NANOVESICLES DERIVED FROM BACTERIA OF GENUS DEINOCOCCUS, AND USE THEREOF

Abstract

Provided are vesicles derived from bacteria of the genus Deinococcus and a use thereof. The vesicles significantly decreased in a clinical sample obtained from a patient with cancer, an inflammatory disease, and dementia, compared with a normal individual, and when the vesicles isolated from the strain were administered, the secretion of inflammation mediators caused by pathogenic vesicles such as E. coli-derived vesicles was considerably inhibited, and vesicles derived from bacteria of the genus Deinococcus significantly inhibit cranial nerve cell damage caused by stress hormones, and therefore, the vesicles derived from bacteria of the genus Deinococcus according to the presently claimed subject matter may be effectively used to develop a method of diagnosing cancer, an inflammatory disease, and/or dementia, and a composition for preventing, alleviating, or treating cancer, an inflammatory disease, and/or a cranial nerve disease.

Claims

1. A method of diagnosing one or more diseases selected from the group consisting of cancer, an inflammatory disease, Grand dementia, the method comprising the following steps: (a) extracting DNAs from vesicles isolated from samples of a normal individual and a subject; (b) performing PCR on the extracted DNA using a pair of primers prepared based on a gene sequence present in 16S rDNA to obtain each PCR product; and (c) determining a case in which a content of vesicles derived from bacteria of the genus Deinococcus is lower than that of the normal individual sample, as one or more diseases selected from the group consisting of cancer, an inflammatory disease, and dementia, through quantitative analysis of the PCR product.

2. The method of claim 1, wherein the sample in Step (a) is blood.

3. The method of claim 1, wherein the cancer is one or more selected from the group consisting of stomach cancer, lung cancer, pancreatic cancer, bile duct cancer, breast cancer, bladder cancer, liver cancer, ovarian cancer, kidney cancer, prostate cancer, colorectal cancer, head and neck cancer, and lymphoma.

4. The method of claim 1, wherein the inflammatory disease is one or more selected from the group consisting of gingivitis, periodontitis, gastritis, inflammatory enteritis, colitis, atopic dermatitis, acne, hair loss, psoriasis, rhinitis, nasal polyps, asthma, chronic obstructive pulmonary disease (COPD), degenerative arthritis, and rheumatoid arthritis.

5. A method of alleviating or treating one or more diseases selected from the group consisting of cancer, an inflammatory disease, and a cranial nerve disease, the method comprising administering to a subject in need thereof a composition comprising an effective amount of vesicles derived from bacteria of the genus Deinococcus.

6. The method of claim 5, wherein the cancer is one or more selected from the group consisting of stomach cancer, lung cancer, pancreatic cancer, bile duct cancer, breast cancer, bladder cancer, liver cancer, ovarian cancer, kidney cancer, prostate cancer, colorectal cancer, head and neck cancer, and lymphoma.

7. The method of claim 5, wherein the inflammatory disease is one or more selected from the group consisting of gingivitis, periodontitis, gastritis, inflammatory enteritis, colitis, atopic dermatitis, acne, hair loss, psoriasis, rhinitis, nasal polyps, asthma, chronic obstructive pulmonary disease (COPD), degenerative arthritis, and rheumatoid arthritis.

8. The method of claim 5, wherein the inflammatory disease is a disease mediated by interleukin-6 (IL-6) or tumor necrosis factor-α (TNF-α).

9. The method of claim 5, wherein the cranial nerve disease is one or more selected from the group consisting of depression, obsessive-compulsive disorder, schizophrenia, dementia, Alzheimer's disease, epilepsy, autism and Parkinson's disease.

10. The method of claim 5, wherein the vesicles have an average diameter of 10 to 200 nm.

11. The method of claim 5, wherein the vesicles are secreted naturally or artificially from bacteria of the genus Deinococcus.

12. The method of claim 5, wherein the vesicles derived from bacteria of the genus Deinococcus are secreted from Deinococcus radiodurans.

13. The method of claim 5, wherein the A food composition is a pharmaceutical composition, a food composition, an inhalable composition, or a cosmetic composition.

14.-24. (canceled)

Description

DESCRIPTION OF DRAWINGS

[0040] FIG. 1A is a series of photographs capturing distribution patterns of bacteria and bacteria-derived vesicles (EV) by time after the bacteria and the vesicles derived from bacteria were orally administered to mice, and FIG. 1B is a result of evaluating the in vivo distribution patterns of the bacteria and the vesicles by harvesting blood, kidneys, liver, and various organs at 12 hours after orally administering the bacteria and the vesicles.

[0041] FIG. 2 shows images of evaluating the infiltration of bacteria and bacteria-derived vesicles into intestinal mucosa epithelial cells after bacteria and bacteria-derived vesicles (EV) are injected into the mouse intestines (Lu: gut lumen; LP: gut lamina propria).

[0042] FIG. 3 is a result of comparing the distributions of vesicles derived from bacteria of the genus Deinococcus after metagenomic analysis of bacteria-derived vesicles present in the blood of stomach cancer patients and a normal individual.

[0043] FIG. 4 is a result of comparing the distributions of vesicles derived from bacteria of the genus Deinococcus after metagenomic analysis of bacteria-derived vesicles present in the blood of asthma patients and a normal individual.

[0044] FIG. 5 is a result of comparing the distributions of vesicles derived from bacteria of the genus Deinococcus after metagenomic analysis of bacteria-derived vesicles present in the blood of dementia patients and a normal individual.

[0045] FIG. 6 is a result of evaluating an effect on the secretion of inflammatory mediators (TNF-α) caused by E. coli EVs by pretreating vesicles derived from Deinococcus radiodurans before treatment of pathogenic vesicles such as E. coli EVs to evaluate anti-inflammatory effects of Deinococcus radiodurans-derived vesicles (EV: extracellular vesicle).

[0046] FIG. 7 shows the result of evaluating the influence on brain-derived neurotrophic factor (BDNF) expression by nerve cells by simultaneously treating nerve cells, which have been treated with an adrenocortical hormone (GC), which is a stress hormone, with Deinococcus radiodurans-derived vesicles to evaluate a nerve cell protective effect of the Deinococcus radiodurans-derived vesicles (EV: Deinococcus radiodurans extracellular vesicle).

BEST MODES

[0047] The present invention relates to vesicles derived from bacteria of the genus Deinococcus and a use thereof.

[0048] The inventors confirmed that a content of vesicles derived from bacteria of the genus Deinococcus are significantly reduced in samples of patients with cancer, an inflammatory disease, and dementia, compared with a normal individual, through metagenomic analysis, thereby completing the present invention based on this.

[0049] Thus, the present invention provides a method of providing information for diagnosing cancer, an inflammatory disease, or dementia, the method comprising the following steps:

[0050] (a) extracting DNAs from vesicles isolated from samples of a normal individual and a subject;

[0051] (b) performing PCR on the extracted DNA using a pair of primers prepared based on a gene sequence present in 16S rDNA to obtain each PCR product; and

[0052] (c) classifying a case in which a content of vesicles derived from bacteria of the genus Deinococcus is lower than that of the normal individual sample, as cancer, an inflammatory disease, or dementia, through quantitative analysis of the PCR product.

[0053] The term “diagnosis” as used herein refers to determination of a condition of a disease of a patient over all aspects, in a broad sense. The contents of the determination are the disease entity, the etiology, the pathogenesis, the severity, the detailed aspects of a disease, the presence and absence of complications, the prognosis, and the like. The diagnosis in the present invention means determining whether cancer, an inflammatory disease, and/or dementia occur, the level of the disease, and the like.

[0054] The term “nanovesicle” or “vesicle” as used herein refers to a structure consisting of a nano-sized membrane secreted from various bacteria. Vesicles derived from gram-negative bacteria or outer membrane vesicles (OMVs) have endotoxins (lipopolysaccharides) or glycosphingolipid, toxic protein, and bacterial DNA and RNA, and vesicles derived from gram-positive bacteria also have peptidoglycan and lipoteichoic acid which are cell wall components of bacteria in addition to proteins and nucleic acids. In the present invention, nanovesicles or vesicles are secreted naturally from bacteria of the genus Deinococcus or produced artificially, are in the form of a sphere, and have an average diameter of 10 to 200 nm.

[0055] The term “metagenome” as used herein also refers to a microbiome, and refers to a total of genomes including all viruses, bacteria, fungi, and the like in an isolated region such as soil and an animal's intestines, and is typically used as a concept of genomes explaining identification of a large number of microorganisms at one time by using a sequence analyzer in order to analyze uncultivated microorganisms. In particular, the metagenome does not refer to a genome of one species, but refers to a kind of mixed genome as a genome of all species of one environmental unit. The metagenome is, when one species is defined in the development process of omics biology, a term derived from the viewpoint of making a complete species is made by various species interacting with each other as well as one kind of functionally existing species. Technically, the metagenome is an object of a technique to identify all species in one environment and investigate interactions and metabolism by analyzing all DNAs and RNAs regardless of species using a rapid sequence analysis method.

[0056] The vesicles may be isolated from a culturing solution comprising bacteria of the genus Deinococcus by using one or more methods selected from the group consisting of centrifugation, ultra-high speed centrifugation, high pressure treatment, extrusion, sonication, cell lysis, homogenization, freezing-thawing, electroporation, mechanical decomposition, chemical treatment, filtration by a filter, gel filtration chromatography, free-flow electrophoresis, and capillary electrophoresis. Further, a process such as washing for removing impurities and concentration of obtained vesicles may be further included.

[0057] In the present invention, the sample in Step (a) is not limited, but may be blood, urine, stool, saliva or nasal mucosa, and preferably blood.

[0058] In the present invention, the primer pair in Step (b) may be primers of SEQ ID Nos. 1 and 2, but is not limited thereto.

[0059] Another aspect of the present invention provides a composition for preventing or treating one or more diseases selected from the group consisting of cancer, an inflammatory disease, and a cranial nerve disease, comprising vesicles derived from bacteria of the genus Deinococcus as an active ingredient.

[0060] In the present invention, the composition includes a pharmaceutical composition and an inhalant composition.

[0061] Further, the present invention provides a method of preventing or treating one or more diseases selected from the group consisting of cancer, an inflammatory disease, and a cranial nerve disease, the method comprising a step of administering a pharmaceutical composition comprising vesicles derived from bacteria of the genus Deinococcus as an active ingredient to a subject.

[0062] Further, the present invention provides a use of a pharmaceutical composition comprising vesicles derived from bacteria of the genus Deinococcus as an active ingredient for preventing or treating one or more diseases selected from the group consisting of cancer, an inflammatory disease, and a cranial nerve disease.

[0063] Further, the present invention provides a use of vesicles derived from bacteria of the genus Deinococcus for producing a drug used in treating one or more diseases selected from the group consisting of cancer, an inflammatory disease and a cranial nerve disease.

[0064] The term “prevention” as used herein refers to all actions that suppress cancer, an inflammatory disease and/or a cranial nerve disease, or delay the onset thereof via administration of the composition according to the present invention.

[0065] The term “treatment” as used herein refers to all actions that alleviate or beneficially change symptoms of cancer, an inflammatory disease and/or a cranial nerve disease, or the like via administration of composition according to the present invention.

[0066] The term “alleviation” used as used herein refers to all actions that at least reduce a parameter associated with a condition to be treated, for example, the degree of symptoms.

[0067] The term “subject” used herein refers to a target in need of treatment of cancer, an inflammatory disease or a cranial nerve disease, and more specifically, a mammal such as a human or a non-human primate, a mouse, a dog, a cat, a horse, a cow, and the like.

[0068] The term “administration” used herein means providing a composition of the present invention to a subject by any suitable method.

[0069] The term “cancer” used herein refers to a disease that forms a mass or tumor consisting of undifferentiated cells neglecting the order in tissue and unlimitedly proliferating, and ultimately, the generic term for a group of diseases that form a novel growth site by disrupting normal peripheral tissue or organs through infiltration and inducing metastasis from the primary lesion to any organ of a subject. In the present invention, the cancer may be one or more selected from the group consisting of stomach cancer, lung cancer, pancreatic cancer, bile duct cancer, breast cancer, bladder cancer, liver cancer, ovarian cancer, kidney cancer, prostate cancer, colorectal cancer, head and neck cancer, and lymphoma, but the present invention is not limited thereto.

[0070] The term “inflammatory disease” used herein refers to a disease caused by a chain of biological reactions occurring by a direct reaction of a humoral mediator constituting the immune system or stimulation of a local or systemic effector system, and in the present invention, the inflammatory disease may be one or more selected from the group consisting of gingivitis, periodontitis, gastritis, inflammatory enteritis, colitis, atopic dermatitis, acne, hair loss, psoriasis, rhinitis, nasal polyps, asthma, chronic obstructive pulmonary disease (COPD), degenerative arthritis, and rheumatoid arthritis, but the present invention is not limited thereto.

[0071] In the present invention, the inflammatory disease may be a disease mediated by interleukin-6 (IL-6) or tumor necrosis factor-α (TNF-α), but is not limited thereto.

[0072] The term “cranial nerve disease” used herein is a generic term for diseases caused by problems with cranial nerve cells, and in the present invention, the cranial nerve disease may be one or more selected from the group consisting of depression, obsessive-compulsive disorder, schizophrenia, dementia, Alzheimer's disease, epilepsy, autism and Parkinson's disease, but the present invention is not limited thereto.

[0073] The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier is typically used in formulation, and includes saline, sterile water, Ringer's solution, buffered saline, cyclodextrin, a dextrose solution, a maltodextrin solution, glycerol, ethanol, liposomes, and the like, but is not limited thereto, and may further include other typical additives such as an antioxidant and a buffer, if necessary. Further, the composition may be formulated into an injectable formulation, such as an aqueous solution, a suspension, and an emulsion, a pill, a capsule, a granule, or a tablet by additionally adding a diluent, a dispersant, a surfactant, a binder, a lubricant, and the like. With regard to suitable pharmaceutically acceptable carriers and formulations, the composition may be preferably formulated according to each ingredient by using the method disclosed in the Remington's literature. The pharmaceutical composition of the present invention is not particularly limited in formulation, but may be formulated into an injection, an inhalant, an external preparation for skin, an oral ingestion, or the like.

[0074] The pharmaceutical composition of the present invention may be administered orally or parenterally (e.g., intravenously, subcutaneously, intradermally) according to a desired method, and a dose may vary according to the condition and body weight of a patient, the severity of a disease, a drug formulation, an administration route, and duration, but may be suitably selected by those of ordinary skill in the art.

[0075] The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, the pharmaceutically effective amount refers to an amount sufficient to treat diseases at a reasonable benefit/risk ratio applicable to medical treatment, and an effective dosage level may be determined according to factors including types of diseases of patients, the severity of disease, the activity of drugs, sensitivity to drugs, administration time, administration route, excretion rate, treatment period, and simultaneously used drugs, and factors well known in other medical fields. The composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with therapeutic agents in the related art, and may be administered in a single dose or multiple doses. It is important to administer the composition in a minimum amount that can obtain the maximum effect without any side effects, in consideration of all the aforementioned factors, and this may be easily determined by those of ordinary skill in the art.

[0076] Specifically, the effective amount of the pharmaceutical composition according to the present invention may be changed according to a patient's age, sex or body weight, and may be increased or decreased depending on the route of administration, the severity of obesity, sex, a body weight, age or the like.

[0077] Another aspect of the present invention provides a food composition for preventing or alleviating one or more diseases selected from the group consisting of cancer, an inflammatory disease, and a cranial nerve disease, comprising vesicles derived from bacteria of the genus Deinococcus as an active ingredient.

[0078] The food composition of the present invention includes a health functional food composition. The food composition according to the present invention may be used by adding an active ingredient as is to food or may be used together with other foods or food ingredients, but may be appropriately used according to a typical method. The mixed amount of the active ingredient may be suitably determined depending on the purpose of use thereof (for prevention or alleviation). In general, when a food or beverage is prepared, the composition of the present invention is added in an amount of 15 wt % or less, preferably 10 wt % or less based on the raw materials. However, for long-term intake for the purpose of health and hygiene or for the purpose of health control, the amount may be less than the above-mentioned range.

[0079] Other ingredients are not particularly limited, except that the food composition of the present invention contains the active ingredient as an essential ingredient at the indicated ratio, and the food composition of the present invention may contain various flavorants, natural carbohydrates, and the like, like a typical beverage, as an additional ingredient. Examples of the above-described natural carbohydrate include common sugars such as monosaccharides, for example, glucose, fructose and the like; disaccharides, for example, maltose, sucrose and the like; and polysaccharides, for example, dextrin, cyclodextrin and the like, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the flavorant other than those described above, a natural flavorant (thaumatin, stevia extract, for example, rebaudioside A, glycyrrhizin and the like), and a synthetic flavorant (saccharin, aspartame and the like) may be advantageously used. The proportion of the natural carbohydrate may be appropriately determined by the choice of those of ordinary skill in the art.

[0080] The food composition of the present invention may contain various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, colorants and fillers (cheese, chocolate, and the like), pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloid thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonating agents used in a carbonated beverage, or the like, in addition to the additives. These ingredients may be used either alone or in combinations thereof. The ratio of these additives may also be appropriately selected by those of ordinary skill in the art.

[0081] The inhalant composition of the present invention may include not only vesicles derived from bacteria of the genus Deinococcus, but also components conventionally used in inhalant compositions, for example, conventional adjuvants such as an antioxidant, a stabilizer, a solubilizer, a vitamin and a flavoring agent, and a carrier.

[0082] Another aspect of the present invention provides a cosmetic composition for preventing or alleviating an inflammatory skin disease, comprising vesicles derived from bacteria of the genus Deinococcus as an active ingredient.

[0083] In the present invention, the inflammatory skin disease may be one or more selected from the group consisting of atopic dermatitis, acne, hair loss, and psoriasis, but is not limited thereto.

[0084] The cosmetic composition of the present invention may comprise ingredients conventionally used in a cosmetic composition as well as vesicles derived from bacteria of the genus Deinococcus, and may comprise, for example, a conventional additive such as an antioxidant, a stabilizer, a solubilizer, a vitamin, a pigment and a flavor, and a carrier.

[0085] In addition, the composition of the present invention may also be used by mixing a conventionally used organic sunscreen as long as it does not impair a skin protection effect by reaction with the vesicles derived from bacteria of the genus Deinococcus, in addition to the vesicles derived from bacteria of the genus Deinococcus. The organic sunscreen may be one or more selected from the group consisting of glyceryl PABA, drometrizole trisiloxane, drometrizole, digalloyl trioleate, disodium phenyl dibenzimidazole tetrasulfonate, diethylhexyl butamidotriazone, diethylamino hydroxybenzoyl hexylbenzoate, DEA-methoxycinnamate, a Lawson/dihydroxyacetone mixture, methylenebis-benzotriazolyltetramethylbutylphenol, 4-methylbenzylidene camphor, methyl anthranilate, benzophenone-3(oxybenzone), benzophenone-4, benzophenone-8(dioxyphebenzone), butyl methoxydibenzoylmethane, bisethylhexyloxyphenol methoxyphenyl triazine, cinoxate, ethyl dihydroxypropyl PABA, octocrylene, ethylhexyldimethyl PABA, ethylhexyl methoxycinnamate, ethylhexyl salicylate, ethylhexyl triazone, isoamyl-p-methoxycinnamate, polysilicon-15 (dimethicodiethylbenzal malonate), terephthalylidene dicamphor sulfonic acid and a salt thereof, TEA-salicylate and aminobenzoic acid (PABA).

[0086] Products that can contain the cosmetic composition of the present invention include, for example, cosmetics such as an astringent, a skin toner, a nourishing toner, various types of creams, essences, packs and foundations, cleansers, face washes, soaps, treatments, and tonics. Specific formulations of the cosmetic composition of the present invention include a skin lotion, a skin softener, a skin toner, an astringent, a lotion, a milk lotion, a moisturizing lotion, a nourishing lotion, a massage cream, a nourishing cream, a moisturizing cream, a hand cream, an essence, a nourishing essence, a pack, a soap, a shampoo, a cleansing foam, a cleansing lotion, a cleansing cream, a body lotion, a body cleanser, an emulsion, a lipstick, a makeup base, a foundation, a pressed powder, a loose powder, and an eyeshadow.

[0087] In one embodiment of the present invention, as a result of orally administering bacteria and bacteria-derived vesicles to mice and observing in vivo absorption, distribution, and excretion patterns of the bacteria and the vesicles, it was confirmed that, while the bacteria were not absorbed via the intestinal mucous membrane, the bacteria-derived vesicles were absorbed within 5 minutes after administration and systemically distributed, and excreted via the kidneys, liver, and the like (see Example 1).

[0088] In another embodiment of the present invention, it was evaluated whether bacteria and vesicles derived from bacteria directly administered to the intestines passed through the protective membrane of the intestinal mucosa, and it was confirmed that bacteria failed to pass through the protective membrane of the intestinal mucosa, whereas vesicles derived from bacteria passed through the protective membrane of the mucosa. (See Example 2).

[0089] In another embodiment of the present invention, a bacterial metagenomic analysis was performed by using vesicles isolated from the blood of normal individuals who were matched in age and sex with patients with cancer, an inflammatory disease, and dementia. As a result, it was confirmed that vesicles derived from bacteria of the genus Deinococcus were significantly decreased in clinical samples of patients with cancer, an inflammatory disease, and dementia as compared to samples of normal individuals (see Examples 4, 5, and 6).

[0090] In yet another embodiment of the present invention, anti-inflammatory effects of vesicles derived from Deinococcus radiodurans strains were evaluated. As a result of evaluating the secretion of inflammatory mediators after treating macrophages with vesicles derived from Deinococcus radiodurans at various concentrations prior to treatment with E. coli-derived vesicles, which are pathogenic vesicles, it was confirmed the vesicles derived from Deinococcus radiodurans efficiently suppressed the secretion of TNF-α, which is a mediator inducing inflammation and cancer, mediator by inflammation-inducing E. coli-derived vesicles (see Example 8).

[0091] In still another embodiment of the present invention, the nerve cell protective effect of vesicles derived from a Deinococcus radiodurans strain was evaluated, and as a result of evaluating brain-derived neurotrophic factor (BDNF) expression by simultaneously treating nerve cells, which have been treated with an adrenocortical hormone, which stresses nerve cells, with Deinococcus radiodurans-derived vesicles, it was confirmed that the Deinococcus radiodurans-derived vesicles effectively increase the expression of BDNF, which is a mediator protecting against nerve cell damage (see Example 9).

[0092] Hereinafter, preferred Examples for helping the understanding of the present invention will be suggested. However, the following Examples are provided only to more easily understand the present invention, and the contents of the present invention are not limited by the following Examples.

EXAMPLES

Example 1. Analysis of In Vivo Absorption, Distribution, and Excretion Patterns of Bacteria and Vesicles Derived from Bacteria

[0093] In order to evaluate whether bacteria and bacteria-derived vesicles were systemically absorbed through the gastrointestinal tract, an experiment was performed with the following method. First, a dose of 50 μg of each of fluorescence-labeled bacteria and the bacteria-derived vesicles was administered through the gastrointestinal tract to the stomach of a mouse, and fluorescence was measured after 0 minute, 5 minutes, 3 hours, 6 hours, and 12 hours. As a result of observing the entire image of the mouse, as illustrated in FIG. 1A, the bacteria were not systemically absorbed, but the vesicles derived from bacteria were systemically absorbed 5 minutes after administration, and fluorescence was strongly observed in the bladder 3 hours after administration, so that it could be seen that the vesicles were excreted to the urinary tract. Further, it could be seen that the vesicles were present in the body until 12 hours after administration (see FIG. 1A).

[0094] In addition, in order to evaluate the pattern in which the intestinal bacteria and the vesicles derived from the intestinal bacteria infiltrated into various organs after they were systemically absorbed, 50 μg of bacteria and vesicles derived from bacteria labeled with fluorescence were administered in the same manner as described above, and then the urine, heart, lungs, liver, kidneys, spleen, fat, and muscle were collected 12 hours after administration. As a result of observing fluorescence in the blood and collected tissues, as illustrated in FIG. 1B, it could be seen that the vesicles derived from bacteria were distributed in the urine, heart, lungs, liver, spleen, fat, muscle, and kidneys but the bacteria were not absorbed (see FIG. 1B).

Example 2. Evaluation of Whether Bacteria and Vesicles Derived from Bacteria Penetrate Protective Membrane of Intestinal Mucosa

[0095] In order to evaluate whether bacteria and bacteria-derived vesicles passed through the protective membrane of the mucosa to be infiltrated into tissue, after bacteria and bacteria-derived vesicles were directly administered to the intestines, infiltration into the intestinal tissue after passing through the protective membrane of the mucosa was evaluated by an immunohistochemistry method. In order to evaluate the presence of bacteria and vesicles in the mucosa tissue, antibodies against the bacteria and the vesicles were prepared, attached to a green fluorescent protein (GFP) and used, and after staining with 4, 6-diamidino 2-phenylindole (DAPI), observed under a microscope.

[0096] As a result, it was confirmed that the bacteria cannot pass through the protective membrane of the mucosal, but the bacteria-derived vesicles infiltrate into the intestinal tissue through the mucosa (see FIG. 2).

Example 3. Metagenomic Analysis of Vesicles Derived from Bacteria in Clinical Sample

[0097] After blood was first put into a 10-ml tube and suspended matter was allowed to settle by a centrifuge (3,500×g, 10 min, 4° C.), only the supernatant was transferred to a new 10-ml tube. After bacteria and impurities were removed by using a 0.22-μm filter, they were transferred to a Centriprep tube (centrifugal filters 50 kD) and centrifuged at 1,500×g and 4° C. for 15 minutes, materials smaller than 50 kD were discarded, and the residue was concentrated to 10 ml. After bacteria and impurities were removed once again by using a 0.22-μm filter, the supernatant was discarded by using a ultra-high speed centrifugation at 150,000×g and 4° C. for 3 hours with a Type 90Ti rotor, and an aggregated pellet was dissolved in physiological saline (PBS).

[0098] Internal DNA was extracted out of the lipid by boiling 100 μl of the vesicles isolated by the above method at 100° C., and then cooled on ice for 5 minutes. And then, in order to remove the remaining suspended matter, the DNA was centrifuged at 10,000×g and 4° C. for 30 minutes, and only the supernatant was collected. And, the amount of DNA was quantified by using Nanodrop. Thereafter, in order to confirm whether the DNA derived from bacteria was present in the extracted DNA, PCR was performed with 16s rDNA primers shown in the following Table 1 and it was confirmed that genes derived from bacteria were present in the extracted genes.

TABLE-US-00001 TABLE 1 SEQ ID primer Sequence No. 16S 16S_V3_F 5′- 1 rDNA TCGTCGGCAGCGTCAGATGTGTATAAGA GACAGCCTACGGGNGGCWGCAG-3' 16S_V4_R 5′- 2 GTCTCGTGGGCTCGGAGATGTGTATAAG AGACAGGACTACHVGGGTATCTAATCC

[0099] The DNA extracted by the above method was amplified using the 16S rDNA primers, and then sequencing was performed (Illumina MiSeq sequencer), the results were output as a standard flowgram format (SFF) file, the SFF file was converted into a sequence file (.fasta) and a nucleotide quality score file using GS FLX software (v2.9), and then the reliability estimation for the reads was confirmed, and a portion in which the window (20 bps) average base call accuracy was less than 99% (Phred score<20) was removed. For the OTU (operational taxonomy unit) analysis, clustering was performed according to sequence similarity by using UCLUST and USEARCH, the genus, family, order, class, and phylum were clustered based on 94%, 90%, 85%, 80%, and 75% sequence similarity, respectively, classification was performed at the phylum, class, order, family, and genus levels of each OUT, and bacteria having a sequence similarity of 97% or more at the genus level were profiled by using the 16S RNA sequence database (108,453 sequences) of BLASTN and GreenGenes (QIIME).

Example 4. Metagenomic Analysis of Bacteria-Derived Vesicles in Blood of Patient with Gastric Cancer

[0100] After a metagenomic analysis was performed using the method of Example 3 on the blood from 87 patients with gastric cancer, and 91 normal individuals who were matched in age and sex by extracting genes from vesicles present in the blood, the distribution of vesicles derived from bacteria of the genus Deinococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Deinococcus were significantly decreased in the blood from the patients with gastric cancer as compared to the blood from the normal individuals (see FIG. 3).

Example 5. Metagenomic Analysis of Bacteria-Derived Vesicles in Blood of Patient with Asthma

[0101] After a metagenomic analysis was performed using the method of Example 3 on the blood from 132 patients with asthma, and 109 normal individuals who were matched in age and sex by extracting genes from vesicles present in the blood, the distribution of vesicles derived from bacteria of the genus Deinococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Deinococcus were significantly decreased in the blood from the patients with asthma as compared to the blood from the normal individuals (see FIG. 4).

Example 6. Metagenomic Analysis of Bacteria-Derived Vesicles in Blood of Patient with Dementia

[0102] After a metagenomic analysis was performed using the method of Example 3 on the blood from 82 patients with dementia, and 99 normal individuals who were matched in age and sex by extracting genes from vesicles present in the blood, the distribution of vesicles derived from bacteria of the genus Deinococcus was evaluated. As a result, it was confirmed that vesicles derived from bacteria of the genus Deinococcus were significantly decreased in the blood from the patients with dementia as compared to the blood from the normal individuals (see FIG. 5).

Example 7. Isolation of Vesicles from Deinococcus radiodurans Culturing Solution

[0103] Based on the above examples, a Deinococcus radiodurans strain were cultured, and then vesicles were isolated therefrom and characteristics of the isolated vesicles were analyzed. First, the Deinococcus radiodurans strains were cultured in a de Man-Rogosa and Sharpe (MRS) medium in an incubator at 37° C. until the absorbance (OD 600) became 1.0 to 1.5, and then sub-cultured in a Luria-Bertani (LB) medium. Subsequently, a culture supernatant including the strain was recovered and centrifuged at 10,000×g and 4° C. for 20 minutes, and then the strain was removed and filtered through a 0.22 μm filter. The filtered supernatant was concentrated to a volume of less than or equal to 50 ml through microfiltration by using a MasterFlex pump system (Cole-Parmer, US) with a 100 kDa Pellicon 2 Cassette filter membrane (Merck Millipore, US), and the concentrated supernatant was filtered once again with a 0.22-μm filter. Thereafter, proteins were quantified by using a BCA assay, and the following experiments were performed on the obtained vesicles.

Example 8. Anti-Inflammatory Effects of Vesicles Derived from Deinococcus radiodurans

[0104] In order to evaluate the anti-inflammatory effects of vesicles derived from Deinococcus radiodurans, after mouse macrophage cell lines were pre-treated with vesicles derived from Deinococcus radiodurans (D. radiodurans EV) at various concentrations (0.1, 1, and 10 μg/ml) for 12 hours, the cell lines were treated with 1 μg/ml of E. coli-derived vesicles, which are a pathogenic factor, and then the secretion of inflammatory cytokines was measured by ELISA after 12 hours.

[0105] As a result, upon pre-treatment of the Deinococcus radiodurans-derived vesicles, it was confirmed that the secretion of TNF-α, which is an inflammation mediator closely associated with cell death, inflammation and cancer induced in inflammatory cells by E. coli-derived vesicle stimulation, is inhibited by Deinococcus radiodurans-derived vesicles in a dose-dependent manner (see FIG. 6).

Example 9. Nerve Cell Protective Effect of Deinococcus radiodurans-Derived Vesicles

[0106] A brain-derived neurotrophic factor (BDNF) is a major mediator protecting nerve cells from nerve cell damage, and its expression is decreased in dementia, depression, Alzheimer's disease, autism, and the like. In this example, to evaluate the therapeutic effect of Deinococcus radiodurans-derived vesicles against a cranial nerve disease, the nerve cell protective effect was evaluated by treating the nerve cells with a stress hormone. That is, nerve cells (hippocampal neuronal cell line, HT22 cells) were cultured with an adrenocortical hormone (GC: corticosterone 400 ng/ml) or Deinococcus radiodurans-derived vesicles (EV, 20 μg/mL) for 24 hours in vitro, and the BDNF expression was evaluated by PCR.

[0107] As a result, it was confirmed that the BDNF expression inhibited by adrenocortical hormone treatment is significantly recovered by the treatment of Deinococcus radiodurans-derived vesicles (see FIG. 7). This means that the Deinococcus radiodurans-derived vesicles can effectively inhibit a cranial nerve disease caused by a factor causing cranial nerve cell damage such as stress.

[0108] The above-described description of the present invention is provided for illustrative purposes, and those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. Therefore, it should be understood that the above-described Examples are illustrative only in all aspects and are not restrictive.

INDUSTRIAL APPLICABILITY

[0109] Vesicles derived from bacteria of the genus Deinococcus according to the present invention are expected to be effectively used in a method of diagnosing cancer, an inflammatory disease or dementia; and a food, inhalant, cosmetic or pharmaceutical composition for preventing, alleviating or treating cancer, an inflammatory disease or a cranial nerve disease.