an extracellular or sub-cellular compartment where activity of that plant endoproteinase is reduced or absent. In certain embodiments where the spacer peptide is resistant to cleavage by endoproteinases in the plant cell, or other cell, cytoplasm, the OeDef1-, MtDef6-, or OeDef7-type protein can be expressed in the cytoplasm by expressing an OeDef1-, MtDef6-, or OeDef7-type protein that lacks any targeting signals. In certain embodiments, an OeDef1-, MtDef6-, or OeDef7-type protein that comprises a spacer peptide or junction sequence that is susceptible to cleavage by a vacuolar plant endoproteinase is targeted to either the apoplast, plastids, mitochondria, or endoplasmic reticulum by operable linkage of suitable localization peptides to that OeDef1-, MtDef6-, or OeDef7-type protein and/or by removal of any vacuolar localization signal that could have been associated with a given OeDef1-, MtDef6-, or OeDef7-type peptide or protein. In certain embodiments, an OeDef1-, MtDef6-, or OeDef7-type protein that comprises a spacer peptide or junction sequence that is susceptible to cleavage by a plastidic plant endoproteinase is targeted to either the apoplast , mitochondria, endoplasmic reticulum, or vacuole by operable linkage of suitable localization peptides to that OeDef1-, MtDef6-, or OeDef7-type protein and/or by removal of any plastid localization signal that could have been associated with a given OeDef1-, MtDef6-, or OeDef7-type peptide or protein. In certain embodiments, an OeDef1-, MtDef6-, or OeDef7-type protein that comprises a spacer peptide or junction sequence that is susceptible to cleavage by an apoplastic plant endoproteinase is targeted to either mitochondria, plastids, endoplasmic reticulum, or vacuole by operable linkage of suitable localization peptides to that OeDef1-, MtDef6-, or OeDef7-type protein. In certain embodiments, an OeDef1-, MtDef6-, or OeDef7-type protein that comprises a spacer peptide or junction sequence that is susceptible to cleavage by a mitochondrial plant endoproteinase is targeted to an apoplastic space, plastids, endoplasmic reticulum, or vacuole by operable linkage of suitable localization peptides to that OeDef1-, MtDef6-, or OeDef7-type protein. Also provided herein are embodiments where an OeDef1-, MtDef6-, or OeDef7-type protein that comprises one or more spacer peptides that are resistant to cleavage by a plant endoproteinase is targeted to the apoplast, plastids, mitochondria, vacuole, or endoplasmic reticulum.

    [0108] An OeDef1-, MtDef6-, or OeDef7-type peptide provided herein can be operably linked to another OeDef1-, MtDef6-, or OeDef7-type peptide, defensin, or antimicrobial peptide via a linker peptide sequence that is susceptible to cleavage by an endoproteinase, including a plant endoproteinase. In certain embodiments, the resultant OeDef1-, MtDef6-, or OeDef7-type protein can be expressed in a cell such that the endoproteinase cleaves the OeDef1-, MtDef6-, or OeDef7-type protein to provide at least one OeDef1-, MtDef6-, or OeDef7-type peptide and another peptide (including an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide). Such OeDef1-, MtDef6-, or OeDef7-type proteins can be provided in a cellular compartment (e.g., cytoplasm, mitochondria, plastid, vacuole, or endoplasmic reticulum) or extracellular space (i.e., to the apoplast) having an endoproteinase that cleaves the linker peptide. Cleavable linker peptides are disclosed in WO2014078900, Vasivarama and Kirti, 2013a, Francois et al., Vasivarama and Kirti, 2013b, and WO2017127558 can be used in the OeDef1-, MtDef6-, or OeDef7-type proteins provided herein. Other cleavable linker peptide sequences that can be used include SEQ ID NO: 27 and SEQ ID NO: 28.

    [0109] A variety of different OeDef1-, MtDef6-, or OeDef7-type peptides and defensin peptides can be used in the OeDef1-, MtDef6-, or OeDef7-type proteins provided herein. In certain embodiments, the OeDef1-type peptides and/or defensin peptides in the OeDef1-type protein will be identical or related to one another such that the two peptides have at least 60%, 70%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity. In certain embodiments, the MtDef6-type peptides and/or defensin peptides in the MtDef6-type protein will be identical or related to one another such that the two peptides have at least 60%, 70%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity. In certain embodiments, the OeDef7-type peptides and/or defensin peptides in the OeDef7-type protein will be identical or related to one another such that the two peptides have at least 60%, 70%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity. In certain embodiments, the OeDef1-type peptides and/or defensin peptides will be distinct and have less than 60% identity to one another. In any of the aforementioned embodiments, the OeDef1-type peptides and/or defensin peptide(s) can comprise an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% identical to SEQ ID NO: 1, 2, 8, 33, 35, 36, 38, 39, or 44, fragments thereof, and chimeras thereof. In any of the aforementioned embodiments, the MtDef6-type peptides and/or defensin peptide(s) can comprise an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% identical to SEQ ID NO: 47, 48, 49, or 50, fragments thereof, and chimeras thereof. In any of the aforementioned embodiments, the OeDef7-type peptides and/or defensin peptide(s) can comprise an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% identical to SEQ ID NO: 54, 55, 56, 57, and 58, fragments thereof, and chimeras thereof. In certain embodiments, OeDef1-type peptides and/or defensin peptide variants used in the OeDef1-type protein can comprise an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identical to SEQ ID NO: 1, 2, 8, 33, 35, 36, 38, 39, or 44. In certain embodiments, OeDef1-type peptides and/or defensin peptide variants used in the OeDef1-type protein can comprise an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identical to SEQ ID NO: 1, 2, 8, 33, 35, 36, 38, 39, or 44, wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues of SEQ ID NO: 1, 2, 8, 33, 35, 36, 38, 39, or 44 are substituted with other hydrophobic, basic, and/or acidic amino acid residues, respectively. In any of the aforementioned embodiments, the variant OeDef1-type peptide(s) and/or defensin peptide(s) can also comprise an amino acid sequence that has at least one, two, three, four, five, six, or seven amino acid insertions, deletions, substitutions, or any combination thereof in a SEQ ID NO: 1, 2, 8, 33, 35, 36, 38, 39, or 44 peptide sequence. In certain aforementioned embodiments, the OeDef1-type peptides in the OeDef1-type protein can comprise: (i) the amino acid sequence of SEQ ID NO: 1, 2, 8, 33, 35, 36, 38, 39, or 44; or a (ii) a variant of the amino acid sequence of SEQ ID NO: 1, 2, 8, 33, 35, 36, 38, 39, or 44 wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively. In certain embodiments, the OeDef1-type, MtDef6-type, or OeDef7-type protein can comprise at least one of any of the aforementioned OeDef1-type, MtDef6-type, or OeDef7-type peptides and another peptide (including an OeDef1-type, MtDef6-type, or OeDef7-type peptide or defensin peptide), wherein the OeDef1-type, MtDef6-type, or OeDef7-type peptides and/or defensin peptides are heterologous to one another. In certain embodiments, the OeDef1-type proteins can comprise an OeDef1-type peptide and an OeDef7, MtDef4, MtDef4 H33R, MtDef6, MsDef1, NaD1, TPP3, MtDef5, RsAFP2, DmAMP1, Psd1, HXL005, HXL008, HXL035, HXL036 defensin peptides and/or any defensin, spacer peptide, or linker peptide disclosed in WO2017156457 or WO2017127558, which are each incorporated herein by reference in their entireties. In certain embodiments, the MtDef6-type proteins can comprise an MtDef6-type peptide and an OeDef1, OeDef7, MtDef4, MtDef4 H33R, MsDef1, NaD1, TPP3, MtDef5, RsAFP2, DmAMP1, Psd1, HXL005, HXL008, HXL035, HXL036 defensin peptides and/or any defensin, spacer peptide, or linker peptide disclosed in WO2017156457 or WO2017127558, which are each incorporated herein by reference in their entireties. In certain embodiments, the OeDef7-type proteins can comprise an OeDef7-type peptide and an OeDef1, MtDef4, MtDef4 H33R, MtDef6, MsDef1, NaD1, TPP3, MtDef5, RsAFP2, DmAMP1, Psd1, HXL005, HXL008, HXL035, HXL036 defensin peptides and/or any defensin, spacer peptide, or linker peptide disclosed in WO2017156457 or WO2017127558, which are each incorporated herein by reference in their entireties.

    [0110] In certain embodiments, one or more amino acids in any of the aforementioned or other variant OeDef1-, MtDef6-, or OeDef7-type peptide or protein sequences are substituted with another amino acid(s), the charge and polarity of which is similar to that of the original amino acid, i.e., a conservative amino acid substitution. Substitutes for an amino acid within the OeDef1-, MtDef6-, or OeDef7-type peptide or protein, or defensin peptide sequence can be selected from other members of the class to which the originally occurring amino acid belongs. Amino acids can be divided into the following four groups: (1) acidic amino acids; (2) basic amino acids; (3) neutral polar amino acids; and (4) neutral non-polar amino acids. Representative amino acids within these various groups include: (1) acidic (anionic, negatively charged) amino acids such as aspartic acid and glutamic acid; (2) basic (cationic, positively charged) amino acids such as arginine, histidine, and lysine; (3) neutral polar amino acids such as glycine, serine, threonine, cysteine, cystine, tyrosine, asparagine, and glutamine; (4) neutral nonpolar (hydrophobic) amino acids such as alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine. Conservative amino acid changes within defensin peptide sequences can be made by substituting one amino acid within one of these groups with another amino acid within the same group. Biologically functional equivalents of OeDef1-, MtDef6-, or OeDef7-type peptides can have 10 or fewer conservative amino acid changes, seven or fewer conservative amino acid changes, or five, four, three, two, or one conservative amino acid changes. The encoding nucleotide sequence (e.g., gene, plasmid DNA, cDNA, or synthetic DNA) will thus have corresponding base substitutions, permitting it to encode biologically functional equivalent forms of the OeDef1-, MtDef6-, or OeDef7-type peptides. Certain semi-conservative substitutions in OeDef1-, MtDef6-, or OeDef7-type peptides including: (i) the substitution of a neutral polar amino acid residue with a neutral nonpolar (hydrophobic) amino acid residue; or (ii) the substitution of a neutral nonpolar (hydrophobic) amino acid residue with a neutral polar amino acid residue are also provided. In particular, semi-conservative substitutions of a neutral polar tyrosine residue with a hydrophobic amino acid residue are provided. Biologically functional equivalents of OeDef1-, MtDef6-, or OeDef7-type peptides can have 10 or fewer semi-conservative amino acid changes, seven or fewer semi-conservative amino acid changes, or five, four, three, two, or one semi-conservative amino acid changes.

    [0111] Functional fragments of any of the aforementioned OeDef1-, MtDef6-, or OeDef7-type peptides or proteins can comprise OeDef1-, MtDef6-, or OeDef7-type peptides or proteins having amino terminal deletions, carboxy terminal deletions, internal deletions, or any combination thereof. In certain embodiments, the functional fragment can contain at least one, two, three, four, five, six, or seven or more amino acid residue deletions from the amino terminus, the carboxy terminus, an internal region, or any combination thereof. In certain embodiments, antimicrobial fragments of the OeDef1-, MtDef6-, or OeDef7-type peptide can comprise at least about 14, 16, 18, 20, 22, or 24 to about 26, 28, 30, 31, 32, 34, 35, 36, 37, or 40 amino acid residues of the C-terminus of the OeDef1-, MtDef6-, or OeDef7-type peptide. In any of the aforementioned embodiments, the functional peptide fragment can comprise: (i) a gamma core peptide as set forth in SEQ ID NO: 3, 4, 31, 32, 34, 37, 51, or 59; (ii) the amino acid sequence of SEQ ID NO: 1, 2, 5, 6, 7, 8, 33, 35, 36, 38, 39, or 44; or (iii) a variant of the amino acid sequence of SEQ ID NO: 1, 2, 5, 6, 7, 8, 35, 36, 38, 39, or 44 wherein: (a) one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; and/or (b) one or more neutral polar amino (e.g., tyrosine) acid residues is substituted with a hydrophobic amino acid residue. Such substitutions of hydrophobic, basic, and/or acidic amino acid residues of the amino acid sequence of SEQ ID NO: 1, 2, 5, 6, 7, 8, 35, 36, 38, 39, or 44 include those set forth in the corresponding sequences of SEQ ID NO: 33 or as indicated in FIG. 1A, 1B, and/or 1C. In certain embodiments, the peptide loop connecting the beta 2 and beta 3 strands of the gamma core peptide can be mutagenized to increase the content of positively charged amino acid residues in the loop and increase the antimicrobial activity of the variant defensin.

    [0112] OeDef1-, MtDef6-, or OeDef7-type peptide chimeras and defensin chimeras comprising portions of any of the aforementioned or other OeDef1-, MtDef6-, or OeDef7-type peptides or variants, defensins or variants, or fragments of any of these can also be used in the OeDef1-, MtDef6-, or OeDef7-type proteins provided herein. In one embodiment, the chimeric defensin can comprise an MtDef4 peptide loop connecting the beta 2 and beta 3 strands of the gamma core peptide that comprises the sequence RGFRRR (SEQ ID NO: 29) or conservative substitutions thereof. Such conservative substitutions would include substitution of one or more arginyl residues in SEQ ID NO: 29 with lysyl residues. In other embodiments, any OeDef1-, MtDef6-, or OeDef7-type peptide chimera or defensin chimera can comprise the substitution of a gamma core peptide sequence of one OeDef1-, MtDef6-, or OeDef7-type peptide or defensin into a gamma core peptide sequence of another OeDef1-, MtDef6-, or OeDef7-type peptide defensin. A non-limiting example of an OeDef1-type peptide chimera that could be used is an OeDef1/MtDef4 chimera wherein the OeDef1 the gamma core peptide sequence is replaced with the MtDef4 gamma core peptide to obtain a defensin peptide with anti-microbial activity (e.g., as exemplified in SEQ ID NO:2). Another non-limiting example of an OeDef1-type peptide chimera that could be used is an OeDef1/DmAMP1 chimera wherein the OeDef1 gamma core peptide sequence is replaced with the DmAMP1 gamma core peptide to obtain a defensin peptide with improved anti-microbial activity (e.g., as exemplified in SEQ ID NO: 39). Other non-limiting examples of an MtDef6-type chimera that could be used include MtDef6-type proteins wherein the MtDef6 gamma core sequence is replaced with a distinct gamma core sequence (e.g., an OeDef1 or OeDef7 gamma core sequence). Other non-limiting examples of an OeDef7-type chimera that could be used include OeDef7-type proteins wherein the OeDef7 gamma core sequence is replaced with a distinct gamma core sequence (e.g., an MtDef4, OeDef1, or MtDef6 gamma core sequence).

    [0113] In any of the aforementioned or other embodiments, the variant OeDef1-, MtDef6-, or OeDef7-type or defensin peptide can also comprise the cysteinyl residues that are involved in formation of disulfide bridges. In certain embodiments, cysteinyl residues involved in Cys1-Cys8, Cys2-Cys5, Cys3-Cys6, and Cys4-Cys7 disulfide bonding are retained in the variant OeDef1-, MtDef6-, or OeDef7-type or defensin peptide. In certain embodiments, cysteinyl residues involved in Cysl-Cys8, Cys2-Cys5, Cys3-Cys6, and Cys4-Cys7 disulfide bonding are retained in the variant OeDef1-, MtDef6-, or OeDef7-type or defensin peptide. In certain embodiments, one or more cysteinyl residues in the variant OeDef1-, MtDef6-, or OeDef7-type or defensin peptide can be substituted with a distinct amino acid residue. In certain embodiments, one or more of the conserved cysteine residues can be substituted with another amino acid residue including a glycine, serine, threonine, cysteine, cystine, tyrosine, asparagine, or glutamine residue. In certain embodiments, one or more of the conserved cysteine residues can be substituted with a serine or threonine residue. While not being limited by theory, it is believed that OeDef1-, MtDef6-, or OeDef7-type peptides with substitutions of cysteine residues and that lack one or more disulfide linkages may be desirable for use in transgenic or gene edited plants that are ultimately used as animal feed or as food for human consumption as such variants are predicted to be more readily digested by animals or humans that consume the plant products. Such OeDef1-, MtDef6-, or OeDef7-type peptides and proteins that have shorter half-lives in the digestive tracts of animals or humans are in theory anticipated to have less potential to become food allergens.

    [0114] In certain embodiments, the permeability of a microbial plasma membrane treated with the OeDef1-, MtDef6-, or OeDef7-type peptide or protein is increased in comparison to permeability of a microbial plasma membrane treated with a single OeDef1-, MtDef6-, or OeDef7-type and/or defensin peptide of the OeDef1-, MtDef6-, or OeDef7-type protein. Membrane permeability can be measured by a variety of techniques that include dye uptake. Convenient dye uptake assays that can be used to assess changes in in membrane permeability include assays for uptake of Hoechst 33342 (H0342), rhodamine 123, SYTOX™ Green, and the like. These dyes enter into microbial cells only if their plasma membrane has been permeabilized by an OeDef1-, MtDef6-, or OeDef7-type peptide or protein, defensin or other membrane-permeabilizing agent. Without seeking to be limited by theory, in certain embodiments it is believed that the OeDef1-, MtDef6-, or OeDef7-type peptide or protein can provide improved microbial inhibition by increasing the permeability of treated microbial membranes in comparison to microbial membranes treated with a single OeDef1-, MtDef6-, or OeDef7-type peptide or defensin, or a non-OeDef1-, MtDef6-, or OeDef7-type peptide or protein.

    [0115] In certain embodiments, the OeDef1-, MtDef6-, or OeDef7-type peptide and/or defensin peptide used in the OeDef1-, MtDef6-, or OeDef7-type proteins are OeDef1-, MtDef6-, or OeDef7-type peptide and/or defensin peptides that exhibit binding to a phospholipid and/or a sphingolipid. In certain embodiments, OeDef1-, MtDef6-, or OeDef7-type proteins provided herein comprised of an OeDef1-, MtDef6-, or OeDef7-type peptide and one or more of a OeDef1-, MtDef6-, OeDef7-type, MtDef4, MtDef4 H33R, MsDef1, NaD1, TPP3, MtDef5, RsAFP2, DmAMP1, Psd1, HXL005, HXL008, HXL035, HXL036 defensin peptides or variants thereof can exhibit lower IC50 values against one or more microbial pathogens, improved binding to phospholipids, improved binding to sphingolipids, or any combination thereof in comparison to a reference peptide containing just one of the OeDef1-, MtDef6-, or OeDef7-type peptides or defensin peptides that is contained in the OeDef1-, MtDef6-, or OeDef7-type protein. In certain embodiments, OeDef1-, MtDef6-, or OeDef7-type proteins comprised of any combination of an OeDef1-, MtDef6-, or OeDef7-type peptide and another peptides (including an OeDef1-, MtDef6-, or OeDef7-type peptide, an MtDef4, MtDef4 H33R, MsDef1, NaD1, TPP3, MtDef5, RsAFP2, DmAMP1, Psd1, HXL005, HXL008, HXL035, HXL036 defensin peptide or variant thereof and various spacer peptides can be optimized for lower IC50 values against one or more microbial pathogens by selecting for OeDef1-, MtDef6-, or OeDef7-type proteins having combinations of the OeDef1-, MtDef6-, or OeDef7-type peptides and another peptide (including an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide) and spacer peptides that provide for improved phospholipid and/or sphingolipid binding in comparison to a reference protein containing just one of the OeDef1-, MtDef6-, or OeDef7-type or defensin peptides that is contained in the OeDef1-, MtDef6-, or OeDef7-type protein. In certain embodiments, OeDef1-, MtDef6-, or OeDef7-type proteins wherein the OeDef1-, MtDef6-, or OeDef7-type peptides and/or defensin peptides are the same or different and each peptide comprises an amino acid sequence at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% identical to an amino acid sequence independently selected from the group consisting of SEQ ID NO: 1, 2, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 33, 35, 36, 38, 39, 44, 47, or 54, functional fragments thereof, and chimeras thereof can be optimized for lower IC50 values against one or more microbial pathogens by selecting for OeDef1-, MtDef6-, or OeDef7-type proteins having combinations of the OeDef1-, MtDef6-, or OeDef7-type peptides and/or defensin peptides and spacer peptides that provide for improved phospholipid binding in comparison to a reference protein containing just one of the OeDef1-, MtDef6-, or OeDef7-type peptides and/or defensin peptides. Suitable assays for determining improved phospholipid and/or sphingolipid binding include protein-lipid overlay assays (e.g., Dowler et al., 2002), surface plasmon resonance assays (e.g., Baron and Pauron, 2014), biotin capture lipid affinity assays (e.g., Davidson et al., 2006), titration calorimetry assays (e.g., Miller and Cistola, 1993), and the like.

    [0116] Expression cassettes that provide for expression of the OeDef1-, MtDef6-, or OeDef7-type peptide or protein in monocotyledonous plants, dicotyledonous plants, or both can be constructed. Such OeDef1-, MtDef6-, or OeDef7-type peptide or protein expression cassette construction can be effected either in a plant expression vector or in the genome of a plant. Expression cassettes are DNA constructs wherein various promoter, coding, and polyadenylation sequences are operably linked. In general, expression cassettes typically comprise a promoter that is operably linked to a sequence of interest, which is operably linked to a polyadenylation or terminator region. In certain instances including the expression of recombinant or edited polynucleotides in monocot plants, it can also be useful to include an intron sequence. When an intron sequence is included it is typically placed in the 5′ untranslated leader region of the recombinant or edited polynucleotide. In certain instances, it can also be useful to incorporate specific 5′ untranslated sequences in a recombinant or edited polynucleotide to enhance transcript stability or to promote efficient translation of the transcript. Aforementioned expression cassettes can comprise: (i) a synthetic DNA of SEQ ID NO: 40, 41, 42, and variants thereof having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 40, 41, or 42 that encodes an OeDef1-type peptide; (ii) a synthetic DNA of SEQ ID NO: 52 and variants thereof having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 52 that encodes a MtDef6-type peptide; and (iii) a synthetic DNA of SEQ ID NO: 60 and variants thereof having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 60 that encodes an OeDef7-type peptide.

    [0117] A variety of promoters can be used to express the OeDef1-, MtDef6-, or OeDef7-type peptides or proteins. One broad class of useful promoters are referred to as “constitutive” promoters in that they are active in most plant organs throughout plant development. For example, the promoter can be a viral promoter such as a CaMV35S or FMV35S promoter. The CaMV35S and FMV35S promoters are active in a variety of transformed plant tissues and most plant organs (e.g., callus, leaf, seed and root). Enhanced or duplicate versions of the CaMV35S and FMV35S promoters are particularly useful (U.S. Pat. No. 5,378,619, incorporated herein by reference in its entirety). Other useful promoters include the nopaline synthase (NOS) and octopine synthase (OCS) promoters (which are carried on tumor-inducing plasmids of A. tumefaciens), the cauliflower mosaic virus (CaMV) 19S promoters, a maize ubiquitin promoter, the rice Act1 promoter, and the Figwort Mosaic Virus (FMV) 35S promoter (see, e.g., U.S. Pat. No. 5,463,175, incorporated herein by reference in its entirety). It is understood that this group of exemplary promoters is non-limiting and that one skilled in the art could employ other promoters that are not explicitly cited here to express OeDef1-, MtDef6-, or OeDef7-type peptides or proteins.

    [0118] Promoters that are active in certain plant tissues (i.e., tissue specific promoters) can also be used to drive expression of OeDef1-, MtDef6-, or OeDef7-type peptides or proteins. Expression of OeDef1-, MtDef6-, or OeDef7-type peptides and proteins in the tissue that is typically infected by a microbial pathogen is anticipated to be particularly useful. Thus, expression in reproductive tissues, seeds, roots, stems, or leaves can be particularly useful in combating infection of those tissues by certain microbial pathogens in certain crops. Examples of useful tissue-specific, developmentally regulated promoters include the β-conglycinin 7S promoter (Doyle et al., 1986), seed-specific promoters (Lam and Chua, 1991), and promoters associated with napin, phaseolin, zein, soybean trypsin inhibitor, ACP, stearoyl-ACP desaturase, or oleosin genes. Examples of root specific promoters include the RB7 and RD2 promoters described in U.S. Pat. Nos. 5,459,252 and 5,837,876, respectively.

    [0119] Another class of useful promoters are promoters that are induced by various environmental stimuli. Promoters that are induced by environmental stimuli include promoters induced by heat (e.g., heat shock promoters such as Hsp70), promoters induced by light (e.g., the light-inducible promoter from the small subunit of ribulose 1,5-bisphosphate carboxylase, ssRUBISCO, a very abundant plant protein), promoters induced by cold (e.g., COR promoters), promoters induced by oxidative stress (e.g., catalase promoters), promoters induced by drought (e.g., the wheat Em and rice rabl6A promoters), and promoters induced by multiple environmental signals (e.g., rd29A promoters, Glutathione-S-transferase (GST) promoters).

    [0120] Promoters that are induced by microbial infections in plants can also be used to drive expression of OeDef1-, MtDef6-, or OeDef7-type peptides and proteins. Useful promoters induced by microbial infections include those promoters associated with genes involved in phenylpropanoid metabolism (e.g., phenylalanine ammonia lyase, chalcone synthase promoters), genes that modify plant cell walls (e.g., hydroxyproline-rich glycoprotein, glycine-rich protein, and peroxidase promoters), genes encoding enzymes that degrade microbial cell walls (e.g., chitinase or glucanase promoters), genes encoding thaumatin-like protein promoters, or genes encoding proteins of unknown function that display significant induction upon microbial infection. Maize and flax promoters, designated as Misl and Fisl, respectively, are also induced by microbial infections in plants and can be used (U.S. Patent Appl. Pub. No. 20020115849).

    [0121] Depending on the microbe to which protection is sought, the present OeDef1-, MtDef6-, or OeDef7-type peptides and proteins can be expressed in any tissue or organ in the plant where the microbe attacks. In the case of Fusarium for example, a useful site for expression is in the roots. In the case of those microbes that infect by entering external plant surfaces, accumulation of the OeDef1-, MtDef6-, or OeDef7-type peptides and proteins in the apoplast can be used. In certain embodiments, the apoplast-localized OeDef1-, MtDef6-, or OeDef7-type peptide or protein can be expressed in roots, stems, leaves, etc., by the use of tissue-specific promoters.

    [0122] Promoters active at particular developmental stages in the plant life cycle can also be used to optimize resistance to microbial infection and/or damage when it is most needed.

    [0123] An intron can also be included in the DNA expression construct, especially in instances when the sequence of interest is to be expressed in monocot plants. For monocot plant use, introns such as the maize hsp70 intron (U.S. Pat. No. 5,424,412; incorporated by reference herein in its entirety), the maize ubiquitin intron, the Adh intron 1 (Callis et al., 1987), the sucrose synthase intron (Vasil et al., 1989) or the rice Act1 intron (McElroy et al., 1990) can be used. Dicot plant introns that are useful include introns such as the CAT-1 intron (Cazzonnelli and Velten, 2003), the pKANNIBAL intron (Wesley et al., 2001; Collier et al., 2005), the PIV2 intron (Mankin et al., 1997) and the “Super Ubiquitin” intron (U.S. Pat. No. 6,596,925, incorporated herein by reference in its entirety; Collier et al., 2005) that have been operably integrated into recombinant or edited polynucleotides. It is understood that this group of exemplary introns is non-limiting and that one skilled in the art could employ other introns that are not explicitly cited here to express OeDef1-, MtDef6-, or OeDef7-type peptides and proteins.

    [0124] Certain embodiments comprise a sequence encoding an apoplast localization peptide that facilitates secretion of the mature OeDef1-, MtDef6-, or OeDef7-type peptides or proteins from plant cells. Apoplast localization peptides include peptides referred to as signal peptides. In certain embodiments, apoplast localization peptides can be operably linked to the n-termini of OeDef1-, MtDef6-, or OeDef7-type peptides or proteins to provide for apoplast localization. Portions of the OeDef1-, MtDef6-, or OeDef7-type or defensin proproteins that encode apoplast localization peptides (e.g., signal peptides) can be used for secreting OeDef1-, MtDef6-, or OeDef7-type peptides or proteins from plant or other cells. Examples of defensin proproteins that contain apoplast localization peptides that can be used in OeDef1-, MtDef6-, or OeDef7-type peptides or proteins include the defensin proproteins of disclosed in U.S. Pat. No. 7,825,297 and U.S. Patent Appl. Pub. No. 20160208278 (each incorporated herein by reference in their entireties), proteins that have at least about 70%, 80%, 90%, 95%, or 99% sequence identity to these sequences, and the biological functional equivalents of these sequences. Alternatively, signal peptide sequences derived from other Medicago defensin proteins (Hanks et al., 2005) can be used. Examples of such other Medicago defensin protein signal peptides include signal peptides of MtDef1.1 and MtDef2.1. Another example of a useful signal peptide encoding sequence that can be used in monocot plants is the signal peptide derived from a barley cysteine endoproteinase gene (Koehler and Ho, 1990) or an alpha-amylase gene. Another example of a useful signal peptide encoding sequence that can be used in dicot plants is the tobacco PR1b signal peptide. In other embodiments, wholly synthetic signal peptides can be used. This group of signal peptides is meant to be exemplary and non-limiting, and one skilled in the art could employ other signal peptides that are not explicitly cited here.

    [0125] In other embodiments, sequences encoding peptides that provide for the localization of an OeDef1-, MtDef6-, or OeDef7-type peptides or proteins in subcellular organelles can be operably linked to the sequences that encode the OeDef1-, MtDef6-, or OeDef7-type peptides or proteins. OeDef1-, MtDef6-, or OeDef7-type peptides or proteins that are operably linked to a signal peptide are expected to enter the secretion pathway and can be retained by organelles such as the endoplasmic reticulum (ER) or targeted to the vacuole by operably linking the appropriate retention or targeting peptides to the C-terminus of the OeDef1-, MtDef6-, or OeDef7-type peptide or protein. Examples of vacuolar targeting peptides include a CTPP vacuolar targeting signal from the barley lectin gene. Examples of ER targeting peptides include a peptide comprising a KDEL amino acid sequence.

    [0126] In certain embodiments, a plastid localization peptide can be operably linked to the OeDef1-, MtDef6-, or OeDef7-type peptides or proteins to provide for localization of the OeDef1-, MtDef6-, or OeDef7-type peptides or proteins in a plant plastid. Plastid transit peptides can be obtained from nuclear-encoded and plastid localized proteins that include Rubisco small subunit (RbcS), chlorophyll a/b-binding protein, ADP-glucose pyrophosphorylase (ADPGPP), and the like. Plastid targeting peptides that been disclosed in non-patent (Li and Teng, 2013) and patent literature (U.S. Patent Appl. Pub. No. 20160017351 and U.S. Pat. No. 5,510,471, each incorporated herein by reference in their entireties). Chimeric plastid targeting peptides have also been disclosed (Lee et al., Plant Physiol., 2015). Any of the aforementioned plastic targeting peptides can be adapted for use in localizing OeDef1-, MtDef6-, or OeDef7-type peptides or proteins in plastids. In certain embodiments, the plastid localization peptide can be operably linked to the N-terminus of the OeDef1-, MtDef6-, or OeDef7-type peptides or proteins.

    [0127] In certain embodiments, a mitochondrial localization peptide can be operably linked to the OeDef1-, MtDef6-, or OeDef7-type peptides or proteins to provide for localization of the OeDef1-, MtDef6-, or OeDef7-type peptides or proteins in the mitochondria. Mitochondrial localization peptides can be obtained from nuclear-encoded and mitochondrial localized proteins that include beta-subunit of the F(1)-ATP synthase, alternative oxidases, and the gamma-subunit of the F(1)-ATP synthase. Mitochondrial targeting peptides have been disclosed (Sjoling and Glaser; 1998; Huang et al., Plant Physiology, 2009). In certain embodiments, the mitochondrial localization peptide will be operably linked to the N-terminus of the OeDef1-, MtDef6-, or OeDef7-type peptides or proteins. Any of the aforementioned mitochondrial targeting peptides can be adapted for use in localizing OeDef1-, MtDef6-, or OeDef7-type peptides or proteins in mitochondria. In certain embodiments, the mitochondrial localization peptide can be operably linked to the N-terminus of the OeDef1-, MtDef6-, or OeDef7-type peptides or proteins.

    [0128] In still other embodiments, dual localization peptide(s) can be used to provide for localization of the OeDef1-, MtDef6-, or OeDef7-type peptides or proteins in both plastids and mitochondria (Carrie and Small, 2013).

    [0129] Localization of OeDef1-, MtDef6-, or OeDef7-type peptides or proteins in the apoplast, endoplasmic reticulum, the vacuole, plastids, or mitochondria can provide for useful properties such as increased expression in transgenic or edited plants and/or increased efficacy in inhibiting microbial growth in transgenic or edited plants. In certain embodiments, the localization peptide is a heterologous localization peptide that can direct an operably associated protein or peptide to an extracellular or sub-cellular location that is different than the extracellular or sub-cellular location of a naturally occurring protein or antimicrobial peptides. In certain embodiments, the localization peptide can target an OeDef1-, MtDef6-, or OeDef7-type protein that comprises a spacer peptide, linker peptide, or junction sequence that is susceptible to cleavage by a plant endoproteinase to an extracellular or sub-cellular compartment where activity of that plant endoproteinase is reduced or absent and thus provide for accumulation of the OeDef1-, MtDef6-, or OeDef7-type protein in the transgenic or edited plant.

    [0130] In other embodiments, the OeDef1-, MtDef6-, or OeDef7-type-, defensin-, localization-, spacer-, or other peptide or protein encoding nucleotide sequence can be synthesized de novo from an OeDef1-, MtDef6-, or OeDef7-type peptide or protein sequence disclosed herein. The sequence of the peptide or protein-encoding nucleotide sequence can be deduced from the OeDef1-, MtDef6-, or OeDef7-type-, defensin-, localization-, spacer-, or other peptide or protein sequence through use of the genetic code. Computer programs such as “BackTranslate” (GCG™ Package, Acclerys, Inc. San Diego, Calif.) can be used to convert a peptide or protein sequence to the corresponding nucleotide sequence that encodes the peptide or protein.

    [0131] Furthermore, the synthetic OeDef1-, MtDef6-, or OeDef7-type-, defensin-, localization-, spacer-, or other peptide or protein nucleotide sequence can be designed so that it will be optimally expressed in plants. U.S. Pat. No. 5,500,365 describes a method for synthesizing plant genes to optimize the expression level of the protein encoded by the synthesized gene. This method relates to the modification of the structural gene sequences of the exogenous recombinant or edited polynucleotide, to make them more “plant-like” and therefore more efficiently transcribed, processed, translated, and expressed by the plant. Features of genes that are expressed well in plants include use of codons that are commonly used by the plant host and elimination of sequences that can cause undesired intron splicing or polyadenylation in the coding region of a gene transcript. A similar method for obtaining enhanced expression of transgenes in monocotyledonous plants is disclosed in U.S. Pat. No. 5,689,052.

    [0132] In certain embodiments, an OeDef1-, MtDef6-, or OeDef7-type peptide or protein encoding sequence can also be operably linked to a 3′ non-translated region containing a polyadenylation signal. This polyadenylation signal provides for the addition of a polyadenylate sequence to the 3′ end of the RNA. The Agrobacterium tumor-inducing (Ti) plasmid nopaline synthase (NOS) gene 3′ and the pea ssRUBISCO E9 gene 3′ un-translated regions contain polyadenylate signals and represent non-limiting examples of such 3′ untranslated regions that can be used. It is understood that this group of polyadenylation regions is non-limiting and that one skilled in the art could employ other polyadenylation regions that are not explicitly cited here.

    [0133] The DNA constructs that comprise the plant expression cassettes described above can either be constructed in the plant genome by using site specific insertion of heterologous DNA into the plant genome, by mutagenizing the plant genome, and/or by introducing the expression cassette into the plant genome with a vector or other DNA transfer method. Vectors contain sequences that provide for the replication of the vector and covalently linked sequences in a host cell. For example, bacterial vectors will contain origins of replication that permit replication of the vector in one or more bacterial hosts. Agrobacterium-mediated plant transformation vectors typically comprise sequences that permit replication in both E. coli and Agrobacterium as well as one or more “border” sequences positioned so as to permit integration of the expression cassette into the plant chromosome. Such Agrobacterium vectors can be adapted for use in either Agrobacterium tumefaciens or Agrobacterium rhizogenes. Selectable markers encoding genes that confer resistance to antibiotics are also typically included in the vectors to provide for their maintenance in bacterial hosts.

    [0134] Methods of obtaining a transgenic or edited plant capable of inhibiting growth of a plant pathogenic microbe are also provided. In one embodiment, expression vectors suitable for expression of the OeDef1-, MtDef6-, or OeDef7-type peptide or protein in various dicot and monocot plants are introduced into a plant, a plant cell, a protoplast, or a plant tissue using transformation techniques as described herein. In another embodiment, the OeDef1-, MtDef6-, or OeDef7-type peptide or protein expression cassette is constructed in the plant nuclear or plastid genome by editing. Next, a transgenic or edited plant containing or comprising the OeDef1-, MtDef6-, or OeDef7-type peptide or protein expression vector is obtained by regenerating that transgenic or edited plant from the plant, plant cell, protoplast, or plant tissue that received the expression vector or genome edits. The final step is to obtain a transgenic or edited plant that expresses a plant pathogenic microbe inhibitory amount of the mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein, where a “plant pathogenic microbe inhibitory amount” is a level of OeDef1-, MtDef6-, or OeDef7-type peptide or protein sufficient to provide any measurable decrease in microbial growth in the transgenic or edited plant and/or any measurable decrease in the adverse effects caused by microbial growth in the transgenic plant or edited.

    [0135] Any of the OeDef1-, MtDef6-, or OeDef7-type peptide or protein expression vectors can be introduced into the chromosomes of a host plant via methods such as Agrobacterium-mediated transformation, Rhizobium-mediated transformation, Sinorhizobium-mediated transformation, particle-mediated transformation, DNA transfection, DNA electroporation, or “whiskers”-mediated transformation. The aforementioned methods of introducing transgenes are described in U.S. Patent Appl. Pub. No. 20050289673 (Agrobacterium-mediated transformation of corn), U.S. Pat. No. 7,002,058 (Agrobacterium-mediated transformation of soybean), U.S. Pat. No. 6,365,807 (particle mediated transformation of rice), and U.S. Pat. No. 5,004,863 (Agrobacterium-mediated transformation of cotton), each of which are incorporated herein by reference in their entirety. Methods of using bacteria such as Rhizobium or Sinorhizobium to transform plants are described in Broothaerts, et al., 2005. It is further understood that the OeDef1-, MtDef6-, or OeDef7-type peptide or protein expression vector can comprise cis-acting site-specific recombination sites recognized by site-specific recombinases, including Cre, Flp, Gin, Pin, Sre, pinD, Int-B13, and R. Methods of integrating DNA molecules at specific locations in the genomes of transgenic plants through use of site-specific recombinases can then be used (U.S. Pat. No. 7,102,055). Those skilled in the art will further appreciate that any of these gene transfer techniques can be used to introduce the expression vector into the chromosome of a plant cell, a protoplast, a plant tissue, or a plant.

    [0136] Methods of introducing plant mini-chromosomes comprising plant centromeres that provide for the maintenance of the recombinant mini-chromosome in a transgenic plant (U.S. Pat. Nos. 6,972,197 and 8,435,783) can also be used to introduce and maintain OeDef1-, MtDef6-, or OeDef7-type peptide or protein in such plants. In these embodiments, the transgenic plants harbor the mini-chromosomes as extrachromosomal elements that are not integrated into the chromosomes of the host plant.

    [0137] In certain embodiments, transgenic plants can be obtained by linking the gene of interest (in this case an OeDef1-, MtDef6-, or OeDef7-type peptide- or protein-encoding polynucleotide sequence) to a selectable marker gene, introducing the linked polynucleotides into a plant cell, a protoplast, a plant tissue, or a plant by any one of the methods described above, and regenerating or otherwise recovering the transgenic plant under conditions requiring expression of the selectable marker gene for plant growth. The selectable marker gene can be a gene encoding a neomycin phosphotransferase protein, a phosphinothricin acetyltransferase protein, a glyphosate resistant 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) protein, a hygromycin phosphotransferase protein, a dihydropteroate synthase protein, a sulfonylurea insensitive acetolactate synthase protein, an atrazine insensitive Q protein, a nitrilase protein capable of degrading bromoxynil, a dehalogenase protein capable of degrading dalapon, a 2,4-dichlorophenoxyacetate monoxygenase protein, a methotrexate insensitive dihydrofolate reductase protein, or an aminoethylcysteine insensitive octopine synthase protein. The corresponding selective agents used in conjunction with each gene can be: neomycin (for neomycin phosphotransferase protein selection), phosphinotricin (for phosphinothricin acetyltransferase protein selection), glyphosate (for glyphosate resistant 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) protein selection), hygromycin (for hygromycin phosphotransferase protein selection), sulfadiazine (for a dihydropteroate synthase protein selection), chlorsulfuron (for a sulfonylurea insensitive acetolactate synthase protein selection), atrazine (for an atrazine insensitive Q protein selection), bromoxinyl (for a nitrilase protein selection), dalapon (for a dehalogenase protein selection), 2,4-dichlorophenoxyacetic acid (for a 2,4-dichlorophenoxyacetate monoxygenase protein selection), methotrexate (for a methotrexate insensitive dihydrofolate reductase protein selection), or aminoethylcysteine (for an aminoethylcysteine insensitive octopine synthase protein selection).

    [0138] In certain embodiments, a plant comprising a recombinant or edited polynucleotide encoding a OeDef1-, MtDef6-, or OeDef7-type peptide or protein can be obtained by using techniques that provide for site specific insertion of heterologous DNA into the genome of a plant (e.g., by editing). In certain embodiments, a DNA fragment encoding at least one of a OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide, a spacer peptide that is resistant to cleavage by a plant endoproteinase, a heterologous promoter, or a heterologous localization peptide, is site specifically integrated into the genome to a plant cell, tissue, part, or whole plant to create a sequence within that genome that encodes a OeDef1-, MtDef6-, or OeDef7-type peptide or protein. In one embodiment of the method, the heterologous DNA encodes a spacer peptide sequence that is used to replace the endogenous DNA sequence encoding a linker peptide that joins two encoded OeDef1-, MtDef6-, or OeDef7-type peptide or defensin to provide a transgenic or edited plant comprising genomic DNA encoding endogenous OeDef1-, MtDef6-, or OeDef7-type peptides or defensin peptides that are operably linked to a heterologous spacer peptide encoding DNA sequence. In one embodiment of the method, the heterologous DNA encodes a spacer peptide sequence and an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide that is inserted in-frame at either the N-terminus of the endogenous OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide coding region or at the C-terminus of the OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide coding region to provide a transgenic or edited plant comprising genomic DNA encoding an endogenous OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide that is operably linked to a heterologous spacer peptide encoding DNA sequence and a OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide encoding DNA sequence. In certain embodiments where heterologous DNA that encodes a spacer peptide sequence and a OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide is inserted in frame with an endogenous OeDef1-, MtDef6-, or OeDef7-type peptide or defensin encoding sequence, the inserted OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide can identical to the endogenous OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide or a variant of the endogenous OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide. In one embodiment of the method, the heterologous DNA encodes a heterologous localization peptide and is inserted in frame with a genomic coding region that comprises endogenous OeDef1-, MtDef6-, or OeDef7-type peptides or defensin peptides that are joined by an endogenous linker peptide to provide a transgenic or edited plant comprising genomic DNA encoding the endogenous OeDef1-, MtDef6-, or OeDef7-type peptides or defensin peptides and the endogenous linker peptide with the localization peptide operably linked to the encoded peptide. In certain embodiments, the localization peptide will provide for localization of the protein encoding the two endogenous OeDef1-, MtDef6-, or OeDef7-type peptides or defensin peptides and the linker peptide in an extracellular or sub-cellular location where activity of a plant endoproteinase that can cleave the peptide linker is reduced or absent. In certain embodiments, a heterologous promoter or promoter element can be inserted at or near the 5′ end of a genomic region that comprises a sequence encoding an endogenous OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide, an endogenous OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide that is joined to another endogenous OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide with a linker peptide, an endogenous OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide that is joined to another OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide with a heterologous spacer peptide, an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide that is operably linked to a heterologous localization peptide, or any combination thereof to obtain a transgenic or edited plant where the genomic region is under the transcriptional control of the inserted or composite promoter. In practicing any of the aforementioned methods, such heterologous DNA can either be inserted in a parallel (e.g., at the same time) or sequentially (e.g., at the distinct times). In one non-limiting example, heterologous DNA encoding a spacer peptide and an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide can be inserted into an endogenous genomic region encoding an endogenous OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide at the same time that a heterologous promoter, promoter element, and/or localization peptide is inserted into the genomic region. In another non-limiting example, heterologous DNA encoding a spacer peptide and an OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide can be inserted into an endogenous genomic region encoding an endogenous OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide to obtain a first transgenic or edited plant comprising genomic DNA encoding an endogenous OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide that is operably linked to the heterologous spacer peptide encoding DNA sequence and the OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide. A heterologous promoter, promoter element, and/or localization peptide can then be inserted into the genomic DNA of the first genomic plant to a first transgenic or edited plant comprising genomic DNA encoding an endogenous OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide that is operably linked to the heterologous spacer peptide encoding DNA sequence and the OeDef1-, MtDef6-, or OeDef7-type peptide or defensin peptide as well as to the heterologous promoter, promoter element, and/or localization peptide. Examples of methods for inserting foreign DNA at specific sites in the plant genome with site-specific nucleases such as meganucleases or zinc-finger nucleases are at least disclosed in Voytas, 2013. Examples of methods for inserting foreign DNA into the plant genome with clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas)-guide RNA technology and a Cas endonuclease are at least disclosed by Svitashev et al., 2015; Murovec et al., 2017; Kumar and Jain, 2015; and in U.S. Patent Appl. Pub. No. 20150082478, which is specifically incorporated herein by reference in its entirety.

    [0139] In certain embodiments, a genetically edited plant comprising a recombinant or edited polynucleotide encoding a OeDef1-, MtDef6-, or OeDef7-type peptide or protein can be obtained by using techniques that provide for genome editing in the plant. In one embodiment, the genome of a plant comprising an endogenous gene encoding an OeDef1-, MtDef6-, or OeDef7-type peptide, defensin or other peptide can be edited to provide a genome, a polynucleotide, or a recombinant polynucleotide comprising an OeDef1-, MtDef6-, or OeDef7-type peptide or protein. Examples of methods for plant genome editing with clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas)-polynucleotide modification template technology and a Cas endonuclease are at least disclosed by Svitashev et al., 2015; Murovec et al., 2017; Kumar and Jain, 2015; and in U.S. Patent Appl. Pub. No. 20150082478, which is specifically incorporated herein by reference in its entirety. Examples of additional methods for editing plant genomes through use of Cpf1 or Csm1 nucleases are disclosed in U.S. Patent Application Publication 20180148735, which is incorporated herein by reference in its entirety,

    [0140] Transgenic plants can also be obtained by linking a gene of interest (in this case an OeDef1-, MtDef6-, or OeDef7-type peptide or protein-encoding polynucleotide sequence) to a scoreable marker gene, introducing the linked polynucleotides into a plant cell by any of the methods described above, and regenerating the transgenic plants from transformed plant cells that test positive for expression of the scoreable marker gene. The scoreable marker gene can be a gene encoding a beta-glucuronidase protein, a green fluorescent protein, a yellow fluorescent protein, a beta-galactosidase protein, a luciferase protein derived from a luc gene, a luciferase protein derived from a lux gene, a sialidase protein, streptomycin phosphotransferase protein, a nopaline synthase protein, an octopine synthase protein, or a chloramphenicol acetyl transferase protein.

    [0141] When an expression vector encoding an OeDef1-, MtDef6-, or OeDef7-type peptide or protein is introduced into a plant cell or plant tissue or when an OeDef1-, MtDef6-, or OeDef7-type peptide or protein is introduced in the genome of a plant cell or tissue by site specific insertion of heterologous DNA into the plant genome, the transformed cells or tissues can be regenerated into whole plants by culturing these cells or tissues under conditions that promote the formation of a whole plant (i.e., the process of regenerating leaves, stems, roots, and, in certain plants, reproductive tissues). The development or regeneration of transgenic plants from either single plant protoplasts or various explants has been described (Horsch, R. B. et al., 1985). This regeneration and growth process typically includes the steps of selection of transformed cells and culturing selected cells under conditions that will yield rooted plantlets. The resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil. Alternatively, transgenes can also be introduced into isolated plant shoot meristems and plants regenerated without going through callus stage tissue culture (U.S. Pat. No. 7,002,058). When the transgene is introduced directly into a plant, or more specifically into the meristematic tissue of a plant, seed can be harvested from the plant and selected or scored for presence of the transgene. In the case of transgenic plant species that reproduce sexually, seeds can be collected from plants that have been “selfed” (self-pollinated) or out-crossed (i.e., used as a pollen donor or recipient) to establish and maintain the transgenic plant line. Transgenic plants that do not sexually reproduce can be vegetatively propagated to establish and maintain the transgenic plant line. In certain embodiments, transgenic plants are derived from a transformation event where the transgene has inserted into one or more locations in the plant genome. In certain embodiments, a seed produced by the transgenic plant, a progeny from such seed, and a seed produced by the progeny of the original transgenic plant are provided. Such progeny and seeds will have an OeDef1-, MtDef6-, or OeDef7-type peptide or protein-encoding recombinant or edited polynucleotide stably incorporated into their genome, and such progeny plants will inherit the traits afforded by the introduction of a stable recombinant or edited polynucleotide in Mendelian fashion. It is further recognized that transgenic plants containing the OeDef1-, MtDef6-, or OeDef7-type peptide or protein encoding DNA constructs described herein, and materials derived therefrom, can be identified through use of PCR or other methods that can specifically detect the sequences in the DNA constructs. Methods developed for regeneration and propagation of transgenic plants can be adapted for regeneration and propagation of edited plants.

    [0142] Once a transgenic or edited plant is regenerated or recovered, a variety of methods can be used to identify or obtain a transgenic or edited plant that expresses a plant pathogenic microbe inhibitory amount of OeDef1-, MtDef6-, or OeDef7-type peptide or protein. One general set of methods is to perform assays that measure the amount of OeDef1-, MtDef6-, or OeDef7-type peptide or protein that is produced. For example, various antibody-based detection methods employing antibodies that recognize OeDef1-, MtDef6-, or OeDef7-type peptide or protein can be used to quantitate the amount of OeDef1-, MtDef6-, or OeDef7-type peptide or protein produced. Examples of such antibody-based assays include ELISAs, RIAs, or other methods wherein an OeDef1-, MtDef6-, or OeDef7-type peptide or protein -recognizing antibody is detectably labelled with an enzyme, an isotope, a fluorophore, a lanthanide, and the like. By using purified or isolated OeDef1-, MtDef6-, or OeDef7-type peptide or protein as a reference standard in such assays (i.e., providing known amounts of OeDef1-, MtDef6-, or OeDef7-type peptide or protein), the amount of OeDef1-, MtDef6-, or OeDef7-type peptide or protein present in the plant tissue in a mole per gram of plant material or mass per gram of plant material can be determined. The OeDef1-, MtDef6-, or OeDef7-type peptide or protein will typically be expressed in the transgenic or edited plant at the level of “parts per million” or “PPM”, where microgram levels of OeDef1-, MtDef6-, or OeDef7-type peptide or protein are present in gram amounts of fresh weight plant tissue. In this case, 1 microgram of OeDef1-, MtDef6-, or OeDef7-type peptide or protein per 1 gram of fresh weight plant tissue would represent a OeDef1-, MtDef6-, or OeDef7-type peptide or protein concentration of 1 PPM. A plant pathogenic microbe inhibitory amount of OeDef1-, MtDef6-, or OeDef7-type peptide or protein is at least about 0.05 PPM (i.e., 0.05 μg OeDef1-, MtDef6-, or OeDef7-type peptide per gram fresh weight plant tissue) or at least about 0.1PPM. In certain embodiments, a plant pathogenic microbe inhibitory amount of OeDef1-, MtDef6-, or OeDef7-type peptide or protein is at least about 0.5 PPM. In certain embodiments, the amount of OeDef1-, MtDef6-, or OeDef7-type peptide or protein is at least about 1.0 PPM. In certain embodiments, the amount of OeDef1-, MtDef6-, or OeDef7-type peptide or protein is at least about 2.0 PPM. In certain embodiments, the amount of the OeDef1-, MtDef6-, or OeDef7-type peptide or protein is at least about 0.05 PPM, 0.1 PPM, 0.5 PPM, or 1.0 PPM to about 5, 10, 20, 50, 100, 200, 500, or 1000 PPM. In certain embodiments, including those where a plastid genome is transformed or edited to express an OeDef1-, MtDef6-, or OeDef7-type peptide or protein, about 0.1%, 0.2% or 0.5% to about 1%, 3%, 5%, or more of the soluble peptide or protein in a plant part, including a leaf, can be the OeDef1-, MtDef6-, or OeDef7-type peptide or protein.

    [0143] Alternatively, the amount of OeDef1-, MtDef6-, or OeDef7-type peptide or protein—encoding mRNA produced by the transgenic or edited plant can be determined to identify plants that express plant pathogenic microbe inhibitory amounts of OeDef1-, MtDef6-, or OeDef7-type peptide or protein. Techniques for relating the amount of peptide or protein produced to the amount of RNA produced include methods such as constructing a standard curve that relates specific RNA levels (i.e., OeDef1-, MtDef6-, or OeDef7-type peptide or protein mRNA) to levels of the OeDef1-, MtDef6-, or OeDef7-type peptide or protein (determined by immunologic or other methods). Methods of quantitating OeDef1-, MtDef6-, or OeDef7-type peptide or protein mRNA typically involve specific hybridization of a polynucleotide to either the OeDef1-, MtDef6-, or OeDef7-type peptide or protein mRNA or to a cDNA (complementary DNA) or PCR product derived from the OeDef1-, MtDef6-, or OeDef7-type peptide or protein RNA. Such polynucleotide probes can be derived from either the sense and/or antisense strand nucleotide sequences of the OeDef1-, MtDef6-, or OeDef7-type peptide or protein -encoding recombinant or edited polynucleotide. Hybridization of a polynucleotide probe to the OeDef1-, MtDef6-, or OeDef7-type peptide or protein mRNA or cDNA can be detected by methods including use of probes labelled with an isotope, a fluorophore, a lanthanide, or a hapten such as biotin or digoxigenin. Hybridization of the labelled probe can be detected when the OeDef1-, MtDef6-, or OeDef7-type peptide or protein RNA is in solution or immobilized on a solid support such as a membrane. When quantitating OeDef1-, MtDef6-, or OeDef7-type peptide or protein RNA by use of a quantitative reverse-transcriptase Polymerase Chain Reaction (qRT-PCR), the PCR product can be detected by use of any of the aforementioned labelled polynucleotide probes, by use of an intercalating dye such as ethidium bromide or SYBR green, or use of a hybridization probe containing a fluorophore and a quencher such that emission from the fluorophore is only detected when the fluorophore is released by the 5′nuclease activity of the polymerase used in the PCR reaction (i.e., a TaqMan™ reaction; Applied Biosystems, Foster City, Calif.) or when the fluorophore and quencher are displaced by polymerase mediated synthesis of the complementary strand (i.e., Scorpion™ or Molecular Beacon™ probes). Various methods for conducting qRT-PCR analysis to quantitate mRNA levels are well characterized (Bustin, S.A.; 2002). Fluorescent probes that are activated by the action of enzymes that recognize mismatched nucleic acid complexes (i.e., Invader™, Third Wave Technologies, Madison, WI) can also be used to quantitate RNA. Those skilled in the art will also understand that RNA quantitation techniques such as Quantitative Nucleic Acid Sequence Based Amplification (Q-NASBA™) can be used to quantitate OeDef1-, MtDef6-, or OeDef7-type peptide or protein -encoding mRNA and identify expressing plants.

    [0144] Transgenic or edited plants that express plant pathogenic microbe inhibitory amounts of OeDef1-, MtDef6-, or OeDef7-type peptides or proteins can also be identified by directly assaying such plants for inhibition of the growth of a plant pathogenic microbe. Such assays can be used either independently or in conjunction with MDD expression assays to identify the resistant transgenic or edited plants.

    [0145] Infection of certain plants with certain plant pathogen microbes can result in distinctive effects on plant growth that are readily observed. Consequently, one can distinguish OeDef1-, MtDef6-, or OeDef7-type peptide or protein—expressing transgenic or edited plants by simply challenging such plants transformed with OeDef1-, MtDef6-, or OeDef7-type peptide or protein—encoding recombinant or edited polynucleotides with pathogenic plant microbes and observing reduction of the symptoms normally associated with such infections. Such observations are facilitated by co-infecting otherwise identical, non-transgenic or unedited control plants that do not contain an OeDef1-, MtDef6-, or OeDef7-type peptide or protein encoding recombinant or edited polynucleotide with the same type and dose of plant pathogenic microbes used to infect the transgenic or edited plants that contain an OeDef1-, MtDef6-, or OeDef7-type peptide or protein -encoding recombinant or edited polynucleotide. Identification of transgenic or edited plants that control or combat microbial infection can be based on observation of decreased disease symptoms, measurement of the decreased microbial growth in the infected plant (e.g., by determining the numbers of colony forming units per gram of infected tissue) and/or by measurement of the amount of mycotoxins present in infected plant tissue. The use of microbial disease severity assays and colony formation assays in conjunction with expression assays to identify transgenic MsDef1-expressing potato plants that are resistant to Verticillium dahliae has been described (U.S. Pat. No. 6,916,970 and Gao et al., 2000). It is similarly anticipated that a variety of OeDef1-, MtDef6-, or OeDef7-type peptide or protein -expressing transgenic or edited plants that combat or control microbial pathogens can be identified by scoring transgenic or edited plants for resistance to microbial pathogens that infect those plants. Examples of OeDef1-, MtDef6-, or OeDef7-type peptide or protein encoding recombinant or edited polynucleotide-conferred microbial resistance that can be assayed by observing reductions in disease symptoms or reductions in microbial growth include resistance of transgenic or edited corn to Fusarium verticillioides, Fusarium moniliforme, Colletotrichum graminicola, Stenocarpella maydis, and/or Cercospora zeae-maydis; resistance of transgenic or edited wheat to head blight (Fusarium graminearum), powdery mildew (Erysiphe graminis f. sp. tritici), stripe rust, stem rust or leaf rust (Puccinia tritici); resistance of transgenic or edited cotton to Fusarium oxysporum and Verticillium dahlia; resistance of transgenic or edited rice to Magnaporthe oryzae and Rhizoctonia solani, and resistance of transgenic or edited soybean to Asian Soybean rust (Phakopsora pachyrhizi), Phytophthora Root Rot (Phytophthora sp.), White Mold (Sclerotinia sp.), Sudden Death Syndrome (Fusarium virguliforme) and/or Brown Stem Rot (Phialophora gregata).

    [0146] Transgenic or edited plants that express plant pathogenic microbe inhibitory amounts of OeDef1-, MtDef6-, or OeDef7-type peptide or protein can also be identified by measuring decreases in the adverse effects cause by microbial growth in such plants. Such decreases can be ascertained by comparing the extent of the adverse effect in an OeDef1-, MtDef6-, or OeDef7-type peptide or protein -expressing transgenic or edited plant relative to an otherwise identical, non-transgenic or unedited control plant that does not express OeDef1-, MtDef6-, or OeDef7-type peptide or protein. Adverse effects of microbial growth in a plant that can be measured include any type of plant tissue damage or necrosis, any type of plant yield reduction, any reduction in the value of the crop plant product, and/or production of undesirable microbial metabolites or microbial growth by-products including mycotoxins. Mycotoxins comprise a number of toxic molecules produced by microbial species, including polyketides (including aflatoxins, demethylsterigmatocystin, O-methylsterigmatocystin, etc.), fumonisins, alperisins (e.g., A1s A2, Bls B2), sphingofungins (A, B, C and D), trichothecenes, fumifungins, and the like. Methods of quantitating mycotoxin levels are widely documented. Moreover, commercial kits for measurement of the mycotoxins such as aflatoxin, fumonisin, deoxynivalenol, and zearalenone are also available (VICAM, Watertown, Mass., USA).

    [0147] A wide variety of plants that express OeDef1-, MtDef6-, or OeDef7-type peptides or proteins can either be constructed by using site specific insertion of heterologous DNA into the plant genome, by mutagenizing the plant genome, and/or by introducing the expression cassette into the plant genome with a vector or other DNA transfer method to obtain transgenic or edited plants that combat or control microbial infections, or that resist such infections.

    [0148] Plants of interest include both food crop plants and biofuels or energy crop plants, as listed above. Transgenic or edited monocot plants obtainable by the expression vectors and methods described herein include barley, corn, flax, oat, rice, rye, sorghum, turf grass, sugarcane, and wheat. Transgenic or edited dicot plants obtainable by the expression vectors and methods described herein include alfalfa, Arabidopsis, barrel medic, banana, broccoli, bean, cabbage, canola, carrot, cassava, cauliflower, celery, citrus, cotton, cucurbits, eucalyptus, garlic, grape, onion, lettuce, pea, peanut, pepper, potato, poplar, pine, sunflower, safflower, soybean, strawberry, sugar beet, sweet potato, tobacco, and tomato.

    [0149] Expression of OeDef1-, MtDef6-, or OeDef7-type peptides and proteins in yeast is also specifically contemplated herein. The construction of expression vectors for production of heterologous proteins in various yeast genera is well established. In general, such expression vectors typically comprise a promoter that is operably linked to a sequence of interest which is operably linked to a polyadenylation or terminator region. Examples of yeast genera that have been used to successfully express heterologous genes include Candida, Kluveromyces, Hansuela, Pichia, Saccharomyces, Schizosaccharomyces, and Yarrowia. A general description of expression vectors and transformation systems for Saccharomyces is found in Kingsman et al (1985). Expression vectors and transformation systems useful for yeasts other than Saccharomyces are described in Reiser et al (1990).

    [0150] In general, the promoter and polyadenylation region are selected based on their operability in a given yeast host. For example, the AOX1 or AOX2 promoters of Pichia can be used in conjunction with the AOX1, AOX2, p40, or p76 polyadenylation sequences of Pichia to express a heterologous protein such as an OeDef1-, MtDef6-, or OeDef7-type peptide or protein. Both the AOX1 and AOX2 promoters are particularly useful in Pichia as both promoters provide for abundant expression of the linked heterologous gene when induced by addition of methanol to the growth medium. The use of these Pichia promoters and polyadenylation sequences is described in U.S. Pat. No. 4,855,231, which is expressly incorporated herein by reference in its entirety. Similarly, the Hansuela MOX, DHAS, or FMDH promoters can be used to express heterologous peptides or proteins such as OeDef1-, MtDef6-, or OeDef7-type peptide or protein in Hansuela. The MOX, DHAS, or FMDH promoters are particularly useful in Hansuela as these promoters provide for abundant expression of the linked heterologous gene when induced by addition of methanol to the growth medium. The use of the MOX and DHAS promoters in Hansuela is described in U.S. Pat. No. 5,741,672, while the use of the FMDH promoter in Hansuela is described in U.S. Pat. No. 5,389,525, each of which is expressly incorporated herein by reference in its entirety. For Kluveromyces, a Lactase promoter and polyadenylation sequence can be used to express heterologous genes such as OeDef1-, MtDef6-, or OeDef7-type peptide or protein encoding genes. Expression of heterologous genes that are operably linked to the Lactase promoter and polyadenylation sequence is achieved by growing Kluveromyces in the presence of galactose. The use of the Lactase promoter and polyadenylation sequences in Kluveromyces is described in U.S. Pat. No. 6,602,682, which is expressly incorporated herein by reference in its entirety.

    [0151] Yeast expression vectors that provide for secretion of heterologous peptides or proteins such as OeDef1-, MtDef6-, or OeDef7-type peptide or protein into the growth medium by transformed yeast are also contemplated. Secretion of the mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein is typically achieved by operable linkage of a signal peptide sequence or a signal peptide and propeptide sequence to the mature OeDef1-, MtDef6-, or OeDef7-type protein- or peptide-encoding sequence. Examples of useful signal peptides for secretion of heterologous proteins in yeast include an alpha-factor signal peptide, an invertase signal peptide, and a PHO1 signal peptide, all of which are derived from yeast. The alpha-factor signal peptide is typically derived from Saccharomyces, Kluveromyces, or Candida, while the PHO1 signal peptide is derived from Pichia.

    [0152] A particularly useful signal peptide sequence or signal peptide and propeptide sequence for secretion of peptides or proteins in yeast is derived from the S. cerevisiae alpha-factor, and is described in U.S. Pat. Nos. 4,546,082, 4,588,684, 4,870,008, and 5,602,034, each of which is expressly incorporated herein by reference in its entirety. The S. cerevisiae alpha-factor signal peptide and propeptide sequence consist of amino acids 1-83 of the primary, unprocessed translation product of the S. cerevisiae alpha mating factor gene (GenBank Accession Number: P01149). In certain embodiments, the signal peptide sequence of the alpha-mating factor comprising amino acids 1 to about 19 to 23 of the alpha-mating factor proprotein can be directly linked to the N-terminus of the mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein to provide for secretion of mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein. In this case, the signal peptide is cleaved from the mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein in the course of the secretion process. Alternatively, the signal peptide and propeptide of the alpha mating factor can be operably linked to the mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein encoding sequence via a cleavage site sequence. This cleavage site sequence can comprise a variety of sequences that provide for proteolytic processing of the leader sequence and gene of interest. In the native S. cerevisiae alpha mating factor gene the s cleavage site sequence corresponds to amino acid residues 84-89 and is represented by the sequence Lys84-Arg85-Glu86-Ala87-Glu88-Ala 89 (SEQ ID NO: 30). The sequence Lys-Arg corresponds to a KEX2 protease recognition site while the Glu-Ala-Glu-Ala sequence corresponds to a duplicated dipeptidylaminopeptidase or STE13 recognition site. In certain embodiments, a DNA fragment encoding the 89 amino acid S. cerevisiae alpha factor signal, propeptide coding region, and entire native spacer coding region (i.e., the N-terminal 89 amino acid residues of the alpha mating factor precursor protein containing both the Lys-Arg KEX2 protease cleavage site at residues 84 and 85 as well as the Glu-Ala-Glu-Ala dipeptidylaminopeptidase or STE13 recognition site at residues 86-89) is operably linked to the sequence encoding the mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein. When the N-terminal 89 amino acids of the alpha mating factor precursor protein are fused to the N-terminus of a heterologous peptide or protein such as OeDef1-, MtDef6-, or OeDef7-type peptide or protein, the propeptide sequence is typically dissociated from the heterologous protein via the cleavage by endogenous yeast proteases at either the KEX2 or STE13 recognition sites. In other embodiments, a DNA fragment encoding the smaller 85 amino acid Saccharomyces cerevisiae alpha factor signal peptide, propeptide, and KEX2 spacer element (i.e., the N-terminal 85 amino acid residues of the alpha mating factor precursor protein containing just the Lys-Arg KEX2 protease cleavage site at residues 84 and 85) is operably linked to the sequence encoding the mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein. When the N-terminal 85 amino acids of the alpha mating factor precursor protein are fused to the N-terminus of a heterologous protein such as OeDef1-, MtDef6-, or OeDef7-type peptide or protein, the propeptide sequence is typically dissociated from the heterologous peptide or protein via cleavage by endogenous yeast proteases at the KEX2 recognition site. The OeDef1-, MtDef6-, or OeDef7-type peptide or protein can thus be expressed without the glu-ala repeats.

    [0153] To obtain transformed yeast that express OeDef1-, MtDef6-, or OeDef7-type peptides and proteins, the yeast OeDef1-, MtDef6-, or OeDef7-type peptide or protein expression cassettes (e.g., yeast promoter, yeast signal peptide encoding sequence, mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein sequence, and polyadenylation sequence) are typically combined with other sequences that provide for selection of transformed yeast. Examples of useful selectable marker genes include genes encoding a ADE protein, a HIS5 protein, a HIS4 protein, a LEU2 protein, a URA3 protein, ARG4 protein, a TRP1 protein, a LYS2 protein, a protein conferring resistance to a bleomycin or phleomycin antibiotic, a protein conferring resistance to chloramphenicol, a protein conferring resistance to G418 or geneticin, a protein conferring resistance to hygromycin, a protein conferring resistance to methotrexate, an a AR04-OFP protein, and a FZF1-4 protein.

    [0154] DNA molecules comprising the yeast OeDef1-, MtDef6-, or OeDef7-type peptide or protein expression cassettes and selectable marker genes are introduced into yeast cells by techniques such as transfection into yeast spheroplasts or electroporation. In certain embodiments, the DNA molecules comprising the yeast OeDef1-, MtDef6-, or OeDef7-type peptide or protein expression cassettes and selectable marker genes are introduced as linear DNA fragments that are integrated into the genome of the transformed yeast host cell. Integration can occur either at random sites in the yeast host cell genome or at specific sites in the yeast host cell genome. Integration at specific sites in the yeast host cell genome is typically accomplished by homologous recombination between sequences contained in the expression vector and sequences in the yeast host cell genome. Homologous recombination is typically accomplished by linearizing the expression vector within the homologous sequence (for example, within the AOX1 promoter sequence of a Pichia expression vector when integrating the expression vector into the endogenous AOX1 gene in the Pichia host cell). In other embodiments, the yeast expression cassettes can also comprise additional sequences such as autonomous replication sequences (ARS) that provide for the replication of DNA containing the expression cassette as an extrachromosomal (non-integrated) element. Such extra-chromosomal elements are typically maintained in yeast cells by continuous selection for the presence of the linked selectable marker gene. Yeast artificial chromosomes (YACs) containing sequences that provide for replication and mitotic transmission are another type of vector that can be used to maintain the DNA construct in a yeast host.

    [0155] Yeast cells transformed with the yeast OeDef1-, MtDef6-, or OeDef7-type peptide or protein expression cassettes can be used to produce OeDef1-, MtDef6-, or OeDef7-type peptides and proteins. These OeDef1-, MtDef6-, or OeDef7-type peptide or protein molecules can be used directly as antimicrobial agents, to produce antimicrobial compositions that can be applied to plants, as immunogens to raise antibodies that recognize the OeDef1-, MtDef6-, or OeDef7-type peptides or proteins, or as reference standards in kits for measuring concentrations of OeDef1-, MtDef6-, or OeDef7-type peptides and proteins in various samples. The transformed yeast cells expressing OeDef1-, MtDef6-, or OeDef7-type peptide or protein antimicrobial molecules can also be applied to plants to combat/control pathogenic microbial infections. The methods of producing OeDef1-, MtDef6-, or OeDef7-type peptides and proteins typically first comprise the step of culturing yeast cells transformed with OeDef1-, MtDef6-, or OeDef7-type peptide or protein expression cassettes under conditions wherein the yeast cells express a mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein molecule. In general, the conditions where the yeast cells express the mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein molecules are conditions that allow for or specifically induce expression of the yeast promoter that is operably linked to the OeDef1-, MtDef6-, or OeDef7-type peptide or protein coding sequence in the yeast expression cassette. When the yeast is Pichia and the signal-peptide/MD gene is under the control of an AOX1 or AOX2 promoter, addition of methanol to the growth medium will provide for expression of mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein. Similarly, when the yeast is Hansuela and the signal-peptide/MD gene is under the control of a MOX, DHAS, or FMDH promoter, addition of methanol to the growth medium will provide for expression of mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein. Alternatively, when the yeast is Kluveromyces and the signal-peptide/De/5 gene is under the control of a Lactase promoter, addition of galactose to the growth medium will provide for expression of mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein.

    [0156] Once the transformed yeast culture has been incubated under culture conditions that provide for expression of mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein for a sufficient period of time, the mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein molecule can be isolated from the culture. A sufficient period of time can be determined by periodically harvesting portions or aliquots of the culture and assaying for the presence of OeDef1-, MtDef6-, or OeDef7-type peptide or protein. Analytical assays such as SDS-PAGE with protein staining, Western blot analysis, or any immunodetection method (e.g., such as an ELISA) can be used to monitor OeDef1-, MtDef6-, or OeDef7-type peptide or protein production. For example, incubation in the presence of methanol for between 1 to 8 days is sufficient to provide for expression of mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein from the AOX1 promoter in Pichia.

    [0157] Isolation of the OeDef1-, MtDef6-, or OeDef7-type peptide or protein from the culture can be partial or complete. For OeDef1-, MtDef6-, or OeDef7-type peptide or protein expression vectors where a yeast signal peptide is operably linked to the sequence encoding the mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein, the mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein can be recovered from the yeast cell culture medium. Yeast cell culture medium that contains the mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein can be separated from the yeast cells by centrifugation or filtration, thus effecting isolation of mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein. Yeast cell culture medium that contains the mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein can be further processed by any combination of dialysis and/or concentration techniques (e.g., precipitation, lyophilization, filtration) to produce a composition containing the OeDef1-, MtDef6-, or OeDef7-type peptide or protein. Production of OeDef1-, MtDef6-, or OeDef7-type peptide or protein can also comprise additional purification steps that result in either a partially or completely pure preparation of the OeDef1-, MtDef6-, or OeDef7-type peptide or protein. To effect such purification, filtration size-exclusion membranes can be used. Alternatively, various types of chromatographic techniques such as size exclusion chromatography, ion-exchange chromatography, or affinity chromatography can be used to produce a partially or completely pure preparation of the OeDef1-, MtDef6-, or OeDef7-type peptide or protein.

    [0158] Combinations of various isolation techniques can also be employed to produce the mature OeDef1-, MtDef6-, or OeDef7-type peptide or protein. For example, the cell culture medium can be separated from the cells by centrifugation and dialyzed or adjusted. In certain embodiments, a buffer for dialysis or adjustment is a 25 mM sodium acetate buffer at about pH4.5-pH6.0. This dialysate is then subjected to ion-exchange chromatography. For example, a cation-exchange resin such as CM-Sephadex C-25 equilibrated with a 25 mM sodium acetate buffer at about pH6.0 can be used. OeDef1-, MtDef6-, or OeDef7-type peptide or protein bound to the cation exchange resin is washed and then eluted. For example, the aforementioned column is washed with 25 mM sodium acetate buffer at about pH6.0 and subsequently eluted in 1M NaCl, 50 mM Tris, pH7.6. Fractions containing the OeDef1-, MtDef6-, or OeDef7-type peptide or protein are identified by an assay or by UV absorbance and then concentrated by a size-cutoff filtration membrane. The concentrated OeDef1-, MtDef6-, or OeDef7-type peptide or protein is then dialyzed to obtain an essentially or substantially pure OeDef1-, MtDef6-, or OeDef7-type peptide or protein in a buffer. Buffers include buffers such as 10 mM Tris, pH 7.6.

    [0159] Also provided are antimicrobial compositions for agricultural, pharmaceutical, or veterinary use comprising either an antimicrobial plant, or antimicrobial human or veterinary, pathogenic microbe inhibitory amount (“antimicrobial effective amount”) of one or more the present isolated, purified antimicrobial OeDef1-, MtDef6-, or OeDef7-type peptides or proteins, or biologically functional equivalents thereof. Such compositions can comprise one, or any combination of, OeDef1-, MtDef6-, or OeDef7-type peptides or proteins disclosed herein, and an agriculturally, pharmaceutically, or veterinary-practicably acceptable carrier, diluent, or excipient. As indicated below, other components relevant in agricultural and therapeutic contexts can be included in such compositions as well. The antimicrobial compositions can be used for inhibiting the growth of, or killing, OeDef1-, MtDef6-, or OeDef7-type protein- or peptide-susceptible pathogenic microbes associated with plant, human or animal microbial infections. Such antimicrobial compositions can be formulated for topical administration, and applied topically to either plants, the plant environment (including soil), or humans or animals. Such antimicrobial compositions can be formulated for enteral, parenteral, and/or intravenous administration of the composition, and administered to a subject in need thereof; such subject can be a human, livestock, poultry, fish, or a companion animal.

    [0160] Agricultural compositions comprising any of the present OeDef1-, MtDef6-, or OeDef7-type peptide or protein molecules alone, or in any combination, can be formulated as described in, for example, Winnacker-Kuchler (1986) Chemical Technology, Fourth Edition, Volume 7, Hanser Verlag, Munich; van Falkenberg (1972-1973) Pesticide Formulations, Second Edition, Marcel Dekker, N.Y.; and K. Martens (1979) Spray Drying Handbook, Third Edition, G. Goodwin, Ltd., London. Formulation aids, such as carriers, inert materials, surfactants, solvents, and other additives are also well known in the art, and are described, for example, in Watkins, Handbook of Insecticide Dust Diluents and Carriers, Second Edition, Darland Books, Caldwell, N.J., and Winnacker-Kuchler (1986) Chemical Technology, Fourth Edition, Volume 7, Hanser Verlag, Munich. Using these formulations, it is also possible to prepare mixtures of the present OeDef1-, MtDef6-, or OeDef7-type peptides and proteins with other pesticidally active substances, fertilizers, and/or growth regulators, etc., in the form of finished formulations or tank mixes.

    [0161] Whether alone or in combination with other active agents, the present antimicrobial OeDef1-, MtDef6-, or OeDef7-type peptides and proteins can be applied at a concentration in the range of from about 0.1 μg ml to about 100 mg ml, or from about 5 μg ml to about 5 mg ml, at a pH in the range of from about 3.0 to about 9.0. Such compositions can be buffered using, for example, phosphate buffers between about 1 mM and 1 M, about 10 mM to about 100 mM, or about 15 mM to about 50 mM. In the case of low buffer concentrations, a salt can be added to increase the ionic strength. In certain embodiments, a sodium salt, including NaCl, in the range of from about 1 mM to about 1 M, about 1 mM, 5 mM, or 10 mM to about 20 mM, 50 mM, 100 mM, 150 mM, or 200 mM, or about 10 mM to about 100 mM, can be added or provided in compositions comprising OeDef1-, MtDef6-, or OeDef7-type peptides and proteins. In certain embodiments, a potassium salt, including KCl, in the range of about 1 mM, 5 mM, or 10 mM to about 20 mM, 50 mM, 100 mM, 150 mM, or 200 mM can be added or provided in compositions comprising OeDef1-, MtDef6-, or OeDef7-type peptides and proteins. In certain embodiments, a calcium salt, including CaCl.sub.2, in the range of about 0.1 mM, 0.5 mM, or 1 mM to about 2 mM, 5 mM, 10 mM, or 20 mM can be added or provided in compositions comprising OeDef1-, MtDef6-, or OeDef7-type peptides and proteins.

    [0162] Numerous conventional microbial antibiotics and chemical antimicrobial agents (e.g., fungicides) with which the present OeDef1-, MtDef6-, or OeDef7-type peptides and proteins can be combined are described in Worthington and Walker (1983) The Pesticide Manual, Seventh Edition, British Crop Protection Council. These include, for example, polyoxines, nikkomycines, carboxy amides, aromatic carbohydrates, carboxines, morpholines, inhibitors of sterol biosynthesis, and organophosphorous compounds. In addition, azoles, triazoles and echinocandins fungicides can also be used. Other active ingredients which can be formulated in combination with the present antimicrobial peptides and proteins include, for example, insecticides, attractants, sterilizing agents, acaricides, nematicides, and herbicides. U.S. Pat. No. 5,421,839, which is incorporated herein by reference in its entirety, contains a comprehensive summary of the many active agents with which substances such as the present antimicrobial OeDef1-, MtDef6-, or OeDef7-type peptides and proteins can be formulated.

    [0163] Agriculturally useful antimicrobial compositions encompassed herein also include those in the form of host cells, such as bacterial and microbial cells, capable of producing the OeDef1-, MtDef6-, or OeDef7-type peptides and proteins, and which can colonize plants, including roots, shoots, leaves, or other parts of plants. The term “plant-colonizing microorganism” is used herein to refer to a microorganism that is capable of colonizing the any part of the plant itself and/or the plant environment, including, and which can express the present OeDef1-, MtDef6-, or OeDef7-type antimicrobial peptides and proteins in the plant and/or the plant environment. A plant colonizing micro-organism is one that can exist in symbiotic or non-detrimental relationship with a plant in the plant environment. U.S. Pat. No. 5,229,112, which is incorporated herein by reference in its entirety, discloses a variety of plant-colonizing microorganisms that can be engineered to express antimicrobial peptides and proteins, and methods of use thereof, applicable to the OeDef1-, MtDef6-, or OeDef7-type antimicrobial peptides and proteins disclosed herein. Plant-colonizing microorganisms expressing the presently disclosed OeDef1-, MtDef6-, or OeDef7-type antimicrobial peptides and proteins useful in inhibiting microbial growth in plants include bacteria selected from the group consisting of Bacillus spp. including Bacillus thuringiensis, Bacillus israelensis, and Bacillus subtilis, Candidatus Liberibacter asiaticus; Pseudomonas spp.; Arthrobacter spp., Azospyrillum spp., Clavibacter spp., Escherichia spp.; Agrobacterium spp., for example A. radiobacter, Rhizobium spp., Erwinia spp. Azotobacter spp., Azospirillum spp., Klebsiella spp., Alcaligenes spp., Rhizobacterium spp., Xanthomonas spp., Ralstonia spp. and Flavobacterium spp. In certain embodiments, the microorganism is a yeast selected from the group consisting of Saccharomyces cerevisiae, Pichia pastoris, and Pichia methanolica. In certain embodiments, the plant colonizing microorganism can be an endophytic bacteria or microbe.

    [0164] When applying the present OeDef1-, MtDef6-, or OeDef7-type peptide or protein molecules to the rhizosphere, rhizosphere-colonizing bacteria from the genus Pseudomonas are particularly useful, especially the fluorescent pseudomonads, e.g., Pseudomonas fluorescens, which is especially competitive in the plant rhizosphere and in colonizing the surface of the plant roots in large numbers. Examples of suitable phylloplane (leaf) colonizing bacteria are P. putida, P. syringae, and Erwinia species.

    [0165] The antimicrobial plant-colonizing microorganisms that can express OeDef1-, MtDef6-, or OeDef7-type peptides or proteins can be applied directly to the plant, e.g., to the surface of leaves, buds, roots, shoots, floral parts, seeds, etc., or to the soil. When used as a seed coating, the plant-colonizing microorganisms that can express OeDef1-, MtDef6-, or OeDef7-type peptides or proteins are applied to the plant seed prior to planting. The determination of an antimicrobial effective amount of plant-colonizing microorganisms used for a particular plant can be empirically determined, and will depend on such factors as the plant species, the microbial pathogen, method of planting, and the soil type, (e.g., pH, organic matter content, moisture content). At least one, 10 or 100 plant-colonizing microorganism(s) containing DNA encoding the OeDef1-, MtDef6-, or OeDef7-type antimicrobial peptides and proteins disclosed herein is sufficient to control microbial pathogens because it or they can grow into a colony of clones of sufficient number to express antimicrobial amounts of the OeDef1-, MtDef6-, or OeDef7-type peptide or protein. However, in practice, due to varying environmental factors which can affect the survival and propagation of the microorganism, a sufficient number of plant colonizing microorganisms should be provided in the seed, plant or plant environment (e.g., roots or foliage) to assure survival and/or proliferation. For example, application of 10.sup.3 to 10.sup.10 bacteria or yeasts per seed can be sufficient to insure colonization on the surface of the roots by the microorganism. In certain embodiments, it is sufficient to dose the plant or plant environment with enough bacteria or other plant-colonizing microorganism to maintain a population that expresses 100 to 250 nanograms of the OeDef1-, MtDef6-, or OeDef7-type peptide or protein per plant. For example, 10.sup.5 to 10.sup.8 bacteria per square centimeter of plant surface can be adequate to control microbial infection. In certain embodiments, at least about 5 or 10 nanograms to about 100, 200, 500, or 1,000 nanograms, of a OeDef1-, MtDef6-, or OeDef7-type peptide or protein can be sufficient to control microbial damage to plants.

    [0166] Compositions containing the plant colonizing microorganisms that express the OeDef1-, MtDef6-, or OeDef7-type peptide or protein can be prepared by formulating the biologically active microorganism with adjuvants, diluents, carriers, etc., to provide compositions in the form of finely-divided particulate solids, granules, pellets, wettable powders, dusts, aqueous suspensions, dispersions, or emulsions. Illustrative of suitable carrier vehicles are: solvents, e.g., water or organic solvents, and finely divided solids, e.g., kaolin, chalk, calcium carbonate, talc, silicates, and gypsum. In certain embodiments, plant colonizing microorganisms that express the OeDef1-, MtDef6-, or OeDef7-type peptide or protein can also be in encapsulated form, e.g., the plant-colonizing microorganisms can be encapsulated within shell walls of polymer, gelatin, lipid, and the like. Other formulation aids such as, for example, emulsifiers, dispersants, surfactants, wetting agents, anti-foam agents, and anti-freeze agents, can be incorporated into the antimicrobial compositions, especially if such compositions will be stored for any period of time prior to use.

    [0167] In addition to the plant-colonizing microorganisms that express OeDef1-, MtDef6-, or OeDef7-type peptides or proteins, the compositions provided herein can additionally contain other known biologically active agents, such as, for example, an antimicrobial agent, herbicide, or insecticide. Also, two or more plant-colonizing microorganisms that express either a different or the same OeDef1-, MtDef6-, or OeDef7-type peptide or protein can be combined.

    [0168] The application of antimicrobial compositions containing the genetically engineered plant-colonizing microorganisms that can express OeDef1-, MtDef6-, or OeDef7-type peptide or protein as the active agent can be carried out by conventional techniques utilizing, for example, spreaders, power dusters, boom and hand sprayers, spry dusters, and granular applicators.

    [0169] The compositions provided herein can be applied in an antimicrobial effective amount, which will vary depending on such factors as, for example, the specific microbial pathogen to be controlled, the specific plant (and plant part or soil) to be treated, and the method of applying the compositions that comprise OeDef1-, MtDef6-, or OeDef7-type peptides and proteins.

    [0170] OeDef1-, MtDef6-, or OeDef7-type peptides and proteins and biologically functional equivalents, as well transgenic or genetically edited plants or microorganisms expressing those peptides or proteins, can be used to inhibit the growth of a wide variety of susceptible microbes in plants. In certain embodiments, growth of microbes in the following genera or species can be inhibited: Alternaria (e.g., Alternaria brassicicola; Alternaria solani); Ascochyta (e.g., Ascochyta pisi); Aspergillus (e.g., Aspergillus flavus; Aspergillus fumigatus); Botrytis (e.g., Botrytis cinerea); Cercospora (e.g., Cercospora kikuchii; Cercospora zeae-maydis); Colletotrichum (e.g., Colletotrichum lindemuthianum); Diplodia (e.g., Diplodia maydis); Erysiphe (e.g., Erysiphe graminis f.sp. graminis; Erysiphe graminis f.sp. hordei); Fusarium (e.g., Fusarium nivale; Fusarium oxysporum; Fusarium graminearum; Fusarium culmorum; Fusarium solani; Fusarium moniliforme; Fusarium roseum); Gaeumanomyces (e.g., Gaeumanomyces graminis f.sp. tritici); Helminthosporium (e.g., Helminthosporium turcicum; Helminthosporium carbonum; Helminthosporium maydis); Leptosphaeria, Macrophomina (e.g., Macrophomina phaseolina; Maganaporthe grisea); Nectria (e.g., Nectria heamatococca); Peronospora (e.g., Peronospora manshurica; Peronospora tabacina); Phakopsora (e.g., Phakopsora pachyrhizi); Phoma (e.g., Phoma betae); Phymatotrichum (e.g., Phymatotrichum omnivorum); Phytophthora (e.g., Phytophthora cinnamomi; Phytophthora cactorum; Phytophthora phaseoli; Phytophthora parasitica; Phytophthora citrophthora; Phytophthora sojae; Phytophthora infestans); Plasmopara (e.g., Plasmopara viticola); Podosphaera (e.g., Podosphaera leucotricha); Puccinia (e.g., Puccinia sorghi; Puccinia striiformis; Puccinia graminis f.sp. tritici; Puccinia asparagi; Puccinia recondita; Puccinia arachidis); Pythium (e.g., Pythium aphanidermatum; Pythium ultimum); Pyrenophora (e.g., Pyrenophora tritici-repentens); Pyricularia (e.g., Pyricularia oryzae); Rhizoctonia (e.g., Rhizoctonia solani; Rhizoctonia cerealis); Sclerotium (e.g., Sclerotium rolfsii); Sclerotinia (e.g., Sclerotinia sclerotiorum); Septoria (e.g., Septoria lycopersici; Septoria glycines; Septoria nodorum; Septoria tritici); Thielaviopsis (e.g., Thielaviopsis basicola); Uncinula (e.g., Uncinula necator); Venturia (e.g., Venturia inaequalis); and Verticillium (e.g., Verticillium dahliae; Verticillium alboatrum).

    [0171] Pharmaceutical or veterinary compositions that comprise an antimicrobial effective amount of OeDef1-, MtDef6-, or OeDef7-type proteins, peptides, or biologically functional equivalents thereof and a pharmaceutically acceptable carrier are also provided. Such pharmaceutical or veterinary compositions can be used for inhibiting the growth of, or killing, susceptible pathogenic microbes that infect humans or animals, i.e., treating such microbial infections by administering to a patient or other subject in need thereof. In certain embodiments, compositions comprising OeDef1-, MtDef6-, or OeDef7-type peptides and proteins, and biologically functional equivalents thereof, can be formulated by methods such as those described in Remington: The Science and Practice of Pharmacy (2005), 21st Edition, University of the Sciences in Philadelphia, Lippincott Williams & Wilkins. In certain embodiments, the compositions can contain OeDef1-, MtDef6-, or OeDef7-type peptides and proteins, and various combinations thereof, at concentrations in the range of from about 0.1 μg per ml to about 100 mg per ml, or about 5 μg per ml to about 5 mg per ml, at a pH in the range of from about 3.0 to about 9.0. Such compositions can be buffered using, for example, phosphate buffers at a concentration of about 1 mM to about 1 M, about 10 mM to about 100 mM, or about 15 mM to 50 mM. In the case of low buffer concentrations, a salt can be added to increase the ionic strength. In certain embodiments, NaCl in the range of about 1 mM to about 1 M, or about 10 mM to about 100 mM, can be added.

    [0172] The OeDef1-, MtDef6-, or OeDef7-type peptides and proteins can be formulated alone, in any combination with one another, and either of these can additionally be formulated in combination with other conventional antimicrobial therapeutic compounds such as, by way of non-limiting example, polyene antimicrobials; imidazole, triazole, and thiazole antimicrobials; allylamines; and echinocandins that are routinely used in human and veterinary medicine.

    [0173] Administration of the compositions that comprise OeDef1-, MtDef6-, or OeDef7-type peptides and proteins to a human or animal subject in need thereof can be accomplished via a variety of routes that include topical application, enteral administration, parenteral administration, and/or intravenous administration.

    EXAMPLES

    Example 1

    Antimicrobial, Antioomycete and Antibacterial Activity of Antimicrobial OeDef1-Type Peptides.

    [0174] The properties of certain OeDef1-type peptides are shown in Table 1.

    TABLE-US-00002 TABLE 1 The amino acid sequences, net positive charge and hydrophobicity of Olive defensin OeDef1a Net % Hydrophobic Peptide Amino acid sequence Length charge amino acids OeDef1a KPCTKLSKGWRGLCAPHKCSSYCIH 53  +8 30 HEGAYHGACLKNRHSKHYGCYCY YRHCY (SEQ ID NO: 1) OeDef1_V1 KPCTKLSKGWRGLCAPHKCSSYCIH 49 +10 30 HEGAYHGRCRGFRRRCYCYYRHCY (SEQ ID NO: 2)

    [0175] For expression of Olea europaea OeDef1-type peptides in Pichia pastoris, synthetic genes (SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42) encoding these peptides were obtained from Genscript (Piscataway, N.J.) were cloned in the pPICZαA vector in frame with the a-factor secretion signal sequence without the Glu-Ala repeats at the Kex2 signal cleavage site. The mature peptides from transformed Pichia were purified to homogeneity by ion exchange chromatography and reverse phase HPLC using published protocols (Ramamoorthy, et al., 2007). Molecular mass of each peptide was confirmed by mass spec analysis. The antimicrobial activity of each peptide was determined against plant microbial pathogens Botrytis cinerea, Fusarium graminearum, F. oxysporum, Alternaria brassicicola, the oomycete Phytophthora capsici and the bacterial pathogen Agrobacterium rhizogenes. The in vitro antimicrobial activity of these peptides was determined spectrophotometrically as described in previous publications (Sagaram et al. 2013: Islam et al. 2017). The IC.sub.50 and MIC values for antimicrobial activity of each peptide against these pathogens are shown in Table 2.

    [0176] The OeDef1-type peptides tested exhibit antifungal activity at micromolar concentrations against the pathogens used in this study.

    TABLE-US-00003 TABLE 2 In vitro antifungal activity of Pichia pastoris-expressed OeDef1-type peptides against fungal pathogens ND = Not Determined Botrytis cinerea Fusarium graminearum Phytophthora capsici Fusarium oxysporum Alternaria brassicicola IC.sub.50 MIC IC.sub.50 MIC IC.sub.50 MIC IC.sub.50 MIC IC.sub.50 MIC (μM) (μM) (μM) (μM) (μM) (μM) (μM) (μM) (μM) (μM) OeDef1a 0.5 1.5-3 2 3 2-3 6 0.5-1 1.5 2 3-6 (SEQ ID NO: 1) OeDef1V1 2 3 3-4 6 2-3 6 1.5-2 3 ND.sup.1 ND.sup.1 (SEQ ID NO: 2) .sup.1Not Determined

    [0177] OeDef1-type peptides also exhibit potent broad-spectrum antimicrobial and antioomycete activity at low micromolar concentrations against all pathogens, especially against B. cinerea and F. oxysporum (Table 2). None of the OeDef1 peptides that were tested exhibit any antibacterial activity against A. rhizogenes or A. tumefaciens.

    [0178] The activity of OeDef1a (SEQ ID NO:1) and OeDef_V5 (SEQ ID NO:39) peptides against Botrytis and Candida were also compared.

    TABLE-US-00004 TABLE 3 Activity of OeDef1a and OeDef_V5 peptides against Botrytis and Candida Botrytis cinerea Candida albicans Peptides IC.sub.50 (μM) IC.sub.100 (μM) IC.sub.50 (μM) IC.sub.100 (μM) OeDef1a 0.75 1.5-3  6 12 (SEQ ID NO: 1) OeDef1-V5 0.3-0.5 0.75-1.5 3 6 (SEQ ID NO: 39)

    [0179] The OeDef_V5 peptide exhibits improved activity over the OeDef1a peptide against these pathogens.

    [0180] In summary, OeDef1-type peptides have high potential as a potent antimicrobial or anti-oomycete agent either applied topically on crops or expressed in transgenic or edited crops. It is likely that these antimicrobial peptides will have a different mode of action than other antimicrobial peptides and thus could potentially be exploited in the fungal or oomycete resistance management strategy in future.

    Example 2

    Activity of OeDef1 Variants with Substitutions of Wild-Type Amino Acid Residues with Alanine Residues in their Gamma Cores

    [0181] Several additional OeDef1 variant peptides (OeDef1_V6, OeDef1_V7, and OeDef1_V8) were tested for activity against Botrytis cinerea essentially as described in Example 1. Results of the experiments are set forth in Table 4.

    TABLE-US-00005 TABLE 4 Activity of OeDef1 Variants against Botrytis Botrytis cinerea Peptides IC.sub.50(μM) MIC (μM) OeDef1a 0.75  1.5-3.0 (SEQ ID NO: 1) OeDef1 V1 1.5 3   (SEQ ID NO: 2) OeDef1_V5 0.3-0.5 0.75-1.5 (SEQ ID NO: 39) OeDef1_V6 0.75 1.5 (SEQ ID NO: 62) OeDef1_V7 0.75 1.5 (SEQ ID NO: 43) OeDef1_V8 0.5 0.75-1.5 (SEQ ID NO: 44)

    [0182] The OeDef1 variants OeDef1_V6 and OeDef1_V7 having substitutions of wild-type amino acid residues with alanine residues in their gamma core regions exhibited the same antifungal activity as OeDef1a. However, the OeDef1 variant OeDef1_V8 (SEQ ID NO:44) also having substitutions of wild-type amino acid residues with alanine residues exhibited about a two-fold improvement in its IC.sub.50 and MIC values in comparison to OeDef1a (SEQ ID NO:1).

    Example 3

    Antimicrobial Activity of OeDef1 Tested Using B. Cinerea Infection of Lettuce Leaves in Presence of Applied OeDef1a.

    [0183] Detached leaf infection assays were performed as described previously with minor modifications (Wang et al., Nature Plants DOI: 10.1038/NPLANTS.2016.151). Briefly, store-bought iceberg lettuce was cut into small pieces of 2×2 cm and placed in Petri dishes. An aliquot of 10 μl of each peptide was drop inoculated onto the leaf samples in different concentrations (0, 3, 6, 12, 24 and 48 μM) and inoculation with B. cinerea was carried out at the same spot by applying 10 μl of spore suspension prepared in 2× SFM at a final concentration of 10.sup.5 spores/ml. Samples were kept in Ziploc Weather Shield plastic boxes containing wet paper towel to maintain high humidity at room temperature for 48 h. Lesions were photographed at 48 h and the relative lesion sizes were determined using ImageJ software. Twelve replications were performed for each treatment.

    [0184] Real-time PCR was used in this study to quantify the biomass of B. cinerea from each lesion. A round punch larger than lesion was used to collect the leaf tissue together with B. cinerea lesion to ensure the same weight/size of the samples under different treatments. After homogenizing samples in liquid nitrogen, 100 mg of each sample was used for total DNA extraction using fungal DNA kit (OMEGA). Internal transcribed spacer (ITS) gene was used as an indicator of biomass with a pair of primers: (TCGAATCTTTGAACGCACATTGCGC (SEQ ID NO: 45)/TGGCAGAAGCACACCGAGAACCTG (SEQ ID NO: 46)). In real-time PCR assay, ten microliter samples were prepared by mixing 10 ng DNA solution with 5 μl 2× SYBR green Supermix (Bio-Rad) and appropriate primers (final concentration 500 nM). Real-time PCR reactions were run in triplicate on Bio-Rad CFX-384 thermocycler. After 98° C. denaturation step for 3 min, samples were run for 40 cycles of 15 s at 95° C. and 20 s at 58° C. After each run, a dissociation curve was acquired to check for amplification specificity by heating the samples from 60 to 95° C. The comparative CT method (2.sup.−ΔΔCT) was used to calculate the relative biomass of B. cinerea.

    [0185] Results of the detached lettuce leaf infection assays are shown in FIG. 3. Inhibition of B. cinerea as measured by both lesion size and B. cinerea biomass was OeDef1a peptide (SEQ ID NO:1) dose dependent.

    Example 4

    Mode of Action Studies on OeDef1a Activity.

    [0186] A fluorescent dye SYTOX Green (SG) (Invitrogen) was used to address whether OeDef1a (SEQ ID NO:1) can induce membrane permeabilization. B. cinerea was cultured on a V8 plate for 10-14 days, and fresh spores were collected and washed 2 times with sterile water. Spores were diluted using 2× SFM medium to reach a final concentration of 10.sup.5 spores per milliliter. 3 μM OeDef1a and 1 μM SYTOX Green were added to 5000 spores in 1× SFM and the SG uptake was observed by confocal microscopy (Leica SP-8) at an excitation wavelength of 488 nm and an emission wavelength of 520 nm to 600 nm. Snap shots were taken every 3 min until the fluorescent dye was taken up completely. The results of these experiments shown in FIG. 4 indicate that OeDef1a can induce membrane permeabilization within 3 min in resting conidia of B. cinerea and causes maximal induction of permeabilization within 30 min. These results indicate that OeDef1 inhibits fungal growth by disrupting the plasma membrane of Botrytis cells.

    [0187] In order to determine the subcellular localization of OeDef1a in B. cinerea, the OeDef1a peptide was labeled with DyLight 550 NHS Ester (Thermo Scientific) according to manufacturer's instructions and localization was analyzed by treating B. cinerea spores or germlings with 6 μM OeDef1a. The uptake of fluorescently labeled OeDef1a (SEQ ID NO:1) was observed by time-lapse confocal microscopy (Leica SP-8). The excitation and emission wavelength were 562 nm and 580-680 nm, respectively. The results of these experiments shown in FIGS. 5 and 6 indicate that OeDef1a is internalized by the cells of newly emerged hyphae, but not by the cells of the ungerminated fungal spores. It is thus likely that interaction with intracellular targets is a factor in the antifungal action of OeDef1a in actively growing fungus, but not in resting conidial cells.

    [0188] Propidium iodide uptake assays were performed to determine the ability of OeDef1a (SEQ ID NO:1) to induce cell death. Spores of B. cinerea were collected from 10-14 day old V8 plates and resuspended in 2× SFM for overnight germination. These fresh germlings were treated with equal volume of 500 nM propidium iodide (Thermo-Fisher) for 30 min and then 3 μM OeDef1a was added. Confocal microscopy was used to record the images every 5 min as soon as OeDef1a was added. The fluorescence was detected under 535 nm excitation wavelength and 615-690 nm emission wavelength. The results of these experiments shown in FIG. 7 indicate that OeDef1a induces cell death in the actively growing fungal hyphae.

    Example 5

    Biological Sequences and Associated SEQ ID NO

    [0189]

    TABLE-US-00006 TABLE 5 Biological sequences SEQ ID NO. Description Sequence Remarks  1 OeDef1a KPCTKLSKGWRGLCAPHKCS Conserved cysteines SYCIHHEGAYHGACLKNRHS underlined KHYGCYCYYRHCY  2 OeDef1_V1 KPCTKLSKGWRGLCAPHKCS Substitution of OeDef1 SYCIHHEGAYHGRCRGFRRR gamma core with MtDef4 CYCYYRHCY gamma core (underlined)  3 Variant GXCX3-10C (where X is any Gamma amino acid) Core consensus  4 OeDef1a GACLKNRHSKHYGC gamma core  5 OeDef1_V2 KPCTKLSKGWRGLCAPHKCS more cationic (substitutions SYCIHHEGAYHGACLKNRRS underlined) KRYGCYCYYRHCY  6 OeDef1_V3 KPCFKLFKGWRGLCAPHKCS Enhanced hydrophobicity SYCIHHEGYYHGICLKNRHSK (substitutions underlined) HYGCYCYYRHCY  7 OeDef1_V4 KPCTKLSKGWRGLCAPHKCS More cationic defensin with SYCIYYEGAYYGACLKNRRS semi-conservative KRYGCYCYYRRCY substitutions (substitutions underlined)  8 OeDef1b KPCTKLSKGWHGLCAPHKCS (gamma core underlined) NYCIHHEGAYHGACLKNHEIN KHYGCYCYYRHCY  9 MtDef5 APKKVEP spacer peptide 10 MtDef4 RTCESQSHKFKGPCASDHNC ASVCQTERFSGGHCRGFRRR CFCTTHC 11 MtDef5-1a KLCQKRSTTWSGPCLNTGNC KRQCINVEHATFGACHRQGF GFACFCYKKC 12 MtDef5-1b KLCERRSKTWSGPCLISGNCK RQCINVEHATSGACHRQGIGF ACFCKKKC 13 MtDef5 KLCQKRSTTWSGPCLNTGNC dimer KRQCINVEHATFGACHRQGF GFACFCYKKC APKKVEPKLCERRSKTWSGP CLISGNCKRQCINVEHATSGA CHRQGIGFACFCKKKC 14 HXL005 KMCQTTSHAFSCVNDSGCSG SCEKQGFASGKCDGVRRRCT CYKKC 15 HXL008 KVCTKPSKFFKGLCGTDGAC TTACRKEGLHSGYCQLKGFL NSVCVCRKHC 16 HXL035 KVCTKPSKFFKGLCGFDRDC TVACKKEGLASGFCQNKGFF NVVCVCRKPC 17 HXL036 KVCTKPSKFFKGLCGADRDC TVACKKEGLATGFCQKKGFF NFVCVCRKPC 18 (Gly4Ser)n GGGGS 19 Ser(Gly4Ser)n SGGGGS 20 Spacer NNESASPASK Peptide 21 Spacer GGKAGKKAPK Peptide 22 Spacer ATPPTPTPPK Peptide 23 Spacer EPPSLTSTPLN Peptide 24 Spacer GGKPGKKAP Peptide 25 Spacer AGRGDKK Peptide 26 Spacer PPTPPSPPTRP Peptide 27 Cleavable EEKKN linker peptide 28 Cleavable X.sub.1X.sub.2X.sub.3X.sub.4X. linker sub.5 where X.sub.1 is E (glu) or peptide D (asp), X.sub.2 is E (glu) or D (asp), X.sub.3 is K (lys) or R (arg), X.sub.4 is K (lys) or R (arg) and X.sub.5 is N (asn) or Q (gln) 29 MtDef4 RGFRRR gamma core loop 30 KEX2 Lys84-Arg85-Glu86-Ala87- cleavage Glu88-Ala 89 (KREAEA) site 31 OeDef1b GACLKNHEINKHYGC gamma core 32 Wild Type GHCRGFRRRC MtDef4 gamma core (H33) 33 OeDef1 KPCXKLXKGWXGLCAPHKC X4 = T or F; X7 = S or F; consensus SXYCDOCEGXYXGXCLKNXX X11 = R or H; X21 = S or N; XKXYGCYCYYRXCY X25 = H or Y; X26 = H or Y; X29 = A or Y; X31 = H or Y; X33 = A or I; X38 = R or H; X39 = H or R; X40 = S or N; X42 = H or R; X51 = H or R; 34 Canonical GXCX3-9C (where X is any Gamma amino acid) Core consensus 35 Deletion GACLKNRHSKHYGCYCYYR variant 1; HCY Gamma core + C- terminal 8 AA 36 Deletion HKCSSYCIHHEGAYHGACLK variant 2; C- NRHSKHYGCYCYYRHCY terminal 37 AA 37 OeDef1 GXCLKNXXXKXYGC X2 = A or I; X7 = R or H; gamma core X8 = H or R; X9 = S or N; consensus X11 = H or R 38 OeDef1- HHEGAYHGACLKNRHSKHY C31 GCYCYYRHCY deletion variant 3; C- terminal 31 AA 39 OeDef1_V5 KPCTKLSKGWRGLCAPHKCS OeDef1/Dahlia DmAMP1 SYCIHHEGAYHGACHVRNG defensin gamma core (bold, KHMCYCYYRHCY underlined) substitution 40 OeDef1a CTCGAGAAAAGAAAGCCAT synthetic GTACTAAGTTGTCTAAGGGT gene TGGAGAGGATTGTGCGCCCC ACATAAGTGTTCATCATATT GTATTCATCACGAAGGAGC ATACCATGGTGCTTGCTTGA AAAACAGACACTCCAAACA CTACGGATGCTATTGCTATT ACAGACATTGCTACTAGTAA TCTAGA 41 OeDef1_V1 CTCGAGAAAAGAGCTAAGC synthetic CATGTACTAAGTTGTCTAAA gene GGTTGGAGAGGTTTGTGTGC TCCTCATAAGTGTTCTTCTT ACTGTATCCATCACGAAGGT GCTTATCACGGTAGATGTAG AGGTTTTAGAAGAAGATGTT ACTGTTACTACAGACATTGT TATTAGTAATCTAGA 42 OeDef_V5 CTCGAGAAAAGAGCTAAGC synthetic CATGTACTAAGTTGTCTAAA gene GGTTGGAGAGGTTTGTGTGC TCCTCATAAGTGTTCTTCTT ACTGTATCCATCACGAAGGT GCTTATCATGGTGCTTGTCA CGTTAGAAACGGTAAACAT ATGTGTTACTGTTACTACAG ACACTGTTATTAGTAATCTA GA 43 OeDef1_V7 KPCTKLSKGWRGLCAPHKCS Variant gamma core with SYCIHHEGAYHGACLKNAAA substitution of alanine KHYGCYCYYRHCY residues (double underlined) 44 OeDef1_V8 KPCTKLSKGWRGLCAPHKCS Variant gamma core SYCIHHEGAYHGACLKNRHS (underlined) with AAAACYCYYRHCY substitution of alanine residues (double underlined) 45 Primer TCGAATCTTTGAACGCACAT TGCGC 46 Primer TGGCAGAAGCACACCGAGA ACCTG 47 MtDef6 RVCESQSHKFKGPCARNHNC 36% hydrophobic AA, +9 ALVCQTERFSGGRCRGFRRR Net charge CFCTRP 48 MtDef6_v1 RVCESQCSHKFKGPCARNHN additional disulfide bond, CALVCCQTERFSGGRCRGFR 38% hydrophobic AA, +9 RRCFCTRPC Net charge 49 MtDef6_v2 RVCQSQSHKFKGPCARNHNC 38% hydrophobic AA, +10 ALVCQTERFSGGRCRGFRRR Net charge CFCTRPC 50 MtDef6_V3 RVCESQSHKFKGPCARRHNC 38% hydrophobic AA, +10 ALVCQTERFSGGRCRGFRRR Net charge CFCTRPC 51 MtDef6 GRCRGFRRRC gamma core 52 MtDef6 AGAGTCTGTGAATCTGAATC encodes the mature MtDef6 synthetic TCATAAGTTCAAGGGTCCAT protein of SEQ ID NO: 47; gene GTGCTAGACAACATAACTGT contains two stop codons at GCTTTGGTTTGTCAAACTGA 3' terminus GAGATTCTCTGGTGGTAGAT GTAGAGGTTTTAGAAGAAG ATGTTTCTGTACTAGACCAT GTTAGTAA 53 MtDef6 CTCGAGAAAAGAGCTAGAG For Pichia expression; n- synthetic TCTGTGAATCTGAATCTCAT terminal alanine addition gene AAGTTCAAGGGTCCATGTGC cassette TAGACAACATAACTGTGC TTTGGTTTGTCAAACTGAGA GATTCTCTGGTGGTAGATGT AGAGGTTTTAGAAGAAGAT GTTTCTGTACTAGACCATGT TAGTAATCTAGA 54 OeDef7_WT RICESLSHRFKGPCVRRGNCA 40% hydrophobic AA, +8 AVCQTEGFPGGLCRGFRRRC Net Charge FCTKHC 55 OeDef7_v1 RICESLCSHRFKGPCVRRGNC additional disulfide bond, AAVCCQTEGFPGGLCRGFRR 42% hydrophobic AA, +8 RCFCTKHC Net charge 56 OeDef7_v2 RICQSLSHRFKGPCVRRGNCA 40% hydrophobic AA, +9 (E4Q) AVCQTEGFPGGLCRGFRRRC Net Charge FCTKHC 57 OeDef7_v3 RICESLSHRFKGPCVRRGNCA 40% hydrophobic AA, +9 (G28R) AVCQTERFPGGLCRGFRRRC Net charge FCTKHC 58 OeDef7_v4 RICESLSHRFKGPCVRRGNCA 40% hydrophobic AA, +9 (L33R) AVCQTEGFPGGRCRGFRRRC Net charge FCTKHC 59 OeDef7 GLCRGFRRRC gamma core 60 OeDef7 AGAATCTGTGAATCTTTGTC Synthetic gene encoding the synthetic TCATAGATTCAAGGGTCCAT mature OeDef7 protein gene GTGTTAGACGTGGTAACTGT GCTGCTGTTTGTCAAACTGA GGGTTTCCCTGGTGGTTTGT GTAGAGGTTTTAGAAGAAG ATGTTTCTGTACTAAGCACT GTTAGTAATCTAGA 61 OeDef7 CTCGAGAAAAGAGCTAGAA Alanine insertion at n- gene TCTGTGAATCTTTGTCTCAT terminus for Pichia cassette AGATTCAAGGGTCCATGTGT expression TAGACGTGGTAACTGTGCCT GCTGTTTGTCAAACTGAGGG TTTCCCTGGTGGTTTGTGTA GAGGTTTTAGAAGAAGATG TTTCTGTACTAAGCACTGTT AGTAATCTAGA 62 OeDef1_V6 KPCTKLSKGWRGLCAPHKCS Variant gamma core SYCIHHEGAYHGACAAARHS (underlined) with KHYGCYCYYRHCY substitution of alanine residues (double underlined) 63 MtDef4 RTCESQSHKFKGPCASDHNC H33R ASVCQTERFSGGRCRGFRRR variant CFCTTHC

    Example 6

    Expression of OeDef7 and MtDef6 in Pichia pastoris

    [0190] For expression of MtDef6-type and OeDef7-type peptides in Pichia pastoris, synthetic gene cassettes of SEQ ID NO: 53 and SEQ ID NO: 61 which respectively encode an MtDef6 variant and an OeDef7 variant were obtained from Genscript (Piscataway, N.J., USA) and were cloned in the pPICZαA vector in frame with the a-factor secretion signal sequence without the Glu-Ala repeats at the Kex2 signal cleavage site. An alanine codon was added at N-terminus of each mature MtDef6 and mature OeDef7 peptide coding region to obtain correct cleavage of the variant MtDef6 and variant OeDef7 peptides in P. pastoris. The mature variant MtDef6 and variant OeDef7 peptides secreted into the growth medium of the transformed P. pastoris liquid cultures were purified to homogeneity by ion exchange chromatography and reverse phase HPLC using published protocols (Ramamoorthy, et al., 2007). Molecular mass of each variant MtDef6 and variant OeDef7 peptide comprising an n-terminal alanine was confirmed by mass spectroscopy.

    [0191] Example 7. Determination of OeDef7 and MtDef6 antifungal activity

    [0192] The antifungal activity of MtDef6—type OeDef7-type variant peptides encoded by SEQ ID NO: 53 and SEQ ID NO: 61 was determined against plant fungal pathogens Botrytis cinerea and Fusarium graminearum was determined in the synthetic fungal growth medium (SFM) or SFM supplemented with 100 mM KCl. The SFM comprised K.sub.2HPO.sub.4 (2.5 mM), MgSO.sub.4 (50 μM), CaCl.sub.2 (50 μM), FeSO.sub.4 (5 μM), CoCl.sub.2 (0.1 μM), CuSO.sub.4 ((0.1 μM), Na.sub.2MoO.sub.4 (2 μM), H.sub.3BO.sub.3 (0.5 μM), KI (0.1 μM), ZnSO.sub.4 (0.5 μM), MnSO.sub.4 (0.1 μM), glucose (10 g/liter), asparagine (1 g/liter), methionine (20 mg/liter), myo-inositol (2 mg/liter), biotin (0.2 mg/liter), thiamine-HCL (1 mg/liter), pyridoxine-HCL (0.2 mg/liter), pH 7.0. The in vitro antimicrobial activity of these peptides was determined spectrophotometrically as described in previous publications (Sagaram et al. 2013: Islam et al. 2017). The IC.sub.50 (concentration for 50% inhibition) value for each peptide is shown in Table 1 below. The MLC (minimal lethal concentration) value was determined by the resazurin cell viability assay. Briefly, after incubation of the pathogen/peptide mixture for 48 h, 10 μl of 0.1% resazurin solution was added to each well and re-incubated for overnight. A change in the color of the resazurin dye from blue to pink or colorless indicated the presence of live fungal cells. If the pathogen/peptide culture remained blue, fungal cells were dead. The concentration of the peptide at which fungal cells were dead was the MLC value shown in Table 6.

    TABLE-US-00007 TABLE 6 In vitro antifungal activity of MtDef6 and OeDef7 in synthetic fungal growth medium (SFM) and SFM supplemented with 100 mM KCl. MtDef6 OeDef7 MtDef6 (SFM + 100 OeDef7 (SFM + 100 (SFM) mM KCl) (SFM) mM KCl) IC.sub.50 MLC IC.sub.50 MLC IC.sub.50 MLC IC.sub.50 MLC Pathogen (μM) (μM) (μM) (μM) (μM) (μM) (μM) (μM) Botrytis cinerea   1-1.5 3 2-3 6 2-3.sup.  4 3-4 6 Fusarium graminearum 0.75-1 2 1-2 4 1-1.5 3 2-3 6 IC.sub.50 values are means of three biological replicates. The MLC values were determined by the resazurin cell viability assay performed three times.

    [0193] The breadth and scope of the present disclosure should not be limited by any of the above-described examples.

    Embodiments

    [0194] The following numbered embodiments form part of the disclosure: [0195] 1. A recombinant polynucleotide comprising a polynucleotide encoding a first antimicrobial peptide comprising: (i) an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 38; (ii) an amino acid sequence of SEQ ID NO: 33 or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; (iii) an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:47; or (iv) an amino acid sequence having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 54; wherein the first antimicrobial peptide comprises a defensin gamma core peptide, and wherein the polynucleotide encoding the first antimicrobial peptide is operably linked to a polynucleotide comprising a promoter which is heterologous to the polynucleotide encoding the first antimicrobial peptide.

    [0196] 2. The recombinant polynucleotide of embodiment 1, wherein the first antimicrobial peptide comprises:

    [0197] (a) an amino acid sequence of (i) comprising any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO:44, or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively;

    [0198] (b) an amino acid sequence of (ii) comprising any one of SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; or

    [0199] (c) an amino acid sequence of (ii) comprising any one of SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively. [0200] 3. The recombinant polynucleotide of embodiment 1 or 2, wherein the defensin gamma core peptide comprises the amino acid sequence of any one of SEQ ID NO: 3, 4, 31, 32, 34, 37, 51, or 59. [0201] 4. The recombinant polynucleotide of any one of embodiments 1 to 3, wherein the first antimicrobial peptide contains: [0202] (i) at least seven of the basic amino acid residues set forth in SEQ ID NO: 1, 47, or 54; [0203] (ii) at least one substitution of a hydrophobic amino acid residue of SEQ ID NO: 1, 33, 35, 36, 38, 39, 44, 47, or 54 with another hydrophobic amino acid residue; [0204] (iii) at least one substitution of a basic amino acid residue of SEQ ID NO: 1, 33, 35, 36, 38, 39, 44, 47, or 54 with another basic amino acid residue; [0205] (iv) at least one substitution of an acidic amino acid residue of SEQ ID NO: 1, 33, 35, 36, 38, 39, 44, 47, or 54 with another acidic amino acid residue or with a basic amino acid residue; or [0206] (v) any combination of (i), (ii),(iii), and (iv). [0207] 5. The recombinant polynucleotide of any one of embodiments 1 to 4, wherein the first antimicrobial peptide contains 4, 5, 6, 7, 8, 9, 10, or 11 to 12, 13, 14, or 15 basic amino acid residues. [0208] 6. The recombinant polynucleotide of any one of embodiments 1 to 5, wherein the recombinant polynucleotide further comprises a polynucleotide encoding: [0209] (i) a transit peptide, a vacuolar targeting peptide, and/or an endoplasmic reticulum targeting peptide; [0210] (ii) a plastid targeting peptide; and/or [0211] (iii) a polyadenylation or transcriptional termination signal,

    [0212] wherein the polynucleotides of (i), (ii), and/or (iii) are operably linked to the polynucleotide encoding the first antimicrobial peptide. [0213] 7. The recombinant polynucleotide of any one of embodiments 1 to 6, wherein the promoter provides for expression of the first antimicrobial peptide in a plant, yeast, bacterial, or mammalian cell when the polynucleotide is located in the plant, yeast, bacterial, or mammalian cell. [0214] 8. The recombinant polynucleotide of any one of embodiments 1 to 7, wherein the polynucleotide encoding the first antimicrobial peptide is inserted into a heterologous nuclear or plastid genome of a cell and operably linked to an endogenous promoter located in the heterologous nuclear or plastid genome. [0215] 9. The recombinant polynucleotide of embodiment 8, wherein the heterologous nuclear or plastid genome is a monocot crop plant or a dicot crop plant nuclear or plastid genome. [0216] 10. The recombinant polynucleotide of embodiment 9, wherein said dicot crop plant nuclear or plastid genome is not a chickpea plant nuclear or plastid genome. [0217] 11. The recombinant polynucleotide of embodiment 9, wherein the monocot crop plant nuclear or plastid genome is selected from the group consisting of a corn, barley, oat, pearl millet, rice, sorghum, sugarcane, turf grass, and wheat plant nuclear or plastid genome. [0218] 12. The recombinant polynucleotide of embodiment 9, wherein the dicot crop plant nuclear or plastid genome is selected from the group consisting of alfalfa, a Brassica sp., cotton, potato, sugar beet, and soybean nuclear or plastid genome. [0219] 13. The recombinant polynucleotide of embodiment 9, wherein the dicot crop plant nuclear or plastid genome is selected from the group consisting of an apple, cucurbit, strawberry, and tomato nuclear or plastid genome. [0220] 14. The recombinant polypeptide of any one of embodiments 1 to 13, wherein the polynucleotide encoding the first antimicrobial peptide further comprises a polynucleotide encoding a second antimicrobial peptide;

    [0221] optionally wherein the second antimicrobial peptide is a defensin;

    [0222] and optionally wherein the defensin comprises and antimicrobial peptide having at least 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 47, SEQ ID NO: 54, or SEQ ID NO: 63. [0223] 15. The recombinant polynucleotide of embodiment 14, wherein the first antimicrobial peptide and/or the second antimicrobial peptide comprise: (i) an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 38; (ii) an amino acid sequence of SEQ ID NO: 33 or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; (iii) an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:47; or (iv) an amino acid sequence having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 54; wherein both the first antimicrobial peptide and the second antimicrobial peptide comprise a defensin gamma core peptide; optionally

    [0224] wherein said second antimicrobial peptide has an amino acid sequence that is identical to said first antimicrobial peptide, or

    [0225] wherein said second antimicrobial peptide has an amino acid sequence that is not identical to said first antimicrobial peptide. [0226] 16. The recombinant polynucleotide of embodiment 14 or 15, wherein the polynucleotides encoding the first antimicrobial peptide and second antimicrobial peptide are operably linked to each other by a polynucleotide encoding a spacer peptide. [0227] 17. The recombinant polynucleotide of embodiment 16, wherein the spacer peptide comprises the amino acid sequence of any one of SEQ ID NO: 9 or 18-28, or a variant of any one of the amino acids sequences of SEQ ID NO: 9 or 18-28, having 1, 2, or 3 conservative and/or semi-conservative amino acid substitutions. [0228] 18. An edited polynucleotide comprising a variant polynucleotide encoding a first antimicrobial peptide comprising: (i) an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 38; (ii) an amino acid sequence of SEQ ID NO: 33 or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; (iii) an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:47; or (iv) an amino acid sequence having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 54; wherein the first antimicrobial peptide comprises a defensin gamma core peptide, wherein the variant polynucleotide is operably linked to a polynucleotide comprising a promoter, wherein the variant polynucleotide sequence comprises at least one nucleotide insertion, deletion, and/or substitution in comparison to the corresponding wild type polynucleotide sequence, and wherein the corresponding unedited wild type polynucleotide sequence does not encode the antimicrobial peptide comprising the amino acid sequence of SEQ ID NO: 1 or 54. [0229] 19. A plant nuclear or plastid genome comprising a polynucleotide encoding a first antimicrobial peptide comprising: (i) an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 38; (ii) an amino acid sequence of SEQ ID NO: 33 or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; (iii) an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:47; or (iv) an amino acid sequence having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 54; wherein the first antimicrobial peptide comprises a defensin gamma core peptide, and wherein the polynucleotide is heterologous to the nuclear or plastid genome and wherein the polynucleotide is operably linked to an endogenous promoter of the nuclear or plastid genome. [0230] 20. The edited polynucleotide of embodiment 18, or nuclear or plastid genome of embodiment 19, wherein the first antimicrobial peptide comprises:

    [0231] (a) an amino acid sequence of (i) comprising any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 36,SEQ ID NO: 38; or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively;

    [0232] (b) an amino acid sequence of (ii) comprising any one of SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; or

    [0233] (c) an amino acid sequence of (ii) comprising any one of SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively. [0234] 21. The edited polynucleotide, the nuclear genome, or the plastid genome of embodiment 20, wherein the defensin gamma core peptide comprises the amino acid sequence of any one of SEQ ID NO: 3, 4, 31, 32, 34, 37, 51, or 59. [0235] 22. The edited polynucleotide or genome of any one of embodiments 18 to 21, wherein the first antimicrobial peptide contains: [0236] (i) at least seven of the basic amino acid residues set forth in SEQ ID NO: 1, 47, or 54; [0237] (ii) at least one substitution of a hydrophobic amino acid residue of SEQ ID NO: 1, 33, 35, 36, 38, 39, 44, 47, or 54 with another hydrophobic amino acid residue; [0238] (iii) at least one substitution of a basic amino acid residue of SEQ ID NO: 1, 33, 35, 36, 38, 39, 44, 47, or 54 with another basic amino acid residue; [0239] (iv) at least one substitution of an acidic amino acid residue of SEQ ID NO: 1, 33, 35, 36, 38, 39, 44, 47, or 54 with another acidic amino acid residue or with a basic amino acid residue; or [0240] (v) any combination of (i), (ii),(iii), and (iv). [0241] 23. The edited polynucleotide or genome of embodiment 22, wherein the first antimicrobial peptide contains 4, 5, 6, 7, 8, 9, 10, or 11 to 12, 13, 14, or 15 basic amino acid residues. [0242] 24. The edited polynucleotide or genome of any one of embodiments 18 to 23, further comprising a polynucleotide encoding: [0243] (i) a transit peptide, a vacuolar targeting peptide, and/or an endoplasmic reticulum targeting peptide; [0244] (ii) a plastid targeting peptide; and/or [0245] (iii) a polyadenylation or transcriptional termination signal,

    [0246] wherein the polynucleotide or sequences encoding (i), (ii), and/or (iii) are operably linked to the polynucleotide encoding the first antimicrobial peptide. [0247] 25. The edited polynucleotide or genome of any one of embodiments 18 to 24, wherein the polynucleotide comprising the promoter contains at least one nucleotide insertion, deletion, and/or substitution in comparison to the corresponding wild type polynucleotide sequence. [0248] 26. The edited polynucleotide of any one of embodiments 18 to 25, wherein the polynucleotide encoding the first antimicrobial peptide is integrated into the nuclear or plastid genome of a cell. [0249] 27. The edited polynucleotide or genome of any one of embodiments 18 to 26, wherein the nuclear or plastid genome is a monocot crop plant or a dicot crop plant nuclear or plastid genome. [0250] 28. The edited polynucleotide or genome of embodiment 27, wherein said dicot crop plant nuclear or plastid genome is not a chickpea plant nuclear genome. [0251] 29. The edited polynucleotide or genome of embodiment 27, wherein the monocot crop plant nuclear or plastid genome is selected from the group consisting of a corn, barley, oat, pearl millet, rice, sorghum, sugarcane, turf grass, and wheat plant nuclear or plastid genome. [0252] 30. The edited polynucleotide or genome of embodiment 27, wherein the dicot crop plant nuclear or plastid genome is selected from the group consisting of alfalfa, a Brassica sp., cotton, potato, sugar beet, and soybean nuclear or plastid genome. [0253] 31. The edited polynucleotide or genome of embodiment 27, wherein the dicot crop plant nuclear or plastid genome is selected from the group consisting of an apple, cucurbit, strawberry, and tomato nuclear or plastid genome. [0254] 32. The edited polynucleotide or genome of any one of embodiments 18 to 31, wherein the polynucleotide encoding the first antimicrobial peptide further comprises a polynucleotide encoding a second antimicrobial peptide;

    [0255] optionally wherein the second antimicrobial peptide is a defensin;

    [0256] and optionally wherein the defensin comprises an antimicrobial peptide having at least 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 10, SEQ ID NO :11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 47, SEQ ID NO: 54, or SEQ ID NO: 63. [0257] 33. The edited polynucleotide or genome of embodiment 32, wherein the first antimicrobial peptide and/or the second antimicrobial peptide comprise: (i) an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 38; (ii) an amino acid sequence of SEQ ID NO: 33 or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; (iii) an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:47; or (iv) an amino acid sequence having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 54; wherein both the first antimicrobial peptide and the second antimicrobial peptide comprise a defensin gamma core peptide; optionally

    [0258] wherein said second antimicrobial peptide has an amino acid sequence that is identical to said first antimicrobial peptide, or

    [0259] wherein said second antimicrobial peptide has an amino acid sequence that is not identical to said first antimicrobial peptide. [0260] 34. The edited polynucleotide or genome of embodiment 32, wherein the polynucleotides encoding the first antimicrobial peptide and second antimicrobial peptide are operably linked to each other by a polynucleotide encoding a spacer peptide. [0261] 35. The edited polynucleotide or genome of embodiment 34, wherein the spacer peptide comprises the amino acid sequence of any one of SEQ ID NO: 9 or 18-28, or a variant of any one of the amino acids sequences of SEQ ID NO: 9 or 18-28, having 1, 2, or 3 conservative and/or semi-conservative amino acid substitutions. [0262] 36. A cell comprising the recombinant polynucleotide of any one of embodiments 1 to 17 or the edited polynucleotide or genome of any one of embodiments 18 to 35. [0263] 37. The cell of embodiment 36, wherein the cell is a plant, yeast, bacterial, or mammalian cell. [0264] 38. The cell of embodiment 37, wherein the cell is a plant cell that is non-regenerable. [0265] 39. A plant comprising the recombinant polynucleotide of any one of embodiments 1 to 17 or the edited polynucleotide or genome of any one of embodiments 18 to 35. [0266] 40. The plant of embodiment 39, wherein said plant or any part thereof contains a plant pathogenic microbe inhibitory concentration of the antimicrobial peptide. [0267] 41. The plant of embodiment 40, wherein the plant pathogenic microbe inhibitory concentration of the antimicrobial peptide is at least 0.005, 0.05, 0.5, or 1 parts per million (PPM) in a tissue or part of the plant. [0268] 42. The plant of embodiment 39, wherein the recombinant polynucleotide, edited polynucleotide, or genome confers to the plant resistance to infection by a plant pathogenic microbe in comparison to a control plant that lacks the recombinant polynucleotide, edited polynucleotide, or genome. [0269] 43. The plant of embodiment 42, wherein the plant pathogenic microbe is a Fusarium sp., Alternaria sp., Verticillium sp., Phytophthora sp., Colletotrichum sp., Botrytis sp., Cercospora sp., Phakopsora sp. Rhizoctonia sp., Sclerotinia sp., Pythium sp., Phoma sp., Leptosphaeria sp., Gaeumannomyces sp., or Puccinia sp. [0270] 44. The plant of embodiment 39, wherein the plant is a monocot crop plant or a dicot crop plant. [0271] 45. The plant of embodiment 44, wherein said dicot crop plant is not a chickpea plant. [0272] 46. The plant of embodiment 44, wherein the monocot crop plant is selected from the group consisting of a corn, barley, oat, pearl millet, rice, sorghum, sugarcane, turf grass, and wheat. [0273] 47. The plant of embodiment 44, wherein the dicot crop plant is selected from the group consisting of alfalfa, a Brassica sp., cotton, cucurbit, potato, strawberry, sugar beet, soybean, and tomato. [0274] 48. A plant part of the plant of embodiment 39, where the plant part comprises the recombinant polynucleotide, edited polynucleotide, or genome. [0275] 49. The plant part of embodiment 48, wherein the plant part is a seed, stem, leaf, root, tuber, flower, or fruit. [0276] 50. A processed plant product of the plant part of embodiment 48, wherein the processed plant product comprises the recombinant polynucleotide, the edited polynucleotide, or a fragment of the recombinant polynucleotide or the edited polynucleotide. [0277] 51. The processed plant product of embodiment 50, wherein the product is non-regenerable. [0278] 52. The processed plant product of embodiment 50, wherein the product is a meal or flour. [0279] 53. The processed plant product of embodiment 50, wherein the fragment comprises a recombinant polynucleotide encoding a junction of the polynucleotide encoding the first antimicrobial peptide with the polynucleotide comprising the promoter which is heterologous to the polynucleotide encoding the first antimicrobial peptide. [0280] 54. The processed plant product of embodiment 50, wherein the fragment comprises an edited polynucleotide which is heterologous to the genome of the plant from which the product was obtained. [0281] 55. The processed plant product of embodiment 50, wherein the processed plant product is characterized by having reduced levels of microbial toxins in comparison to processed plant products obtained from corresponding control plant crops. [0282] 56. A method for obtaining a plant comprising the recombinant polynucleotide of any one of embodiments 1 to 17 or plant nuclear or plastid genome of embodiments 18 to 35 that is resistant to infection by a plant pathogenic microbe, comprising the steps of: (i) introducing the recombinant polynucleotide, the polynucleotide encoding the first antimicrobial peptide, the polynucleotide comprising the promoter, a fragment of said polynucleotides, or a combination of said polynucleotides, into a plant cell, tissue, plant part, or whole plant; (ii) obtaining a plant cell, tissue, part, or whole plant wherein the recombinant polynucleotide, the polynucleotide encoding the first antimicrobial peptide, the polynucleotide comprising the promoter, a fragment of said polynucleotides, or a combination of said polynucleotides has integrated into the plant nuclear or plastid genome; and (iii) selecting a plant obtained from the plant cell, tissue, part or whole plant of step (ii) for expression of a plant pathogenic microbe inhibitory amount of the first antimicrobial peptide, thereby obtaining a plant that is resistant to infection by a plant pathogenic microbe. [0283] 57. The method of embodiment 56, wherein the recombinant polynucleotide is introduced into the plant cell, tissue, part, or whole plant by Agrobacterium-, electroporation-, transfection-, or particle-mediated transformation. [0284] 58. The method of embodiment 56, wherein the recombinant polynucleotide, the polynucleotide encoding the first antimicrobial peptide, the polynucleotide comprising the promoter, a fragment of said polynucleotides, or a combination of said polynucleotides is introduced in step (i) with: (a) a clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas)-guide RNA or source thereof and a Cas endonuclease or source thereof, wherein the guide RNA and Cas endonuclease can form a complex that can introduce a double strand break at a target site in a nuclear genome of the plant cell, tissue, part, or whole plant; and (b) a template polynucleotide comprising the recombinant polynucleotide, the polynucleotide encoding the first antimicrobial peptide, the polynucleotide comprising the promoter, a fragment of said polynucleotides, or a combination of said polynucleotides. [0285] 59. The method of embodiment 58, wherein said template comprises sequences at its 5′ and 3′ terminus with sequence identity to sequences on both sides of the double strand break that permit integration of the template by homologous recombination. [0286] 60. The method of embodiment 56, wherein the recombinant polynucleotide is introduced in step (i) with: (a) an endonuclease or an endonuclease and a guide RNA, wherein the endonuclease or the endonuclease and guide RNA can form a complex that can introduce a double strand break at a target site in a nuclear genome of the plant cell, tissue, part, or whole plant; and (b) a template polynucleotide comprising the recombinant polynucleotide, the polynucleotide encoding the first antimicrobial peptide, the polynucleotide comprising the promoter, a fragment of said polynucleotides, or a combination of said polynucleotides. [0287] 61. A method for obtaining a plant comprising the edited polynucleotide or genome of any one of embodiments 18 to 35 that is resistant to infection by a plant pathogenic microbe comprising the steps of: (i) providing: (a) a template polynucleotide comprising the polynucleotide encoding the first antimicrobial peptide; and (b) an endonuclease or an endonuclease and a guide RNA to a plant cell, tissue, part, or whole plant, wherein the endonuclease or guide RNA and endonuclease can form a complex that can introduce a double strand break at a target site in a nuclear or plastid genome of the plant cell, tissue, part, or whole plant; (ii) obtaining a plant cell, tissue, part, or whole plant wherein at least one nucleotide insertion, deletion, and/or substitution has been introduced into the corresponding wild type polynucleotide; and (iii) selecting a plant obtained from the plant cell, tissue, part or whole plant of step (ii) comprising the edited polynucleotide for expression of a plant pathogenic microbe inhibitory amount of the first antimicrobial peptide, thereby obtaining a plant that is resistant to infection by a plant pathogenic microbe. [0288] 62. The method of embodiment 61, further comprising the step of introducing at least one nucleotide insertion, deletion, and/or substitution in the promoter that is operably linked to variant polynucleotide encoding the first antimicrobial peptide. [0289] 63. The method of embodiment 61, wherein the endonuclease is a Cas endonuclease and the guide RNA is a clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas)-guide RNA. [0290] 64. The method of embodiment 63, wherein the Cas endonuclease is a Cas9 or Cpf1 endonuclease. [0291] 65. The method of embodiment 56 to 64, wherein the polynucleotide encoding the first antimicrobial peptide further comprises a polynucleotide encoding a spacer peptide and a second antimicrobial peptide;

    [0292] optionally wherein the second antimicrobial peptide is a defensin;

    [0293] and optionally wherein the defensin comprises an antimicrobial peptide having at least 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO 1, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 47, SEQ ID NO: 54, or SEQ ID NO: 63. [0294] 66. The method of embodiment 65, wherein the first antimicrobial peptide and/or the second antimicrobial peptide comprise: (i) an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 38; (ii) an amino acid sequence of SEQ ID NO: 33 or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; (iii) an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:47; or (iv) an amino acid sequence having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 54; wherein both the first antimicrobial peptide and the second antimicrobial peptide comprise a defensin gamma core peptide; optionally

    [0295] wherein said second antimicrobial peptide has an amino acid sequence that is identical to said first antimicrobial peptide, or

    [0296] wherein said second antimicrobial peptide has an amino acid sequence that is not identical to said first antimicrobial peptide. [0297] 67. The method of embodiment 65, wherein the spacer peptide comprises the amino acid sequence of any one of SEQ ID NO: 9 or 18-28, or a variant of any one of the amino acids sequences of SEQ ID NO: 9 or 18-28, having 1, 2, or 3 conservative and/or semi-conservative amino acid substitutions. [0298] 68. A method for producing plant seed that provide plants resistant to infection by a plant pathogenic microbe that comprises the steps of: (i) selfing or crossing the plant of embodiment 40; and (ii) harvesting seed that comprises the recombinant polynucleotide of the plant from the self or cross, thereby producing plant seed that provide plants resistant to infection by a plant pathogenic microbe. [0299] 69. The method of embodiment 68, wherein the plant is used as a pollen donor in the cross and the seed are harvested from a pollen recipient. [0300] 70. A method for preventing or reducing crop damage by a plant pathogenic microbe comprising the steps of: (i) placing seeds or cuttings of the plants of embodiment 40 in a field where control plants are susceptible to infection by at least one plant pathogenic microbe; and (ii) cultivating a crop of plants from the seeds or cuttings, thereby reducing crop damage by the plant pathogenic microbe. [0301] 71. The method of embodiment 70, wherein the method further comprises the step of harvesting seed, fruit, leaves, tubers, stems, roots, or any combination thereof from the crop. [0302] 72. The method of embodiment 71, wherein said seed, fruit, leaves, tubers, stems, roots, or any combination thereof have reduced levels of microbial toxins in comparison to seed, fruit, leaves, tubers, stems, roots, or any combination thereof obtained from corresponding control plant crops. [0303] 73. A composition comprising a first antimicrobial peptide comprising: (i) an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 38; (ii) an amino acid sequence of SEQ ID NO: 33 or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; (iii) an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:47; or (iv) an amino acid sequence having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 54; wherein the first antimicrobial peptide comprises a defensin gamma core peptide, said composition further comprising an agriculturally, pharmaceutically, or veterinarily acceptable carrier, diluent, or excipient. [0304] 74. The composition of embodiment 73, wherein the first antimicrobial peptide comprises: [0305] (a) an amino acid sequence comprising any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO:44, SEQ ID NO: 47, SEQ ID NO: 54, or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; [0306] (b) any one of the amino acid sequences of (i), further comprising an N-terminal alanine residue; or [0307] (c) a chemically modified peptide comprising an amino acid sequence having: (a) at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 33, a variant of SEQ ID NO: 33 wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues respectively, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 39, or SEQ ID NO:44; [0308] (b) an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:47; or [0309] (c) an amino acid sequence having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 54; wherein said chemically modified peptide comprises at least one non-naturally occurring amino acid residue. [0310] 75. The composition of embodiment 74, wherein the defensin gamma core peptide comprises the amino acid sequence of any one of SEQ ID NO: 3, 4, 31, 32, 34, 37, 51, or 59. [0311] 76. The composition of any one of embodiments 73 to 75, wherein the first antimicrobial peptide contains: [0312] (i) at least seven of the basic amino acid residues set forth in SEQ ID NO: 1, 47, or 54; [0313] (ii) at least one substitution of a hydrophobic amino acid residue of SEQ ID NO: 1, 33, 35, 36, 38, 39, 44, 47, or 54 with another hydrophobic amino acid residue; [0314] (iii) at least one substitution of a basic amino acid residue of SEQ ID NO: 1, 33, 35, 36, 38, 39, 44, 47, or 54 with another basic amino acid residue; [0315] (iv) at least one substitution of an acidic amino acid residue of SEQ ID NO: 1, 33, 35, 36, 38, 39, 44, 47, or 54 with another acidic amino acid residue or with a basic amino acid residue; or [0316] (v) any combination of (i), (ii),(iii), and (iv). [0317] 77. The composition of embodiment 76, wherein the first antimicrobial peptide contains 4, 5, 6, 7, 8, 9, 10, or 11 to 12, 13, 14, or 15 basic amino acid residues. [0318] 78. The composition of any one of embodiments 73 to 75, further comprising a second antimicrobial peptide and/or a non-peptidic antimicrobial agent;

    [0319] optionally wherein the second antimicrobial peptide is a defensin;

    [0320] and optionally wherein the defensin comprises an antimicrobial peptide having at least 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 47, SEQ ID NO: 54, or SEQ ID NO: 63. [0321] 79. The composition of embodiment 73, wherein the first antimicrobial peptide further comprises a spacer peptide and a second antimicrobial peptide, both being operably linked to said first antimicrobial peptide; optionally

    [0322] wherein the spacer peptide comprises the amino acid sequence of any one of SEQ ID NO: 9 or 18-28, or a variant of any one of the amino acids sequences of SEQ ID NO: 9 or 18-28, having 1, 2, or 3 conservative and/or semi-conservative amino acid substitutions. [0323] 80. The composition of embodiment 79, wherein the first antimicrobial peptide and/or the second antimicrobial peptide comprise: (i) an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, SEQ ID NO: 35, SEQ ID NO: 36, or SEQ ID NO: 38; (ii) an amino acid sequence of SEQ ID NO: 33 or a variant thereof wherein one or more of the hydrophobic, basic, and/or acidic amino acid residues are substituted with hydrophobic, basic, and/or acidic amino acid residues, respectively; (iii) an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:47; or (iv) an amino acid sequence having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 54; wherein both the first antimicrobial peptide and the second antimicrobial peptide comprise a defensin gamma core peptide; optionally

    [0324] wherein said second antimicrobial peptide has an amino acid sequence that is identical to said first antimicrobial peptide, or

    [0325] wherein said second antimicrobial peptide has an amino acid sequence that is not identical to said first antimicrobial peptide. [0326] 81. The composition of embodiment 79, wherein the first antimicrobial peptide or the second antimicrobial peptide comprises a defensin. [0327] 82. The composition of embodiment 81, wherein the defensin comprises: [0328] (i) a peptide having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% amino acid sequence identity across the entire length of any one of SEQ ID NO: 1, 10, 11, 12, 13, 14, 15, 16, or 17; a peptide having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% amino acid sequence identity to SEQ ID NO:47; or a peptide having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% amino acid sequence identity to SEQ ID NO: 54; [0329] (ii) any one of the peptides of (i), further comprising an N-terminal alanine residue; or [0330] (iii) a chemically modified peptide comprising an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity across the entire length of SEQ ID NO: 1, 10, 11, 12, 13, 14, 15, 16, or 17, (b) an amino acid sequence having at least 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:47; or (c) an amino acid sequence having at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 54; wherein said chemically modified peptide comprises at least one non-naturally occurring amino acid residue. [0331] 83. The composition of any one of embodiments 73 to 82, wherein the first antimicrobial peptide and/or the second antimicrobial peptide is/are provided at a concentration of about 0.1, 0.5, 1.0, or 5 μg/m1 to about 1, 5, 20, 50, or 100 mg/ml for a liquid composition or at a concentration of about 0.1, 0.5, 1.0, or 5 μg/gram to about 1, 5, 20, 50, or 100 mg/gram for a powder or solid composition. [0332] 84. A method for preventing or reducing crop damage by a plant pathogenic microbe comprising the step of contacting a plant, a plant seed, or other part of said plant with an effective amount of the composition of any one of embodiments 73 to 83. [0333] 85. The method of embodiment 84, wherein the plant pathogenic microbe is a Fusarium sp., Alternaria sp., Verticillium sp., Phytophthora sp., Colletotrichum sp., Botrytis sp., Cercospora sp., Phakopsora sp. Rhizoctonia sp., Sclerotinia sp., Pythium sp., Phoma sp., Leptosphaeria sp., Gaeumannomyces sp., or Puccinia sp. [0334] 86. A medical device comprising the device and the composition of any one of embodiments 73 to 83, wherein the device comprises at least one surface that is topically coated and/or impregnated with the composition. [0335] 87. The medical device of embodiment 86, wherein said device is a stent, a catheter, a contact lens, a condom, a patch, or a diaphragm. [0336] 88. A method for treating, preventing, or inhibiting a microbial infection in a subject in need thereof comprising administering to said subject an effective amount of the composition of any one of embodiments 73 to 83. [0337] 89. The method of embodiment 88, wherein said administration comprises topical, enteral, parenteral, and/or intravenous introduction of the composition. [0338] 90. The method of embodiment 89, wherein the subject is a human, livestock, poultry, fish, or a companion animal. [0339] 91. The method of embodiment 90, wherein the microbial infection is of a mucosal membrane, eye, skin, and/or a nail and the composition is applied to the mucosal membrane, eye, skin, and/or nail. [0340] 92. The method of embodiment 91, wherein the microbial infection is by a dermatophyte. [0341] 93. The method of embodiment 92, wherein the dermatophyte is selected from the group consisting of Trichophyton rubrum, Trichophyton interdigitale, Trichophyton violaceum, Trichophyton tonsurans, Trichophyton soudanense, Trichophyton mentagrophytes, Microsporum flavum, Epidermophyton floccosum, and Microsporum gypseum. [0342] 94. The method of embodiment 91, wherein the microbial infection is by an Aspergillus, Cryptococcus, Penicillium, Rhizopus, Apophysomyces, Cunninghamella, Saksenaea, Rhizomucor, Syncephalostrum, Cokeromyces, Actinomucor, Pythium, Fusarium, Histoplasmosis, or Blastomyces species. [0343] 95. The method of any one of embodiments 88 to 91, wherein the microbial infection is by a Candida species. [0344] 96. The method of embodiment 95, wherein the Candida species is Candida albicans, C. glabrata, C parasilosis, C. tropicalis, or C. krusei. [0345] 97. The composition of any one of embodiments 73 to 83 for use in a method of treating, preventing, or inhibiting microbial infection in a subject in need thereof. [0346] 98. The composition of embodiment 97, wherein the subject is a human, livestock, poultry, fish, or a companion animal. [0347] 99. The composition of embodiment 98, wherein the microbial infection is of a mucosal membrane, eye, skin, or a nail and the composition is applied to the mucosal membrane, eye, skin, or nail. [0348] 100. The composition of embodiment 99, wherein the microbial infection is by a dermatophyte. [0349] 101. The composition of embodiment 100, wherein the dermatophyte is selected from the group consisting of Trichophyton rubrum, Trichophyton interdigitale, Trichophyton violaceum, Trichophyton tonsurans, Trichophyton soudanense, Trichophyton mentagrophytes, Microsporum flavum, Epidermophyton floccosum, and Microsporum gypseum. [0350] 102. The composition of embodiment 99, wherein the microbial infection is by an Aspergillus, Cryptococcus, Penicillium, Rhizopus, Apophysomyces, Cunninghamella, Saksenaea, Rhizomucor, Syncephalostrum, Cokeromyces, Actinomucor, Pythium, Fusarium, Histoplasmosis, or Blastomyces species. [0351] 103. The composition of any one of embodiments 97 to 99, wherein the microbial infection is by a Candida species. [0352] 104. The composition of embodiment 103, wherein the Candida species is Candida albicans, C. glabrata, C parasilosis, C. tropicalis, or C. krusei.

    Publications Cited

    [0353] Argos, (1990) J Mol Biol. February 20; 211(4):943-58. [0354] Baron, O. L. and Pauron, D. (2014). Bio-protocol 4(18): e1237. [0355] Broadley, M. R., Bowen, H. C., Cotterill, H. L., Hammond, J. P., Meacham, M. C., Mead, A., and White, P. J. (2003). Journal of Experimental Botany 54, 1431-1446 [0356] Broekaert, W. F., et al., (1990). FEMS Microbiology Letters 69, 55-60. [0357] Broekaert, W. F., et al., (1995). Plant Physiol 108, 1353-1358. [0358] Broekaert, W. F., et al., (1997). Critical Reviews in Plant Sciences 16, 297-323. [0359] Broothaerts W, et al., (2005) Nature. 433(7026):629-33. [0360] Bustin, S.A. (2002) Journal of Molecular Endocrinology 29, 23-39. [0361] Callis, J, Fromm, M, Walbot, V. (1987) Genes Dev. 1987 December; 1(10): 1 183-200. [0362] Cappelini, R. A., and Peterson, J. L. (1965) Mycologia 57, 962-966. [0363] Carrie and Small (2013) Biochimica et Biophysica Acta (BBA) Molecular Cell Research, 1833, (2), 253-259. [0364] Cazzonnelli, C. I. and J. Velten. (2003) Plant Molecular Biology Reporter 21 : 271-280. [0365] Collier, R., et al., (2005) Plant J 43: 449-457. [0366] Chen et al., (2013) Adv Drug Deliv Rev.; 65(10): 1357-1369. [0367] Correll, J. C., et al., (1987).. Phytopathology 77, 1640-1646. [0368] da Silva Conceicao, A., and Broekaert, W. F. (1999). Plant Defensins. In Pathogenesis-related proteins in plants, S. Muthukrishnan, ed (New York: CRC Press), pp. 247-260. [0369] Davidson et al., (2006) Lipid Research, 47, 440-449. [0370] Dowler et al.; Sci STKE. 2002 Apr. 23; 2002(129):16. [0371] Doyle J J, et al., (1986). J Biol Chem. 261(20):9228-38. [0372] François et al., Plant Physiology (2002) 128: 1346-1358. [0373] Frame, B. R., et al., (2002) Plant Physiol. 129(1): 13-22. [0374] Gao, A., et al., (2000). Nature Biotechnology 18, 1307-1310. [0375] George R A, and Heringa (2002) J Protein Eng. 15(11):871-879. [0376] Grant M R, et al., (1995) Science. 269(5225):843-6. [0377] Hammond-Kosack, K. E., Urban, M., Baldwin, T., Daudi, A., Rudd, J. J., Keon, J., Lucas, J. A., Maguire, K., Kornyukhin, D., Jing, H.-C, Bass, C, and Antoniw, J. (2004). 4th International Crop Science Congress. In New directions for a diverse planet, T. Fischer, Turner, N., Angus, J., McIntyre, L., Robertson, M., Borrell, A., Lloyd, D., ed (Brisbane, Australia: The Regional Institute, Ltd, Gosford, Australia). [0378] Hanks, J. N., et al., (2005). Plant Mol Biol 58, 385-399. [0379] Horsch, R. B., et al., (1985) Science. 227: 1229-1231. [0380] Huang et al., (2009) Plant Physiology, 150(3): 1272-1285. [0381] Islam K T, Velivelli S L S, Berg R H, Oakley B, Shah D M. Sci Rep. 2017 Nov 23;7(1):16157. doi:10.1038/s41598-017-16508-w. [0382] Kerenga B K, et al. (2019) Front. Microbiol. 10:795. doi: 10.3389/fmicb.2019.00795 [0383] Kingsman SM , et al., (1985) Biotechnol Genet Eng Rev. 3:377-416. [0384] Koehler S M, and Ho, T H. (1990) Plant Cell. (8):769-83. [0385] Kumar, V. and Jain, M. (2015) J Exp Bot 66: 47-57. [0386] Lam E, and Chua N H.(1991). J Biol Chem. 1991 Sep 15;266(26): 17131-5. [0387] Lacerda et al., Frontiers in Microbio. (2014) 5(116):1-10. [0388] Lay, F. T., and Anderson, M. A. (2005) Curr Protein Pept Sci 6, 85-101. [0389] Lee et al., (2015) Plant Physiol. 169(1):471-84. [0390] Li and Teng (2013) Trends Plant Sci 18: 360-366. [0391] Liang, J., Shah, D. M., Wu, Y., Rosenberger, C. A., and Hakimi, S. M. U.S. Pat. No. 6,916,970; issued Jul. 12, 2005. [0392] Mankin, S. L, G. C. Allen, and W. F. Thompson. 1997. Plant Mol Biol Rep 15(2): 186-196. [0393] Marschner H. 1995. Mineral nutrition of higher plants, 2nd edn. London, UK: Academic Press. [0394] McElroy, D, et al., (1990) The Plant Cell, Vol. 2, 163-171. [0395] Miller and Cistola (1993) Molecular and Cellular Biochemistry, 123(1): 29-37. [0396] Mottram et al., FEBS Lett. (1989) 258(2):211-215. [0397] Murovec et al., Plant Biotechnol J. 2017 Aug; 15(8): 917-926. [0398] Ramamoorthy V, et al. Cellular Microbiology 2007 June; 9(6):1491-506. [0399] Reiser J, et al., (1990) Adv Biochem Eng Biotechnol.;43:75-102. [0400] Roy, et al. Nature Protocols, 5: 725-738 (2010). [0401] Sagaram et al., (2011) PLOS ONE 6: e18550. [0402] Sagaram et al., (2013) PLoS ONE, 8(12): e82485. [0403] Sambrook, J., and Russell, D. W. (2001). Molecular Cloning: A Laboratory Manual. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). [0404] Seong, K., et al., (2005) Phytopathology 95, 744-750. [0405] Shabala, S., and Pottosin, I. I. (2010) Signal. Commun. Plants 87-110. [0406] Sjoling and Glaser; Trend Plant Sci., 1998, 3 (4) 136-140. [0407] Sidorov, V, et al., (2006). Plant Cell Rep. 2006 Apr;25(4):320-8. (Epub 2005 Oct. 27). [0408] Svitashev et al., (2015) Plant Physiology, 169 (2): 931-945. [0409] Spelbrink, R. G., et al., (2004). Plant Physiol 135, 2055-2067. [0410] Terras, F. R., et al., (1992). J Biol Chem 267, 15301-15309. [0411] Thevissen, K., et al., (2005). Curr Drug Targets 6, 923-928. [0412] Thevissen, K., et al., (1996). J Biol Chem 271, 15018-15025 [0413] Thevissen, K., et al., (2000). Proc Natl Acad Sci U S A 97, 9531-9536. [0414] Thevissen, K., et al., (2004). J Biol Chem 279, 3900-3905. [0415] Thomma, B. P., et al., (2003). Curr Drug Targets Infect Disord 3, 1-8. [0416] Thomma, B. P. H. J. , Camrnue, B. P. A., and Thevissen, K. (2002). Planta 216, 193-202. [0417] Turner et al., 1993) Protein Eng. 6(1):101-108. [0418] Voytas, D. Annual Review of Plant Biology, Vol. 64: 327-350, 2013. [0419] Tsiatsiani et al., (2012) Physiologia Plantarum 145: 28-40. [0420] Using Antibodies: A Laboratory Manual.(1999). Ed. Harlow and Lane. Cold Spring Harbor Laboratory Press. [0421] Vasil V, et al., (1989) Plant Physiol. 1989 December; 91(4): 1575-1579. [0422] Vasivarama and Kirti (2013a) Plant Cell Tiss Organ Cult, 115:309-319. [0423] Vasivarama and Kirti (2013b) Funct Integr Genomics 13:435-443. [0424] Vriens, K., et al. Molecules 2014, 19, 12280-12303; doi:10.3390/molecules190812280. [0425] White, P., and Karley, A. (2010). Potassium. In Cell Biology of Metals and Nutrients; Hell, [0426] R., Mendel, R. R., Eds.; Springer: Berlin/Heidelberg, Germany., 199-224 [0427] Wesley SV, (2001). Plant J. 27(6):581-590. [0428] Yang, J., et al. Nature Methods, 12: 7-8 (2015). [0429] Zhang, Y. BMC Bioinformatics, 9: 40 (2008).