System and Method of Induced Mutant Protein Based on Activation-induced Cytidine Deaminase
20220090043 · 2022-03-24
Inventors
- Xionglei He (Guangzhou, CN)
- Li Liu (Guangzhou, CN)
- Chang Ye (Guangzhou, CN)
- Kehui Liu (Guangzhou, CN)
- Shanjun Deng (Guangzhou, CN)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/78
CHEMISTRY; METALLURGY
C07K2319/80
CHEMISTRY; METALLURGY
International classification
C12N9/78
CHEMISTRY; METALLURGY
C07K16/00
CHEMISTRY; METALLURGY
Abstract
The present invention provides a mutant protein of activation-induced cytidine deaminase, wherein hsAID is mutated with the following mutations: T82I, K10E, K34E, E156G, 181*, S38, H130, V152, R174, T100. The present invention also provides a High-efficiency Base Editor, including the mutant protein of activation-induced cytidine deaminase of the present invention and a DNA-specific binding protein, which are linked sequentially via a linking sequence. The present invention also provides a single-base locus-directed editing system, including single-base locus-directed editing proteins and target Hyper Mutation Fragment. Compared with the existing activation-induced cytidine deaminase (AID)-based single-base editing system, the mutant protein inducing system of the present invention has a smaller molecular weight and higher mutation efficiency.
Claims
1. A mutant protein of activation-induced cytidine deaminase, wherein hsAID is mutated with the following mutations: T82I, K10E, K34E, E156G, 181*, S38, H130, V152, R174, and T100; and compared with the sequence shown in SEQ ID NO:1, the corresponding nucleotide sequence of the mutant protein has at least 95% sequence identity.
2. A High-efficiency Base Editor, comprising the mutant protein of activation-induced cytidine deaminase as claimed in claim 1, a DNA-specific binding protein and a nuclear localization signal, the mutant protein of activation-induced cytidine deaminase and the DNA-specific binding protein are sequentially liked via a linking sequence, and the nuclear localization signal is located at the C-terminus of the High-efficiency Base Editor.
3. The High-efficiency Base Editor of claim 2, wherein the DNA-specific binding protein is a homing endonuclease; the corresponding nucleotide sequence of the DNA-specific binding protein is shown in SEQ ID NO: 2.
4. The High-efficiency Base Editor of claim 2, further comprising a UGI protein domain, the UGI protein domain is located after the DNA-specific binding protein and before the nuclear localization signal.
5. The High-efficiency Base Editor of claim 3, further comprising a UGI protein domain, the UGI protein domain is located after the DNA-specific binding protein and before the nuclear localization signal.
6. The High-efficiency Base Editor of claim 2, wherein, it is suitable for yeast system, and its corresponding nucleotide sequence is shown in SEQ ID NO: 3; it is suitable for Drosophila system, and its corresponding nucleotide sequence is shown in SEQ ID NO: 4; or it is suitable for zebrafish and mouse systems, and its corresponding nucleotide sequence is shown in SEQ ID NO:5.
7. A single-base locus-directed editing system, comprising the single-base locus-directed editing protein of claim 3 and a target Hyper Mutation Fragment.
8. A single-base locus-directed editing system, comprising the single-base locus-directed editing protein of claim 4 and a target Hyper Mutation Fragment.
9. A single-base locus-directed editing system, comprising the single-base locus-directed editing protein of claim 5 and a target Hyper Mutation Fragment.
10. A single-base locus-directed editing system, comprising the single-base locus-directed editing protein of claim 6 and a target Hyper Mutation Fragment.
11. The single-base locus-directed editing system according to claim 7, wherein the target Hyper Mutation Fragment includes the nucleotide sequence as shown in SEQ ID NO: 6 and SEQ ID NO: 7.
12. The single-base locus-directed editing system according to claim 8, wherein the target Hyper Mutation Fragment includes the nucleotide sequence as shown in SEQ ID NO: 6 and SEQ ID NO: 7.
13. The single-base locus-directed editing system according to claim 9, wherein the target Hyper Mutation Fragment includes the nucleotide sequence as shown in SEQ ID NO: 6 and SEQ ID NO: 7.
14. The single-base locus-directed editing system according to claim 10, wherein the target Hyper Mutation Fragment includes the nucleotide sequence as shown in SEQ ID NO: 6 and SEQ ID NO: 7.
15. A gene editing method, comprising using the single-base locus-directed editing system of claim 7.
16. A gene editing method, comprising using the single-base locus-directed editing system of claim 8.
17. A gene editing method, comprising using the single-base locus-directed editing system of claim 10.
18. A gene editing method, comprising using the single-base locus-directed editing system of claim 11.
19. A gene editing method, comprising using the single-base locus-directed editing system of claim 12.
20. A gene editing method, comprising using the single-base locus-directed editing system of claim 14.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
DETAILED DESCRIPTION OF THE INVENTION
[0042] In order to show the technical solutions, objectives and advantages of the present invention more concisely and clearly, the present invention will be further described in detail below in combination with specific embodiments and the accompanying drawings.
Example 1 Design and Optimization of Activation-Induced Cytidine Deaminase (AID)
[0043] 1. Screen AID with High Mutation Rate
[0044] The sequence of the deaminase gene family is obtained through sequence alignment, and classified into several major categories according to its structure on the evolutionary tree (
[0045] The deaminase gene is integrated into the induction expression vector (pGA) after codon optimization, and the mutation efficiency is determined in the yeast platform. The results can be seen in
[0046] By calculating the number of resistant clones, the mutation efficiency of each deaminase was estimated. From the analysis results (
[0047] Therefore, the subsequent experiments started with hsAID and thus modified and optimized the AID protein.
[0048] 2. Transforming and Optimizing AID to Obtain the Mutator
[0049] There adopted a semi-rational design strategy. With the help of bioinformatics methods, based on homologous protein sequence alignment, three-dimensional structure or existing knowledge, multiple amino acid residues are selected as targets for modification, combined with the rational selection of effective codons, and by constructing a high-quality mutant library, K10E, K34E, T82I, F115E, E156G, and R174E were tested for the substitution of 6 amino acid positions. In addition, according to the annotation of the AID protein domain, the C-terminus of the protein mediates the class switch recombination of immune gene loci. Therefore, it is inferred that removing the C-terminus of the AID protein can improve the stability of the target sequence and improve the mutation efficiency.
[0050] Test the combination of these loci in the same yeast screening platform to observe whether the efficiency of deaminase mutation can be improved. The experiment materials and methods refer to 7.2.7 and materials and methods 7.3.1 for the and analysis process. The test results are shown in
[0051] As shown in
Example 2 Screening and Optimization of DNA-Specific Binding Proteins
[0052] The reason why AID protein can induce high mutations at specific locus in vivo is due to a large number of cofactors and complex time-conditioning control mechanisms. If it is only a simple overexpression of AID protein, the mutation rate cannot reach a high level on the one hand, on the other hand, mutations will be randomly generated in all positions of the genome, thus triggering mutation burden. Therefore, the job of the “targeted recording” system requires the assistance of DNA-specific binding proteins. The “mutator” is pulled by a DNA-specific binding protein to target specific regions in the genome. In the following description, “DNA specific binding protein” is referred to as “targeter” for abbreviation.
[0053] Currently widely used DNA-specific binding proteins can be classified into three categories: zinc finger proteins, TALENs proteins, and CRISPR/Cas proteins. Wherein, zinc finger proteins have short recognition sequences and poor scalability and generally its one protein domain only recognizes specific 3 bases (nucleotide triplets), so multiple protein domains need to be linked in series to recognize specific sequences. Each structural unit of TALENs protein specifically recognizes a single base, by the combination of structural units, the recognition of any sequence can be achieved. However, there are a large number of repeating sequences in the DNA encoding TALENs, which are prone to develop recombination, which is not conducive to the construction of stable transgenic lines. CRISPR/Cas is currently the most widely accepted technology. It relies on specific guide RNA (gRNA) to achieve the combination of specific DNA sequences and it is convenient for modification. However, as a targeting protein, there are also several shortcomings: the protein structure is large (˜160 kDa), and as a binding protein, it will produce steric resistance effect, thus affects the function of the linking group; the long gene sequence (˜4 kb) has restrictions on the transgenic application of some species; strong protein binding ability reduces the possibility of single-strand opening, resulting in a shortened window for effective mutation of deaminase.
[0054] “Homing endonucleases” are meganucleases that recognize DNA sequences of 14-40 bp in length, which are very rare in the genome. By exogenously expressing homing endonuclease, homology directed repair can be specifically activated. I-SceI is a homing endonuclease found in yeast. Its recognition sequence (5′-TAGGGATAACAGGGTAAT-3′, SEQ ID NO: 6) is as long as 18 bp and has extremely high specificity. Its protein peptide chain length is 234 aa, the space structure is small. The cleavage active site of I-SceI can be mutated (D44N and D145A) to remove the cleavage activity of the protein, but retain the ability of DNA binding. Therefore, inactivated i-SceI (denoted as: d-iSceI) can be used as a specific DNA binding protein, and its nucleotide sequence is shown in SEQ ID NO:2. Therefore, i-SceI was selected for subsequent experiments.
Example 3 Preparation of High-Efficiency Base Editor (HBE) (Yeast System)
[0055] Through the screening and optimization of “mutator” and “targeter”, the two core parts of the “recording protein” in the target recording system were initially obtained. Use a flexible peptide chain to connect the two parts to obtain the prototype of the recorded protein. Then, by overall optimizing the fusion protein, and adding other enhancing elements, there obtained the “High-efficiency Base Editor (HBE)”.
[0056] Further optimizing and screening the AID protein: Using the AID5 protein in Example 1 as a template, a mutation library of the AID protein was obtained by error-prone PCR. In the final library, each molecule contained about 4 base substitution mutations. After gel recovery, the AID library was constructed into the pGA induction vector with a library size of about 10.sup.5. The plasmid library was transformed into GIL104 yeast strain by lithium acetate transformation method, and positive clones were screened on SC-Leu−/GLU+ agar plate. Randomly pick about 3000 yeast single clones and inoculate them into SC-Leu−/GAL+ liquid medium to induce the expression of AID protein. Each single clone was independently induced in a 96-well plate, and the pGA-AID5 strain was set as the control group. The TLC experiment was the same as the above experiment method.
[0057] According to the results of the TLC experiment, the mutants with a higher number of resistant clones than the control group (AID5) were selected, and the sequence of the AID mutant was amplified by yeast colony PCR for Sanger sequencing. Since the library screening method only comes from a single experimental repeating, the estimation of mutation efficiency is affected by the fluctuation effect. Therefore, the amplified gene was reconstituted into the pGA vector for the second round of TLC screening. In the second round of screening, 20 parallel induction experiment groups were set up for each clone. Finally, the fluctuation analysis of the TLC results in the second round of screening found a mutant with a slight increase in mutation efficiency (
[0058] Further optimization and screening of DNA-specific binding proteins: In order to replace and screen better binding proteins, other proteins in the homing endonuclease family are also inactivated at the cleavage site. After being linked to the AID10 protein, they are also tested for DNA binding capability. The test strain is GIL104 yeast with the corresponding binding sequence integrated downstream of the CAN gene. The process of TLC experiment and fluctuation analysis is similar to the previous ones.
[0059] From the results of the fluctuation analysis (
[0060] Since the nuclear localization of the protein is the prerequisite for HBE to act on DNA. The N-terminal of the AID protein carries a human-derived nuclear localization signal, but in cross-species applications, the human-derived localization signal may be relatively inferior. Therefore, in downstream applications, the SV40 nuclear localization signal is added to the C-terminus of the HBE protein. The SV40 localization signal is derived from the large T antigen of the virus SV40 (sequence: PKKKRKV, SEQ ID NO: 8), which has been verified to have a good localization effect in multiple species.
[0061] After the cytosine is mutated to uracil, the DNA uracil carbonylase (uracilDNA glycosylase, Ung) in vivo can recognize the abnormalities of the DNA and repair them. Uracil Glyco-sylase Inhibitor (Ugi) is found in Bacillus subtilis bacteriophage PBS2. This protein can form a complex structure with Ung protein, thereby weakening the deamination ability to repair mutations. Therefore, adding the UGI protein domain to the HBE protein improves the efficiency of deaminase mutagenesis. The final HBE protein structure applied to the lineage is shown in
Example 4 Preparation of HBE Protein in Drosophila
[0062] The HBE protein in Drosophila realizes controllable expression in time and space under the control of the GAL4-UAS system (
Example 5 Preparation of HBE Protein in Zebrafish and Mice
[0063] The structure of the zebrafish HBE protein is the same as that in Drosophila (
Example 6 Design and Optimization of the Target Hyper Mutation Fragment (HMF)
[0064] Through manual design and optimization, after obtaining the targeted recording protein (HBE), the problem of targeting fragment also needs to be solved. On the one hand, since the i-SceI recognition sequence is fixed, the recognized sequence does not exist in the genome of higher model organisms, so it is necessary to introduce an exogenous targeting fragment.
[0065] However, the length of the foreign targeting fragment is bound to be limited. On the other hand, because deaminase-induced mutations are sequence-biased, it is necessary to design target mutation hotspots.
[0066] Therefore, in this embodiment, the target fragment suitable for higher model organisms was designed, and the design and optimization process are shown in
[0067] 1) According to the known mutation loci, train the scoring algorithm, design and screen out the “target Hyper Mutation Fragments” (abbreviated as HMF). (in silico)
[0068] 2) Import the sequence into the system expressing HBE protein, and analyze the mutation rate of the target fragments through high-throughput sequencing data. (yeast)
[0069] 3) Design the target fragment according to the analysis result. (in silico)
[0070] The final target hyper mutation fragments are as follows:
[0071] Forward iSceI binding motif: 5′ TAGGGATAACAGGGTAAT3′ (SEQ ID NO:6);
[0072] Reverse iSceI binding motif: 5′ ATTACCCTGTTATCCCTA3′ (SEQ ID NO:7).
[0073] The above target Hyper Mutation Fragments were used in yeast to test the targeting ability, and the results are as follows:
TABLE-US-00001 >HMF1 (368 bp) (SEQ ID NO: 9) CAGGTGGGTAAGCAAACTGGTTCCAATGCTGGCACCTAGGCTTGCCAGCA TGCTTAGGTAGGTTGGTGCCCAGGTGAGCTTAGGAACTAGCTTGCCAACT AGCCTGCTGGTACACCTGTGCCTGCTAGCATGCCGGTTAGTACCCAGGTA AGCCTACCAGTTAGCTATTACCCTGTTATCCCTATACGTAGGGATAACAG GGTAATAGCTAGTAGGCTTACTAACTTACTAACCGGTTTACTCCAATGCC AGCCAGCCTAGGAGTTTGCCTACTAGCTTGCTAGTAGGTTCAGGTGAGCT AGCTAACCAGCAAGTTGGTATACCAACCAGTTAGTAAGCATGCTGGTAAG CCAGTAAACCTGCTGGCT >HMF2 (752 bp) (SEQ ID NO: 10) TACTCCAATAGGCCAAGGCATTGGCCTACAGGTGGGCTAGCAAGCAAGCC TACTCAGGTGAGCTAGCTTACCTACTAGCTGGCTAACCAGCTAGCAAACC AGCAGGTAAGTTCACCTGGGCATAGGTACTGGTACAGGTGTAGGAACCAA CTGGCAGGTAGGTAGGTAATTACCCTGTTATCCCTATCAGTAGGGATAAC AGGGTAATAGCAAACCGGTTAGTTTACCTAGGTGCCCACCTGAGCACCTA AGCTCAGGTGAGCCGGCTAGCTAGCTGGTTTACCTTGGAGCTTGCCTACT CAGGTGAGCCTGCCAACCTACTAGCCAGTTGGTTTGCCGGTAGGTTAACC AGTTGGCAAGCCTGCCCACCTGCAGGTGCAATTCCAGGTGGGTAAGCAAA CTGGTTCCAATGCTGGCACCTAGGCTTGCCAGCATGCTTAGGTAGGTTGG TGCCCAGGTGAGCTTAGGAACTAGCTTGCCAACTAGCCTGCTGGTACACC TGTGCCTGCTAGCATGCCGGTTAGTACCCAGGTAAGCCTACCAGTTAGCT ATTACCCTGTTATCCCTATACGTAGGGATAACAGGGTAATAGCTAGTAGG CTTACTAACTTACTAACCGGTTTACTCCAATGCCAGCCAGCCTAGGAGTT TGCCTACTAGCTTGCTAGTAGGTTCAGGTGAGCTAGCTAACCAGCAAGTT GGTATACCAACCAGTTAGTAAGCATGCTGGTAAGCCAGTAAACCTGCTGG CT
[0074] The above target Hyper Mutation Fragments were used in Drosophila, zebrafish or mice to test the targeting ability, and the results are as follows:
TABLE-US-00002 >HMF3k (2940 bp) (SEQ ID NO: 11) AGCTTACTAACCAGCCAACTAGCTGGCTAGCAGGTAAACCTGCCAGCCTGC CGGCTCAGGTGAGCCAGTTAGTAGGCAAGTAAGCTCACCTGTAGGGGCTTTGGAGC AGGTATTGGAGTACAGGTGTAGGTTGGAGTTAGCCAGTAGGTTCACCTGATTACCC TGTTATCCCTACAGGTGAGCAGGCTAGCAAGTAGGTTCCAATGCCGGCTGGTAAGC ATACCAACTCCAAAGTTCACCTGCAGGTGTAGGTACCTAGGCACCTGCACCTGGGCA TAGGTGCTCCTAAGCTAGCAAACCGGTACCTATACTCAGGTGAGCTAGCAAGCTCAG GTGTAGGGATAACAGGGTAATAGCTAACCTACTAGTTGGCTAACCCCAACCAATA CTTAGGAGCTGGCAGGCTAGTTTACTAGCTCAGGTGCAGGTGAGTAAGTACACCTGT GCCAGTAAGCACCTAAGCCAACCAGCCCAGGTGAGCCAACTTGCTGGCAAACCTAC TGGTATACCATTACCCTGTTATCCCTAAGCTGGTAAGCTTACCCCTATACTCACCTG TGCCAGCCCAGGTGAGCAAGTTGGTATACCCACCTGCAGGTGAGTAGGCTAGTAAG CTAGCTAGTATGCTAGCTGGTTAGTTTGCCGGCTGGCTCCAAAACTAGTTGGTTGGC TCAGGTGTGCCGGTTTAGGGATAACAGGGTAATTGCTCCTACAGGTGAGTAGGCTT ACCAGCTCAGGTGAGCAAGCTTGCTCCAATAGGTAGGTTGGAGCATGCCAGTTAGCT TTGGAGCTCAGGTGAGTTTGCCAGTAGGTAAACTAGTATACTTGCTAGCTGGCAAGC CGGTTAGTAGGCTCCTAATTACCCTGTTATCCCTACCAAAACCTGCCCCTAAGCTA GTATAGGAGCCGGTTAGCCAACCAGTACCAACCTAAGCACACCTGAGCTAGCAAAC TAGTACCTATACTTGCCAGCAGGCTAGCTTACCAGTAAGTAGGCACAGGTGTGCCCC TAAGCCAGCTGGCAAGCTTAGGGATAACAGGGTAATGGCTGGCTTGCCAGCAGGT TTACCAACTAACCTAGGAACCAACTAACTTGCTCCAAAGCAAGCAAACTCACCTGG GCATGCCCCTAAGCTAGTAAACCCAGGTGAGCAGGTAGGTAAGTTTACCAGCCAAC TTACCCAGGTGAACCAGTTCACCTGATTACCCTGTTATCCCTATGCTAGCATACTT GCTTGCCGGCATGCTTGCTAGTACCAAAACTAGCTGGTTGGCACAGGTGGGCTTGCT TAGGCACCTGAGCAGGCAGGCTAGTACCTAAGCCAACCGGCAAGTAAGTTAGTAGG CTCCAAAGTTCAGGTGTTGGAGTTAACTTAGGGATAACAGGGTAATAGTAGGTAG GTTAGCTGGTTAGTAAGCTTGCCTTGGAGCTTGCTAGTTTGCTAGTTTACCAACTAAC CGGCAAGTTAACTTTGGCACCTGTTGGTAGGCCTAAGCTTGCCAGCCCACCTGAACC TGCCCAGGTGGGCACACCTGAGTATGCCTTGGATTACCCTGTTATCCCTAAGCACA CCTGAGCAAGCTAGTACAGGTGCACCTGCAGGTGCCTACACCTGGGTAGGCTAACT CACCTGTGCCTGCCTGCTGGCACACCTGAACTGGTTGGCACCTATGCCAGCTTGCCA ACCGGCTTAGGTAGGTACCAGCCGGTATACTAGCTAACTAACCTAGGGATAACAGG GTAATCACCTGAGTAAACCCCTAGGTAAGTACAGGTGTACCAGCTGGTTGGTTCCA ACCTAAGCTTTGGTTGGTGCCGGCTGGTTTACCGGTATACTCCAACACCTGAGCTGG TACCTAGGCTTACTCACCTGCAGGTGGGCTGGTACCTATGCCAACCAACCATTACCC TGTTATCCCTACACCTGTTGGAGCTTTGGCACCTGAGCACACCTGGGCTGGCATGCT TAGGCACCTGGGTAGGCTTAGGCAGGTGAGCAGGCTAGCTGGTAGGTTAGCCGGTA CACCTGAGTTTACTCAGGTGCCTAAGCTGGTTTAGGAGCTGGTATAGGGGCATTGGA GCATAGGGATAACAGGGTAATGGCTGGCAGGTTAACCAACTAACCAACTCCTAAG CCGGTAGGCTAGCTAGCATACCTGCTAGCCCCAACACCTGTACCAGCAGGCAAGCT GGCTCCTAAACTAGTACAGGTGAACCTGCCGGCTAGCTAGCTTAGGGGCTAGCCAGT AGGTTATTACCCTGTTATCCCTAAGCTAGCCTGCCAGCTCCTATGCTAGTTAGCAA GCTGGTAGGCTGGCTAGCCTGCCTACTTACCGGTTGGTAGGTAAACCCACCTGAGCA TGCCGGTATGCCTAGGGGCTTGCCTGCCAGCCAACCTAGGTGCTGGCACCTATGCCT ACTTAGGGATAACAGGGTAATAACTGGCTCCAACACCTGTACTAGCAAGCTTGCCA GCAAGTATAGGCACCTGAGCTAACTAGCTTAGGAACCCACCTGGGCATAGGAACCA GCTAGTTAGCTCCAAAGCTAACCCCTAGGTTGGTTTGCCAGCACACCTGTACTTACC CACCTGTACTATTACCCTGTTATCCCTAAGTTAACTCCTAAGCCCACCTGTACCAA CCAGTAGGCATTGGAGTTGGCTGGTACCTAGGCTGGCTAGCCAGCTGGTAAGCAAG CAAGTTTACCCAGGTGGGCTCCTACAGGTGAGCTCCTAAGCTCACCTGGGTACCAAG GCTGGCAAGCAAGCCTAGGGATAACAGGGTAATAGCTGGCTAGTTGGTAGGCTAG CTTAGGGGCTGGCTAACCAGCAGGTAAGTAAGCACCAAAGCAGGTTGGTAAACCTT GGCAGGTGAGTTGGCTAGCTTTGGAACTAGCCAGTTTACCTAGGAACTAGTTCCTAA GCTAGTAGGTTAGTA
Example 7 Verification of the Mutation Effect Induced by the Single-Base Locus-Directed Editing System Constructed by the Present Invention
[0075] (I) Strain Construction of tet-SLOTH Mice
[0076] Mouse HBE protein (mHBE) had been codon optimized and HA protein tag was added. From N-terminus to C-terminus are: AID10, 3×(GGGGS) (SEQ ID NO: 12) linker, d-iSceI, 10aa GS rich linker, HA protein tag and SV40 nuclear localization signal, respectively. mHBE is linked between the Tet promoter and the β-globin polyA termination signal; the HMF3k tag sequence has two ends added with specific amplification sequences that can be used for specific amplification in the mouse genome, and is placed downstream of the mHBE expression frame. Together they form the tet-SLOTH system. The system uses Cas9-mediated transgene technology to integrate into the mouse H11 (Hipp11) locus between the Eif4enif1 and Drg1 genes. The H11 locus is located on mouse chromosome 11 and has been confirmed to be used for the stable and high-efficiency expression of foreign genes. The transgenic locus was identified by Southern blot and confirmed to be a single copy. The map of the tet-SLOTH system in the mouse H11 transgenic locus is shown in
[0077] After mating between tet-SLOTH mice and rtTA strain mice (JAX ID: 006965), in the progeny of tet-SLOTH+/rtTA+, the stably expressed rtTA protein binds to the Tet promoter upstream of HBE under the effect of doxycycline (Dox), and induces the expression of HBE protein. By controlling the intake of Dox in mice, the switch of the SLOTH system can be regulated, as shown in
[0078] (II) Strain Construction of Lox-SLOTH Mice
[0079] Similar to mice of the tet-SLOTH strain, the lox-SLOTH system consists of two parts: mHBE and HMF3k. The mHBE protein was connected between the chicken β-actin promoter and the polyA termination signal, and a termination signal of 3 tandem repeats with LoxP recombination loci at both ends was inserted between the promoter and the mHBE gene. The system integrated a single copy into the Rosa26 locus in the mouse. Rosa26 locus is located on mouse Chromosome 6, and is the most commonly used safe harbor for mouse transgenic system. The foreign gene integrated into Rosa26 locus could be stably expressed. The map of the lox-SLOTH system in the mouse Rosa26 transgenic loci are shown in
[0080] In order to verify whether the mutation inducting system can normally function in mice, a transgenic mouse strain of tet-SLOTH was selected and the following experiment was designed: mice homozygous for tet-SLOTH locus and mice heterozygous for rtTA were mated, the genotypes of the progeny were: tet-SLOTH+/rtTA+ and tet-SLOTH+/rtTA−. From 3 days before mating, the mother mice were fed Dox (2 mg/day) in the form of feed intake, and the fetuses could absorb Dox through the placenta to activate the expression of HBE. By comparing the survival rates and phenotype of the progeny of the two genotypes, it can be determined whether the system has an effect on the development of mice. In terms of the number of progeny (F1), there is no significant difference between tet-SLOTH+/rtTA+ and tet-SLOTH+/rtTA−, and there is no abnormality in development.
[0081] Two time points, E14 and P1, were selected, and after the individuals with tet-SLOTH+/rtTA+ were identified by PCR, the whole transcriptome sequencing was performed respectively. First, isolate the hind limbs of the mouse for RNA extraction; then take 1 μg of total RNA from each sample to construct a transcriptome sequencing library; finally, use the Illumina NovaSeq platform for high-throughput sequencing. The data volume of a single sample is greater than 8 Gb, and the sequencing length is PE150. The analysis steps of the sequencing data are as follows: 1) Use fastp to control the quality of the sequencing data, and filter the sequences whose average quality is lower than Q35. 2) Using the map of the locus (
[0082] In order to compare the mutations on a single molecule of HMF3k, different organ types in each individual mouse were amplified, monoclonalized with TOPO cloning kit, and single clones were randomly selected for Sanger sequencing. It can be seen from
[0083] The above-mentioned embodiments only convey several embodiments of the present invention, and the descriptions are more specific and detailed, but they should not be understood as limiting the scope of the present invention. It should be pointed out that for those of ordinary skilled in the art, without departing from the concept of the present invention, several modifications and improvements can be made, and these all fall within the protection scope of the present invention. Therefore, the protection scope of the present invention should be subject to the appended claims.