FIBRINOLYTIC COMPOSITION AND METHOD OF ITS PREPARATION
20220096608 · 2022-03-31
Inventors
Cpc classification
International classification
Abstract
The present invention discloses modified forms of plasmin with advantageous properties. As compared to their natural unmodified form, these variants exhibit significantly modulated kinetics in terms of delayed inhibition characteristics in the presence of specific inhibitors, such as α.sub.2-antiplasmin (α.sub.2-AP). These include PEG-conjugated thiol derivatives of truncated plasmin with potential clinical applications in various regimens of thrombolytic therapies.
Claims
1-15. (canceled)
16. A fibrinolytic composition comprising: (a) a modified thiol derivative of plasminogen having substitution of one to eight amino acid residues of SEQ ID NO: 2 with a cysteine residue; and (b) a pharmaceutically acceptable diluent, carrier, or adjuvant, wherein the substitutions are done in regions comprising of sequences selected from the group having sequences EVNLEPHV, GTF, AG, FGM, and EKS.
17. The fibrinolytic composition of claim 16, wherein the cysteine substitution in span EVNLEPHV is done at a position selected from the group consisting of E81C (SEQ ID NO: 3), V82C (SEQ ID NO: 4), N83C (SEQ ID NO: 5), L84C (SEQ ID NO: 6), E85C (SEQ ID NO: 7), P86C (SEQ ID NO: 8), H87C (SEQ ID NO: 9), V88C (SEQ ID NO: 10), E85C-H87C (SEQ ID NO: 11), and V82C-H87C (SEQ ID NO: 12).
18. The fibrinolytic composition of claim 16, wherein the cysteine substitution in span GTF is done at a position selected from the group consisting of G148C (SEQ ID NO: 13), T149C (SEQ ID NO: 14), and F150C (SEQ ID NO: 15).
19. The fibrinolytic composition of claim 16, wherein the cysteine substitution in span AG is done at a position selected from the group consisting of A189C (SEQ ID NO: 16) and G190C (SEQ ID NO: 17).
20. The fibrinolytic composition of claim 16, wherein the cysteine substitution in span FGM is done at a position selected from the group consisting of F41C (SEQ ID NO: 18), G42C (SEQ ID NO: 19), and M43C (SEQ ID NO: 20).
21. The fibrinolytic composition of claim 16, wherein the cysteine substitution in span EKS is done at a position selected from the group consisting of E64C (SEQ ID NO: 21), K65C (SEQ ID NO: 22), and S66C (SEQ ID NO: 23).
22. The fibrinolytic composition of claim 16, wherein the modified thiol derivative of plasminogen is covalently modified with thiol-reactive polyethylene glycol (PEG) moiety which is linear or branched polymer having a molecular size from 5 kDa to 40 kDa.
23. Use of the fibrinolytic composition of claim 16 for prolonging the clot lysis time by retarding or inhibiting alpha2-antiplasmin mediated inhibition.
24. A plasminogen variant polypeptide comprising substitution of one to eight amino acid residues of amino acid sequence as set forth in SEQ ID NO: 2 useful as a therapeutic agent, wherein the substitutions are done in regions comprising of sequences selected from the group having sequences EVNLEPHV, GTF, AG, FGM, and EKS.
25. The plasminogen variant polypeptide of claim 24, consisting of at least 2, 3, and 8 consecutive or alternate or random substitution of amino acid residues with cysteine.
26. The plasminogen variant polypeptide of claim 25, further comprising covalently modified thiol groups at one or more substituted cysteine residues.
27. The plasminogen variant polypeptide of claim 24, wherein the polypeptide is covalently modified with thiol-reactive polyethylene glycol (PEG) moiety.
28. The plasminogen variant polypeptide if claim 27, wherein the polyethylene glycol moiety is a linear or a branched polymer of varying molecular size ranging from about 5 kDa to about 40 kDa.
29. The plasminogen variant polypeptide of claim 24, wherein the polypeptide is insensitive to alpha2-antiplasmin mediated inhibition.
Description
BRIEF DESCRIPTION OF FIGURES
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046] MALDI-TOF data of the μPG and PEGylated variants confirmed their size, which were close to the expected ones. Expected masses of proteins are 6a. wild-type μPG ˜28 kDa 6b. μPG cysteine variant 6c. mono-PEGylated μPG variant ˜48 kDA 6d. bi-PEGylated μPG variant ˜68 kDa.
[0047]
DETAILED DESCRIPTION OF INVENTION
[0048] The present invention discloses an approach to address the problems associated with the development of direct-acting thrombolytics having desirable therapeutic profile. The invention relates to recombinant analogues of plasminogen-derivative as well as their PEGylated counterparts. The catalytic domain of plasmin(ogen) has been altered by cysteine mutation of one or more amino acids in its primary sequence. Further, a PEG moiety is covalently coupled to the free cysteine residues incorporated in its catalytic domain. The invention describes the method of conjugating thiol reactive PEG to biologically active plasminogen derivative and process involving purification of these PEG-conjugated plasminogen derivatives. Furthermore, the invention exemplifies the in vitro activity of modified plasmin variants against α.sub.2-antiplasmin.
[0049] An embodiment of the present invention provides a fibrinolytic composition comprising: [0050] a. a modified thiol derivative of plasminogen having substitution of one to eight amino acid residues of SEQ ID NO. 2 with a cysteine residue; and [0051] b. a pharmaceutically acceptable diluent, carrier, or adjuvant.
[0052] In an embodiment of the present invention, there is provided a fibrinolytic composition, wherein the substitutions are done in regions comprising of sequences selected from the group having sequences EVNLEPHV, GTF, AG, FGM, and EKS.
[0053] In another embodiment of the present invention, there is provided a fibrinolytic composition, wherein the cysteine substitution in span EVNLEPHV is done at a position selected from the group consisting of E81C (SEQ ID NO. 3), V82C (SEQ ID NO. 4), N83C (SEQ ID NO. 5), L84C (SEQ ID NO. 6), E85C (SEQ ID NO. 7), P86C (SEQ ID NO. 8), H87C (SEQ ID NO. 9), V88C (SEQ ID NO. 10) E85C-H87C (SEQ ID NO. 11), and V82C-H87C (SEQ ID NO. 12).
[0054] In yet another embodiment of the present invention, there is provided a fibrinolytic composition, wherein the cysteine substitution in span GTF is done at a position selected from the group consisting of G148C (SEQ ID NO. 13), T149C (SEQ ID NO. 14), and F150C (SEQ ID NO. 15).
[0055] In still another embodiment of the present invention, there is provided a fibrinolytic composition, wherein the cysteine substitution in span AG is done at a position selected from the group consisting of A189C (SEQ ID NO. 16), and G190C (SEQ ID NO. 17).
[0056] In another embodiment of the present invention, there is provided a fibrinolytic composition, wherein the cysteine substitution in span FGM is done at a position selected from the group consisting of F41C (SEQ ID NO. 18), G42C (SEQ ID NO. 19), and M43C (SEQ ID NO. 20).
[0057] In yet another embodiment of the present invention, there is provided a fibrinolytic composition, wherein the cysteine substitution in span EKS is done at a position selected from the group consisting of E64C (SEQ ID NO. 21), K65C (SEQ ID NO. 22), and S66C (SEQ ID NO. 23).
[0058] In still another embodiment of the present invention, there is provided a fibrinolytic composition, wherein the modified thiol derivative of plasminogen is covalently modified with thiol-reactive polyethylene glycol (PEG) moiety which is linear or branched polymer having varying molecular size from 5 kDa to 40 kDa.
[0059] Another embodiment of the present invention provides a use of the fibrinolytic composition for prolonging the clot lysis time by retarding or inhibiting alpha2-antiplasmin mediated inhibition.
[0060] Yet another embodiment of the present invention provides a plasmin(ogen) variant polypeptide comprising substitution of one to eight amino acid residues of amino acid sequence as set forth in SEQ ID NO: 2 useful as a therapeutic agent.
[0061] An embodiment of the present invention provides a plasmin(ogen) variant polypeptide comprising substitution of one to eight amino acid residues of amino acid sequence as set forth in SEQ ID NO: 2, wherein the amino acid residue substituted with a cysteine residue is selected from the amino acid sequences EVNLEPHV, GTF, AG, FGM and EKS of plasmin(ogen) catalytic domain.
[0062] In yet another embodiment of the present invention, there is provided a plasmin(ogen) variant polypeptide comprising substitution of one to eight amino acid residues of amino acid sequence as set forth in SEQ ID NO. 2, wherein the amino acid residue substituted with a cysteine residue is selected from the amino acid sequence EVNLEPHV of plasmin(ogen) catalytic domain.
[0063] In still another embodiment of the present invention, there is provided a plasmin(ogen) variant polypeptide consisting of cysteine substitution, wherein the amino acid sequences with substitution are as set forth in E81C (SEQ ID NO. 3), V82C (SEQ ID NO. 4), N83C (SEQ ID NO. 5), L84C (SEQ ID NO. 6), E85C (SEQ ID NO. 7), P86C (SEQ ID NO. 8), H87C (SEQ ID NO. 9), V88C (SEQ ID NO. 10) E85C-H87C (SEQ ID NO. 11), and V82C-H87C (SEQ ID NO. 12).
[0064] In another embodiment of the present invention, there is provided a plasmin(ogen) variant polypeptide comprising substitution of one to three amino acid residues of amino acid sequence as set forth in SEQ ID NO. 2, wherein the amino acid residue substituted with a cysteine residue is selected from the amino acid sequence GTF of plasmin(ogen) catalytic domain.
[0065] In yet another embodiment of the present invention, there is provided a plasmin(ogen) variant polypeptide consisting of cysteine substitution, wherein the amino acid sequences with substitution are as set forth in G148C (SEQ ID NO. 13), T149C (SEQ ID NO. 14), and F150C (SEQ ID NO. 15).
[0066] In still another embodiment of the present invention, there is provided a plasmin(ogen) variant polypeptide comprising substitution of one to two amino acid residues of amino acid sequence as set forth in SEQ ID NO. 2, wherein the amino acid residue substituted with a cysteine residue is selected from the amino acid sequence AG of plasmin(ogen) catalytic domain.
[0067] In another embodiment of the present invention, there is provided a plasmin(ogen) variant polypeptide consisting of cysteine substitution, wherein the amino acid sequences with substitution are as set forth in A189C (SEQ ID NO. 16), and G190C (SEQ ID NO. 17).
[0068] In yet another embodiment of the present invention, there is provided a plasmin(ogen) variant polypeptide comprising substitution of one to three amino acid residues of amino acid sequence as set forth in SEQ ID NO. 2, wherein the amino acid residue substituted with a cysteine residue is selected from the amino acid sequence FGM of plasmin(ogen) catalytic domain.
[0069] In still another embodiment of the present invention, there is provided a plasmin(ogen) variant polypeptide consisting of cysteine substitution, wherein the amino acid sequences with substitution are as set forth in F41C (SEQ ID NO. 18), G42C (SEQ ID NO. 19), and M43C (SEQ ID NO. 20).
[0070] In another embodiment of the present invention, there is provided a plasmin(ogen) variant polypeptide comprising substitution of one to three amino acid residues of amino acid sequence as set forth in SEQ ID NO. 2, wherein the amino acid residue substituted with a cysteine residue is selected from the amino acid sequence EKS of plasmin(ogen) catalytic domain.
[0071] In yet another embodiment of the present invention, there is provided a plasmin(ogen) variant polypeptide consisting of cysteine substitution, wherein the amino acid sequences with substitution are as set forth in E64C (SEQ ID NO. 21), K65C (SEQ ID NO. 22), and S66C (SEQ ID NO. 23).
[0072] In another embodiment of the present invention, there is provided a plasmin(ogen) variant polypeptide consisting of cysteine substitution, wherein the amino acid sequences with substitution are as set forth in E81C (SEQ ID NO. 3), V82C (SEQ ID NO. 4), N83C (SEQ ID NO. 5), L84C (SEQ ID NO. 6), E85C (SEQ ID NO. 7), P86C (SEQ ID NO. 8), H87C (SEQ ID NO. 9), V88C (SEQ ID NO. 10) E85C-H87C (SEQ ID NO. 11), V82C-H87C (SEQ ID NO. 12), G148C (SEQ ID NO. 13), T149C (SEQ ID NO. 14), F150C (SEQ ID NO. 15), A189C (SEQ ID NO. 16), G190C (SEQ ID NO. 17), F41C (SEQ ID NO. 18), G42C (SEQ ID NO. 19), M43C (SEQ ID NO. 20), E64C (SEQ ID NO. 21), K65C (SEQ ID NO. 22), and S66C (SEQ ID NO. 23).
[0073] In still another embodiment of the present invention, there is provided a plasmin(ogen) variant polypeptide consisting at least 2, 3 and 8 consecutive or alternate or random substitution of amino acid residues of catalytic domain of plasmin(ogen) with cysteine.
[0074] In another embodiment of the present invention, there is provided a plasmin(ogen) variant polypeptide further comprising covalently modified thiol groups at one or more substituted cysteine residues.
[0075] In yet another embodiment of the present invention, there is provided a plasmin(ogen) variant polypeptide wherein said polypeptide is covalently modified with thiol-reactive polyethylene glycol (PEG) moiety.
[0076] In still another embodiment of the present invention, there is provided a plasmin(ogen) variant polypeptide covalently modified with thiol-reactive polyethylene glycol (PEG) moiety, wherein the polyethylene glycol moiety is a linear or a branched polymer of varying molecular size ranging from about 5 kDa to about 40 kDa.
[0077] In another embodiment of the present invention, there is provided a plasmin(ogen) variant polypeptide, wherein said polypeptide is insensitive to alpha2-antiplasmin mediated inhibition.
[0078] Another embodiment of the present invention provides a pharmaceutical composition comprising the covalently modified plasmin(ogen) variant polypeptide for prolonging the clot lysis time by retarding or inhibiting alpha2-antiplasmin mediated inhibition.
[0079] The selection of appropriate sites for surface modification is a critical step to maintain the functionality of the modified variants. Several strategies have been developed for protein PEGylation, but the rare occurrence of free cysteine residues in proteins makes thiol based chemistry a more selective approach for PEG-conjugation. Cysteine contains a potentially reactive sulph-hydryl/thiol (—SH) group (Veronese, 2002; Grace et al., 2005). Furthermore, cysteines are commonly present as disulphides, considered to be responsible for maintaining the folding and stability of proteins, hence preserving the bioactive conformation essential for its biological activity (Roberts, 2002). The kringle-less derivative of plasminogen contains twelve cysteine residues, all of which are engaged in six disulphide linkages. Since none of intrinsic cysteines are free in natively folded micro-plasminogen (Peterson et al. 1990), this offers a unique opportunity to strategically incorporate an unpaired cysteine into the micro-plasminogen which will be available free for PEG-coupling provided the cysteine incorporation is tolerated without disruption of catalytic activity. The technique of in vitro mutagenesis allows incorporation of a non-native, free cysteine residue into protein which can offer the benefit of selecting the target site for modification to obtain desired results without unwanted side effects.
[0080] The molecular surface of the catalytic domain of plasminogen consists of several distinct surface-exposed loops (Wang et al., 2000). The surface-loops among different serine proteases are considered to be important for their selective interactions with substrates and inhibitors (Madison et al., 1989; Wang et al., 2000). The residues were selected on the basis of surface accessibility and association with α.sub.2-AP using available structural information. The X-ray crystal structure of human antiplasmin (α.sub.2-AP) has not been solved yet. But the crystal structure of murine antiplasmin is known (Law et al., 2008), which shares ˜78.47% sequence similarity with human plasminogen. The three dimensional structure models of micro-plasminogen in complex with murine α.sub.2-antiplasmin was predicted using the available structural information of human plasminogen catalytic domain (Wang et al., 2000) as well as murine antiplasmin. The docking models generated by GRAMM-X Protein-Protein Docking Web Server v.1.2.0 (Tovchigrechko and Vakser, 2006) were analyzed using PyMOL graphic visualization system and used to interpret potential interface residues between these two proteins.
[0081] Five different locations consisting of two to eight residues were chosen by keeping it in mind that selected sites are distant from the catalytic site as well as the native cysteines of protein involved in disulfide linkage so that there is expected to be little interference with the fibrinolytic abilities [
[0082] The present invention provides a method for development of improved thrombolytic molecules to treat ischemic stroke and other thrombotic diseases. Because α.sub.2-antiplasmin is a fast covalent inhibitor of plasmin and its derivatives, it makes them inefficient for clot dissolution. Therefore, the specific object of the present invention is to provide partial protection to plasmin or its derivatives from ultrafast inactivation by plasma inhibitors, thereby speeding up the fibrinolysis process and making it more effective. The present invention describes construction of eight cysteine analogs of truncated plasminogen derivatives, primarily in the regions of the protein that are associated in interaction with α.sub.2-antiplasmin, as also those regions that lie relatively away from the major activation sites. Further, the invention illustrates the effect of covalent grafting of single 20 kDa/40 kDa PEG chain (i.e. mono-PEGylation) and also the double (i.e. bi-PEGylation) sites in the protein, on α.sub.2-antiplasmin mediated inhibition of truncated plasmin derivatives. The present invention further discloses that the covalently modified plasmin variants obtained by site-specific PEGylation exhibit a markedly reduced inhibition rate relative to the wild type/unmodified/native plasmin variant. The explanation to the successful protein resistance properties of PEG attached to the surface is the flexibility and mobility of PEG chains as flexible PEG moiety that sterically interfered with the recognition of α.sub.2-antiplasmin interacting sites. In addition, the correlation of the number of conjugation sites, size of PEG group and their effect on α.sub.2-antiplasmin inhibition was determined. Bi-PEGylation i.e. attachment of 20 kDa-PEG at two different sites in plasmin derivative molecule contributes to its relatively longer activity than the mono-PEGylated ones as the cumulative shielding effect of PEG is greater that affects the interaction between α.sub.2-antiplasmin and modified plasmin derivatives in more significant manner. Furthermore, the present invention describes that modified conjugates retain their characteristic amidolytic properties. The kinetic parameters revealed that both the free cysteine variants and their covalently modified forms were quite equivalent to their natural counterparts, showing comparable amidolysis of small molecular weight chromogenic substrate (chromozyme PL). The present invention provides a method for achieving efficient clot lysis by prolonging the α.sub.2-antiplasmin mediated inhibition of plasmin derivative as the long half-life will allow the persistence of effect. The combined effects of native plasmin activity and retardation of α.sub.2-antiplasmin mediated inhibition helps to facilitate faster clot dissolution. This new functional attribute of lesser antiplasmin sensitivity imparted to plasmin variants makes it a distinctly promising molecule for the treatment thrombotic disorders.
[0083] The primary attributes such as self-sustaining mechanism (plasminogen-independent pathway of fibrin degradation) combined with enhanced α.sub.2-antiplasmin resistance makes modified plasmin derivatives a promising candidate for the development of efficacious thrombolytic agents.
EXAMPLES
Materials
[0084] The cloning of truncated plasminogen derivative (catalytic domain) was done in T7 RNA polymerase inducible promoter based expression vector pET11a and transformed into expression host E. coli strain BL21(DE3) procured from Novagen Inc. (Madison, Wis., USA). All the DNA modifying enzymes including restriction enzymes, T4 DNA Ligases and thermostable DNA polymerase used in gene cloning experiments were purchased from New England Biolabs (Beverly, Mass.) or Promega Inc. (Madison, Wis., USA). E. coli XL1-Blue cloning host and the QuickChange™ Site-Directed Mutagenesis Kit were obtained from Stratagene Inc. (La Jolla, Calif.). Commercially available kits from Qiagen (GmbH, Germany) were used for isolation of plasmid and extraction of the DNA or for retrieving the PCR amplified DNA from agarose gel. All the oligonucleotide primers used in the study for cloning and mutagenesis were custom synthesized from the Integrated DNA Technologies (IDT), USA. DNA sequencing was performed on an automated sequencer (ABI PRISM 377 DNA Sequencer, Perkin Elmer Applied Biosystems). Protein purification resins such as SP-Sepharose™ (Fast Flow) and Superdex™-75 pg were procured from GE-Amersham Biosciences. FPLC was performed on the sophisticated chromatographic purification pump AKTA Purifier™, GE Healthcare, USA. Absorption spectroscopic measurements were carried out on Lambda 35 Perkin-Elmer UV/Vis spectrophotometer. All the materials required for the SDS-PAGE were purchased from Bio-RAD, USA. Superior quality methoxy-PEG maleimide reagent (10 kDa to 40 kDa) was purchased from JenKem Technology, USA. Zeba™ Spin Desalting columns used for protein desalting were obtained from Thermo Fisher Scientific, USA. Exact masses of the modified derivatives were determined by MALDI-TOF on ABISCIEX machine TripleTOF® 5600/5600. Urokinase was covalently immobilized onto cross-linked agarose (Sepharose 6B-CL) obtained from Pharmacia Ltd., Uppsala, Sweden. Chromogenic plasmin substrate, tosyl-Gly-Pro-Lys-anilide (Chromozyme® PL), was a product of Boehringer-Mannheim, USA. Plasmin inhibition kinetics was studied using commercially available α.sub.2-Antiplasmin from Calbiochem. All the reagents used were of the highest analytical grade available.
[0085] The present invention is described in further detail in the following non-limiting examples.
Example 1
Cloning, Expression and Purification of Truncated Derivatives of Human Plasminogen
[0086] The full length HPG cDNA (encoding protein having amino acid sequence as set forth in SEQ ID NO. 1) in pCMV6 vector was custom synthesized from Ori Gene Technologies Inc, USA. The nucleotide sequence coding for full length HPG available in NCBI (GenBank: AL109933.25) was used as a template for designing the forward and reverse primers for PCR amplification of the desired coding sequence. Overhang primers containing suitable restriction sites (Nde1/Hind III pair) for directional cloning in pET-11a were used for PCR amplification of micro-plasminogen. The amplified sequences restriction digested with Nde1/Hind III were then ligated into the pET-11a vector digested with the same set of restriction enzymes [
Example 2
Design of PEGylation Sites
[0087] The selection of appropriate sites for surface modification is a critical step to maintain the functionality of the modified variants. The kringle-less derivative of plasminogen contains twelve cysteine residues, all of which are engaged in six disulphide linkages. Since none of intrinsic cysteines are free in natively folded micro-plasminogen, in vitro mutagenesis was used to strategically incorporate an unpaired cysteine into the micro-plasminogen which will be available for PEG-coupling. The technique of in vitro mutagenesis allows incorporation of a non-native, free cysteine residue into protein which can offer the benefit of selecting the target site for modification to obtain desired results without unwanted side effects.
[0088] The molecular surface of the catalytic domain of plasminogen consists of several distinct surface-exposed loops. The residues were selected on the basis of surface accessibility and association with α.sub.2-AP using available structural information. The docking models generated by GRAMM-X Protein-Protein Docking Web Server v.1.2.0 were analyzed using PyMOL graphic visualization system and used to interpret potential interface residues between these two proteins.
[0089] Five different locations consisting of two to eight residues were chosen by keeping it in mind that selected sites are distant from the catalytic site as well as the native cysteines of protein involved in disulfide linkage so that there is expected to be little interference with the fibrinolytic abilities [
Example 3
Construction, Expressions and Purification of Mutants
[0090] The variants of micro-plasminogen having cysteine mutations selected on the basis of computational studies are selected from the amino acid sequences as set forth in SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, SEQ ID NO. 17, SEQ ID NO. 18, SEQ ID NO. 19, SEQ ID NO. 20, SEQ ID NO. 21, SEQ ID NO. 22, and SEQ ID NO. 23. Variants of micro-plasminogen having single site substitution (SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 18, and SEQ ID NO. 20) as well as variants having double-site substitution (SEQ ID NO. 11, and SEQ ID NO. 12) were constructed based on the predicted locations using site-directed mutagenesis (QuickChange mutagenesis kit obtained from Stratagene Inc.) [
TABLE-US-00001 TABLE 1 Single and double cysteine substitution on micro-plasminogen (AMINO ACID SEQUENCE IDs) MOLECULE (SEQ ID NOs) MODIFICATION SEQ ID 1. HPG (Human Plasminogen) SEQ ID 2. HPG Catalytic Domain/Micro-plasminogen Cysteine Mutants SEQ ID 3. E81C Catalytic Domain SEQ ID 4. V82C Catalytic Domain SEQ ID 5. N83C Catalytic Domain SEQ ID 6. L84C Catalytic Domain SEQ ID 7. E85C Catalytic Domain SEQ ID 8. P86C Catalytic Domain SEQ ID 9. H87C Catalytic Domain SEQ ID 10. V88C Catalytic Domain SEQ ID 11. E85C-H87C Catalytic Domain SEQ ID 12. V82C-H87C Catalytic Domain SEQ ID 13. G148C Catalytic Domain SEQ ID 14. T149C Catalytic Domain SEQ ID 15. F150C Catalytic Domain SEQ ID 16. A189C Catalytic Domain SEQ ID 17. G190C Catalytic Domain SEQ ID 18. F41C Catalytic Domain SEQ ID 19. G42C Catalytic Domain SEQ ID 20. M43C Catalytic Domain SEQ ID 21. E64C Catalytic Domain SEQ ID 22. K65C Catalytic Domain SEQ ID 23. S66C Catalytic Domain
TABLE-US-00002 TABLE 2 Primer sequence for cysteine substitution in Plasminogen catalytic domain/Micro-plasminogen S. No. Name of Primer Sequence ID Sequence 1. E81C Catalytic SEQ ID 24 Forward primer: GGTGCGCATCAATGTGTTAATCTCGAA Domain 2. E81C Catalytic SEQ ID 25 Reverse primer: TTCGAGATTAACACATTGATGCGCACC Domain 3. V82C Catalytic SEQ ID 26 Forward primer: CACACCAGGAATGCAATCTCGAACCG Domain 4. V82C Catalytic SEQ ID 27 Reverse primer: CGGTTCGAGATTGCATTCCTGGTGTG Domain 5. N83C Catalytic SEQ ID 28 Forward primer: ACCAGGAAGTGTGTCTCGAACCGCAT Domain 6. N83C Catalytic SEQ ID 29 Reverse primer: ATGCGGTTCGAGACACACTTCCTGGT Domain 7. L84C Catalytic SEQ ID 30 Forward primer: AAGAAGTGAATTGTGAACCGCATGTCCAG Domain 8. L84C Catalytic SEQ ID 31 Reverse primer: CTGGACATGCGGTTCACAATTCACTTCTT Domain 9. E85C Catalytic SEQ ID 32 Forward primer: AGTGAATCTTTGTCCGCATGTT Domain 10. E85C Catalytic SEQ ID 33 Reverse primer: AACATGCGGACAAAGATTCACT Domain 11. P86C Catalytic SEQ ID 34 Forward primer: AATCTCGAATGTCATGTCCAG Domain 12. P86C Catalytic SEQ ID 35 Reverse primer: CTGGACATGACATTCGAGATT Domain 13. H87C Catalytic SEQ ID 36 Forward primer: AATCTAGAACCGTGTGTGCAGGAA Domain 14. H87C Catalytic SEQ ID 37 Reverse primer: TTCCTGCACACACGGTTCTAGATT Domain 15. V88C Catalytic SEQ ID 38 Forward primer: CGAACCGCATTGTCAGGAGATAGAA Domain 16. V88C Catalytic SEQ ID 39 Reverse primer: TTCTATCTCCTGACAATGCGGTTCG Domain 17. F41C Catalytic SEQ ID 40 Forward primer: AGAACTAGGTGTGGAATGCAT Domain 18. F41C Catalytic SEQ ID 41 Reverse primer: ATGCATTCCACACCTAGTTCT Domain 19. M43C Catalytic SEQ ID 42 Forward primer: AGGTTTGGATGTCACTTCTGT Domain 20. M43C Catalytic SEQ ID 43 Reverse primer: ACAGAAGTGACATCCAAACCT Domain
Example 4
Quantitation of Thiols and PEGylation Reaction
[0091] The number of free thiols in cysteine variant proteins was measured by a classical colorimetric method using Ellman's reagent 5,5′-dithiobis (2-nitrobenzoic acid). DTNB or 5,5′-dithiobis (2-nitrobenzoic acid) reacts with thiol groups to form a mixed disulphide of the protein and one mole of 2-nitro 5 thiobenzoate per mole of protein sulphydryl group. The amount and concentration of free sulphydryls per molar concentration of protein sample is calculated from the molar extinction coefficient of TNB dianions and the absorbance value of protein at 412 nm. β-mercaptoethanol having single free thiol was used standard.
[0092] Following the validation of present free thiol groups, the proteins were then incubated with 15-20 fold molar excess of maleimide-activated linear methoxy PEG (JenKem Technology USA) of different molecular weight (eg. 20 kDa, 40 kDa) in presence of 100 mM Tris-Cl (pH 8) and 2 mM EDTA. The reaction mixture was allowed to gently stir for 3 h at room temperature. [
Example 5
Purification and Activation of PEGylated Proteins
[0093] Desalted PEGylation reaction mixture (consisting of PEG-protein conjugate, un-reacted protein and polymer, described in example 4) was diluted 10 times with 20 mM sodium acetate, pH 5.5 and loaded onto a SP-Sepharose column (GE Healthcare life sciences) pre-equilibrated in 20 mM sodium acetate, pH 5.5. After washing with 2-3 bed volumes of 20 mM sodium acetate, pH 5.5, bound protein was eluted using linear gradient of 1M NaCl. The eluted protein fraction was further purified to obtain more uniform PEGylated product using Superdex-75 pg (16×600 mm) (GE Healthcare Life Sciences, USA) size exclusion chromatography to separate un-reacted protein fraction from the PEGylated protein [
[0094] The purified mono-PEGylated as well as bi-PEGylated thiol derivatives of micro-plasminogen were converted to their active forms (microplasmin) using urokinase-coupled sepharose beads in presence of 50 mM Tris-Cl (pH 8), 25 mM lysine and 25% glycerol. The reaction was set up at 25° C. with slow stirring from for upto 8 hours and monitored at regular intervals using Chromozym® PL.
Example 6
Characterization of PEGylated and Un-PEGylated Micro-Plasminogen Variants
[0095] PEGylated micro-plasminogen variants (SEQ ID NO. 3; SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9. SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 18, SEQ ID NO. 20) as well as un-PEGylated micro-plasminogen (SEQ ID NO. 2) were further characterized. All the variants were checked for their purity on the SDS-PAGE. The protein sample was mixed in 5× loading reducing dye and separated on 12% polyacrylamide gel. Furthermore, the accurate molecular weights of both PEGylated as well un-PEGylated derivatives were determined by MALDI-TOF on ABISCIEX machine TripleTOF® 5600/5600 [
TABLE-US-00003 TABLE 3 Hydrodynamic size measurement (DLS) R.sub.h, Average Hydrodynamic Construct radius (nm) Micro-plasminogen (μPG) 2.6 (SEQ ID NO. 2) Mono-PEGylated μPG variants (20 kDa) 5.8 (SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 18, SEQ ID NO. 20) Mono-PEGylated μPG variants (40 kDa) 6.4 (SEQ ID NO. 4, SEQ ID NO. 7, SEQ ID NO. 9) Bi-PEGylated μPG variants (20 kDa-20 kDa) 4.7 (SEQ ID NO. 11, SEQ ID NO. 12)
Example 7
Evaluation of Activity of PEGylated Micro-Plasmin Variants
[0096] The PEGylated variants (SEQ ID NO. 4, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12) were assessed for amidolytic as well α.sub.2-AP inhibition activity.
[0097] The enzymatic activity of PEGylated-microplasmin variants were monitored with the substrate, Chromozym® PL (0.5 mM), at 37° C. in presence of 50 mM Tris-Cl, pH 7.4, 0.1 M NaCl and 0.5% BSA. Absorbance was recorded at 405 nm for 10 minutes. Enzyme activities of the all cysteine variants and their PEGylated forms were compared to that of wild type micro-plasmin [Table 4]. The results show that there amidolytic parameters were not substantially affected upon PEGylation, however, a slight increase in Michaelis-Menten constant (Km) values can be accounted for slightly reduced accessibility.
TABLE-US-00004 TABLE 4 Amidolytic parameters of wild-type and PEGylated micro-plasmin(ogen) variants Amidolytic Parameters Km Kcat kcat/Km Construct μM s.sup.−1 μM.sup.−1 s.sup.−1 Microplasminogen (μPG) 2013 ± 201 18 ± 0.8 0.008 (SEQ ID NO. 2) Mono-PEGylated μPG variants (20 kDa) 2290 ± 254 23.45 ± 2.5 0.010 (SEQ ID NO. 4, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10) Mono-PEGylated μPG variants (40 kDa) 2519 ± 430 26.05 ± 2.5 0.010 (SEQ ID NO. 4, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10) Bi-PEGylated μPG variants (20 kDa-20 kDa) 2310 ± 220 21.32 ± 4.5 0.009 (SEQ ID NO. 11, SEQ ID NO. 12)
[0098] α.sub.2-AP inhibition kinetics was performed by separately adding PEGylated micro-plasmin variants (20 nM) and antiplasmin (60 nM) to cuvette containing 100 mM sodium phosphate, pH 7.2 and incubating at 25° C. for the time interval ranging 15 sec-30 minutes. Change in absorbance at 405 nm was recorded at 60 s intervals after the addition of 0.5 mM Chromozym® PL. The residual enzyme activity was measured at different intervals from the slope of the curve and plotted as log % residual activity versus time (Wiman et al., 1978; Turner et al., 2002) as shown in
TABLE-US-00005 TABLE 5 In vitro half-life of inactivation of PEGylated and unmodified Plasmin(ogen) variants by α.sub.2-antiplasmin S. NO. Plasmin(ogen) variant In vitro Half-life 1. Wild-type Micro-plasmin >5 min (SEQ ID NO. 2) 2. Mono-PEGylated Micro-plasmin variant 6-7 min (20 kDa PEG) (SEQ ID NO. 4, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10) 3. Mono-PEGylated Micro-plasmin variant >7 min (40 kDa PEG) (SEQ ID NO. 4, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10) 4. Bi-PEGylated Micro-plasmin variant >10 min (20 kDa-20 kDa PEG) (SEQ ID NO. 11, SEQ ID NO. 12)
Advantages of the Invention
[0099] The present invention provides a method that can be utilized for designing of highly potent, longer-acting plasmin derivatives. Covalently modified plasmin variants capable of significantly retarding antiplasmin-mediated inhibition, offers an advantage of enhanced half-life thereby, making it “therapeutically effective” as compared to the unmodified plasmin and derivatives thereof. [0100] The composition comprising strategically designed PEGylated variants of micro-plasminogen possessing dual properties of delayed inhibition (evasion of inactivation) by endogenous α.sub.2-antiplasmin along with its intrinsic fibrinolytic ability would be beneficial for the treatment of various thrombotic disorders such as pulmonary embolism, myocardial infarction, or ischemic stroke. Furthermore, the retention of micro-plasmin activity for longer period by delaying the course of interaction with α.sub.2-AP inhibitor by appropriate placement of PEG groups would facilitate developing the conjugates as lower dose formulation/s. Moreover, the slow inhibitory reaction of micro-plasmin upon site-specific conjugation of a flexible PEG group, instead of a more rigid moiety or other disruptive mutation, would tend to prevent the undesired consequence of permanent inhibition of α.sub.2-AP, thereby maintaining the safety of micro-plasmin derivative molecules in thrombolytic therapy. [0101] To improve thrombolytic therapy, it is necessary to increase the rate and extent of clot lysis without inducing a systemic lytic state. These novel PEGylated micro-plasmin variants are expected to be attractive candidates for thrombolytics possessing controllable/tunable half-life.
REFERENCES
[0102] 1. Adivitiya, Khasa Y P (2017). The evolution of recombinant thrombolytics: Current status and future directions. Bioengineered 4; 8(4):331-358. [0103] 2. Ambrus J L, Ambrus C M, Bock N et al. (1957). Clinical and experimental studies on fibrinolytic enzymes. Ann New York AcadSci 68: 97. [0104] 3. Aoki N (2005). Discovery of alpha2-plasmin inhibitor and its congenital deficiency. J ThrombHaemost; 3:623-631. [0105] 4. Bailon P, Berthold W (1998) Polyethylene glycol-conjugated pharmaceutical proteins. Pharm SciTechnolo 1: 352-356. [0106] 5. Boyles P W, Meyer W H, Graff J, Ashley C C, Ripic R C (1960). Comparative effectiveness of intravenous and intra-arterial fibrinolysis therapy. In: Cliffton E C, ed. Symposiumon Fibrinolysis. Am J Cardiol 6:539-46. [0107] 6. Cazalis C S, Haller C A, Sease-Cargo L, Chaikof E L (2004) C-Terminal site-specific PEGylation of a truncated thrombomodulin mutant with retention of full bioactivity. BioconjugChem 15: 1005-1009. [0108] 7. Chapman A P (2002) PEGylated antibodies and antibody fragments for improved therapy: a review. Adv Drug Deliv Rev 54:531-545. [0109] 8. Chapman A P, Antoniw P, Spitali M, West S, Stephens S, and King D J (1999). Therapeutic antibody fragments with prolonged in vivo half-lives. Nat Biotechnol 17:780-783. [0110] 9. Chen W, Huang X, Ma X W, Mo W, Wang W J, Song H Y (2008). Enzymatic vitreolysis with recombinant microplasminogen and tissue plasminogen activator. Eye (Lond) 22:300-307 [0111] 10. Chiu K, Agoubi L L, Lee I, Limpar M T, Lowe J W, et al. (2010) Effects of polymer molecular weight on the size, activity, and stability of PEG functionalized trypsin. Biomacromolecules 11: 3688-3692. [0112] 11. Clifton E E (1957). The use of plasmin in humans Ann New York AcadSci 68: 209-29. [0113] 12. Cohen D, Lijnen H R (1991). Basic and clinical aspects of fibrinolysis and thrombolysis. Blood 78:3114. [0114] 13. Cohen D (1985). The Main Components of the Fibrinolytic System: Biochemical and Physiological Properties. European Heart Journal, 6; 193-195 [0115] 14. Cohen, D, Sinnaeve, P, Demarsin, E, Moreau, H, De Maeyer, M, Jespers, L, Laroche, Y, and Van de Werf, F (2000). Polyethylene glycol-derivatized cysteine-substitution variants of recombinant staphylokinase for single-bolus treatment of acute myocardial infarction. Circulation 102(15): 1766-72 [0116] 15. Crumrine R C, Marder V J, Taylor G M, et al. (2012). Safety evaluation of a recombinant plasmin derivative lacking kringles 2-5 and rt-PA in a rat model of transient ischemic stroke. Experimental & Translational Stroke Medicine 4:10. [0117] 16. De Smet M D, Valmaggia C, Zarranz-Ventura J, Willekens B (2009). Microplasmin: ex vivo characterization of its activity in porcine vitreous. Invest Ophthalmol Vis Sci 50(2):814-9. [0118] 17. Doherty D H, Rosendahl M S, Smith D J, Hughes J M, Chlipala E A, Cox G N (2005). Site-specific PEGylation of engineered cysteine analogues of recombinant human granulocyte-macrophage colony-stimulating factor. Bioconjug Chem. 16(5):1291-1298 [0119] 18. Fishburn C S (2008). The pharmacology of PEGylation: Balancing PD with PK to generate novel therapeutics. J Pharm Sci. 97: 4167-4183. [0120] 19. Gaberc-Porekar V, Zore I, Podobnik B, Menart V (2008). Obstacles and pitfalls in the PEGylation of therapeutic proteins. Curr. Opin. Drug Discov. Dev. 11:242-250 [0121] 20. Grace M, Lee S, Bradshaw S, Chapman J, Spond J, Cox S, Delorenzo M, Brassard D, Wylie D, Cannon-Carlson S, Ccullen, Indelicato S, Voloch M, and Bordens R. (2005) Site of pegylation and polyethylene glycol molecule size attenuate interferon-α antiviral and antiproliferative activities through the JAK/STAT signaling pathway. J. Biol. Chem. 280 (8), 6327-6336. [0122] 21. Greenwald R B, Choe Y H, McGuire J, Conover C D (2003) Effective drug delivery by PEGylated drug conjugates. Adv Drug Deliv Rev 55: 217-250. [0123] 22. Hamed E, Xu, T, Keten S (2013). Poly(Ethylene Glycol) Conjugation Stabilizes the Secondary Structure of A-Helices by Reducing Peptide Solvent Accessible Surface Area. Biomacromolecules 14, 4053-4060. [0124] 23. Hao Y, Chen J, Wang X, Zhu H, Rong Z (2006). Effects of site-specific polyethylene glycol modification of recombinant human granulocyte colony-stimulating factor on its biologic activities. BioDrugs 20: 357-362. [0125] 24. Harris J M and Chess R B (2003) Effect of pegylation on pharmaceuticals. Nat Rev Drug Discov 2:214-221. [0126] 25. Harris J M and Veronese F M (2003). “Peptide and Protein pegylation II—clinical evaluation”, Ad. Drug Del. Rev. 55: 1259-1350. [0127] 26. Hunt J A, Petteway S R Jr, Scuderi P, Novokhatny V (2008). Simplified recombinant plasmin: production and functional comparison of a novel thrombolytic molecule with plasma-derived plasmin ThrombHaemost 100(3):413-9. [0128] 27. Jensen V J (1976). U.S. Pat. No. 3,950,513. Process of stabilizing therapeutically useful plasmin solutions. Novo TerapeutiskLaboratorium (assignee). [0129] 28. King D J, Turner A, Farnsworth A P, Adair J R, Owens R J, Pedley R B, Baldock D, Proudfoot K A, Lawson A D, Beeley N R, et al. (1994) Improved tumor targeting with chemically cross-linked recombinant antibody fragments. Cancer Res 54:6176-6185. [0130] 29. Kurfurst, M M (1992). Detection and molecular weight determination of polyethylene glycol-modifedhirudin by staining after sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Anal Biochem 200, 244-248 [0131] 30. Lapchak P A, Araujo D M, Pakola S, Song D, Wei J, Zivin J A (2002). Microplasmin: a novel thrombolytic that improves behavioral outcome after embolic strokes in rabbits. Stroke. 33: 2279-2284. [0132] 31. Law, R H P, Sofian, T, Kan, W T, Horvath, A J, Hitchen, C R, Langendorf, C G, Buckle, A M, Whisstock, J C, Coughlin, P B (2008). X-ray crystal structure of the fibrinolysis inhibitor {alpha}2-antiplasmin. Blood 111: 2049-2052. [0133] 32. Marder V J, Landskroner K, Novokhatny V, Zimmerman T P, Kong M, Kanouse J J, Jesmok G (2001). Plasmin induces local thrombolysis without causing hemorrhage: a comparison with tissue plasminogen activator in the rabbit. ThrombHaemost 86: 739-45. [0134] 33. Marder V J (2011). Historical perspective and future direction of thrombolysis research: the re-discovery of plasmin. J ThrombHaemost; 9 (Suppl 1):364-73. [0135] 34. Meng, W, Guo X, Qin M, Pan H, Cao Y, Wang W (2012). Mechanistic Insights into the Stabilization of Srcsh3 by Pegylation. Langmuir, 28, 16133-16140. [0136] 35. Milla P, Dosio F, Cattel L (2012) PEGylation of Proteins and Liposomes: a Powerful and Flexible Strategy to Improve the Drug Delivery. Curr Drug Metab 13: 105-119. [0137] 36. Mok, H, Palmer D J, Ng P, Barry M A (2005). Evaluation of polyethylene glycol modification of first-generation and helper-dependent adenoviral vectors to reduce innate immune responses. Mol. Ther. 11, 66-79. [0138] 37. Nagai N, De Mol M, Lijnen H R, Carmeliet P, Collen D (1999). Role of plasminogen system components in focal cerebral ischemic infarction: a gene targeting and gene transfer study in mice. Circulation. 99: 2440-2444. [0139] 38. Nagai N, De Mol M, Van Hoef B, Verstreken M, Collen D (2001). Depletion of circulating α.sub.2-antiplasmin by intravenous plasmin or immunoneutralization reduces focal cerebral ischemic injury in the absence of arterial recanalization. Blood 97: 3086-92. [0140] 39. Nagai N, Demarsin E, Van Hoef B, Wouters S, Cingolani D, Laroche Y, Collen D (2003). Recombinant human microplasmin: production and potential therapeutic properties. J Thromb Haemost.1 (2): 307-313. [0141] 40. Novokhatny V (2008). Structure and activity of plasmin and other direct thrombolytic agents. Thromb Res. 122 (Suppl 3):S3-S8. [0142] 41. Ozbakir H F and Scott Banta (2018). Kinetic and Transport Effects on Enzymatic Biocatalysis Resulting from the PEGylation of Cofactors A IChE Journal 64 (1) [0143] 42. Pakola S, Cahillane G, Stassen J M, Lijnen H R, Verhamme P (2009). Neutralization of alpha(2)-antiplasmin by microplasmin: a randomized, double-blind, placebo-controlled, ascending-dose study in healthy male volunteers. ClinTher. 31:1688-1706 [0144] 43. Pandey B K, Smith M S, Torgerson C, Lawrence P B, Matthews S S, Watkins E, Groves M L, Prigozhin, M B, Price J L (2013) Impact of Site-Specific Pegylation on the Conformational Stability and Folding Rate of the Pin Ww Domain Depends Strongly on Peg Oligomer Length. Bioconjugate Chem. 24, 796-802. [0145] 44. Petersen T E, Martzen M R, Ichinose A, and Davie E W (1990). Characterization of the gene for human plasminogen, a key proenzyme in the fibrinolytic system. J. Biol. Chem. 265:6104-6111. [0146] 45. Qimeng Mu, Tao Hu, Jingkai Yu (2013). Molecular Insight into the Steric Shielding Effect of PEG on the Conjugated Staphylokinase: Biochemical Characterization and Molecular Dynamics Simulation. PLoS ONE 8(7). [0147] 46. Reed G L, Houng A K, Wang D (2014). Microvascular thrombosis, fibrinolysis ischemic injury, and death after cerebral thromboembolism are affected by levels of circulating α.sub.2-antiplasmin ArteriosclerThrombVasc Bio134:2586-2593. [0148] 47. Reed G L, Matsueda G R, and Haber E (1990.). Inhibition of Clot-Bound α.sub.2-Antiplasmin Enhances In Vivo Thrombolysis. Circulation 82(1):164-168. [0149] 48. Reed G L (2004) Compositions and methods for treating thrombotic treatments. WO 2004/045558 A2. [0150] 49. Reed G L (1997). Functional characterization of monoclonal antibody inhibitors of alpha 2-antiplasmin that accelerate fibrinolysis in different animal plasmas. Hybridoma. 16(3):281-6. [0151] 50. Robbins K C, Summaria L, Hsieh B, Shah R J (1967). The peptide chains of human plasmin. Mechanism of activation of human plasminogen to plasmin. J Biol Chem. 242: 2333-42. [0152] 51. Roberts M J, Bentley M D. Harris J M (2002). Chemistry for peptide and protein PEGylation. Adv. Drug Deliv. Rev. 54, 459-476. [0153] 52. Sakata Y, Aoki N (1982). Significance of cross-linking of α.sub.2-plasmin inhibitor to fibrin in inhibition of fibrinolysis and in hemostasis. J Clin Invest. 69:536-542. [0154] 53. Singh S, Houng A, Reed G L (2017). Releasing the brakes on the fibrinolytic system in pulmonary emboli: unique effects of plasminogen activation and α.sub.2-antiplasmin inactivation. Circulation. 135:1011-1020. [0155] 54. Suzuki Y, Chen F, Ni Y, Marchal G, Collen D, Nagai N (2004). Microplasmin reduces ischemic brain damage and improves neurological function in a rat stroke model monitored with MRI. Stroke. 35:2402-2406. [0156] 55. Thijs, V N, Peeters A, Vosko M, Aichner F and Schellinger P D et al., (2009). Randomized, placebo-controlled, dose-ranging clinical trial of intravenous microplasmin in patients with acute ischemic stroke, 40: 3789-3795. [0157] 56. Tovchigrechko A, Vakser I A (2006). GRAMM-X public web server for protein-protein docking. Nucleic Acids Res. 34:W310-4. [0158] 57. Turner R B, Liu L, Sazonova I Y, Reed G L (2002). Structural elements that govern the substrate specificity of the clot dissolving enzyme plasmin. J Biol Chem. 277:33068-74. [0159] 58. US FDA (2016). Jetrea® safety and utilization review. [0160] 59. Veronese F M (2001). Peptide and Protein P EGylation: a review of problems and solutions, Biomaterials, 22; 405-417. [0161] 60. Wang X, Terzyan S, Tang J, Loy J A, Lin X, Zhang X C (2000). Human plasminogen catalytic domain undergoes an unusual conformational change upon activation J. Mol. Biol. 295: 903-914. [0162] 61. Weir A N, Nesbitt A, Chapman A P, Popplewell A G, Antoniw P, and Lawson A D. (2002) Formatting antibody fragments to mediate specific therapeutic functions. BiochemSoc Trans 30:512-516. [0163] 62. Wiman B, Boman L, and Collen D (1978). On the Kinetics of the Reaction between Human Antiplasmin and a Low-Molecular-Weight Form of Plasmin Eur. J. Biochem. 87, 143-146. [0164] 63. Wiman B, Caen D (1979). On the mechanism of the reaction between human alpha 2-antiplasmin and plasmin. J Biol Chem. 254(18):9291-9297. [0165] 64. Wiman B, Lijnen H R, Cohen D (1979). On the specific interaction between the lysine-binding sites in plasmin and complementary sites in alpha 2-antiplasmin and in fibrinogen. BiochimBiophysActa 579: 142-54. [0166] 65. Yang K, Basu A, Wang M, Chintala R, Hsieh M C, Liu S, Hua J, Zhang Z, Zhou J, Li M, et al. (2003). Tailoring structure-function and pharmacokinetic properties of single-chain Fv proteins by site-specific PEGylation. Protein Eng 16:761-770. [0167] 66. Zheng J C, Lei N, He Q C, Hu W, Jin J G, et al. (2012). PEGylation is effective in reducing immunogenicity, immunotoxicity, and hepatotoxicity of alpha momorcharin in vivo. ImmunopharmacolImmunotoxicol 34: 866-873.