Soybean Transgenic Event IND-00410-5

20220090114 · 2022-03-24

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention relates to the fields of plant production, plant breeding and agriculture. More specifically, it relates to soybean transgenic event IND-ØØ41Ø-5, which expresses the gene HaHB4 that confers drought tolerance without affecting other agricultural capabilities. The application also discloses related nucleotide sequences, plants, parts of plants, seeds, cells, agricultural products, and detection and production methods.

    Claims

    1. A soybean plant or a part thereof comprising the event IND-ØØ41Ø-5, wherein representative soybean seeds comprising the event IND-ØØ41Ø-5 have been deposited under ATCC PTA-125535 access number.

    2. A seed of the plant according to claim 1, wherein the seed comprises the event IND-ØØ41Ø-5.

    3. A commodity product produced with the seed according to claim 2.

    4. The commodity product according to claim 3, additionally defined as meal, flour, flakes, oil, biodiesel, biogas, or other biomaterials.

    5. A part of the soybean plant according to claim 1, defined as a cell, pollen, ovule, flower, shoot, root or leaf.

    6. A plant according to claim 1, wherein said plant has improved yield under conditions of abiotic stress with respect to the plant without the event in the same conditions.

    7. The soybean plant according to claim 1, also defined as a progeny plant of any generation of a soybean plant comprising said event IND-ØØ41Ø-5.

    8. The soybean plant according to claim 1, wherein said plant genome comprises a DNA molecule comprising SEQ ID NO: 1.

    9. The soybean plant according to claim 7, wherein DNA derived from said plant produces a diagnostic amplicon for the event IND-ØØ41Ø-5 when tested in a DNA amplification method, comprising said amplicon SEQ ID NO: 2 or SEQ ID NO: 3.

    10. The seed according to claim 2, wherein the seed DNA produces a diagnostic amplicon for the event IND-ØØ41Ø-5 when tested in a DNA amplification method, comprising said amplicon SEQ ID NO: 2 or SEQ ID NO: 3.

    11. The meal, flour, flakes, oil, biodiesel, biogas, or other biomaterials according to claim 4, additionally defined as comprising a DNA molecule that produces a diagnostic amplicon for the event IND-ØØ41Ø-5 when tested in a DNA amplification method, said amplicon comprising SEQ ID NO: 2 or SEQ ID NO: 3.

    12. A recombinant DNA molecule comprised in the event IND-ØØ41Ø-5, characterized by comprising the sequences SEQ ID NO: 2 and SEQ ID NO: 3 and is represented by the deposit under access number ATCC PTA-125535.

    13. A DNA molecule according to claim 12, characterized by improving the yield of a soybean cultivar under abiotic stress conditions.

    14. The recombinant DNA molecule according to claim 12, characterized in that said recombinant DNA molecule is formed by the splicing of a heterologous nucleic acid molecule of SEQ ID NO: 4 and genomic DNA of a soybean plant, plant cell or seed.

    15. The recombinant DNA molecule according to claim 12, characterized in that said DNA molecule is found in a soybean plant, plant cell, seed, progeny plant, part of the plant, or commodity product derived from the soybean transgenic event IND-ØØ41Ø-5.

    16. A DNA molecule comprising a nucleic acid molecule having a nucleotide sequence complementary to a sufficient portion of the contiguous nucleotide sequence of SEQ ID NO: 1 to operate as a DNA probe hybridizing under stringent conditions to a DNA molecule comprising a nucleotide sequence of SEQ ID NO: 1 and not hybridizing under stringent conditions to a DNA molecule not comprising a nucleotide sequence of SEQ ID NO: 1.

    17. A DNA polynucleotide primer molecule comprising at least 15 contiguous nucleotides of SEQ ID NO: 1, or its complement that is useful in a DNA amplification method to produce a diagnostic amplicon for the event IND-ØØ41Ø-5.

    18. An isolated DNA polynucleotide primer molecule comprising the sequence of SEQ ID NO: 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 2527, 203, 378, 1970, 1747, 1748, 1745, 1746, 822, 1127, 817, 818, 868, 752, 530, 531, 527, 528, 718, 719, 934, or 935.

    19. An isolated DNA polynucleotide probe molecule comprising the sequence of SEQ ID NO: 819, 532, 529, 720, or 936.

    20. An expression vector functional in plants characterized by comprising the sequence SEQ ID NO: 43.

    21. A microorganism according to claim 1 comprising a nucleic acid molecule having a nucleotide sequence consisting of SEQ ID NO: 4.

    22. The microorganism according to claim 21, wherein said microorganism is a bacterium.

    23. The microorganism according to claim 22, characterized in that the bacterium es Agrobacterium tumefaciens.

    24. Use of a vector according to claim 20, to transform plants.

    25. Use of a microorganism according to any of claims 21 to 23, to transform plants.

    26. A DNA detection kit comprising at least a DNA molecule comprising a nucleotide sequence with a sufficient length of contiguous nucleotides of SEQ ID NO: 1 to operate as DNA primer or specific probe to detect the presence of DNA derived from soybean transgenic event IND-ØØ41Ø-5, wherein detection of said DNA is diagnostic of the presence of said soybean transgenic event IND-ØØ41Ø-5 in a sample.

    27. A method for producing a soybean plant tolerant to abiotic stresses, comprising the steps of: (a) introducing into the genome of a soybean cell the event IND-ØØ41Ø-5; (b) selecting the cells containing the bar marker gene; and (c) regenerating a soybean plant from the cell of item (b).

    28. A method for producing a soybean plant tolerant to abiotic stresses, comprising the steps of: (a) crossing a first soybean plant comprising the event IND-ØØ41Ø-5 with a second soybean plant lacking the event IND-ØØ41Ø-5 to produce the progeny plants; and (b) selecting at least a first progeny plant comprising the event IND-ØØ41Ø-5 and that is tolerant to abiotic stresses.

    29. The method according to claim 28, further comprising selfing said first progeny plant to produce progeny plants from second generation and selecting at least one first homozygous plant for the event IND-ØØ41Ø-5.

    30. A method for detecting the presence of DNA corresponding to soybean event IND-ØØ41Ø-5 in a sample, characterized by comprising: (a) comparing a sample comprising soybean DNA with a set of primers, that when used in an amplification reaction of nucleic acid with genomic DNA of soybean event IND-ØØ41Ø-5, produces a diagnostic amplicon for soybean event IND-ØØ41Ø-5; and (b) performing a nucleic acid amplification reaction, thus producing the diagnostic amplicon; (c) detecting the diagnostic amplicon.

    31. A method for determining the zygosity of soybean genome containing DNA from the event IND-ØØ41Ø-5, comprising: a) contacting the sample with different pairs of primers and probes that, i) when used in an amplification reaction of nucleic acid with the soybean event IND-ØØ41Ø-5, produces a diagnostic amplicon which is a positive diagnostic for soybean event IND-ØØ41Ø-5; and ii) when used in an amplification reaction of nucleic acid with soybean genomic DNA that is not IND-ØØ41Ø-5, produces an amplicon diagnostic for soybean wild-type genomic DNA or other than the event IND-ØØ41Ø-5; b) performing an amplification reaction of nucleic acid; and c) detecting said amplicons; wherein the presence of said amplicons is diagnostic for a heterozygous genome in said sample, and wherein the presence of only one of the amplicons is diagnostic for a homozygous genome in said sample, of the event IND-ØØ41Ø-5 or of a wild-type, depending whether the primers are those mentioned in i) or ii).

    32. A method for producing a commodity product manufactured from soybean comprising, (a) obtaining the soybean plant or a part thereof according to claim 1; and (b) manufacturing a commodity product from the soybean plant or a part thereof.

    33. The method according to claim 32, wherein the commodity product is defined as meal, flour, flakes, protein isolate, oil, biodiesel, biogas, or other biomaterials.

    34. A nonliving plant material comprising a recombinant DNA molecule according to claim 12.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0042] FIG. 1. Map of the plasmid pIND2-HB4. a) Binary vector plasmid with the T-DNA. The fragments resulting from NdeI digestion are indicated as Left Right arrows along with their sizes. LB, left border; RB, right border. Probes are presented in thick Left Right arrows. b) Detailed T-DNA portion of the pIND2-HB4 plasmid. HindIII digest fragments are presented as arrows along with their minimum respective sizes to the LB and RB, respectively. NdeI digest fragments are presented. The expected size of the NdeI internal digest was 2703 bp long.

    [0043] FIG. 2. Transformation constructs and expression levels of HB4 events. A—Genetic description of the regulatory elements in the three different plasmids (a, b and c) used for obtaining the (pIND1:HB4=a), (pIND2:HB4=b) and (pIND3:HB4=c) transgenic events. B—Hahb-4 and bar genes relative expression levels. Relative values referred to water control treatment.

    [0044] FIG. 3. Water stress tolerance under controlled conditions. A—Representative plants after a period of water deprivation during V2, R2 and R4 developmental stages. B—Recovery rate as the number of plants without wilting symptoms after a period of water restoration, from the total plants used in the experiment. C—Water 10 loss measured at 1-hour intervals for a period of 10 hours, from detached leaves of each transgenic event and the non-transgenic control.

    [0045] FIG. 4. Ethylene sensitivity and darkness treatment. A—Stay green phenotype on leaves after ethephon and darkness treatments. Stay green phenotype in water treated leaves, as the negative control, is also shown. B—Hypocotyl hook as part of the ethylene triple response, at five ethephon concentrations. C—UV/Vis absorption spectrums from the leaves presented in A. Photosynthesis related carotenoids (pike at 480 nm) and the photosynthetic pigments chlorophyll A and B (pikes at 665 nm and 649 nm respectively) for each genotype. The lines correspond to samples collected from the water treatment and the lines correspond to samples collected from the ethylene/darkness treatments. D—Quantification of seedlings with hypocotyl hook formation at a 25 μM Ethephon solution.

    [0046] FIG. 5. Yield and yield components differences across environmental index for 4 independent transgenic events. Seed yield (a), seed number (b) and seed size (c) differences (%) between transgenic events and the non-transgenic control at low (L<2500 kg ha-1), medium (M=2500-3500 kg ha-1) and high (H>3500 kg ha-1) yield environments. Stars indicate statistically significant differences at p<0.05 for the mean values.

    [0047] FIG. 6. Yield and yield components differences across environmental index for the selected event (b1). Seed yield (a), seed number (b) and seed size (c) differences (%) between b1 transgenic event and the non-transgenic control for al low (L<2500 kg ha-1), medium (M=2500-3500 kg ha-1) and high (H>3500 kg ha-1) yield environments. Stars indicate statistically significant differences at p<0.05 for the mean values

    [0048] FIG. 7. Venn diagram of differentially expressed genes. A—Number of differentially expressed genes between water stressed and well-watered treatments for the b1 transgenic event and the non-transgenic control genotype.

    [0049] FIG. 8. Comparison of GO enrichment in DE genes. The results are summarized in biological process, cellular component and molecular function. The y-axis indicates the gene ontology categories; the x-axis indicates the number of DE genes.

    [0050] FIG. 9. Southern blots of T5 IND-ØØ41Ø-5 plant DNA digested with HindIII and NdeI. Blots were hybridized with DIG-labeled probes for a) HaHB4 and b) bar detection, respectively. DNA bands in IND-ØØ41Ø-5 digests hybridizing to indicated probes are highlighted in white boxes. Williams 82+200 pg plasmid DNA and 100 pg plasmid DNA were used as positive controls. DIG-labeled Marker VII ladder band sizes are indicated on the left of the blots in kb.

    [0051] FIG. 10. Junction Sequence Analysis of event IND-ØØ41Ø-5. A vertical line in the sequence alignment indicates the junction between the T-DNA and the soybean chromosome. Columns from left to right: vector name, position of the JS in the vector, numbers of read supporting JS, name of the read, and the partial sequence. Last row, fourth column in each JS, indicates the element where the JS begins. The insertion site and structure were confirmed by assembling the raw sequence data de novo using the Velvet assembler software (sequences were aligned considering only the last 30 bases of the T-DNA insert; all the Illumina-generated reads were 101 bp long).

    [0052] FIG. 11. Schematic representation of IND-ØØ41Ø-5 insertion locus and native allele. A) Scheme of the insertion in IND-ØØ41Ø-5 showing the elements present in T-DNA and primers used for analysis of segregation in F2 plants. The labeled primers 868 and 752 were used to assay for the presence of the Left Border Junction. B) Scheme of native allele showing the elements present in insertion region (without the T-DNA) and primers used for PCR test of segregation in F2 plants. Primers 934 and 935 were used to assay for the presence of the native allele. Gm: Glycine max, Chr9: chromosome 9, UTR: untranslated region, CDS: coding sequence.

    [0053] FIG. 12. Schematic representation of the insertion in IND-ØØ41Ø-5. The scheme shows 4 detection systems from different elements of the insert in the event IND-ØØ41Ø-5. Three of them correspond to TaqMan detection systems (HaHB4, bar and flank to RB) while one corresponds to an end-point PCR system (flank to LB).

    [0054] FIG. 13. Transgenic event and control yield for 16 evaluated sites. Darker Solid Circles indicate the sites for which transgenic event had higher yield than control and lighter circles are the sites for which the event had lower yield than control.

    BRIEF DESCRIPTION OF THE SEQUENCES

    [0055] SEQ ID NO: 1 DNA sequence corresponding to insert and contiguous genomic regions.

    [0056] SEQ ID NO: 2 DNA sequence corresponding to right flanking sequence.

    [0057] SEQ ID NO: 3 DNA sequence corresponding to left flanking sequence.

    [0058] SEQ ID NO: 4 DNA sequence corresponding to insert.

    [0059] SEQ ID NO: 5 DNA sequence corresponding to primer 750.

    [0060] SEQ ID NO: 6 DNA sequence corresponding to primer 751.

    [0061] SEQ ID NO: 7 DNA sequence corresponding to primer 752.

    [0062] SEQ ID NO: 8 DNA sequence corresponding to primer 753.

    [0063] SEQ ID NO: 9 DNA sequence corresponding to primer 754.

    [0064] SEQ ID NO: 10 DNA sequence corresponding to primer 755.

    [0065] SEQ ID NO: 11 DNA sequence corresponding to primer 756.

    [0066] SEQ ID NO: 12 DNA sequence corresponding to primer 757.

    [0067] SEQ ID NO: 13 DNA sequence corresponding to primer 758.

    [0068] SEQ ID NO: 14 DNA sequence corresponding to primer 759.

    [0069] SEQ ID NO: 15 DNA sequence corresponding to primer 760.

    [0070] SEQ ID NO: 16 DNA sequence corresponding to primer 2527.

    [0071] SEQ ID NO: 17 DNA sequence corresponding to primer 203.

    [0072] SEQ ID NO: 18 DNA sequence corresponding to primer 378.

    [0073] SEQ ID NO: 19 DNA sequence corresponding to primer 1970.

    [0074] SEQ ID NO: 20 DNA sequence corresponding to primer 1747.

    [0075] SEQ ID NO: 21 DNA sequence corresponding to primer 1748.

    [0076] SEQ ID NO: 22 DNA sequence corresponding to primer 1745.

    [0077] SEQ ID NO: 23 DNA sequence corresponding to primer 1746.

    [0078] SEQ ID NO: 24 DNA sequence corresponding to primer 822.

    [0079] SEQ ID NO: 25 DNA sequence corresponding to primer 1127.

    [0080] SEQ ID NO: 26 DNA sequence corresponding to primer 817.

    [0081] SEQ ID NO: 27 DNA sequence corresponding to primer 818.

    [0082] SEQ ID NO: 28 DNA sequence corresponding to probe 819.

    [0083] SEQ ID NO: 29 DNA sequence corresponding to primer 868.

    [0084] SEQ ID NO: 30 DNA sequence corresponding to primer 752.

    [0085] SEQ ID NO: 31 DNA sequence corresponding to primer 530.

    [0086] SEQ ID NO: 32 DNA sequence corresponding to primer 531.

    [0087] SEQ ID NO: 33 DNA sequence corresponding to probe 532.

    [0088] SEQ ID NO: 34 DNA sequence corresponding to primer 527.

    [0089] SEQ ID NO: 35 DNA sequence corresponding to primer 528.

    [0090] SEQ ID NO: 36 DNA sequence corresponding to probe 529.

    [0091] SEQ ID NO: 37 DNA sequence corresponding to primer 718.

    [0092] SEQ ID NO: 38 DNA sequence corresponding to primer 719.

    [0093] SEQ ID NO: 39 DNA sequence corresponding to probe 720.

    [0094] SEQ ID NO: 40 DNA sequence corresponding to primer 934.

    [0095] SEQ ID NO: 41 DNA sequence corresponding to primer 935.

    [0096] SEQ ID NO: 42 DNA sequence corresponding to probe 936.

    [0097] SEQ ID NO: 43 DNA sequence corresponding to pIND2-HB4 plasmid.

    DETAILED DESCRIPTION

    [0098] The following definitions and methods are presented to better define the invention and to enable those skilled in the art to reduce the invention to practice. Unless otherwise stated terms are to be construed according to the conventional use by those skilled in the relevant art.

    EXAMPLES

    Example 1: Construction of Plasmid pIND2-HB4

    [0099] The plasmid pIND2-HB4 that would be subsequently used for transformation of soybean plants derives from the binary plasmid family pPZP, in particular, is based on the series pPZP200.

    [0100] The transgenic insert and expression cassette of IND-ØØ41Ø-5 comprise the 2× cauliflower mosaic virus (CaMV) promoter 35S and the vsp terminator for bar marker gene. Additionally, comprise the sunflower gene HaHB4 promoter (Large Promoter Fragment, LPF) and nos terminator for gene HaHB4. The plasmid obtained, pIND2-HB4, is schematized in FIG. 1.

    Example 2: Transformation of Soybean Plants and Selection of Event IND-ØØ41Ø-5

    [0101] Soybean cell may be transformed through a variety of methods. Particularly, Agrobacterium tumefaciens strain EHA 101 (Hood et al., 1986), disarmed, transformed with the binary plasmid containing HaHB4 and bar within the T-DNA region (transference DNA) was used. The transformation was made using a modification of the method described by Paz et al., (2004). Briefly, soybean seeds (Glycine max cv. Williams 82) were pre-germinated in basal medium in the dark. Cotyledonary nodes were isolated from half-mature seeds, which were infected with Agrobacterium. During 5-7 days, the explants were cultured in the dark with the Agrobacterium strain. Medium for shoot initiation, elongation and rooting was supplemented with cefoxatime, timentin and vancomycin to inhibit Agrobacterium overgrowth. Shoots transformed using ammonium glufosinate (which inhibits the development of shoots not expressing PAT) were selected. The regenerated explants were maintained at 24° C. for two/three weeks under white fluorescent light and with photoperiodic lighting 16:8. During shoot induction, the explants were subcultured several times in shoot induction selective medium (SISM) containing Gamborg basal medium (macronutrients B5 1×, micronutrients B5 1×, vitamins B5 1×, Ferrous 28 mg/L, NaEDTA 38 mg/L), sucrose 30 g/L, MES 0.59 g/L and agar type A 7 g/L, pH 5.7. After medium autoclaving, filtered and sterilized BAP (2 mg/L), IBA (0.2 mg/L), Timentin (50 mg/L), Cefotaxime (100 mg/L), and Vancomycin (50 mg/L), and the selective agent were added. As soon as leaves were visible, their stems were cut and transferred to a shoot elongation selective medium (SESM). The elongated shoots (two nodes) were transferred to a semisolid rooting medium (RM: basal medium modified with Gamborg vitamins MS ½× (macronutrients MS ½×, micronutrients MS ½×, Vitamins B5 ½×, Ferrous 28 mg/L, NaEDTA 38 mg/L), sucrose 20 g/L, MES 0.59 g/L and agar type A 7 g/L, pH 5.6). After medium autoclaving, filtered and sterilized indole-3-butyric acid (IBA, 2 mg/L), and selective agent were added. Rooted plants with normal phenotypic characteristics were transferred to plots containing substrate mixture for seedlings acclimatization, inducing their growth for further analyses.

    TABLE-US-00001 TABLE 1 Micronutrients and macronutrients composition of Gamborg basal medium B5 Macronutrients (NH.sub.4).sub.2SO.sub.4 0.134 g/l KNO.sub.3 2.528 g/l MgSO.sub.4.7H.sub.2O 0.246 g/l CaCl.sub.2.aq 0.15 g/l KH.sub.2PO.sub.4 0.15 g/l Micronutrients KI 0.75 mg/l H.sub.3BO.sub.3 3.0 mg/l MnSO.sub.4.H.sub.2O 10 mg/l ZnSO.sub.4.7H.sub.2O 2.0 mg/l Na.sub.2MoO.sub.4.2H.sub.2O 0.25 mg/l CuSO.sub.4.5H.sub.2O 0.025 mg/l CoCl.sub.2.6H.sub.2O 0.025 mg/l Na.sub.2.EDTA 37.3 mg/l FeSO.sub.4.7H.sub.2O 27.8 mg/l

    Plants Regeneration and Event Selection

    I) Seeds Sterilization:

    [0102] Seeds were washed in a diluted solution of aqueous detergent for 5 minutes and subsequently washed 6 times with sterilized distilled water. Then, seeds were washed with alcohol (ethanol 70%) for one to two minutes with occasional agitation. After settling of the ethanol solution, seeds were placed in a bell jar desiccator with a stem cover for chlorine gas disinfection. After gaseous disinfection, seeds are imbibed in distilled water for 12 hours to soften their teguments.

    II) Seeds Germination:

    [0103] Seeds were peeled and placed in germination medium (GM: basal medium Murashige & Skoog with salts and vitamins, Sucrose 30 g/l, and agar type A 7 g/L, pH 5.8) for a period of time of 72-96 hours approximately in the dark up to radial elongation. After pre-germination period, roots and hypocotyledonous stem were extracted. Adaxial epidermis was partially removed mechanically from both cotyledons to increase inocula contact with explant cells enhancing efficiency of Agrobacterium tumefaciens infection.

    III) Transformation Proceedings

    [0104] a) Explants Directly Co-Cultivated with Agrobacterium tumefaciens by Infiltration.

    [0105] Pre-germinated seeds were contacted with an infection medium through vacuum infiltration (VIIM: Gamborg basal medium B5 1/10× (macronutrients B5 1/10×, micronutrients B5 1/10×, vitamins B5 1/10×, Ferrous 2.8 mg/L, NaEDTA 3.8 mg/L), Sucrose 30 g/L, MES 3.9 g/L, pH 5.4. After medium autoclaving GA3 filtered and sterilized (0.25 mg/L), BAP (2 mg/L), Silwet L-77 (0.03%) and 40 mg/L acetosyringone) containing a bacterial suspension (direct co-culture) were added to this medium. Vacuum was raised to 450 mm Hg. The explants were maintained under vacuum conditions for 5-7 minutes. This process was repeated twice.

    b) Seeds Dissection and Indirect Co-Culture of the Same with Transformed Agrobacterium tumefaciens

    [0106] After seed infiltration proceeding, seeds were dried with sterile filter paper and placed on a sterile plane surface (empty plate) for dissection. Cotyledons were broken separately using a sharp sterile scapel and the plumula was removed.

    c) Explants Indirectly Co-Cultured

    [0107] An additional treatment involving dehydration/rehydration of half of seed explants was included to favour bacterial infection. Loss of turgor was induced in half seed explants dissected under laminar flow hood for 30 minutes. Then, explants were rehydrated in infection medium (IM: Gamborg basal medium B5 1/10× (macronutrients B5 1/10×, micronutrients B5 1/10×, vitamins B5 1/10×, Ferrous 2.8 mg/L, NaEDTA 3.8 mg/L), Sucrose 30 g/L, MES 3.9 g/L, pH 5.4. After autoclaving GA3 filtered and sterilized (0.25 mg/L), BAP (2 mg/L) and 40 mg/L acetosyringone) containing a suspension of Agrobacterium (DO 0.7) at 24° C. for 30 minutes were added to this medium. Explants were dried with sterile paper and immediately transferred to co-culture medium (CCM: Gamborg basal medium B5 1/10× (macronutrients B5 1/10×, micronutrients B5 1/10×, vitamins B5 1/10×, Ferrous 2.8 mg/L, NaEDTA 3.8 mg/L), Sucrose 30 g/L, MES 3.9 g/L and agar type A 4.25 g/L, pH 5.4. After autoclaving GA3 filtered and sterilized (0.25 mg/L), BAP (2 mg/L), cysteine (400 mg/L), dithiothreitol (154.2 mg/L) and 40 mg/L acetosyringone) were added to this medium for 5-7 days in the dark at 24° C.

    d) Rinse

    [0108] Explants were gently steered in sterile water for 10 minutes to remove the bacteria adhered to them, and then were dried with sterile paper filter. Then, explants were submerged in shoot induction washing medium (SIWM: Gamborg basal medium B5 1× (macronutrients B5 1×, micronutrients B5 1×, vitamins B5 1×, Ferrous 28 mg/L, NaEDTA 38 mg/L), Sucrose 30 g/L, y MES 0.59 g/L, pH 5.7. After autoclaving the medium filtered and sterilized BAP (1 mg/L), TDZ (0.1 mg/L), IBA (0.2 mg/L) Timentin (100 mg/L), Cefotaxime (100 mg/L), and Vancomycin (50 mg/L) (25 explants per bottle) were added. Washing continued for 6-12 hours with continuous agitation (100 rpm) at 24° C., with photoperiodic lighting 16:8.

    e) Selection and Regeneration of Transformed Explants

    [0109] Explants were transferred to shoot induction selective medium (SISM) and were maintained at 24° C. for two weeks under white fluorescent light and with photoperiodic lighting 16:8. They were placed with adaxial face upwards on the surface of the selective medium. Petri plates (100×25 mm) were used for selection and regeneration process. Each two weeks, explants were sub-cultured in fresh medium SISM supplemented with phytohormones and antibiotics. When leaves appeared, stems were removed and transferred to plates with selective medium for shoot elongation (SESM: Gamborg basal medium modified with vitamins MS 1× (macronutrients MS 1×, micronuctrients MS 1×, Vitamins B5 1×, Ferrous 28 mg/L, NaEDTA 38 mg/L), Sucrose 30 g/L, MES 0.59 g/L and agar type A 7 g/L, pH 5.7. After autoclaving this medium asparagine (50 mg/L), L-pyroglutamic acid (100 mg/L), IAA (0.1 mg/L), GA3 (0.5 mg/L), Zeatin-R (1 mg/L), IBA (0.2 mg/L), Timentin (50 mg/L), Cefotaxime (100 mg/L), Vancomycin (50 mg/L) were added.

    f) Rooting of Transgenic Shoots

    [0110] Elongated shoots (two nodes) were transferred to culture flasks (1 plant/250×25 mm flask) containing semisolid rooting medium (RM).

    [0111] Then, the transgenic plants were transferred to plots in an environment subjected to growing conditions to induce greater selection and perform their phenotypic and molecular characterization.

    [0112] Selection was made based on the presence of a “wild” phenotype in normal growing conditions and a higher tolerance to environmental stress, expressed through a greater production in agricultural zones with less favourable conditions for cultivation.

    Event Preliminary Selection

    [0113] Soybean transgenic events were generated by Agrobacterium-mediated protocol in the cultivar Williams 82. T1 seeds were obtained for 35 independent events using three different expression cassettes and strategies. The first multiplication was conducted in a greenhouse and ten T1 individuals derived from each event were sampled for a Mendelian segregation test by PCR determination. After this analysis the lines with not Mendelian segregation were discarded. Lines derived from selfings of individuals from selected events (3:1 Mendelian segregation in T1) were sowed. Off-type phenotypes with penalties were identified throughout the growing season and discarded. During the vegetative stages, plants were sampled for PCR analysis to identify homozygous lines. Seed increase (T3 seed) of homozygous and null lines was conducted in a greenhouse.

    [0114] To continue with the event selection, fifteen HB4 soybean selected transgenic events and control lines were evaluated under field conditions. Two levels (low and high) of irrigation regime were applied. For low irrigation regime the water supply was suspended from R1 to R6 developmental soybean stages. Therefore, this regime consisted of only two water applications, one at the beginning of the season and the other one at the end.

    [0115] Homozygous transgenic events lines within or between constructions, and within the same line, had higher yield than the not transgenic lines. There were significant yield differences between transgenic and not transgenic lines for two inducible transgenic events, one (b) (pIND2:HB4) and one (c) (pIND3:HB4), within the same line. Furthermore, two constitutive (a) (pIND1:HB4) transgenic events had higher yield than its not transgenic counterparts. These four events were selected to continue with the deeper characterization that would allow the selection of an event.

    Soybean Transgenic Events and Genetic Constructs

    [0116] Williams 82 soybean genotype was used for transformation with Agrobacterium tumefaciens strain EHA101. Transformation vectors consisted on binary plasmids derivatives from pPZP200 series (Hajdukiewicz et al., 1994). The bar gene from Streptomyces hygroscopicus, present in the plasmids, was used as selectable marker (Thompson et al., 1987). In order to evaluate the effect of different levels of expression on growth and tolerance response, three different promoters were used for Hahb-4 expression. A constitutive expression of the Hahb-4 TF was obtained using the Cauliflower mosaic (CaMV) 35s promoter and, an inducible expression was obtained using two different Hahb-4 promoter regions. The difference between the inducible promoters is the presence or absence of the COX5c intron (FIG. 2A). Constructs were similar to the described in Cabello et al. (2007). Transgenic plants from the first generation (T0) were selected using herbicide (ammonium glufosinate) sprays. The following generations (T1 and T2) were selected by detection of the HaHb-4 cDNA and regulatory sequences using PCR. Several homozygous lines were obtained and, after a preliminary analysis, four transgenic independent events (a1, a2, b1 and c1) were selected for further evaluation. Preliminary analysis consisted on visual observations and selection of events with phenotype without altered morphology.

    HaHB4 and Bar Genes Transcriptional Expression Analysis

    [0117] The HaHB4 and bar genes expression levels on homozygous lines were evaluated by transcriptional expression analysis. Seedlings of each transgenic event were treated either with a solution of ABA 100 μM for 1-hour or with water as the control treatment. The experiment was conducted three times and five seedlings were sampled at each individual experiment. After treatment period, total biomass of seedlings was harvested and immediately placed in liquid nitrogen. From the samples, RNA for quantitative RT-PCR was isolated using TriPure reagent (ROCHE). RNA (1 μg) was incubated with RQ1 DNAse (Promega, Madison, Wis., USA) according to manufacturer's instructions and then used for reverse transcription reactions using the Transcriptor First Strand cDNA Synthesis Kit (ROCHE). Quantitative PCRs were conducted using the LightCylcer® 480 II apparatus (ROCHE) in a 20 μl final volume using LightCycler® 480 SYBR Green I Master kit. Fluorescence was measured at 80-84° C. during 40 cycles. Primers used for quantification procedures were designed to work at 60° C. of annealing temperature and melting curves were analyzed for detecting unspecific amplification products. In every case, gene expression analysis was performed by triplicate and the relative expression level of transcripts was calculated using the Ct values obtained for each sample as described by Pfaffl (2001).

    Water Stress Under Controlled Condition Experiments

    [0118] The experiment consisted on five genotypes (transgenic events a1, a2, b1, c1, and Williams 82), two water treatments (well-watered and water-stress), three stress onset periods: second node (V2), full bloom (R2) and full pod (R4) (Fehr and Caviness, 1977), and 15 replications. Pots (5-L) were filled with commercial GrowMix MultiPro (Terrafertil SA, AR). Three seeds were planted in each individual pot. At emergence, plants were thinned to one plant per pot. Water stress was imposed from V2, R2, and R4 developmental stages by completely withholding watering. The remaining control pots were maintained at field capacity until maturity. After first appearance of wilting symptoms in the Hahb-4 plants, pots were watered until field capacity. A recovery rate (%), after a 7-days recovery period, for each genotype and developmental stage was calculated as the number of plants without symptoms of wilting divided by the total number of plants at the beginning of the experiment.

    Ethylene Sensitivity Experiments

    [0119] Soybean leaves (15 leaves per genotype) of a1 and b1 transgenic events and control plants (Williams 82) were detached from plants growing under controlled conditions at V4 developmental stage. Detached leaves were placed in Petri dishes and incubated with: a—water and left under normal light conditions (control treatment); b—water and covered with aluminum foil (darkness treatment) and, c—with a solution of 2-chloroethilphosfonic acid 100 μM (Ethephon treatment) (Tifón, Gleba, AR). After a 7-days treatment period, pigments extraction and quantification were conducted on the recovered leaves.

    [0120] For chlorophyll (A and B) and photosynthesis-related carotenoid determinations, leaves were grinded in liquid nitrogen and left overnight on darkness in a solution with ethanol 99.9%. An aliquot of the ethanol solution was used for further UV/Vis spectroscopy quantification. Serial dilutions were conducted from each aliquot to avoid outliers in the absorption spectrum. Visible electronic absorption spectra of chlorophyll A and B and carotenoids were recorded at 15° C. using a JASCO V-550 spectrophotometer (Jasco Analytical Instruments, MD, USA). A spectral scanning between wavelength of 350 nm and 750 nm was conducted for each sample. The values of the entire experiment are the average of three independent experiments. In order to evaluate one of the “triple response” morphological effects of ethylene, soybean seeds of the a1, b1 and control genotypes were placed in germination trays with filter paper with either water or a solution of 25 μM of 2-chloroethilphosfonic acid. A total of 3 trays (20 seeds each) per genotype and treatment were used. Trays were covered with aluminum foil for 48 hours. After hypocotyl emergence, a quantification of seeds with hook formation was conducted.

    Water Loss Experiment

    [0121] Three plants of each soybean transgenic event (a1, a2, b1 and c1) and the non-transgenic control (Williams 82) were grown in 5-L pots with GrowMix MultiPro soil under normal watering conditions. At the beginning of bloom (R1) (Fehr and Caviness, 1977), 10 leaves of each plant were detached and immediately weighted in an air-isolated analytical balance at intervals of 1 hour for 10 hours.

    Field Experiments Under Rainfed Field Conditions

    [0122] Transgenic events a1, a2, b1, c1, and the wild-type (Williams 82) were evaluated for yield and yield components in 12 environments during the 2012-13 growing season. Environments were defined as a combination of location and planting date, since for some of the locations two planting dates were sowed. Field trials locations were Monte Buey (Córdoba), Chilibroste (Córdoba), Corral de Bustos (Córdoba), Villa Saboya (Buenos Aires), Carmen de Areco (Buenos Aires), San Agustin (Buenos Aires), Landeta (Santa Fe), Hughes (Santa Fe) y Aranguren (Entre Rios). At San Agustin, Carmen de Areco and Aranguren, two planting dates were planted. Environments were grouped based on yield of the wild-type genotype (environmental index). Three environmental index (low, medium and high) were defined considering different criteria: 1) allowing for event selection maximizing the yield difference between the events and the non-transgenic control; 2) representing the Argentina national yield average (upper limit for the low environmental index) and the average yield of the two most productive areas of Argentina (lower limit for the high environmental index) at the year of event selection (Bolsa de Cereales, Panorama Agricola Semanal 2013, May 30. Retrieved from www.bolsadecereales.com/pas); 3) balance the number of environments within each group. Thus, low environmental index comprise environments where wild-type yield was lower than 2500 kg ha.sup.−1 (San Agustin, both planting dates, Aranguren, both planting dates and Landeta); medium environmental index encompass environments where wild-type yield was between 2500-3500 kg ha.sup.−1 (Carmen de Areco, both planting dates and, Villa Saboya); and finally, high environmental index include environments where wild-type yield was higher than 3500 kg ha.sup.−1 (Corral de Bustos, Hughes, Monte Buey and Chilibroste). Event selection was performed based on seed yield and yield components (seed number per square meter and 100-seed weight) relative performance of the transgenic events and the wild-type. The transgenic relative performance to the wild-type was calculated as a relative difference between the transgenic event and the wild type.

    [0123] Field trials were planted using a randomized complete block design with 4 to 7 replications, depending on the site considered. Plots consisted on 4-rows, 5 to 6 meters in length and 0.4 to 0.7 meters between rows. The middle two rows of each plot were harvested at full maturity (R8) (Fehr and Caviness, 1977). Yield was expressed on a 13% moisture base. Seed number per square meter was calculated based on 100-seed weight and yield. Seed yield, seed number and seed weight were analyzed with ANOVA using SAS software. The statistical model included environmental index, environment nested within environmental index, block nested within environment, genotype, and the interaction terms (genotype by environmental index and environment by genotype).

    [0124] After event selection, additional field testing was performed in six environments during the 2013-14 growing season. Field trials locations were Monte Buey (Córdoba), Aranguren (Entre Rios), Rolden (Santa Fe) and Villa Saboya (Buenos Aires). At Aranguren, two experiments were sowed that differ in fertilization treatment at planting: a) 100 kg ha-1 Monoammonium phosphate fertilizer and, b) 0 kg ha-1 Monoammonium phosphate. At Rolden, two planting dates were planted (December and January). Experimental design for the 2013-14 field trials was the same as 2012-13. Data from the two years were pooled and all environments were analyzed together for the comparison between b1 transgenic event and the non-transgenic control. Field trials within the low environmental index were Aranguren, two fertilization conditions. Field trials with medium environmental index were Monte Buey and Roldán (two planting dates). Finally, Villa Saboya was classified as the medium environmental index trial. Data were analyzed using the same statistical model as the previous data set.

    Library Construction and Illumina Sequencing

    [0125] Leaf tissue of Williams 82 and b1 transgenic event were collected from three plants at two different water treatments (well-watered and water-stressed plants), as described in the “Water stress experiment under controlled conditions” section. Tissue samples were collected at R2 stage. Total RNA extraction from leaf tissue was conducted as described in the “Hahb-4 and bar genes expression levels” section, using the SV Total RNA Isolation System (Promega, Madison, Wis., USA). RNA quality was evaluated using Agilent 2100 Bioanalyzer Eukaryote Total RNA Nano (Agilent, Santa Clara, Calif., USA), and RNA concentration was determined using Quant-iT RiboGreen RNA Assay Kit (Thermo Fisher Scientific, Waltham, Mass., USA).

    [0126] RNAseq differential expression assay was designed using a single factor scheme, two levels (water stressed and well-watered) and three biological replicates for each factor level. RNA-seq libraries were constructed using TruSeq RNA Library Prep Kit v2 according to the manufacturer's recommendations (Illumina, San Diego, Calif., USA). Library quality check were performed using Agilent 2100 Bioanalyzer DNA 1000 chip (Agilent, Santa Clara, Calif., USA). Libraries were quantified using KAPA Library Quantification Kits for Illumina platforms (KAPA Biosystems, Wilmington, Mass., USA), pooled, diluted and loaded for further sequencing in an Illumina HiSeq 1500 RR 2×100 pb lane. All samples were sequenced using the next-generation sequencing facilities at Instituto de Agrobiotecnología Rosario (Rosario, Republica Argentina).

    Mapping, Differential Expression and Gene Ontology (GO) Enrichment Analysis

    [0127] Raw data quality check was performed using FastQC v0.11.4 (Andrews, S. 2010).

    [0128] Trimming and adapter removal was performed using Trimmomatic v0.33. Paired-end RNA-seq reads were mapped to the Glycine_max reference genome (phytozome Gmax_275_Wm82.a2.v1) using Bowtie2 v2.2.6 (Langmead and Salzberg, 2012) included in TopHat v2.1.0 (Trapnell et al., 2009) using the default parameters. Cufflinks v2.2.1 (Trapnell et al., 2012) was used for transcripts assembly, abundance estimation was measured using the fragments per kilobase of transcript per million mapped reads (FPKM) and differential expression analysis (FDR=0.05) was done using cuffdiff. The differentially expressed genes were annotated with gene ontology (GO) terms. A Singular Enrichment Analysis (SEA) (Fisher's exact test; 0.05 significance level) was done using the agriGO web server (http://bioinfo.cau.edu.cn/agriGO) (Zhou D., et al, 2010) with Glycine max Wm82.a2.v1 genes as background. To get a broad overview of the transcripts functions we mapped the GO terms to GO slims plant categories using the GOSlimViewer tool (http://www.agbase.msstate.edu/). The genes ID were obtained using the phytozome 11.0v repository.

    Selection of Event Between Two Constitutive Transgenic Events (a1 and a2) and Two Inducible Transgenic Events, (b) and (c)

    [0129] Four independent transgenic lines (a1, a2, b1, and c1), belonging to three different constructs, were evaluated for HaHB4 relative expression levels (FIG. 2B). As expected, transgenic events b1 and c1 with the inducible promoter showed higher levels of HaHB4 expression when exposed to abscisic acid (ABA) compared to control plants without phytohormone exposure. On the contrary, transgenic events a1 and a2 with constitutive promoter showed similar HaHB4 expression for both treatments. The expression levels for the bar gene remained similar at both conditions as expected.

    [0130] Following expression analysis, drought tolerance experiments were conducted under controlled conditions. Thus, drought tolerance at three different developmental stages was evaluated in the four independent transgenic lines (a1, a2, b1, and c1). After a period of water deprivation, all transgenic lines showed fewer wilted plants compared to non-transgenic plants (Williams 82) (FIG. 3A). Observations of wilting recovery (recovery rate) after a period of water deprivation following irrigation were conducted for each independent transgenic line (FIG. 3B). At V2, second node of developmental stage (Fehr and Caviness, 1977), only 7% of control plants showed tissue recovery while average recovery rate for the transgenic events was 67%. Similar results were found at R2, full bloom, and R4, full pod, developmental stages (Fehr and Caviness, 1977), where recovery rate for control plants was 12% and 13% while transgenic events showed values of 68% and 65%, respectively. A recovery rate averaged across developmental stages (final recovery rate) was calculated to estimate the average performance of each transgenic event. Results showed some differences among transgenic events, with a1 and b1 events showing higher values of final recovery than a2 and c1 events (FIG. 3B).

    [0131] On the other hand, the rate of water loss from plant-detached soybean leaves was measured at 1-hour intervals during 10-hours to test whether stomata closure regulation contributes to transgenic lines stress tolerance. Results showed that water loss of all independent lines and the wild type were similar, (FIG. 3C) demonstrating that earlier stomata closure is not a mechanism involved in drought tolerance mediated by HaHB4.

    Ethylene Sensitivity and Delayed Senescence Evaluations on HaHB4 Transgenic Plants

    [0132] A lower ethylene sensitivity and a consequent delayed senescence would be the main mechanisms conferring higher drought tolerance in HaHB4 Arabidopsis transgenic plants (Manavella et al., 2006; Cabello et al., 2007). To evaluate this physiological mechanism in soybean, two independent transgenic lines with different promoters, a1 constitutive and b1 inducible, were selected for evaluation.

    [0133] Transgenic line b1 maintained photosynthetic activity longer than the non-transgenic control (Williams 82) when both were exposed to either Ethephon (2-chloroethyl phosphoric acid) exogenous applications or darkness to trigger tissue senescence. Leaves of transgenic line b1 treated with Ethephon or under darkness showed similar abundance of chlorophyll, A and B, and photosynthesis related-carotenoids than non-stressed leaves (FIG. 4C). On the contrary, the non-transgenic control genotype showed lower levels of chlorophyll, A and B and carotenoids when leaves were treated with ethephon or darkness, compared to non-stressed leaves. An intermediate response was found for the transgenic event with a constitutive response (a1). Longer delayed senescence was also observed in transgenic b1 leaves when exposed to ethephon or darkness (FIG. 4A). Thus, while transgenic b1 leaves showed stay-green phenotype, the non-transgenic line showed yellowing symptoms under these treatments.

    [0134] On the other hand, ethylene application to seedlings results in the pronounced curvature of the apical hook. This effect, known as the “triple response”, causes stem elongation inhibition, stem radial swelling, and absence of normal geotropic response (Guzman and Ecker, 1990). FIG. 4B shows the lower sensibility to ethephon in transgenic lines a1 and b1 compared to the non-transgenic line, indicating differences in the timing of ethephon sensing in soybean. In addition, seedlings of the transgenic lines exposed to different Ethephon concentrations showed hypocotyl hook formation at higher concentrations than the non-transgenic line. At the same time, first symptoms of hook formation for transgenic lines were observed at 25 μM Ethephon concentration while a concentration of 10 μM was sufficient for hook formation in the non-transgenic control. In the same way, transgenic lines showed a 17% (b1 line) and a 9% (a1 line) of seedlings with hook formation at concentration of 25 μM ethephon, while in the non-transgenic control almost 50% of the seedlings presented hook formation as this concentration (FIG. 4D).

    [0135] Therefore, the lower ethylene sensitivity of soybean transgenic events compared to the non-transgenic control is demonstrated by the maintenance of chlorophyll levels and the observation of higher hypocotyls without hook formation under Ethephon and darkness treatments.

    Independent HaHB4 Transgenic Events Performance Under Rainfed Field Conditions

    [0136] Four independent transgenic events were initially evaluated under field conditions in 12 trials during the 2012-2013 growing season. The trials were grouped as low, medium and high yield environments based on the non-transgenic control yield. All transgenic events showed lower 100-seed weight than the non-transgenic control (genotype main effect: p<0.0001). On the other hand, seed number per square meter and seed yield showed a significant genotype-environment interaction (p=0.013 for seed yield and p=0.033 for seed number). Seed yield of the a2 and b1 events was significantly higher than the control in the low yield environment (FIG. 5A). Seed yield was 9.4% for a2 and 11.2% for b1 higher than the non-transgenic control. These performance differences at the low yield environment were a consequence of a significant increase in seed number lesser than proportional reduction in seed weight. The a2 transgenic event showed a 15.3% increase in seed number (FIG. 5B) and a −4.8% decrease in seed weight (FIG. 5C) whereas the transgenic event b1 showed a 20.6% increase in seed number (FIG. 5B) and a −7.6% decrease in seed weight (FIG. 5C). For the medium and high yield environments, there was no difference in seed yield for any of the events except c1. Transgenic event c1 showed a significant seed yield reduction (−8.4%) (FIG. 5A) explained by significant reductions in seed number (−5.8%) (FIG. 5B) and seed weight (−2.6%) (FIG. 5C). Based on the better performance of the b1 event in the low yield environment and the absence of seed yield penalty in the high yield environment, the b1 event was selected for further field testing.

    [0137] Further evaluation of the selected transgenic event b1 in an expanded set of environments during the 2013-14 growing season showed consistent results compared to the previous year. A combined analysis of the b1 event and the non-transgenic control for both growing seasons showed statistically significant genotype-environment interaction for seed yield (p=0.048) and seed number (p=0.050), whereas seed weight showed a significant genotype main effect (p<0.0001). Seed yield was significantly different between the two genotypes at the low yield environment (FIG. 6A). Seed number increase (23.3%) was proportionally higher than the seed weight decrease (−6.7%) resulting in significant seed yield increase (14.9%) (FIG. 6A, B, C). For medium and high yield environments, there was a compensation between seed weight and seed number. Seed weight decreases (−6.8% and −4.2% for medium and high yield environments, respectively) (FIG. 6C) were of similar magnitude that seed number increases (7.3% and 6.2% for medium and high yield environments, respectively) (FIG. 6B).

    Classification and Identification of Differentially Expressed Genes

    [0138] In order to evaluate the changes to transcriptional level conferring drought tolerance in the soybean transgenic b1 event, RNA-Seq transcriptomic analysis, using Illumina technology, was conducted in the b1 event and in the non-transgenic control (Williams 82). A first approach comparing irrigated vs. drought treatments identified 1931 differentially expressed (DE) genes (FC>=+/−2) in HaHB4 genotype. A similar number of DE genes were found for the wild type genotype, with 2215 DE genes (FC>=+/−2) in response to water stress. 866 DE genes were shared between the two genotypes (FIG. 7B). A second approach, comparing genotypes within treatments was conducted to identify DE genes associated to the HaHB4 transgene. As expected, due to the inducible character of the HaHB4 promoter, only 298 DE genes (FC>=+/−2) were observed when transgenic and non-transgenic plants were compared in irrigated plants.

    [0139] The enriched Gene Ontology (GO) annotation comparing genotypes under irrigated conditions identified 941 GO terms associated to DE genes in the biological processes category, while 9931 GO terms in DE genes were identified under drought treatment (FIG. 7). In addition, the largest proportion of DE genes under water stress corresponds to metabolic and biological processes while cellular and biosynthetic processes also showed a considerable number of DE genes between genotypes (FIG. 8). Within the biological processes main group, DE genes under water stress were mostly involved in photosynthesis, plant defense response, transcription factors, and signal transduction (Table 2). Within the mentioned category, a second selection of DE genes was conducted based on fold change values. Values of either FC<=−2 (down regulated) or FC>=2 (up regulated) were selected for further identification and analysis.

    [0140] A total of 12 photosynthesis-related genes were down regulated, with 9 of them exclusively associated to photosystem II (PSII) reaction center proteins, specifically downregulation of genes encoding for Photosystem II reaction center proteins A, B, C, D, E and M was detected (Tikkanen et al., 2014). Regarding genes involved in plant defense response to stresses, lipoxygenase 1 (LOX1), lipoxygenase 2 (LOX2) and beta-1,3-glucanase 1 genes were up regulated when comparing transgenic and non-transgenic plants under water stress conditions. In addition, a set of genes involved in water transport were also DE. In that sense, three Aquaporin-like superfamily proteins were considerably repressed in the transgenic plants (Johansson et al., 2000; Sade and Moshelion, 2017).

    [0141] Soybean transcription factors (Wang et al., 2010) differentially expressed between transgenic and non-transgenic genotypes under drought, involved genes playing important roles both in developmental processes and in response to environmental stresses, were observed (Table 2). In that sense, some members of the K-box region and MADS-box (Shu et al., 2013), Squamosa promoter-binding protein-like (Tripathi et al., 2017), basic helix-loop-helix (Hudson and Hudson, 2015) and Myb like transcription factors (Du et al., 2012) were downregulated while others were upregulated when comparing genotypes under water stress. On the other hand, salt tolerance zinc finger (Yuan et al., 2018), WRKY DNA-binding protein (Yin et al., 2013; Yang et al., 2017), basic leucine-zipper (Zhanq et al., 2018) and, the Arabidopsis homologous of GBF's pro-rich region-interacting factor 1 (Tokumaru et al., 2017) and the Integrase-type DNA-binding superfamily proteins (Licausi et al., 2010; Yan, 2014), were upregulated.

    [0142] Finally, genes coding for proteins involved in signal transduction (Ahanger et al., 2018), showed changes when comparing genotypes under water stress conditions. Particularly, these genes are Calcium-binding EF-hand family, phosphatase and kinase proteins, whose expression was considerable higher in HaHB4 compared to control genotype under water stress (Table 2).

    TABLE-US-00002 TABLE 2 Fold change (fc) value of a selection of differentially expressed genes between transgenic and non-transgenic genotypes under water stress. Gene ID Gene Annotation log2 (Fc) p-val Glyma.09G160500 Aquaporin-like superfamily protein −6.3460 0.0120505 Glyma.10G174400 Aquaporin-like superfamily protein −6.0696 0.0114654 Glyma.16G210000 Aquaporin-like superfamily protein −5.8523 0.0010792 Glyma.01G058600 photosynthetic electron transfer B −5.3466 0.0010792 Glyma.11G114700 photosystem II reaction center protein C −5.1418 0.0064869 thiazole biosynthetic enzyme, chloroplast (ARA6) (THI1) Glyma.06G269700 (THI4) −4.4050 0.0010792 Glyma.04G095000 photosystem II reaction center protein D −4.1302 0.0010792 Glyma.11G162200 photosystem II reaction center protein A −4.1066 0.0010792 Glyma.13G028200 photosystem II reaction center protein A −4.0988 0.0010792 Glyma.06G217900 photosystem II reaction center protein D −3.8959 0.0010792 Glyma.01G153500 photosystem II reaction center protein D −3.6724 0.0064869 Glyma.12G232700 photosystem II reaction center protein E −3.6514 0.0281353 Glyma.08G281300 photosystem II reaction center protein B −3.0341 0.0137509 Glyma.05G074900 photosystem II reaction center protein C −2.6759 0.0010792 Glyma.12G232900 photosynthetic electron transfer A −2.3801 0.0058037 Glyma.08G189500 lipoxygenase 1 2.1110 0.0180400 Glyma.12G054700 lipoxygenase 2 2.7721 0.0010792 Glyma.03G132900 beta-1,3-glucanase 1 2.2403 0.0010792 Glyma.19G034500 K-box region and MADS-box transcription factor family −3.6906 0.0028364 protein Glyma.04G197100 Squamosa promoter-binding protein-like (SBP domain) −3.2700 0.0356172 transcription factor family protein Glyma.05G200900 basic helix-loop-helix (bHLH) DNA-binding superfamily −2.5748 0.0058037 protein Glyma.07G074300 Myb like DNA-binding domain −2.4033 0.0175182 Glyma.13G368500 basic helix-loop-helix (bHLH) DNA-binding superfamily −2.3053 0.0010792 protein Glyma.12G226000 squamosa promoter-binding protein-like 12 −2.2374 0.0010792 Glyma.17G156000 basic helix-loop-helix (bHLH) DNA-binding superfamily −2.0947 0.0422725 protein Glyma.17G236200 salt tolerance zinc finger 2.0543 0.0010792 Glyma.U025800 squamosa promoter-binding protein-like 12 2.0921 0.0312612 Glyma.20G153700 K-box region and MADS-box transcription factor family 2.2592 0.0043799 protein Glyma.17G097900 VVRKY DNA-binding protein 72 2.3047 0.0338911 Glyma.02G126100 basic leucine-zipper 42 2.3690 0.0253887 Glyma.17G099800 myb domain protein 94 2.3812 0.0276823 Glyma.15G063000 basic helix-loop-helix (bHLH) DNA-binding superfamily 2.5315 0.0058037 protein Glyma.12G206600 GBF\'s pro-rich region-interacting factor 1 2.7909 0.0010792 Glyma.17G047300 lntegrase-type DNA-binding superfamily protein 2.2879 0.0064869 Glyma.09G072000 lntegrase-type DNA-binding superfamily protein 2.5876 0.0010792 Glyma.13G112400 lntegrase-type DNA-binding superfamily protein 2.6309 0.0010792 Glyma.15G180000 lntegrase-type DNA-binding superfamily protein 3.2130 0.0078017 Glyma.09G210900 phosphoribulokinase 2.0034 0.0281353 Glyma.06G159400 Small GTP-binding protein 2.0098 0.0010792 Glyma.12G227800 sodium/calcium exchanger family protein/calcium-binding 2.0401 0.0010792 EF hand family protein Glyma.14G157700 wall-associated kinase 2 2.0668 0.0294783 Glyma.06G081800 Protein kinase superfamily protein 2.1118 0.0225366 Glyma.13G296200 Concanavalin A-like lectin protein kinase family protein 2.1834 0.0096839 Glyma.14G040200 CBL-interacting protein kinase 3 2.1869 0.0258477 Glyma.11G157100 calmodulin-like 41 2.2133 0.0164572 Glyma.03G001600 HAD superfamily, subfamily IIIB acid phosphatase 2.2990 0.0442716 Glyma.02G044600 protein kinase family protein 2.4190 0.0285838 Glyma.08G200100 HAD superfamily, subfamily IIIB acid phosphatase 5.7805 0.0010792 Glyma.17G112000 Calcium-binding EF-hand family protein inf. 0.0010792 Groups of genes correspond, from top to bottom, to (A) aquaporin-related genes, (B) photosynthesis related genes, (C) plant defense response genes, (D) transcriptior factors and (D) signal transduction.

    [0143] Differences between efficacy of the transgenic events in the low yield environment and the existence of yield penalty in the high yield environment suggest that the promoter type (inducible or constitutive) and HaHB4 expression level contribute to the final response to environmental conditions and performance. Our results in the selected transgenic event b1 with inducible promoter showed that the physiological responses induced by HaHB4 could be translated into higher yield in low yield environments with no yield penalty in high yield ones (FIG. 6).

    Example 3: Soybean Event IND-ØØ41Ø-5 DNA Sequences Characterization

    [0144] Soybean event IND-ØØ41Ø-5 inserted in genomic DNA of the plant was characterized, as well as flanking genomic sequences, through molecular techniques.

    [0145] To this end, sequencing of DNA of event IND-ØØ41Ø-5 was performed, the number of transgenic inserts was determined (number of integration sites within soybean genome), also the integrity and stability of the sequence over six generations were determined.

    [0146] Besides, next generation sequencing (NGS) technology was used in parallel with conventional technologies to describe the event IND-ØØ41Ø-5. NGS was used to determine: the whole-genome sequence of IND-ØØ41Ø-5; this includes the T-DNA sequence; and the junction sequences (JS) between the T-DNA and the native soybean genome. The flanking sequences allowed further monitoring of the stability and the integrity of the T-DNA insertion across six self-fertilized generations, as well as in plants resulting from out crossing with another soybean variety.

    [0147] DNA was isolated from leaf tissues of homozygous plants for the event IND-ØØ41Ø-5 (from greenhouse or field grown) or from soybeans plants Williams-82 variety for Southern blot analysis. For whole-genome sequencing and segregation analysis in F2 plants, DNA was extracted from embryonic tissue.

    [0148] A commercially available soybean cultivar, Bio 6.5 (Bioceres Semillas S. A., Ocampo 210 bis, Rosario, Argentina), was used for crossing of plants carrying the event IND-ØØ41Ø-5.

    [0149] In general, prior to extraction, leaf tissue frozen in liquid nitrogen was processed to a fine powder in a mortar with a pestle or in tubes in a “96 mill” for minipreps.

    [0150] The following techniques were used to extract plant DNA, depending on the amounts of DNA needed for experimental purposes: [0151] CTAB Method (hexadecyltrimethylammonium bromide or cetyltrimethylammonium bromide):

    [0152] Said method was used to extract genomic DNA from plant samples (http://irc.iqd.cornell.edu/Protocols/DoyleProtocol.pdf). 600 μl of CTAB buffer (2% w/v CTAB, 100 mM Tris HCl, 20 mM EDTA, 1.4 M NaCl, and β-mercaptoethanol) and 5 μg RNaseA were added to approximately 100 mg of ground leaf tissue and homogenate was incubated at 55-60° C. for 15-20 minutes with intermittent mixing. 600 μL of chloroform was added to the samples and mixed by hand for 2-3 minutes, then centrifuged at 10,000 rpm for 8 minutes. The upper aqueous phase was placed into a clean microtube and the DNA was precipitated with 400 μL of isopropanol. The sample was centrifuged at 12,500 rpm for 10 minutes to pellet the precipitated DNA. The DNA pellets were washed with 300 μl of 70% ethanol by centrifuging the samples at 12,500 rpm (5 minutes). The DNA pellets were air-dried, then resuspended in 100 μl of TE buffer (10 mM Tris HCl, 1 mM EDTA, pH 8.0). All extracted DNA was stored in a 4° C. refrigerator or a −20° C. freezer. [0153] Kit DNeasy Plant Maxi by Qiagen (Valencia, Calif.) for large preparations (Southern blot analyses) or QIAprep® Miniprep (Qiagen Inc.) for small preparations. [0154] DNA isolated from embryonic tissue was used por Illumina-based sequencing, and for segregations studies of F2 progeny from IND-ØØ41Ø-5 crosses and Bio 6.5. Prior to the extraction, seeds carrying the event IND-ØØ41Ø-5, Williams 82 and F2 were incubated in water at 37° C. to facilitate the disruption of the seeds. The embryonic tissues were then separated from the cotyledons and their DNA extracted following the CTAB method. The DNA was quantified either using a Quant-iT™ PicoGreen® (Invitrogen, Carlsbad, Calif.) or by QuBit fluorometer (Invitrogen) and the Quant-iT™ dsDNA BR Assay Kit (Invitrogen). Then, the DNA was stored at 4° C. or at −20° C.

    [0155] The DNA was sawed on 0.8% (w/v) agarose gels to assess the integrity of the samples. The gel was prepared with TAE 1× buffer (40 mM Tris, 20 mM acetic acid and 1 mM EDTA) and run at 120v. DNA samples were diluted in loading buffer 6× (Glycerol 30% and bromophenol blue) and GelRed™ Nucleic Acid Gel Stain 200× (Biotium, Inc., Hayward, Calif.).

    [0156] Agarose gels of 1.5% (w/v) were used for resolving amplicons with lengths between 200 bp to 1500 bp, while 1% (w/v) agarose gels were used for larger DNA fragments. The electrophoresis was performed in TAE 1× buffer and run at 120v. The samples were processed as described above. Molecular Weight Markers 100 bp (from 100 to 2080 bp) and/or Lambda BstII (from 117 bp to 14140 bp) (P-BL, Argentina) were selected according to the amplicon size to be resolved.

    [0157] The standard PCR reactions performed in most of the studies were conducted using 100 ng of genomic DNA template in a 40 μl reaction volume with final concentrations of: 1.8 mM MgCl.sub.2, 2 mM DMSO, 0.4 μM of each primer, 50 μM of each dNTP and 1 U of FastStart High Fidelity (Roche, Indianapolis, Ind.). The following cycling program was applied for amplicons with intended sizes comprised between 400 bp and 700 bp: [0158] 1 cycle at 95° C. for 30 seconds; [0159] 35 cycles at 95° C. for 30 seconds, 55° C. for 30 seconds, 72° C. for 30 seconds; [0160] final extension: 1 cycle at 72° C. for 10 minutes.

    [0161] For the generation of amplicons with sizes of 1100 bp to 1300 bp the duration of the extension step at 72° C. was increased from 30 seconds to 60 seconds.

    [0162] In the case of the whole insert amplification with the Expand Long Range polymerase, final concentrations of 2.5 mM MgCl.sub.2, 6% DMSO, 0.3 μM of each primer, 500 μM of each dNTP, and 3.5 U of Expand Long Range (Roche, Indianapolis, Ind.) were used. The amplification was performed under the following conditions: [0163] 1 cycle at 92° C. for 2 minutes; [0164] 10 cycles at 92° C. for 10 seconds, 55° C. for 15 seconds, 68° C. for 10 minutes; [0165] 25 cycles at 92° C. for 10 seconds, 55° C. for 15 seconds, 68° C. for 10 minutes increasing the time of this final step for 20 seconds for each cycle; [0166] 1 cycle at 68° C. for 7 minutes.

    [0167] Amplicons for determining the sequence of the T-DNA insertion were produced using Phusion® High-Fidelity DNA Polymerase from New England BioLabs (Ipswich, Mass.).

    [0168] All sequenced PCR products were resolved by agarose gel electrophoresis as described above and further purified using Illustra GFX PCR DNA and Gel Band Purification Kit (GE, Piscataway, N.J.).

    [0169] Amplicons were cloned (TOPO TA Cloning® kit by Invitrogen) for determination of the T-DNA sequence by Sanger method.

    TABLE-US-00003 TABLE 3 The list of primers used to determine insert sequence in the event  IND-ØØ41Ø-5 through Sanger conventional sequencing method. Primer SEQ ID name NO: Primer sequence 5′-3′ 750 5 ACGCAACTGAACTCAGACCA 751 6 AAGTGGCGATATGGTTCCAG 752 7 GGCTGCAAGTTTTGGTCAAT 753 8 TTCGGCTACATTTCTCAGCA 754 9 AGCCAATGAATCCTCACCAG 755 10 ATTAGGCGAGTAGGCAGCAA 756 11 CAACACACCTACAAACGTGTCA 757 12 GGGTGGGGGCTACTACTTTT 758 13 CTTCAGCAGGTGGGTGTAGAG 759 14 AGTCGACCGTGTACGTCTCC 760 15 GTTGGGTCAGCCTGAGTGAT

    [0170] Clones were then purified following the QIAprep Spin Miniprep Kit by Qiagen (Valencia, Calif.). Plasmid DNA was sent for sequencing to Davis Sequencing (Davis, Calif.). Sequences were analyzed using the software SeqMan Pro from DNASTAR (Madison, Wis.). At least three clones were sequenced for each amplicon.

    [0171] a) Southern Blot Analysis

    [0172] The number of T-DNA inserts was determined in homozygous T5 IND-ØØ41Ø-5 plants by Southern blot analysis. The DNA from this event was digested with two enzymes: HindIII and NdeI. There were two sites for HindIII in the T-DNA, located near each other (FIGS. 1A and 1B). Assuming the occurrence of a single, intact T-DNA in the genome of IND-ØØ41Ø-5, the minimum fragment size detected by hybridization of the HaHB34 probe would be 1.85 kb. The probe for the selectable bar gene, on the other hand, would detect digests extending over the left border into the soybean genome. These fragments should be longer than 2.6 kb (FIG. 1B). In the Southern blot presented in FIG. 9, the highlighted fragments have the expected sizes and were consistent with a single T-DNA insert.

    [0173] There are four NdeI restriction sites in the construct (FIG. 1Aa), two within the T-DNA and two in the binary vector. Complete NdeI digestion in the T-DNA should release a DNA segment precisely 2703 bp long that contains the binding target for the bar probe. The HaHB4 probe was expected to detect a DNA fragment of a minimum size of 1.35 kb, assuming a single, intact T-DNA. The hybridizing band in the NdeI digest was longer than 8.6 kb (FIG. 9A), which is consistent with the presence of a single, intact T-DNA insert.

    [0174] One gram of leaf tissue from either IND-ØØ41Ø-5 or Williams 82 was flash frozen using liquid nitrogen and ground into fine powder using a pre-chilled pestle and mortar. DNA was extracted with Qiagen DNeasy Maxi Prep Kit following manufacturer's protocol. After elution, the DNA was precipitated by adding 1/10 volume of 3M sodium acetate and 2-3 volumes of 100% ethanol. The pellet was washed with 70% ethanol and suspended in 80 μl of 1×TE buffer. The DNA was quantified using a QuBit fluorometer. The concentration of DNA for IND-ØØ41Ø-5 was 1120 ng/μl and that of Williams 82 was 800 ng/μl.

    [0175] To obtain the fragments digested with restriction enzymes, for each 50 μl digestion reaction, 5 μg genomic DNA was mixed with either Hind/l enzyme or NdeI enzyme at concentrations of 10 U/μg of DNA. The samples were digested overnight (˜16 hours) at 37° C. For digests of the plasmid control, 100-200 picograms of plasmid DNA were used.

    [0176] The digested fragments of IND-ØØ41Ø-5 and Williams 82 genomic DNA were loaded into a 0.7% agarose gel along with DIG labeled Molecular Weight Marker VII (Roche Cat No. 1669940910). The samples were run at 50 V overnight. The gel was incubated in denaturing buffer twice for 30 minutes each time. The denatured gel was washed in transfer buffer for 15 minutes prior to alkaline transfer.

    [0177] Molecular probes for HaHB4 and bar genes (Table 4) were synthesized following the procedure outlined in the Roche PCR DIG Probe Synthesis Kit (Cat. No. 11636090910).

    TABLE-US-00004 TABLE 4 List of primers used for the preparation of the probes used in Southern blot analyses. Hybridi- Size Location on zation Primer Primer Probe (pb) vector (° C.) type Number Sequence HB4 226 10159 . . . 10510 45 Forward 2527 CGCTTGCGTCTAAATCCGAGTCTC (SEQ ID NO: 16) Reverse 203(SEQ CAAGACCGGCAACAGGATTC ID NO: 17) Bar 448  7267 . . . 7714 55 Forward 378(SEQ ATATGGCGCTGATCTCTGCT ID NO: 18) Reverse 1970(SEQ GGCGGTCTGCACCATCGTCA ID NO: 19) STA 357  1229 . . . 1585 54 Forward 1747(SEQ AAGACGACCATCGCAACCCATCTA ID NO: 20) Reverse 1748(SEQ TAGCCTTCCATCCGTGACCTCAAT ID NO: 21) REP 258  2979 . . . 3236 50 Forward 1745(SEQ AGCTGATTGGATGTACCGCGAGAT ID NO: 22) Reverse 1746(SEQ TTCAAATCGTACTCCGGCAGGTCA ID NO: 23) aadA 229  5935 . . . 6163 50 Forward 822(SEQ ATCAAACATCGACCCACGGCGTAA ID NO: 24) Reverse 1127(SEQ GATCAATTCGGGCACGAACCCAGT ID NO: 25)

    [0178] Alkaline transfer of DNA from the agarose gel was performed using Turboblotter-Rapid downward transfer system (Whatman). The DNA was transferred to a 12×21 cm Nylon membrane (Nytran™ SuPerCharge, Sigma-Aldrich Co., St. Louis, Mo.) for 4 hours. The membrane was washed in neutralizing buffer (0.2M sodium phosphate, pH6.8). The DNA was permanently cross-linked to the membrane by Ultraviolet Gross linker (CL-1000) with 2 exposures of 1500 mJ.

    [0179] The membrane was incubated in 50 ml of Roche DIG EasyHyb hybridization buffer (Cat. no. 11 603 558 001) at pre-calculated hybridization temperatures (45° C., 55° C. for bar gene and HaHB4 gene probes respectively) on an orbital shaker.

    [0180] Aliquots of 35 μl and 45 μl bar and HaHB4 probes, were diluted by adding 65 and 55 μl, respectively, of 1×TE buffer. The probe solutions were incubated at 95° C. for 10 min and cooled to 4° C. for 2 min. They were added to 8.75 ml of DIG hybridization buffer and poured to the bottom of the hybridization bottle. The membranes were incubated at the described hybridization temperatures for 16 hours in a hybridization oven (VWR scientific products) with an orbital shaker.

    [0181] After hybridization, the membranes were washed with washing buffer according to instructions provided with the Roche, DIG Luminescent Detection Kit. After 1 hour blocking with 1× blocking reagent, the membrane were incubated for 30 min in a solution containing 50 ml of 1× blocking reagent and 5 μl of anti-digoxigenin-AP. The membrane was washed twice with washing buffer for 30 minutes each time and finally treated with detection buffer for 5 minutes. At this point the membrane was placed in a KPL Hybridization Bag (KPL Cat. No. 60-00-51). 5 ml of CSPD solution from the DIG Luminescent Detection Kit was applied evenly across the membrane. The membrane was incubated with CSPD solution for 5 minutes at room temperature. The hybridization bag with the membrane was heat sealed and incubated at 37° C. for 15 minutes. The hybridization bag was placed in a cassette with Kodak Biomax Light Film (Cat. No. 178 8207) in dark room and exposed for 20 minutes. The films were developed at dark using a Konika QX-60A X-ray film processor. Subsequent exposures were made at 1 hour or 2 hours as required.

    [0182] b) Junction Sequence Analysis (JSA) and of T-DNA Sequence of Event IND-ØØ41Ø-5

    [0183] The Junction Sequence Analysis (JSA) of IND-ØØ41Ø-5 using the Illumina-generated sequence data was consistent with the integration or a single copy of the insert at a single locus. This result was supported by the finding of only two junction sequences in the sequenced whole-genome containing event IND-ØØ41Ø-5. The Junction Sequences (JS) were named after the chromosome in which the T-DNA is integrated. The positions in the soybean genome according to SoyBase data are JS-9L-32743826 and JS-9R-32743683. JSA are presented in FIG. 10.

    [0184] The complete sequence of the T-DNA insert and its flanking soybean sequences (SEQ ID NO: 1) were assembled de novo from the Illumina-generated DNA sequence reads.

    [0185] It was verified that the sequence of the T-DNA insert in event IND-ØØ41Ø-5 was identical to the sequence of T-DNA in the binary plasmid, with a single copy of each gene and each regulatory element, except for the almost complete lack of RB (FIG. 11B). Conventional Sanger sequencing of multiple amplicons covering the whole insertion and its flanking sequences corroborated the JSA analysis of the Illumina-generated sequence. In addition, it was possible to generate a single amplicon of 4710 bp, using Expand Long Range PCR, with a set of primers complementary to the flanking sequences. The amplicons obtained using IND-ØØ41Ø-5 or Williams 82 DNA as templates were of the expected sizes and the DNA sequence of this IND-ØØ41Ø-5 amplicon was identical to the T-DNA sequence derived from whole-genome sequencing.

    [0186] c) Localization of IND-ØØ41Ø-5 T-DNA in the Soybean Genome.

    [0187] The flanking sequences were mapped to the soybean genome by homology search using BLASTN (Altschul et al. 1990). The insertion of the T-DNA occurred in a single location of chromosome 9. The insertion was located 752 bp downstream of the last exon (Exon number 5) of F-box At1g60400-like putative gene (corresponding to Glyma.09g142000 in the reference genome (Williams 82), formerly known as Glyma09g26270), and 405,138 bp upstream of the nearest confirmed gene, an ATL6-like E3 ubiquitin ligase. It should be noted that a 142 bp fragment of the soybean chromosome was lost at the T-DNA insertion site. The insertion did not disrupt any genes or any other known annotated feature in the soybean genome (FIG. 11).

    [0188] d) Absence of Transgenic Binary Plasmid Elements:

    [0189] In principle, Agrobacterium should only transfer into the host cells its T-DNA the portion of the plasmid contained between the left border (LB) and right border (RB) sequences. However, it has been reported that Agrobacterium can also transfer a portion of the binary plasmid, not corresponding to the T-DNA, or even the whole of it (De Buck et al. 2000). Assays for the presence of said unintended DNA in the IND-ØØ41Ø-5 soybean genome were negative.

    [0190] The whole genome was sequenced using Illumina NGS technology to determine unequivocally the absence of remains of sequences of the plasmid in event IND-ØØ41Ø-5. Additionally, Southern blot assays were performed to provide a second assay to prove the absence of remains of vector sequences. None of the probes specific for plasmid sequences foreign to the T-DNA (aadA, STA, and REP) hybridized to the genomic DNA of IND-ØØ41Ø-5.

    [0191] e) Insertion Locus Stability in IND-ØØ41Ø-5 and T-DNA Integrity:

    [0192] The position of the IND-ØØ41Ø-5 T-DNA across six generations was monitored. A set of PCR primer pairs was selected to provide overlapping amplicons across the insertion locus of the IND-ØØ41Ø-5 T-DNA, inclusive of the soybean chromosome 9 flanking sequences. Sequences of the contigs assembled from these overlapping PCR products suggested that the T-DNA was intact and stable. The organization of the genetic elements in the IND-ØØ41Ø-5 soybean event was the same as the one present in the binary plasmid T-DNA used in transformation to obtain this transgenic line. No changes in DNA sequence were detected across six tested generations.

    [0193] f) T-DNA Segregation Over Sexual Transfer:

    [0194] Segregation of the T-DNA was assessed in F2 progeny plants from crosses between IND-ØØ41Ø-5 and a commercial soybean cultivar (Bio 6.5) using PCR. A set of PCR reactions, diagnostic of the T-DNA junction at the Left Border and of the native soybean allele, clearly showed that the T-DNA segregated as a single locus.

    [0195] A homozygous IND-ØØ41Ø-5 transgenic plant was crossed with Bio 6.5 to produce the F1 progeny. Four F1 plants were self-pollinated to produce F2 seeds that were used for the segregation analysis. The DNA isolation and the corresponding experiments were conducted using 73 F2 seeds. F2 plants were scored as homozygous for the IND-ØØ41Ø-5 T-DNA (I) when the amplicon for the Left Border Junction was present and the amplicon for the native allele was absent. F2 plants were scored as hemizygous (H) when both amplicons described above were present. F2 plants were scored as homozygous for the native Williams 82 cultivar allele when the amplicon for the Left Border Junction was absent and the amplicon for the native allele was present (W).

    [0196] These results support the conclusion that the IND-ØØ41Ø-5 T-DNA resides at a single locus within the soybean genome and is inherited according to Mendelian inheritance principles.

    [0197] The selected transgenic event IND-ØØ41Ø-5 differs from the parental Williams 82 by a single T-DNA. This T-DNA carries a single copy of the selectable marker-gene bar and a single copy of the HaHB4 gene along with their regulatory sequences. The T-DNA was integrated in chromosome 9 between two native genes coding for an F-box At1g60400-like protein and an AtL6-like E3 ubiquitin ligase. The integration did not disrupt any known gene or annotated sequence but caused the loss of a 142 base pair sequence corresponding to an intergenic region. The locus of the insertion and the T-DNA structure were stable over six generations of self-pollination. The T-DNA insertion was shown to segregate in a Mendelian fashion. No sequences outside the T-DNA border were integrated into the IND-ØØ41Ø-5 event.

    Example 4: Useful Methods for Identification of IND-ØØ41Ø-5 in a Sample

    [0198] The following example describes the detection system event-specific useful to identify DNA of event IND-ØØ41Ø-5 in a soybean sample. This method is site-specific, therefore, only amplifies sequences of one of the insertion sites of event IND-ØØ41Ø-5.

    [0199] Multiplex qPCR for HaHB4 and Le1 (reference soybean gene Lecithin 1) was performed using specific oligonucleotides and different fluorescent probes attached to FAM and HEX for HaHB4 and Le1, respectively. Multiplex qPCR technique was also used for RB of event IND-ØØ41Ø-5 and bar transgene using probes marked with FAM and HEX respectively. On the other hand, LB of the event was detected through end-point PCR, and qPCR was used for detection of the wild allele (WT) using a probe marked with HEX.

    [0200] FIG. 12 shows a scheme of the insertion in IND-ØØ41Ø-5 and of oligonucleotides positions and probes used for detection of different elements of the construct.

    [0201] Detection of Insertion Site Towards RB

    [0202] Great part of RB (T-DNA right border) was lost during the insertion process; there are only 3 pb left. It is mentioned with the purpose of being aware of the insert with respect to the original construct.

    [0203] The oligonucleotides 817 (SEQ ID NO:) and 818 (SEQ ID NO:) amplify a 200 pb quimeric fragment formed by the left flanking sequences (soybean genome “Gm chr9”) and a part of the inserted construct.

    Oligonucleotides and Probe:

    [0204]

    TABLE-US-00005 817 (SEQ ID NO: 26): 5 GCAACTGAACTCAGACCACTG 3 818 (SEQ ID NO: 27): 5 GAGCTTGAGCTTGGATCAGA 3 819 (SEQ ID NO: 28): 5-FAM-TTGTCGTTTCCCGCCTTCAGTTTAA-BHQ1-3

    QPCR Protocol:

    [0205]

    TABLE-US-00006 2 ul Genomic DNA (100 ng/ul) 5.9 ul mqH2O 10 ul qPCR SuperMix Roche (2X) 0.5 ul Probe (10 uM) 0.8 ul Primer F (10 uM) 0.8 ul Primer R (10 uM) 20 ul

    Amplification Program:

    [0206]

    TABLE-US-00007 Temp. (° C.) Time (min) Variation (° C./s) 95  5 4.4 Denaturation Temp. (° C.) Time (s) Variation (° C./s) 95 10 4.4 35 cycles-qPCR 55 30 2.2 72 10 4.4 Temp. (° C.) Time (min) Variation (° C./s) 10  5 2.2 Cooling

    [0207] Detection of Insertion Site Towards LB

    [0208] The oligonucleotides 868 (SEQ ID NO: 29) and 752 (SEQ ID NO: 30) amplify a 356 pb quimeric fragment formed by the right flanking sequences (soybean genome “Gm chr9”) and part of the event IND-ØØ41Ø-5.

    Oligonucleotides:

    [0209]

    TABLE-US-00008 868 (SEQ ID NO: 29): 5 CCGCAATGTGTTATTAAGTTGTC 3 752 (SEQ ID NO: 30): 5 GGCTGCAAGTTTTGGTCAAT 3

    PCR Protocol:

    [0210]

    TABLE-US-00009 2 ul Genomic DNA (100 ng/ul) 2 ul PCR buffer solution 10X 1.6 ul MgCl2 (25 mM) 1 ul Primer F (10 uM) 1 ul Primer R (10 uM) 0.4 ul dNTPs (10 mM) 0.1 ul Taq 11.9 ul mqH2O 20 ul

    Amplification Program:

    [0211]

    TABLE-US-00010 94° C. 35 cycles  4 min 94° C. 30 seg 55° C. 30 seg 72° C. 30 seg  4° C. 2 min

    [0212] HaHB4 Detection

    [0213] Oligonucleotides 530 (SEQ ID NO: 31) and 531 (SEQ ID NO: 32) amplify a 68 pb fragment within HaHb4 transgene.

    Oligonucleotides and Robe:

    [0214]

    TABLE-US-00011 530 (SEQ ID NO: 31): 5 CGCCACTTGACGAGGATGA 3 531 (SEQ ID NO: 32): 5 CGAGACCCGAGTTAAGGATGAAAC 532 (SEQ ID NO: 33): 5-FAM-AGCCCGAGTTTATGTGCCAACTGGT-BHQ1-3

    QPCR Protocol:

    [0215]

    TABLE-US-00012 2 ul Genomic DNA (100 ng/ul) 5.9 ul mqH2O 10 ul Roche SuperMix qPCR (2X) 0.5 ul Probe (10 uM) 0.8 ul Primer F (10 uM) 0.8 ul Primer R (10 uM) 20 ul

    Amplification Program:

    [0216]

    TABLE-US-00013 Temp. Variation (° C.) Time (min) (° C./s) 95  5 4.4 Denaturation Temp. Variation (° C.) Time (s) (° C./s) 95 10 4.4 qPCR-35 cycles 55 30 2.2 Bar detection 72  1 4.4 Oligonucleotides 527 (SEQ ID NO: 34) and 528 (SEQ ID NO: 35) amplify a 84 pb fragment within bar transgene. Temp. Variation (° C.) Time (min) (° C./s) 10  5 2.2 Cooling

    Oligonucleotides and Probe:

    [0217]

    TABLE-US-00014 527 (SEQ ID NO: 34): 5 CTGCACCATCGTCAACCACTAC 3 528 (SEQ ID NO: 35): 5 GGTCGTCCGTCCACTCCTG 3 529 (SEQ ID NO: 36): 5′-HEX-TCGAGACAAGCACGGTCAACTTCC-BHQ1-3′

    QPCR Protocol:

    [0218]

    TABLE-US-00015 2 ul Genomic DNA (100 ng/ul) 5.9 ul mqH2O 10 ul qPCR SuperMix Roche (2X) 0.5 ul Probe (10 uM) 0.8 ul Primer F (10 uM) 0.8 ul Primer R (10 uM) 20 ul

    Amplification Program:

    [0219]

    TABLE-US-00016 Temp. (° C.) Time (min) Variation (° C./s) 95  5 4.4 Denaturation Temp. (° C.) Time (s) Variation (° C./s) 95 10 4.4 qPCR-35 cycles 55 30 2.2 72  1 4.4 Temp. (° C.) Time (min) Variation (° C./s) 10  5 2.2 Cooling

    [0220] In the case that HaHB4 and bar detection were necessary, it may be performed simultaneously by multiplex qPCR with the last two systems. The HaHB4 probe has a FAM fluorophore while Bar probe has a HEX fluorophore, enabling detection of both amplifications with different filters.

    [0221] Furthermore, HaHB4 as well as bar (separately) can be simultaneously detected with endogenous control through multiplex qPCR, provided that said control has a fluorophore different from that of the gene of interest. An example of endogenous control is soybean-specific Lecithin gene. Protocol and amplification program for multiplex PCR are detailed below.

    Multiplex qPCR Protocol:

    TABLE-US-00017 2 ul Genomic DNA (100 ng/ul) 3.8 ul dd(H2O) 10 ul Roche SuperMix qPCR (2X) 0.5 ul Gen 1 probe (10 uM) 0.8 ul Gen 1 primer F(10 uM) 0.8 ul Gen 1 primer R (10 uM) 0.5 ul Gen 2 probe (10 uM) 0.8 ul Gen 2 primer F (10 uM) 0.8 ul Gen 2 primer R (10 uM) 20 ul

    Amplification Program:

    [0222]

    TABLE-US-00018 Temp. (° C.) Time (min) Variation (° C./s) 95  5 4.4 Denaturation Temp. (° C.) Time (s) Variation (° C./s) 95 10 4.4 qPCR-35 cycles 55 30 2.2 72  1 4.4 Temp. (° C.) Time (min) Variation (° C./s) 10  5 2.2 Cooling

    Ie1 Detection

    [0223] Oligonucleotides 718 (SEQ ID NO: 37) and 719 (SEQ ID NO: 38) amplify a 118 pb fragment within Lecithin 1 gene.

    Oligonucleotides and Probe:

    [0224]

    TABLE-US-00019 718 (SEQ ID NO: 37): 5 CTACTGACCAGCAAGGCAAA 3 719 (SEQ ID NO: 38): 5 TCACAATAGCGTCTCCTTGG 3 720 (SEQ ID NO: 39): 5′-HEX-TCGTGCCGAAGCAACCAAACA-BHQ1-3′
    qPCR Protocol:

    TABLE-US-00020 2 ul Genomic DNA (100 ng/ul) 5.9 ul dd (H2O) 10 ul Roche Supermix qPCR (2X) 0.5 ul Probe (10 uM) 0.8 ul Primer F (10 uM) 0.8 ul Primer R (10 uM) 20 ul

    Amplification Program:

    [0225]

    TABLE-US-00021 Temp. (° C.) Time (min) Variation (° C./s) 95  5 4.4 Denaturation Temp. (° C.) Time (s) Variation (° C./s) 95 10 4.4 qPCR-35 cycles 55 30 2.2 72  1 4.4 Temp. (° C.) Time (min) Variation (° C./s) 10  5 2.2 Cooling

    Detection of Heterozygous Individuals

    [0226] Event insertion is contiguous to 3′UTR region of gene Glyma.09g142000, formerly known as Glyma09g26270. Using oligonucleotides hybridizing in the flanking sequences of the insertion sites it was possible to differentiate the wild allele (they amplify a 205 pb fragment) from the allele having the insert of IND-ØØ41Ø-5 (in this case, they amplify 4710 pb).

    [0227] For the detection of heterozygous individuals, detection of event IND-00410-5 was performed in first place by means of any of the 2 event-specific systems previously mentioned and then a qPCR was conducted to detect the wild allele.

    [0228] Oligonucleotides 934 (SEQ ID NO: 40) and 935 (SEQ ID NO: 41) amplify a 205 pb fragment formed by the flanking sequences of the IND-ØØ41Ø-5 event insertion site and a part of 142 pb lost during transformation (absent in event IND-ØØ41Ø-5).

    Oligonucleotides and Probe:

    [0229]

    TABLE-US-00022 934 (SEQ ID NO: 40): 5 AGACCACTGAAATAGAGAGAAAG 3 935 (SEQ ID NO: 41): GGAGTTCTGATAATTGTTATCGTC 936 (SEQ ID NO: 42): 5 HEX-TGAAGTGAGATGATTGAGGGTGGG-BHQ1 3

    PCR Protocol:

    [0230]

    TABLE-US-00023   2 ul Genomic DNA (100 ng/ul) 5.9 ul mq(H2O)  10 ul SuperMix qPCR (2X) 0.5 ul Probe (10 uM) 0.8 ul Primer F (10 uM) 0.8 ul Primer R (10 uM)  20 ul

    Amplification Program:

    [0231]

    TABLE-US-00024 Temp. (° C.) Time (min) Variation (° C./s) 95  5 4.4 Denaturation Temp. (° C.) Time (s) Variation (° C./s) 95 10 4.4 qPCR-35 cycles 55 30 2.2 72 10 4.4 Temp. (° C.) Time (min) Variation (° C./s) 40  5 1.9 Cooling

    Example 5: Susceptibility to Abiotic Stress Factors and Yield

    [0232] The environments in which event IND-ØØ41Ø-5 and control were assessed were different with respect to their potential yield probably due to the combination of stress factors such as drought, salinity and low temperatures (osmotic stresses), high temperatures, excess of radiation, low nutrient availability, soil compaction preventing root development, etc. The efficacy of the transgenic event was assessed over three growing seasons in different locations and in different sowing dates, a total of 16 sites were assessed.

    [0233] The set of these stress factors combined allowed the separation of the environments in categories of high, medium, and low yield potential.

    [0234] With the transgenic event a yield higher that control was obtained with a level of statistical significance of 10% (p=0.09) for sites with yields lower than 2000 kg ha-1 (W1, W2, P, I1 y J1). Yield difference was 12% favourable to the transgenic event. For higher yield categories no significant differences were found between the event and control, showing the absence of penalty in conditions of medium (2000-3000 Kg ha-1) (I2, G1, G2, J2 y K) or high yield potential (>3000 Kg ha-1) (D2, C, Q2, L, A y F) (Table 5).

    [0235] These results confirmed the presence of an expected genotype-environment interaction (p=0.02) due to the different combination of abiotic stresses specific to each site or environment and showed that susceptibility to these factors in the transgenic event is specifically associated to the characteristics related to the gene mode of action.

    [0236] The yields observed for event IND-ØØ41Ø-5 and its control were analyzed in individual sites as specific environment conditions play a key rol in the expression of the phenotype associated to the introduced gene. The efficacy of the introduced gene was assessed over three growing seasons in different locations and in different sowing dates, a total of 16 sites were assessed

    [0237] Twelve out of sixteen sites correspond to the growing season 2012-2013, wherein all agronomic parameters, both in the transgenic event and control, as well as in the varieties used as reference were measured. In said growing season, the yields of the Northern and Southern core areas were largely higher than in the previous ones, furthermore, historical yields never obtained before were observed in isolated lots of land (Bolsa de Cereales, 2013). The four remaining sites correspond to assays performed in previous growing seasons to determine the efficacy of the event as compared to control. These four assays correspond to the following locations: Hughes, Santa Fe (Site L, 2011-2012), Quimili, Santiago del Estero (2009-2010, Site K) and Liborio Luna, San Luis (2009-2010) with two hydrological conditions: low availability (J1) and high availability (J2). Data were analyzed by analysis of variance using sites and genotypes as factors and evaluating the significance of genotype-environment interaction. “A posteriori” comparisons were made using a least significant differences (LSD) test.

    [0238] Results confirmed the presence of genotype-environment interaction (p=0.02) for the evaluated sites. The transgenic event had a higher yield in eleven out of sixteen sites, with an average difference of 11% for the sites with positive differences (FIG. 13).

    [0239] The introduced gene response in terms of yield was also evaluated with respect to control in sites grouped by yield categories. Grouping sites with similar ranks allows the evaluation of the event response under different potential yield conditions. A higher yield was obtained with the transgenic event with respect to control with a significance level of 10% (p=0.09) for sites with yields lower than 2000 kg ha-1 (W1, W2, P, I1, and J1). Yield difference was 12% in favor of the transgenic event. For higher yield categories, no significative differences were found between event and control, showing the absence of penalty in conditions of medium (2000-3000 Kg ha-1) (I2, G1, G2, J2 y K) or high (>3000 Kg ha-1) (D2, C, Q2, L, A y F) (Table 5) yield potential.

    TABLE-US-00025 TABLE 5 Mean yields for transgenic event and control for low, medium, and high yield potential environments. Mean (SEM) Environments IND-ØØ41Ø-5 Williams 82 Sites Low potential 1900.4  (86.6) 1699.1 (80) * W1, W2, P, I1, J1 Medium potential 2646 (104.2) 2649.3  (82.5) NS G1, G2, I2, J2, K High potential 4209.6 (131)  4117.4 (123.8) NS C, D2, Q2, A, F, L *indicates significant differences (α = 0.1) NS: non significant differences