MUTANT TRANSPORTERS FOR BACTERIAL UPTAKE OF TEREPHTHALIC ACID

20220089654 · 2022-03-24

    Inventors

    Cpc classification

    International classification

    Abstract

    The present disclosure relates to a non-naturally occurring microorganism that includes a gene encoding a MucK transporter protein, where the microorganism is capable of catabolizing terephthalic acid (TPA). In some embodiments of the present disclosure, the gene encoding the MucK transporter protein may contain at least one mutation, relative to a reference gene encoding a reference MucK transporter protein.

    Claims

    1. A non-naturally occurring microorganism comprising: a gene encoding a MucK transporter protein, wherein the microorganism is capable of catabolizing terephthalic acid (TPA).

    2. The non-naturally occurring microorganism of claim 1, wherein the gene encoding the MucK transporter protein contains at least one mutation, relative to a reference gene encoding a reference MucK transporter protein.

    3. The non-naturally occurring microorganism of claim 1, wherein the reference MucK transporter protein is at least 90% identical to SEQ:ID 2.

    4. The non-naturally occurring microorganism of claim 1, wherein the gene encoding the reference MucK transporter protein is at least 90% identical to SEQ:ID 1.

    5. The non-naturally occurring microorganism of claim 1, wherein the mutation to the MucK transporter protein comprises at least one point mutation.

    6. The non-naturally occurring microorganism of claim 5, wherein the point mutation is present at an amino acid located at at least one of positions 34, 53, 133, 341, or 342 on SEQ:ID 2.

    7. The non-naturally occurring microorganism of claim 6, wherein the point mutation comprises at least one of M34L, M34I, Y133C, T342I, or E53G.

    8. The non-naturally occurring microorganism of claim 1, further comprising a deletion of an endogenous gene encoding a MucK transporter protein.

    9. The non-naturally occurring microorganism of claim 1, wherein the microorganism is further capable of growing on TPA.

    10. The non-naturally occurring microorganism of claim 9, wherein the microorganism is characterized by a TPA consumption rate between greater than zero g TPA/L/hr and about 0.2 g/L/hr.

    11. The non-naturally occurring microorganism of claim 9, wherein the microorganism is grown in a liquid media at a temperature between about 25° C. and about 35° C.

    12. The non-naturally occurring microorganism of claim 11, wherein the liquid media is maintained at pH between about 6 and about 7.

    13. The non-naturally occurring microorganism of claim 1, wherein the microorganism comprises at least one of a bacterium, a yeast, or a fungus.

    14. The non-naturally occurring microorganism of claim 13, wherein the microorganism is a bacterium.

    15. The non-naturally occurring microorganism of claim 14, wherein the bacterium comprises a strain from at least one of A. baylyi, P. putida, P. fluorescens, or P. stutzeri.

    16. The non-naturally occurring microorganism of claim 15, wherein the bacterium is A. baylyi.

    17. The non-naturally occurring microorganism of claim 16, wherein the bacterium is A. baylyi ADPI.

    18. The non-naturally occurring microorganism of claim 16, further comprising the deletion of an endogenous gene encoding a transcriptional regulator.

    19. The non-naturally occurring microorganism of claim 18, wherein the transcriptional regulator is a DcaS transcriptional regulator.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0010] Some embodiments are illustrated in referenced figures of the drawings. It is intended that the embodiments and figures disclosed herein are to be considered illustrative rather than limiting.

    [0011] FIG. 1 illustrates step-wise integration of tph:tpi genes into the chromosome of ADP1, according to some embodiments of the present disclosure. The top line shows the schematic representation of the initial design of the synthetic operon, targeting the pobA-hcaG intergenic region. The PCR products used for the step-wise integration, containing inserted genes flanked by ˜1 kbp targeting regions, are numbered 1 to 3. Cells transformed with PCR products 1 and 3a-3c were selected on MMP+Km. Cells transformed with PCR product 2 were selected on YT+25% sucrose. Strain IP101 was obtained from transformation of ADP1 with 1. Strain IP103 was obtained from transformation of IP101 with 2. Strain IP115 was obtained from transformation of IP103 with 3b. Strain IP130 was obtained from transformation of IP103 with 3c. Transformation with 3a (tpiBA with strong RBS sequences, shown in gray) was unsuccessful.

    [0012] FIG. 2 illustrates the growth (OD.sub.420-580) of ADP1 (A, B), IP115 (C, D), IP130 (E, F) and IP148 (G, H) in minimal medium supplemented with 20 mM pyruvate (light gray), 5 mM TPA (black), or 20 mM pyruvate+5 mM TPA (dark gray), according to some embodiments of the present disclosure. The medium was adjusted to pH 6 (A, C, E, G) or pH 7 (B, D, F, H). Average and standard deviation for three biological replicates are shown.

    [0013] FIG. 3 illustrates TPA transport and catabolism, genetic organization, and TPA turnover in A. baylyi strains with a single copy of heterologous genes integrated in the chromosome, according to some embodiments of the present disclosure. (A) TPA transport and catabolic proteins from Comamonas sp. E6. (B) Schematic representation of the synthetic tph:tpi operons integrated in the chromosome of ADP1, downstream of pobA. Catabolic genes are tphA genes encoding TPAD or tphB encoding dihydrodiol dehydrogenase. Transport genes are tphC encoding periplasmic SBP or tpiBA encoding transmembrane proteins). The kanamycin resistance gene is Km.sup.R. Synthetic RBS sequences are shown in gray (high predicted TIR) or white (low predicted TIR). Black arrows indicate transcription initiation and direction. The “T” s indicate transcription terminators (rrnB T1 upstream tphC and prophage T4 transcription/translation termination signal flanking the Km.sup.R gene). The EASy amplicon is bound by a dotted line for strain IP148. (C-F) Growth (OD.sub.600) and consumed TPA (mM) for (C) wild-type ADP1, (D) IP115, (E) IP130, and (F) IP148, grown in MMP+5 mM TPA at pH 6 and pH 7. Pyruvate (20 mM) was supplemented every 24 h to support growth and completely consumed in all cases (120 mM in total). Consumed TPA values shown are corrected with respect to non-inoculated flasks to account for the increased TPA concentrations caused by evaporation. Error bars indicate the standard deviation for three replicates.

    [0014] FIG. 4 illustrates ALE of IP148-derived amplification mutants on TPA), according to some embodiments of the present disclosure. Symbols indicate changes in amplicon copy number over time (values indicated on the right-side axis). Error bars indicate the standard deviation for four technical replicates. Cumulative generations are shown as dashed lines (values indicated on the left-side axis). Changes in serial transfer conditions (culture dilution, frequency, and TPA concentration) during ALE are indicated.

    [0015] FIG. 5 illustrates the increase of normalized fluorescence at 520 nm (F.sub.520/OD.sub.600, as measured in a plate-reader; 50 gain, 8-h timepoint) for A. baylyi strains carrying pTPA3 and grown in MMP with increasing TPA concentrations), according to some embodiments of the present disclosure. Error bars indicate the standard deviation for three biological replicates.

    [0016] FIG. 6 illustrates a sequence of mutated tpiA found in IP148 and Tpa.sup.+ amplification isolates TPA_1 to TPA_4), according to some embodiments of the present disclosure. Mutation is shown in gray box. The encoded amino acid sequence for peptides TpiA(W366*) and TpiA(Δ1-370) are respectively indicated with a simpe or double underline.

    [0017] FIG. 7 illustrates a dendrogram of A. baylyi strains and isolates used in this work, according to some embodiments of the present disclosure. Mutations introduced during strain construction relevant to TPA catabolism and transport are indicated.

    [0018] FIGS. 8A and 8B illustrate changes in growth rates in 10 mM TPA for the different EASy lineages throughout ALE), according to some embodiments of the present disclosure. Average OD.sub.420-580 (left axis) over time (hours, lower axis) is shown as lines (error bars indicate standard deviation for three individual wells). Amplicon copy number (right axis) for a given ALE population (days, top axis) is shown as circles (error bars indicate standard deviation for four technical replicates).

    [0019] FIG. 9 illustrates the copy-number ratio of tphA.sub.2 over the Km.sup.R gene for evolved Tpa.sup.+ isolates determined by qPCR), according to some embodiments of the present disclosure. Error bars indicate standard deviation for four technical replicates.

    [0020] FIG. 10 illustrates shake-flask cultures with TPA as a sole carbon and energy source), according to some embodiments of the present disclosure. Growth (OD.sub.600) and TPA concentration (mM) over time are plotted for cultures of EASy lineages after ˜30 generations and isolates after ˜750 generations. Cultures from top (A, C, E, G) and bottom (B, D, F, H) rows were respectively grown at pH 6 and pH 7. Error bars indicate the standard deviation from three biological replicates.

    [0021] FIG. 11 illustrates the growth in increasing TPA concentrations of EASy lineages after ˜30 generations and evolved isolates after ˜750 generations), according to some embodiments of the present disclosure. Changes in OD.sub.420-580 over time are shown for individual triplicates. TPA concentrations used (mM) are indicated on the right.

    [0022] FIG. 12 illustrates a comparison of A. baylyi EASy lineages after ˜30 generations and isolates after ˜750 generations to native TPA-utilizing bacteria), according to some embodiments of the present disclosure. (A-B) Growth (OD.sub.600) and TPA concentration (mM) over time for (A) Comamonas sp. E6 and (B) R. jostii RHA1 cultures grown at pH 7. (C) Growth rates (h.sup.−1), calculated from ln(OD.sub.600) as a function of time. (D) TPA consumption rates (g/L/h) calculated from TPA concentration as a function of time in log growth phase. Error bars indicate the standard deviation from three biological replicates.

    [0023] FIG. 13 illustrates an evaluation of RpoD(A87E)), according to some embodiments of the present disclosure. (A) Agar plates from growth competition cultures showing colonies of different size. Amplified images (5×) of representative large (1-3) and small (4-5) colonies are shown. (B) Growth (OD.sub.600) and (C) normalized fluorescence (F.sub.520/OD.sub.600) for individual clones from three large colonies (L1-L3) and three small colonies (S1-S3) from IP148+rpoD plate, transformed with pTPA3. Clones L1-L3 were confirmed to have acquired wild-type rpoD by sequencing, whereas S1-S3 retained rpoD148. Cells were grown in MMP without TPA. Average and standard deviation for triplicate wells are shown.

    [0024] FIG. 14A illustrates a schematic representation of mucK and dcaS mutations found in evolved isolates, showing their genetic organization in the chromosome), according to some embodiments of the present disclosure. Predicted amino acid changes are shown in bold.

    [0025] FIG. 14B (top) illustrates relative mucK expression levels (2.sup.−ΔΔCt) for wild-type ADP1 and Δ dcaS mutant IP461), according to some embodiments of the present disclosure. Results are shown for three biological replicates, each measured with three technical replicates, and normalized to wild-type ADP1 grown on pyruvate. Error bars indicate the standard deviation. PYR: pyruvate; MUC: muconate; PCA: protocatechuate. FIG. 14B (bottom) illustrates the increase of normalized fluorescence at 520 nm (F.sub.520/OD.sub.600) for wild-type ADP1 and ΔdcaS mutant IP461, both transformed with pTPA3, after 8 hours of growth in MMP with increasing TPA concentrations, according to some embodiments of the present disclosure. Error bars indicate the standard deviation for biological triplicates.

    [0026] FIG. 14C illustrates the normalized fluorescence (F.sub.520/OD.sub.600) over time for mucK mutant strains in wild-type or ΔdcaS backgrounds, transformed with pTPA3, and grown in the absence (gray lines) or presence of 0.01 mM TPA (black lines), according to some embodiments of the present disclosure. MucK variants encoded by the different alleles are indicated in brackets. Average and standard deviation for biological triplicates are shown.

    [0027] FIG. 15 illustrates three-dimensional (3D) structure models for dimers of DcaS variants selected during ALE. Models were built with SWISS-MODEL, using the crystal structure of BaaR from Brucella abortus as template (PDB 5WHM, 62% sequence identity).

    [0028] FIG. 16 illustrates the growth of three independent mucK knock-out mutants (1a-1c and 2a-2c) derived from evolved isolates IP243 (1) and IP255 (2) on minimal medium plates supplemented with (A) 20 mM pyruvate, (B) 5 mM muconate, and (C) 5 mM TPA, according to some embodiments of the present disclosure.

    [0029] FIG. 17 illustrates tphA.sub.2 gene copy number in dcaS and mucK IP148-derived mutants after spontaneous growth on minimal medium with 10 mM TPA as the sole carbon and energy source, according to some embodiments of the present disclosure. The parent strain IP148 was included as a control. IP378, ΔdcaS; IP398, mucK258; IP400, mucK243; IP411, mucK246; IP413, ΔdcaS mucK258; IP415, ΔdcaS mucK243; IP417, ΔdcaS mucK255; IP419, ΔdcaS mucK246. Average copy number and standard deviation are shown for four technical replicates.

    [0030] FIG. 18 illustrates clustal Omega alignment of TpaK from R. jostii RHA1 (GenBank accession no. ABH00388), Rhodococcus sp. DK17 (GenBank accession no. AAR90191), and P. xenovorans LB400 (GenBank accession no. ABE33247) with MucK and GudP variants from A. baylyi. Replaced residues in MucK and GudP variants found in evolved Tpa.sup.+ isolates are in bold and underlined text.

    DETAILED DESCRIPTION

    [0031] The present disclosure may address one or more of the problems and deficiencies of the prior art discussed above. However, it is contemplated that some embodiments as disclosed herein may prove useful in addressing other problems and deficiencies in a number of technical areas. Therefore, the embodiments described herein should not necessarily be construed as limited to addressing any of the particular problems or deficiencies discussed herein.

    [0032] A “vector” or “recombinant vector” is a nucleic acid molecule that is used as a tool for manipulating a nucleic acid sequence of choice or for introducing such a nucleic acid sequence into a host cell. A vector may be suitable for use in cloning, sequencing, or otherwise manipulating one or more nucleic acid sequences of choice, such as by expressing or delivering the nucleic acid sequence(s) of choice into a host cell to form a recombinant cell. Such a vector typically contains heterologous nucleic acid sequences not naturally found adjacent to a nucleic acid sequence of choice, although the vector can also contain regulatory nucleic acid sequences (e.g., promoters, untranslated regions) that are naturally found adjacent to the nucleic acid sequences of choice or that are useful for expression of the nucleic acid molecules.

    [0033] A vector can be either RNA or DNA, either prokaryotic or eukaryotic, and typically is a plasmid. The vector can be maintained as an extrachromosomal element (e.g., a plasmid) or it can be integrated into the chromosome of a recombinant host cell. The entire vector can remain in place within a host cell, or under certain conditions, the plasmid DNA can be deleted, leaving behind the nucleic acid molecule of choice. An integrated nucleic acid molecule can be under chromosomal promoter control, under native or plasmid promoter control, or under a combination of several promoter controls. Single or multiple copies of the nucleic acid molecule can be integrated into the chromosome. A recombinant vector can contain at least one selectable marker.

    [0034] The term “expression vector” refers to a recombinant vector that is capable of directing the expression of a nucleic acid sequence that has been cloned into it after insertion into a host cell or other (e.g., cell-free) expression system. A nucleic acid sequence is “expressed” when it is transcribed to yield an mRNA sequence. In most cases, this transcript will be translated to yield an amino acid sequence. The cloned gene is usually placed under the control of (i.e., operably linked to) an expression control sequence. The phrase “operatively linked” refers to linking a nucleic acid molecule to an expression control sequence in a manner such that the molecule can be expressed when introduced (i.e., transformed, transduced, transfected, conjugated or conduced) into a host cell.

    [0035] Vectors and expression vectors may contain one or more regulatory sequences or expression control sequences. Regulatory sequences broadly encompass expression control sequences (e.g., transcription control sequences or translation control sequences), as well as sequences that allow for vector replication in a host cell. Transcription control sequences are sequences that control the initiation, elongation, or termination of transcription. Suitable regulatory sequences include any sequence that can function in a host cell or organism into which the recombinant nucleic acid molecule is to be introduced, including those that control transcription initiation, such as promoter, enhancer, terminator, operator and repressor sequences. Additional regulatory sequences include translation regulatory sequences, origins of replication, and other regulatory sequences that are compatible with the recombinant cell. The expression vectors may contain elements that allow for constitutive expression or inducible expression of the protein or proteins of interest. Numerous inducible and constitutive expression systems are known in the art.

    [0036] Typically, an expression vector includes at least one nucleic acid molecule of interest operatively linked to one or more expression control sequences (e.g., transcription control sequences or translation control sequences). In one aspect, an expression vector may comprise a nucleic acid encoding a recombinant polypeptide, as described herein, operably linked to at least one regulatory sequence. It should be understood that the design of the expression vector may depend on such factors as the choice of the host cell to be transformed and/or the type of polypeptide to be expressed.

    [0037] Expression and recombinant vectors may contain a selectable marker, a gene encoding a protein necessary for survival or growth of a host cell transformed with the vector. The presence of this gene allows growth of only those host cells that express the vector when grown in the appropriate selective media. Typical selection genes encode proteins that confer resistance to antibiotics or other toxic substances, complement auxotrophic deficiencies, or supply critical nutrients not available from a particular media. Markers may be an inducible or non-inducible gene and will generally allow for positive selection. Non-limiting examples of selectable markers include the ampicillin resistance marker (i.e., beta-lactamase), tetracycline resistance marker, neomycin/kanamycin resistance marker (i.e., neomycin phosphotransferase), dihydrofolate reductase, glutamine synthetase, and the like. The choice of the proper selectable marker will depend on the host cell, and appropriate markers for different hosts as understood by those of skill in the art.

    [0038] Suitable expression vectors may include (or may be derived from) plasmid vectors that are well known in the art, such as those commonly available from commercial sources. Vectors can contain one or more replication and inheritance systems for cloning or expression, one or more markers for selection in the host, and one or more expression cassettes. The inserted coding sequences can be synthesized by standard methods, isolated from natural sources, or prepared as hybrids. Ligation of the coding sequences to transcriptional regulatory elements or to other amino acid encoding sequences can be carried out using established methods. A large number of vectors, including bacterial, yeast, and mammalian vectors, have been described for replication and/or expression in various host cells or cell-free systems, and may be used with the sequences described herein for simple cloning or protein expression.

    [0039] “Nucleic acid” or “polynucleotide” as used herein refers to purine- and pyrimidine-containing polymers of any length, either polyribonucleotides or polydeoxyribonucleotide or mixed polyribo-polydeoxyribonucleotides. This includes single- and double-stranded molecules (i.e., DNA-DNA, DNA-RNA and RNA-RNA hybrids) as well as “protein nucleic acids” (PNA) formed by conjugating bases to an amino acid backbone. This also includes nucleic acids containing modified bases.

    [0040] Nucleic acids referred to herein as “isolated” are nucleic acids that have been removed from their natural milieu or separated away from the nucleic acids of the genomic DNA or cellular RNA of their source of origin (e.g., as it exists in cells or in a mixture of nucleic acids such as a library) and may have undergone further processing. Isolated nucleic acids include nucleic acids obtained by methods described herein, similar methods or other suitable methods, including essentially pure nucleic acids, nucleic acids produced by chemical synthesis, by combinations of biological and chemical methods, and recombinant nucleic acids that are isolated.

    [0041] Nucleic acids referred to herein as “recombinant” are nucleic acids which have been produced by recombinant DNA methodology, including those nucleic acids that are generated by procedures that rely upon a method of artificial replication, such as the polymerase chain reaction (PCR) and/or cloning or assembling into a vector using restriction enzymes. Recombinant nucleic acids also include those that result from recombination events that occur through the natural mechanisms of cells but are selected for after the introduction to the cells of nucleic acids designed to allow or make probable a desired recombination event. Portions of isolated nucleic acids that code for polypeptides having a certain function can be identified and isolated by, for example, the method disclosed in U.S. Pat. No. 4,952,501.

    [0042] A nucleic acid molecule or polynucleotide can include a naturally occurring nucleic acid molecule that has been isolated from its natural source or produced using recombinant DNA technology (e.g., polymerase chain reaction (PCR) amplification, cloning) or chemical synthesis. Isolated nucleic acid molecules can include, for example, genes, natural allelic variants of genes, coding regions or portions thereof, and coding and/or regulatory regions modified by nucleotide insertions, deletions, substitutions, and/or inversions in a manner such that the modifications do not substantially interfere with the nucleic acid molecule's ability to encode a polypeptide or to form stable hybrids under stringent conditions with natural gene isolates. An isolated nucleic acid molecule can include degeneracies. As used herein, nucleotide degeneracy refers to the phenomenon that one amino acid can be encoded by different nucleotide codons. Thus, the nucleic acid sequence of a nucleic acid molecule that encodes a protein or polypeptide can vary due to degeneracies.

    [0043] Unless so specified, a nucleic acid molecule is not required to encode a protein having enzyme activity. A nucleic acid molecule can encode a truncated, mutated or inactive protein, for example. In addition, nucleic acid molecules may also be useful as probes and primers for the identification, isolation and/or purification of other nucleic acid molecules, independent of a protein-encoding function.

    [0044] Suitable nucleic acids include fragments or variants that encode a functional enzyme. For example, a fragment can comprise the minimum nucleotides required to encode a functional enzyme. Nucleic acid variants include nucleic acids with one or more nucleotide additions, deletions, substitutions, including transitions and transversions, insertion, or modifications (e.g., via RNA or DNA analogs). Alterations may occur at the 5′ or 3′ terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among the nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.

    [0045] In certain embodiments, a nucleic acid may be identical to a sequence represented herein. In other embodiments, the nucleic acids may be at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence represented herein, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequences represented herein. Sequence identity calculations can be performed using computer programs, hybridization methods, or calculations. Exemplary computer program methods to determine identity and similarity between two sequences include, but are not limited to, the GCG program package, BLASTN, BLASTX, TBLASTX, and FASTA. The BLAST programs are publicly available from NCBI and other sources. For example, nucleotide sequence identity can be determined by comparing query sequences to sequences in publicly available sequence databases (NCBI) using the BLASTN2 algorithm.

    [0046] Nucleic acids may be derived from a variety of sources including DNA, cDNA, synthetic DNA, synthetic RNA, or combinations thereof. Such sequences may comprise genomic DNA, which may or may not include naturally occurring introns. Moreover, such genomic DNA may be obtained in association with promoter regions or poly (A) sequences. The sequences, genomic DNA, or cDNA may be obtained in any of several ways. Genomic DNA can be extracted and purified from suitable cells by means well known in the art. Alternatively, mRNA can be isolated from a cell and used to produce cDNA by reverse transcription or other means.

    [0047] Also disclosed herein are recombinant vectors, including expression vectors, containing nucleic acids encoding enzymes. A “recombinant vector” is a nucleic acid molecule that is used as a tool for manipulating a nucleic acid sequence of choice or for introducing such a nucleic acid sequence into a host cell. A recombinant vector may be suitable for use in cloning, assembling, sequencing, or otherwise manipulating the nucleic acid sequence of choice, such as by expressing or delivering the nucleic acid sequence of choice into a host cell to form a recombinant cell. Such a vector typically contains heterologous nucleic acid sequences not naturally found adjacent to a nucleic acid sequence of choice, although the vector can also contain regulatory nucleic acid sequences (e.g., promoters, untranslated regions) that are naturally found adjacent to the nucleic acid sequences of choice or that are useful for expression of the nucleic acid molecules.

    [0048] The nucleic acids described herein may be used in methods for production of enzymes and enzyme cocktails through incorporation into cells, tissues, or organisms. In some embodiments, a nucleic acid may be incorporated into a vector for expression in suitable host cells. The vector may then be introduced into one or more host cells by any method known in the art. One method to produce an encoded protein includes transforming a host cell with one or more recombinant nucleic acids (such as expression vectors) to form a recombinant cell. The term “transformation” is generally used herein to refer to any method by which an exogenous nucleic acid molecule (i.e., a recombinant nucleic acid molecule) can be inserted into a cell but can be used interchangeably with the term “transfection”.

    [0049] Non-limiting examples of suitable host cells include cells from microorganisms such as bacteria, yeast, fungi, and filamentous fungi. Exemplary microorganisms include, but are not limited to, bacteria such as E. coli; bacteria from the genera Pseudomonas (e.g., P. putida or P. fluorescens), Bacillus (e.g., B. subtilis, B. megaterium or B. brevis). Caulobacter (e.g., C. crescentus), Lactoccocus (e.g., L. lactis), Streptomyces (e.g., S. coelicolor), Streptococcus (e.g., S. lividans), and Corynybacterium (e.g., C. glutamicum); fungi from the genera Trichoderma (e.g., T. reesei, T. viride, T. koningii, or T. harzianum), Penicillium (e.g., P. funiculosum), Humicola (e.g., H. insolens). Chrysosporium (e.g., C. lucknowense), Gliocladium. Aspergillus (e.g., A. niger, A. nidulans, A. awamori, or A. aculeatus). Fusarium. Neurospora, Hypocrea (e.g., H. jecorina), and Emericella; yeasts from the genera Saccharomyces (e.g., S. cerevisiae), Pichia (e.g., P. pastoris), or Kluyveromyces (e.g., K. lactis). Cells from plants such as Arabidopsis, barley, citrus, cotton, maize, poplar, rice, soybean, sugarcane, wheat, switch grass, alfalfa, miscanthus, and trees such as hardwoods and softwoods are also contemplated herein as host cells.

    [0050] Host cells can be transformed, transfected, or infected as appropriate by any suitable method including electroporation, calcium chloride-, lithium chloride-, lithium acetate/polyene glycol-, calcium phosphate-, DEAE-dextran-, liposome-mediated DNA uptake, spheroplasting, injection, microinjection, microprojectile bombardment, phage infection, viral infection, or other established methods. Alternatively, vectors containing the nucleic acids of interest can be transcribed in vitro, and the resulting RNA introduced into the host cell by well-known methods, for example, by injection. Exemplary embodiments include a host cell or population of cells expressing one or more nucleic acid molecules or expression vectors described herein (for example, a genetically modified microorganism). The cells into which nucleic acids have been introduced as described above also include the progeny of such cells.

    [0051] Vectors may be introduced into host cells such as those from bacteria or fungi by direct transformation, in which DNA is mixed with the cells and taken up without any additional manipulation, by conjugation, electroporation, or other means known in the art. Expression vectors may be expressed by bacteria or fungi or other host cells episomally or the gene of interest may be inserted into the chromosome of the host cell to produce cells that stably express the gene with or without the need for selective pressure. For example, expression cassettes may be targeted to neutral chromosomal sites by recombination.

    [0052] Host cells carrying an expression vector (i.e., transformants or clones) may be selected using markers depending on the mode of the vector construction. The marker may be on the same or a different DNA molecule. In prokaryotic hosts, the transformant may be selected, for example, by resistance to ampicillin, tetracycline or other antibiotics. Production of a particular product based on temperature sensitivity may also serve as an appropriate marker.

    [0053] Host cells may be cultured in an appropriate fermentation medium. An appropriate, or effective, fermentation medium refers to any medium in which a host cell, including a genetically modified microorganism, when cultured, is capable of growing or expressing the polypeptides described herein. Such a medium is typically an aqueous medium comprising assimilable carbon, nitrogen and phosphate sources, but can also include appropriate salts, minerals, metals and other nutrients. Microorganisms and other cells can be cultured in conventional fermentation bioreactors and by any fermentation process, including batch, fed-batch, cell recycle, and continuous fermentation. The pH of the fermentation medium is regulated to a pH suitable for growth of the particular organism. Culture media and conditions for various host cells are known in the art. A wide range of media for culturing bacteria or fungi, for example, are available from ATCC. Media may be supplemented with aromatic substrates like guaiacol, guaethol or anisole for dealkylation reactions.

    [0054] The nucleic acid molecules described herein encode the enzymes with amino acid sequences such as those represented by the SEQ ID NOs presented herein. As used herein, the terms “protein” and “polypeptide” are synonymous. “Peptides” are defined as fragments or portions of polypeptides, preferably fragments or portions having at least one functional activity as the complete polypeptide sequence. “Isolated” proteins or polypeptides are proteins or polypeptides purified to a state beyond that in which they exist in cells. In certain embodiments, they may be at least 10% pure; in others, they may be substantially purified to 80% or 90% purity or greater. Isolated proteins or polypeptides include essentially pure proteins or polypeptides, proteins or polypeptides produced by chemical synthesis or by combinations of biological and chemical methods, and recombinant proteins or polypeptides that are isolated. Proteins or polypeptides referred to herein as “recombinant” are proteins or polypeptides produced by the expression of recombinant nucleic acids.

    [0055] Proteins or polypeptides encoded by nucleic acids as well as functional portions or variants thereof are also described herein. Polypeptide sequences may be identical to the amino acid sequences presented herein or may include up to a certain integer number of amino acid alterations. Such protein or polypeptide variants retain functionality as enzymes, and include mutants differing by the addition, deletion or substitution of one or more amino acid residues, or modified polypeptides and mutants comprising one or more modified residues. The variant may have one or more conservative changes, wherein a substituted amino acid has similar structural or chemical properties (e.g., replacement of leucine with isoleucine). Alterations may occur at the amino- or carboxy-terminal positions of the reference polypeptide sequence or anywhere between those terminal positions, interspersed either individually among the amino acids in the reference sequence or in one or more contiguous groups within the reference sequence.

    [0056] In certain embodiments, the polypeptides may be at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequences presented herein and possess enzymatic function. Percent sequence identity can be calculated using computer programs (such as the BLASTP and TBLASTN programs publicly available from NCBI and other sources) or direct sequence comparison. Polypeptide variants can be produced using techniques known in the art including direct modifications to isolated polypeptides, direct synthesis, or modifications to the nucleic acid sequence encoding the polypeptide using, for example, recombinant DNA techniques.

    [0057] Polypeptides may be retrieved, obtained, or used in “substantially pure” form, a purity that allows for the effective use of the protein in any method described herein or known in the art. For a protein to be most useful in any of the methods described herein or in any method utilizing enzymes of the types described herein, it is most often substantially free of contaminants, other proteins and/or chemicals that might interfere or that would interfere with its use in the method (e.g., that might interfere with enzyme activity), or that at least would be undesirable for inclusion with a protein.

    [0058] Among other things, the present disclosure relates to non-naturally occurring microorganisms that include a gene encoding a variant of a MucK transporter protein, where the microorganism is capable of at least one of growing on terephthalic acid (TPA), catabolizing TPA, and/or transporting TPA. In some embodiments of the present disclosure, a microorganism may further include the deletion of an endogenous gene encoding a DcaS transcriptional regulator. In some embodiments of the present disclosure, the microorganism may include at least one of a bacterium, a yeast, and/or a fungus. In some embodiments of the present disclosure, the microorganism may include a bacterium. In some embodiments of the present disclosure, the bacterium may include a strain from at least one of A. baylyi, P. putida, P. fluorescens, and/or P. stutzeri. As described herein, in some embodiments of the present disclosure, a biosensor was incorporated into non-naturally occurring micro-organisms to identify strains capable of at least one of growing on TPA, catabolizing TPA, and/or transporting TPA.

    [0059] Among other things, adaptive laboratory evolution was performed on an Acinetobacter baylyi ADP1 engineered strain for growth on the xenobiotic compound terephthalic acid, a component of the plastic polyethylene terephthalate (PET). Sequencing revealed that the native muconate transporter MucK had acquired mutations in several of the evolved clones, and that mutations that could inactivate a putative repressor of expression of MucK (i.e. DcaS) had also been selected. Using a transcription-factor based TPA fluorescent biosensor, it was demonstrated that TPA uptake in ADP1 strains expressing mutated versions of MucK and/or with dcaS gene deleted was more efficient than in wild-type ADP1. In particular, the MucK variants with improved performance contained the following amino acid mutations: i) M34I and E53G, ii) M34L and T342L, and iii) Y133C (see FIG. 1). Furthermore, it was also shown that expression of MucK in a different bacterium, namely Pseudomonas putida KT2440, also enables uptake of TPA, similarly to what is observed in strains expressing the TPA transporter TpaK from Rhodococcus jostii RHA1 (see FIG. 2).

    [0060] As described herein, TPA conversion was engineered in Acinetobacter baylyi ADP1 via the heterologous expression of catabolic and transporter genes from a native TPA-utilizing bacterium. Specifically, ADP1-derived strains were derived capable of growing on TPA as the sole carbon source using chromosomal insertion and targeted amplification of the tph catabolic operon from Comamonas sp. E6. Adaptive laboratory evolution was then used to improve growth on this substrate. TPA consumption rates of the evolved strains, which retained multiple copies of the tph genes, were ˜0.2 g/L/h (or ˜1 g TPA/g cells/h), similar to that of Comamonas sp. E6 and almost 2-fold higher than that of Rhodococcus jostii RHA1, another native TPA-utilizing strain. To evaluate TPA transport in the evolved ADP1 strains, a TPA biosensor was used that included the transcription factor TphR and a fluorescent reporter. In combination with whole-genome sequencing, the TPA biosensor revealed that transport of TPA was not mediated by the heterologous proteins from Comamonas sp. E6. Instead, the endogenous ADP1 muconate transporter MucK, a member of the major facilitator superfamily, was responsible for TPA transport in several evolved strains in which MucK variants were found to enhance TPA uptake. Furthermore, the IclR-type transcriptional regulator DcaS was identified as a repressor of mucK expression.

    Results:

    [0061] Heterologous Expression of Genes Encoding TPA Transport and Catabolism in ADP1:

    [0062] To confer growth on TPA, genes needed to convert this substrate to PCA were introduced, a metabolite that is consumed via the native β-ketoadipate pathway, into ADP1 (see FIG. 3, Panels A and B). The first step of this conversion, i.e. the hydroxylation of the aromatic ring, is catalyzed by TPADO. This multicomponent enzyme includes a two-subunit Rieske non-heme iron oxygenase, encoded by tphA.sub.2 and tphA.sub.3, and a multi-domain reductase component, encoded by tphA.sub.1. The second step in forming PCA is catalyzed by a diol dehydrogenase, encoded by tphB. Furthermore, we predicted that growth on TPA would require a transporter. For this purpose, we also introduced the genes coding for the TPA-TIT, consisting of a periplasmic substrate binding protein, encoded by tphC, and two cytoplasmic transmembrane proteins, encoded by tpiA and tpiB. In Comamonas sp. E6, all the tph genes are organized in an operon, whereas tpiBA form a distinct transcriptional unit. Here, the Comamonas genes of the tph.sub.II operon and the tpiBA genes were codon optimized for expression in ADP1 and synthesized as a polycistronic DNA cassette (see FIG. 3, Panel B).

    [0063] Initially, high expression of all genes was targeted by replacing the native promoter with a constitutive tac promoter (P.sub.tac) and by inserting synthetic ribosome binding site (RBS) sequences with high predicted translation initiation rates (TIR, ˜10,000 arbitrary units, a.u.). However, attempts to integrate this large cassette into the ADP1 chromosome were unsuccessful. This fragment had 9 kbp of synthetic sequence, flanked on either side by 2 kbp of DNA identical to the chromosomal target for integration downstream of pobA. To reduce the size of the transforming DNA, the synthetic cassette was split into three fragments for use in a stepwise integration plan (see FIG. 1). The results suggested that the difficulty with integration of the foreign DNA was specific to the tpiBA genes. Since high-level synthesis of the transmembrane proteins might be toxic to the cell, the DNA sequence was modified to lower the expression of these genes. First, the RBS sequences for these genes were redesigned to match the predicted TIRs for the native tpiBA genes in Comamonas sp. E6 (2,841 and 333 a.u. for tpiB and tpiA, respectively). Additionally, the initial ATG in tpiB was replaced with GTG to match that of the native Comamonas sp. E6 gene. In this way, the tphCA.sub.2A.sub.3BA.sub.1:tpiBA genes were integrated into the ADP1 chromosome to generate strain IP130 (see FIG. 3, Panel B).

    [0064] Next, we evaluated the effect of pH on TPA consumption by wild-type ADP1, IP130, and a strain lacking tpiBA (IP115), (see FIG. 3, Panels C-E)). In contrast to wild type and IP115, IP130 turned over small amounts of TPA (˜10%) when pyruvate, which minimizes catabolic repression of aromatic metabolism, was provided as a growth substrate. However, all strains presented a Tpa.sup.− phenotype—i.e., were unable to grow on TPA as the sole carbon and energy source (see FIG. 2). The amount of TPA consumed by IP130 was higher at pH 6 than at pH 7 (p-values <0.05 for a two-tailed t-test between TPA consumed at pH 6 and at pH 7 for 48- through 120-h timepoints). Since no significant consumption of TPA was observed for IP115, these results suggest that, although minimally, TPA uptake might be enhanced when tpiBA genes are expressed.

    [0065] Gene Amplification and Adaptive Laboratory Evolution by EASy:

    [0066] With the aim of developing Tpa.sup.+ strains (i.e., capable of growing on TPA as sole carbon and energy source), we next amplified the chromosomal gene dosage of the tph genes to initiate adaptive laboratory evolution (ALE). Given the potential toxicity to the cell of synthesizing the transmembrane proteins at a high level, we first reorganized the synthetic operon so that the tpiBA genes would not be part of the amplicon (boundaries shown for IP148 in FIG. 3, Panel B). As observed for strain IP130, IP148 turned over small amounts of TPA when grown on pyruvate, but remained Tpa.sup.− (see FIG. 3, Panel F and FIG. 2).

    [0067] IP148 was transformed with the SBF, which serves as a platform for homologous recombination and precise duplication of chromosomal segments. This duplication enables changes in the number of tandemly arrayed amplicon copies under selective pressure. In this way, transformants with increased gene dosage were first selected on MMP plates with high Km. Selective pressure was then changed to growth on TPA as the sole carbon source, and Tpa.sup.+ colonies arose after ˜10 days (in the absence of antibiotics). When these colonies were re-streaked, Tpa.sup.+ colonies appeared more rapidly, after only 2-3 days. Although individual colonies each represent a clonal population, the proclivity of the tandem copies to increase or decrease via recombination suggests that different cells within the colony may differ in amplicon copy number. Frequent recombination also promotes additional genetic change, so that all cells in any Tpa.sup.+ colony may not be genetically identical. Therefore, we hereafter refer to these Tpa.sup.+ mutants as isolates.

    [0068] Four isolates, designated TPA_1 to TPA_4, were selected to initiate ALE. These were grown in liquid MM with 5 mM TPA, and cultures were serially transferred to enrich for mutations enabling faster growth. Given that lower pH values could advantageously favor diffusion of TPA into the cell, serial transfers for ALE with these isolates were conducted at pH 6 and pH 7 in parallel (8 lineages, designated by 0.6 or 0.7 after the isolate name to indicate the pH of the medium used for serial transfer (see FIG. 4). The copy number of the amplicon was monitored regularly by qPCR of the Km.sup.R gene to assess whether a reduction in gene dosage resulted from the selection of beneficial mutations that improve cell fitness. After initial serial transfers inoculated by 100-fold dilution every 48 h in 5 mM TPA, the selection pressure for ALE was gradually increased with the aim of improving tolerance, growth, and TPA consumption rates. This was first done by diluting cells 100-fold every 24 hours in 5 mM TPA, and then 200-fold every 24 hours in 10 mM TPA. The evolution of the gene copy number over time for the eight lineages is shown in FIG. 4.

    [0069] In parallel with ALE, we also sequenced PCR products amplified from the tpiBA genes from IP148 and isolates TPA_1 to TPA_4, to test whether early acquisition of beneficial mutations in the transporter genes could have enabled growth on TPA. Sequencing revealed that all of them, including parent-strain IP148, carried an unexpected mutation in tpiA that would result in a premature stop codon (GAG.fwdarw.UAG (see FIG. 6)). This tpiA1481 allele is predicted to encode a 365-residue peptide [TpiA(W366*)] with an early termination disrupting the 7.sup.th transmembrane helix (TMH), in contrast to the 503-residue TpiA protein of 11-12 predicted TMHs. Further inspection of the sequence also revealed that translation could be re-initiated from an in-phase start codon (AUG) only 12 bp downstream of the premature stop codon, with a predicted TIR of 437 au. This new coding sequence, referred to as allele tpiA1482, would encode a peptide corresponding to the last 133 residues of TpiA [TpiA(Δ 1-370)]. Interestingly, no mutations were found in the tpiBA genes in strain IP130.

    [0070] Use of a Fluorescent Biosensor to Evaluate TPA Transport:

    [0071] The results from sequencing raised the question of whether the TPA-TIT was still functional in IP148 and the four Tpa.sup.+ isolates, despite the mutation in tpiA. Two possibilities were contemplated. The first was that, due to the internal homology in TpiA, two TpiA(W366*) peptides, each encompassing TMHs 1-6, could form a homo-dimer that enabled TPA transport. Evolutionary studies of TTTs have shown that in homologs of TpiA, the transmembrane helices 1-6 are homologous to TMHs 7-12, suggesting that these proteins originated as a result of gene duplication and fusion. The second possibility was that, if re-initiation of translation were to occur downstream of the premature stop codon, the two individually translated peptides, TpiA(W366*) and TpiA(Δ 1-370), could associate to restore function. We sought to evaluate TPA uptake in strains expressing different alleles of tpiA. To evaluate TPA transport, we required a rapid assay that would allow us to screen multiple mutants at the same time. Hence, we employed a biosensor for intracellular TPA based on the transcription factor TphR, an IclR-family member which regulates expression of the tph operon in Comamonas sp.

    [0072] A total of three biosensors were tested, referred to herein as pTPA1, pTPA2, and pTPA3. Testing of all three sensors, not discussed herein, and out of the scope of the present disclosure, showed a negligible response towards aromatic compounds similar to TPA, such as benzoate, 4-hydroxybenzoate, PCA, and catechol, confirming the high specificity of the biosensor for TPA. Ultimately a single biosensor, pTPA3 was chosen for all subsequent work. We then re-evaluated A. baylyi strains encoding the different variants of the TPA-TIT using the pTPA3 biosensor (see FIG. 5). In contrast to our expectation, the fluorescent response in all strains were comparable. In fact, wild-type ADP1, which does not encode a TPA-TIT, also responded to increasing TPA concentrations. Nevertheless, the reduced response of IP148 with respect to IP337 and IP348 (all encoding the split TpiA variant) suggested that the biosensor was sufficiently sensitive to detect the turnover of small amount of TPA when the tph catabolic genes were expressed from a single copy in IP148. It should also be noted that, in the absence of TPA, IP148 and IP337 still exhibited higher fluorescence signals relative to other strains, as observed with pTPA1. This observation supported the hypothesis that the increased fluorescence signal in these two strains was independent of TPA uptake or the biosensor plasmid, and instead was likely due to a mutation in the genome that affected expression of the sfGFP gene.

    [0073] In all, no significant differences were found between ADP1-derived strains expressing different alleles of tpiA (i.e. IP297, IP313, and IP348). Furthermore, their fluorescent response was barely above that of wild type. We also note that no differences in growth rates were observed for any of the strains at the TPA concentrations tested. These results suggest that the heterologous TPA-TIT would have a minimal role in TPA uptake in A. baylyi, and that the evolved TPA.sup.+ isolates could instead be importing this substrate through an unidentified, native transporter.

    [0074] Phenotypic Characterization of Evolved A. baylyi Isolates:

    [0075] After ˜100 transfers of ALE (˜750 generations), the copy number of the amplicon stabilized at 15-25 copies without substantial changes in growth rates (see FIG. 4 and FIGS. 8A and 8B). Therefore, single colonies were isolated from each lineage for phenotypic characterization and WGS. The copy-number ratio of tphA.sub.2 over the Km.sup.R gene for the selected isolates was confirmed to be of ˜1, suggesting that qPCR of the latter accurately estimates the copy number of the entire amplicon defined by the SBF (see FIG. 9). Shake-flask cultures of early ALE populations (˜30 generations) and post-evolution isolates showed that growth rates and TPA consumption rates were enhanced (see FIG. 10), except for populations TPA_2.6 and TPA_2.7 and their respective evolved isolates IP247 and IP250 (see FIG. 10, Panels C and D). However, it is notable that the amplicon copy number in these populations had decreased from ˜40 to ˜20 copies during ALE (see FIG. 4 and FIGS. 8A and 8B). An important decrease in the lag-phase was also observed, especially in the case of IP254 with respect to early population TPA_3.7 (see FIG. 10, Panel F). Moreover, tolerance to increasing TPA concentrations was enhanced in several evolved strains (see FIG. 11). No important phenotypic differences were observed between isolates derived from the parallel evolution at pH 6 compared to that at pH 7, although growth and TPA utilization appeared to be slightly faster at pH 6 than at pH 7.

    [0076] We also compared the evolved A. baylyi isolates to the native TPA-utilizing bacteria Comamonas sp. E6 and R. jostii RHA1, both grown at the standard pH 7 (see FIG. 12 and Table 1). Growth and TPA consumption rates of the evolved Tpa.sup.+ isolates were slightly lower than those of Comamonas sp. E6 (an average of 0.40 h.sup.−1 and 0.20 g/L/h, respectively, in the evolved A. baylyi isolates, compared to 0.50 h.sup.−1 and 0.26 g/L/h in Comamonas sp. E6), which was the source of the catabolic and TTT genes expressed in the engineered A. baylyi strains. In contrast, the evolved isolates out-performed R. jostii RHA1, which had a 12-hour lag phase, a 0.26 h.sup.−1 growth rate and a 0.13 g/L/h TPA consumption rate. Specific consumption rate values for the evolved isolates (˜1 g TPA/g cells/h in average) were also between those of Comamonas sp. E6 (1.55 g/g/h) and R. jostii RHA1 (0.46 g/g/h).

    TABLE-US-00001 TABLE 1 Growth and substrate consumption parameters for Tpa.sup.+ EASy lineages after ~30 generations, evolved isolates after ~750 generations, Comanonas sp. E6, and Rhodococcus jostii RHA1. Lineage, Specific TPA Specific isolate, or growth rate Doubling consumption consumption rate strain μ (h.sup.−1) time (h) rate (g/L/h) q.sub.s (g/g/h) TPA_1.6 0.27 ± 0.01 2.54 ± 0.05 0.14 ± 0.00 0.71 ± 0.02 TPA_1.7 0.32 ± 0.01 2.14 ± 0.03 0.17 ± 0.01 0.75 ± 0.01 TPA_2.6 0.43 ± 0.01 1.60 ± 0.01 0.19 ± 0.00 0.98 ± 0.01 TPA_2.7 0.39 ± 0.00 1.78 ± 0.01 0.18 ± 0.00 0.91 ± 0.01 TPA_3.6 0.22 ± 0.00 3.18 ± 0.03 0.13 ± 0.00 0.59 ± 0.01 TPA_3.7 0.09 ± 0.00 7.41 ± 0.08 0.11 ± 0.00 0.29 ± 0.00 TPA_4.6 0.16 ± 0.00 4.24 ± 0.01 0.12 ± 0.00 0.45 ± 0.00 TPA_4.7 0.18 ± 0.00 3.78 ± 0.01 0.15 ± 0.01 0.45 ± 0.01 IP243 0.40 ± 0.01 1.74 ± 0.07 0.22 ± 0.01 0.95 ± 0.05 IP246 0.40 ± 0.02 1.73 ± 0.08 0.19 ± 0.00 0.98 ± 0.06 IP247 0.43 ± 0.01 1.63 ± 0.02 0.23 ± 0.01 0.97 ± 0.01 IP250 0.45 ± 0.01 1.56 ± 0.05 0.22 ± 0.02 1.02 ± 0.06 IP251 0.39 ± 0.01 1.78 ± 0.04 0.17 ± 0.00 1.07 ± 0.03 IP254 0.29 ± 0.01 2.39 ± 0.11 0.19 ± 0.00 0.79 ± 0.03 IP255 0.43 ± 0.00 1.61 ± 0.01 0.22 ± 0.00 1.04 ± 0.01 IP258 0.43 ± 0.00 1.61 ± 0.01 0.19 ± 0.00 1.06 ± 0.04 E6 0.50 ± 0.01 1.39 ± 0.03 0.26 ± 0.01 1.55 ± 0.11 RHA1 0.26 ± 0.00 2.66 ± 0.03 0.13 ± 0.00 0.46 ± 0.01

    [0077] Whole-Genome Sequence Analysis of Evolved A. baylyi Isolates:

    [0078] To identify mutations that might be responsible for their improved growth on TPA, WGS was performed for each of the evolved isolates selected from the eight lineages. A complete list of the mutations found in the IP148 parent strain, relative to the published sequence for wild-type ADP1. Results are summarized in Table 2. The increased coverage for certain regions of the chromosome revealed unexpected duplications and amplifications different than the one targeted by EASy. For example, a region of ˜10 kb (corresponding approximately to positions 1,849,000-1,858,000 in NCBI reference sequence NC_005966), including several duplicate genes coding for hypothetical proteins, is amplified in the parent strain IP148 and maintained in all evolved derivatives. IP251 and IP254 (both derived from TPA_3) show a spontaneous amplification of a ˜56 kb fragment (corresponding approximately to positions 1,670,000-1,727,000 in the reference sequence) directly upstream of the insertion site of the synthetic tph:tpi operon, that includes the dca, pca, qui, and pob gene clusters. These gene clusters are respectively involved in the metabolism of saturated C.sub.6-C.sub.10 dicarboxylic acids, PCA, quinic acid, and 4-hybroxybenozoic acid, all of which are metabolized via the β-ketoadipate pathway.

    TABLE-US-00002 TABLE 2 Summary table of mutations, relative to wild-type ADP1, found in coding DNA sequences with >80% variant frequency. Locus Description Protein effect IP148 IP243 IP246 IP247 IP250 IP251 IP254 IP255 IP258 Count ACIAD_RS08285 Hypothetical protein None X X X X X X X X X 9 ACIAD_RS13200 RNA polymerase sigma Amino acid replacement X X X X X X X X 8 factor RpoD ACIAD_RS07750 MFS transporter MucK Amino acid replacement X X X X 4 ACIAD_RS07760 IclR transcriptional Amino acid replacement/ .sup. X.sup.1 .sup. X.sup.1 .sup. X.sup.2 .sup. X.sup.2 4 regulator DcaS Truncation ACIAD_RS10455 16S rRNA (uracil(1498)- Truncation X X X X 4 N(3))-methyltransferase ACIAD_RS00385 EpsG family protein Insertion X X X 3 ACIAD_RS00595 MFS transporter GudP Amino acid replacement X X 2 ACIAD_RS00620 FadR family Truncation X X 2 transcriptional regulator ACIAD_RS08520/ Hypothetical protein Truncation X X 2 ACIAD_RS08570 ACIAD_RS15190 Membrane protein Partial deletion of X X 2 N-terminus ACIAD_RS00395 Gluosyltransferase family Insertion X 1 2 protein ACIAD_RS00475 UDP-glucose 4- Truncation X 1 epimerase GalE ACIAD_RS01220 Sigma-54-dependent Fis Truncation X 1 family transcriptional regulator ACIAD_RS01685 Type IV-A pilus assembly Truncation X 1 ATPase PilB ACIAD_RS03905 Cell division protein ZipA Truncation X 1 ACIAD_RS04405 Hypothetical protein Truncation X 1 ACIAD_RS15025 Type IV pilus modification Truncation X 1 protein PilV ACIAD_RS15030 Prepilin-type N-terminal Truncation X 1 cleavage/methylation domain-containing protein ACIAD_RS15180 Pilus assemly protein Partial deletion of X 1 PilP N-terminus

    [0079] As observed in the phenotypic characterization of the evolved isolates, there were no clear trends in the mutations found for the lineages evolved at pH 6 or at pH 7, except for an in-phase tandem repeat in the gene coding for an EpsG family protein (ACIAD_RS00385) that was present in 3 out of the 4 isolates evolved at pH 6 and absent in all those evolved at pH 7 (see Table 2). The mutation in tpiA, initially identified in the parent-strain IP148 and the amplified derivatives that were used to initiate ALE (TPA_1 to TPA_4), was maintained in all evolved isolates. This fact suggests that this mutation, potentially encoding a truncated or split TpiA, was not disadvantageous for growth on TPA. Unexpectedly, no mutations were found in the tph genes, except for a single nucleotide change in the synthetic RBS sequence preceding tphA.sub.3 in IP251 and IP254, both derived from TPA_3. Nevertheless, it should be noted that the short reads provided by the Illumina sequencing method do not allow the detection of mutations that might be present in only one of the multiple copies of the amplicon and that could be beneficial for growth on TPA.

    [0080] Another mutation identified in the parent-strain IP148 encoded a variant of the RNA polymerase sigma-70 factor, RpoD(A87E). This mutation was maintained in all evolved isolates except IP246 (see Table 2). A different mutation in rpoD results in a growth deficit in ADP1. However, a growth competition experiment showed that RpoD(A87E) was only minimally detrimental to growth. Residue A87 is located in region 1.1 of RpoD, which is involved in promoter binding. Therefore, this mutation could potentially affect transcription efficiency in the cell. Indeed, when the mutated rpoD was replaced by the wild-type allele in IP148 derivatives, the high baseline fluorescence observed when transformed with the biosensor plasmid pTPA3 was reduced (see FIG. 13). As RpoD is the primary or “housekeeping” sigma factor in many bacteria, it is possible that this mutation alters the gene expression profile in ADP1. Additional experiments to confirm this possibility are needed.

    [0081] Further analysis of WGS data revealed that 4 out of the 8 isolates (derived from TPA_1 and TPA_4) had mutations in mucK (ACIAD_RS07750) in combination with mutations in dcaS (ACIAD_RS07760), which are two genes in close proximity in the chromosome (see FIG. 14A). Moreover, the spontaneous amplification of the dca-pca-qui-pob supraoperonic cluster in IP251 and IP254 (derived from TPA_3) included the mucK and dcaS genes. These two isolates also had a mutation in the mucK-caiB intergenic region. The prevalence of mutations in these loci suggested that MucK and DcaS may have a relevant role in the Tpa.sup.+ phenotype.

    [0082] A DcaS homolog from Brucella abortus, also an IclR-type regulator, has been identified as a repressor of adipic acid metabolism therein, and its crystal structure has been solved. Using this structure as template (PDB 5WHM, 62% sequence identity), three-dimensional structure models of DcaS were built to examine the location of the amino acid replacements encoded by the different evolved isolates (see FIG. 15). In the case of IP243 and IP246, these replacements are located in the predicted A-helical linker involved in dimerization (V101G) and the ligand-binding pocket (A134E). In IP255 and IP258, the deletion of bases 499 and 500 in the dcaS coding sequence causes a shift in the open reading frame. The resulting DcaS variant would lack residues 169-282, which form part of the ligand-binding domain. Based on this analysis, these amino acid changes are predicted to disrupt DcaS function.

    [0083] While there were conserved dcaS mutations in evolved isolates derived from the same initial Tpa.sup.+ mutant, mucK mutations were different in all cases, suggesting that mutations in dcaS appeared before those in mucK (see FIG. 14A). MucK is a MFS muconate transporter in ADP1, and it belongs to the same superfamily as the TPA transporters from Rhodococcus species and P. xenovorans. Therefore, we hypothesized that MucK and its variants are capable of transporting TPA in A. baylyi. Furthermore, the potential loss of DcaS function in the evolved isolates, seemingly preceding the mutation of mucK, suggested that DcaS acts as a repressor of mucK transcription.

    [0084] A similar combination of mutations in genes encoding a transcriptional regulator and a MFS transporter is found in evolved isolates IP247 and IP250 (both derived from TPA_2). These isolates share a ˜100 bp deletion in a gene encoding a FadR-family transcriptional regulator (ACIAD_RS00620 locus). In contrast, they have two different mutations in a neighboring gene predicted to encode a glucarate/galactarate MFS transporter (gudP, ACIAD_RS00595 locus). These mutations lead to amino acid replacements R289C in IP247 and R447L in IP250 (see Table 2). However, we decided to focus on mucK and dcaS for further evaluation, as they had apparently co-evolved in separate lineages.

    [0085] Evaluation of MucK as a TPA Transporter and its Regulation by DcaS:

    [0086] To test our hypothesis that MucK was importing TPA, we first attempted to knock out its coding gene in the eight evolved isolates. However, due to a presumed loss of natural competency, we were only able to knock out mucK in IP243 and IP255, 2 out of the 4 isolates that had mutations in this gene. Consistent with our hypothesis, these mutants lost the ability to grow on either muconate (Muc.sup.− phenotype) or TPA (see FIG. 16).

    [0087] We then tested whether the deletion of dcaS and/or replacement of wild-type mucK with the four alleles selected during ALE enabled growth of the IP148 parent strain on TPA (see Table 3). The resulting IP148-derived mutants were inoculated in MM with 10 mM TPA as a sole carbon and energy source. After an incubation of 1-2 weeks, 8 out of 9 mutant cultures started growing and reached saturation in 24-48 h, indicating that each of these genetic modifications was sufficient to enable growth on TPA. The exception was strain IP402, carrying the allele encoding MucK(W150C I403T), which unexpectedly also presented a Muc.sup.− phenotype. However, when this allele was expressed in a ΔdcaS background (strain IP417), Muc.sup.+ and Tpa.sup.+ phenotypes were observed, indicating that MucK(W150C I403T) was still functional. As expected, control mutants IP367 and IP387 with mucK knocked out were Tpa.sup.− and Muc.sup.−, even if dcaS was deleted in the latter. Consistent with previous observations, no growth on TPA was observed for parent-strain IP148 after 2 weeks of incubation.

    TABLE-US-00003 TABLE 3 Growth on muconate (Muc phenotype) and TPA (Tpa phenotype) of IP148-derived dcaS and mucK mutants. MucK Phenotype Strain Mutations variant Muc Tpa IP148 None Native + − IP367 ΔmucK::Sm.sup.R:sacB None − − IP378 ΔdcaS Native + + IP387 ΔdcaS None − − ΔmucK::Sm.sup.R:sacB IP398 ΔmucK::mucK258 M34I + + E53G IP400 ΔmucK::mucK243 M34L + + T342I IP402 ΔmucK::mucK255 W150C − − I403T IP411 ΔmucK::mucK246 Y133C + + IP413 ΔdcaS M34I + + ΔmucK::mucK258 E53G IP415 ΔdcaS M34L + + ΔmucK::mucK243 T342I IP417 ΔdcaS W150C + + ΔmucK::mucK255 I403T IP419 ΔdcaS Y133C + + ΔmucK::mucK246

    [0088] Given the natural propensity of bacteria to undergo spontaneous gene duplication and amplification to increase gene expression under selective pressure, we tested whether these IP148-derived Tpa.sup.+ mutants still retained a single copy of the synthetic tph operon or if it had been duplicated. For this purpose, we collected the Tpa.sup.+ cells from the TPA cultures indicated in Table 4 to evaluate the copy number by qPCR. Unlike the case of the Tpa.sup.+ strains obtained by transformation with an SBF to delimit the amplicon, it was possible that in these new mutants an amplified chromosomal region may not include the Km.sup.R gene. Therefore, we used primers and a probe specific for tphA.sub.2. We found that, indeed, all Tpa.sup.+ mutants had 6-14 copies of tphA.sub.2 (See FIG. 17). This result indicates that the deletion of dcaS and/or expression of different mucK alleles is sufficient to enable growth on TPA, but that multiple copies of the tph catabolic genes are needed to sustain growth of A. baylyi on TPA as sole carbon and energy source.

    TABLE-US-00004 TABLE 4 Description of A. baylyi strains, isolates, and lineages used in this work. For the purpose of standardized nomenclature, tphA genes are numbered in subscript to differentiate them from mutated alleles. More details on the genotype and strain construction can be found in Table 8. Strains, isolates, and lineages Relevant features Strains ADP1 Wild type IP115 pobA:P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R IP130 pobA:P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:tpiB:ΩKm.sup.R IP148 pobA:P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R:P.sub.trc:tpiBA1481:tpiA1482 [tpiA1481 encodes TpiA(W366*); tpiA1482 encodes TpiA(Δ1-370)] IP297 pobA:P.sub.tac:tphC:ΩKm.sup.R:P.sub.trc:tpiBA1481 IP313 pobA:P.sub.tac:tphC:ΩKm.sup.R:P.sub.trc:tpiBA IP337 pobA:P.sub.tac:tphC:ΩKm.sup.R:P.sub.trc:tpiBA1481:tphA1482 (obtained by deletion of tphA.sub.2A.sub.3BA.sub.1 genes in IP148) IP348 pobA:P.sub.tac:tphC:ΩKm.sup.R:P.sub.trc:tpiBA1481:tphA1482 (obtained by de novo integration in ADP1) IP367 IP148-derived mutant, ΔmucK::Sm.sup.R:sacB IP378 IP148-derived mutant, ΔdcaS IP387 IP148-derived mutant, ΔdcaS ΔmucK::Sm.sup.R:sacB IP398 IP148-derived mutant, ΔmucK::mucK258 [encodes MucK(M34I E53G)] IP400 IP148-derived mutant, ΔmucK::mucK243 [encodes MucK(M34L T342I)] IP402 IP148-derived mutant, ΔmucK::mucK255 [encodes MucK(W150C I403T)] IP411 IP148-derived mutant, ΔmucK::mucK246 [encodes MucK(Y133C)] IP413 IP148-derived mutant, ΔdcaS ΔmucK::mucK258 IP415 IP148-derived mutant, ΔdcaS ΔmucK::mucK243 IP417 IP148-derived mutant, ΔdcaS ΔmucK::mucK255 IP419 IP148-derived mutant, ΔdcaS ΔmucK::mucK246 IP461 ADP1-derived mutant, ΔdcaS IP492 ADP1-derived mutant, ΔmucK::mucK258 IP493 ADP1-derived mutant, ΔmucK::mucK243 IP494 ADP1-derived mutant, ΔmucK::mucK255 IP495 ADP1-derived mutant, ΔmucK::mucK246 IP496 ADP1-derived mutant, ΔdcaS ΔmucK::mucK258 IP497 ADP1-derived mutant, ΔdcaS ΔmucK::mucK243 IP498 ADP1-derived mutant, ΔdcaS ΔmucK::mucK255 IP499 ADP1-derived mutant, ΔdcaS ΔmucK::mucK246 Tpa.sup.+ isolates and ALE lineages (multiple copies of tph genes) TPA_1 IP148-derived isolate, used to initiate ALE TPA_2 IP148-derived isolate, used to initiate ALE TPA_3 IP148-derived isolate, used to initiate ALE TPA_4 IP148-derived isolate, used to initiate ALE TPA_1.6 ALE lineage derived from TPA_1, evolved at pH 6 TPA_1.7 ALE lineage derived from TPA_1, evolved at pH 7 TPA_2.6 ALE lineage derived from TPA_2, evolved at pH 6 TPA_2.7 ALE lineage derived from TPA_2, evolved at pH 7 TPA_3.6 ALE lineage derived from TPA_3, evolved at pH 6 TPA_3.7 ALE lineage derived from TPA_3, evolved at pH 7 TPA_4.6 ALE lineage derived from TPA_4, evolved at pH 6 TPA_4.7 ALE lineage derived from TPA_4, evolved at pH 7 IP243 Isolate from lineage TPA_1.6 after ~750 generations IP246 Isolate from lineage TPA_1.7 after ~750 generations IP247 Isolate from lineage TPA_2.6 after ~750 generations IP250 Isolate from lineage TPA_2.7 after ~750 generations IP251 Isolate from lineage TPA_3.6 after ~750 generations IP254 Isolate from lineage TPA_3.7 after ~750 generations IP255 Isolate from lineage TPA_4.6 after ~750 generations IP258 Isolate from lineage TPA_4.7 after ~750 generations

    [0089] The apparent sequential emergence of dcaS and mucK mutations in the EASy lineages derived from TPA_1 and TPA_4, and the observation that deletion of dcaS alone enabled a Tpa.sup.+ phenotype in IP148-derived mutants, strongly suggested that DcaS acts as a repressor of the transcription of mucK. To test this hypothesis, we used RT-qPCR in wild-type ADP1 and a Δ dcaS mutant (IP461) grown on 20 mM pyruvate, 10 mM muconate, or 10 mM PCA. In wild-type ADP1, transcription of mucK is induced in the presence of muconate when compared to an unrelated carbon source, i.e. pyruvate (see FIG. 14B). Conversely, transcription of mucK is constitutive for all conditions in the Δ dcaS strain IP461, confirming our hypothesis that DcaS is a transcriptional repressor of mucK. Additionally, a slight repression of mucK transcription in the presence of PCA was observed in wild-type ADP1, suggesting that the generation of this intermediate during TPA catabolism could impede further uptake of TPA by MucK. This effect might explain why mutations that inactivate DcaS were selected early on during ALE.

    [0090] Next, we evaluated how deletion of dcaS affected TPA uptake using our biosensor. For this assessment, we transformed the third-generation TPA biosensor pTPA3 into IP461 and compared the fluorescent response to increasing TPA concentrations to that of wild-type ADP1 (see FIG. 14B). Indeed, the ΔdcaS strain IP461 exhibited higher fluorescence at lower TPA concentrations, and a significant fluorescent response above baseline (no TPA) was detected for this strain in as low as 0.01 mM TPA (p-value <0.001 for a two-tailed t-test). The results obtained for IP461 are in clear contrast to those presented in FIG. 5 for the TPA-TIT mutants, further supporting the hypothesis that the heterologous transporter has a minimal impact in TPA uptake in ADP1.

    [0091] Finally, we sought to assess how mutations in mucK affected uptake of TPA in the presence or absence of DcaS. Hence, we replaced the native mucK gene in either wild-type ADP1 or IP461 backgrounds, transformed all strains with pTPA3, and evaluated fluorescence in the presence or absence of TPA. In order to detect differences in uptake efficiency between the different MucK variants, we induced expression of the sfGFP gene with 0.01 mM TPA, the lowest concentration tested at which wild-type ADP1 did not exhibit a fluorescent response but IP461 did (see FIG. 14B). As shown in FIG. 14C, the expression of all mutated mucK alleles, except that encoding MucK(W150C I403T), resulted in an increased extent of fluorescence in the presence of TPA. These results demonstrate that at least 3 of the 4 MucK variants that arose during ALE are more efficient in TPA uptake than native MucK. Furthermore, the increased fluorescent response was synergistic with the deletion of dcaS, which is consistent with our finding that deletion of this transcription factor increases expression of mucK. Thus, in some embodiments of the present disclosure, a non-naturally occurring microorganism, capable of, among other things, at least one of the catabolism, transport, or growth of TPA may include a mutation to a MucK gene according to at least one of SEQ ID NOs: 3, 5, and/or 7. In some embodiments of the present disclosure, a non-naturally occurring microorganism, capable of, among other things, at least one of the catabolism, transport, or growth of TPA may include a mutation to a MucK protein according to at least one of SEQ ID Nos: 4, 6, and/or 8.

    DISCUSSION

    [0092] In this work, our goal was to engineer A. baylyi ADP1 to grow on TPA as a sole carbon and energy source using EASy with the tph catabolic genes from Comamonas sp. E6, a native TPA-utilizing bacterium. To that end, we successfully evolved A. baylyi strains for improved growth and consumption rates on this substrate. ALE through serial transfer did not lead to the isolation of Tpa.sup.+ strains with less than ˜15 copies of the tph catabolic operon. While WGS [whole genome sequencing] of evolved isolates identified beneficial mutations that enabled growth of ADP1 mutants on TPA (i.e. in dcaS and mucK), none of these were found to lie within the exogenous catabolic or transporter genes. Furthermore, the reintroduction of these beneficial mutations in the parent strain IP148 still led to the spontaneous amplification of the tph genes upon selection for growth on TPA (see Table 4 and FIG. 17). These results demonstrate that ADP1 requires multiple copies of these genes to support growth on TPA as sole carbon and energy source, and highlight the benefit of gene amplification as a natural mechanism employed by microorganisms to rapidly increase gene expression in response to an abrupt selective pressure.

    [0093] Interestingly, the TPA catabolic gene clusters in TPA-utilizing bacteria Comamonas sp. E6, R. jostii RHA1, and Rhodococcus sp. DK17 are duplicated in the genomes of these organisms. Additionally, the presence of transposable elements and DNA modifying genes (integrases, recombinases, and reverse transcriptases) in the immediate vicinity of the TPA operons in these three bacteria and in D. tsurhuratensis (de visu inspection of publicly available sequences) suggest that these may have been acquired through horizontal gene transfer. Considering the xenobiotic nature of TPA, it is likely that TPA catabolism has appeared recently, and that it has not yet fully evolved to be as efficient as the catabolism of other aromatic compounds that are ubiquitous in nature, such as those derived from lignin. In this sense EASy, by combining increased gene dosage and ALE, mimics how new catabolic pathways can evolve in nature: acquisition of exogenous genes through horizontal gene transfer, duplication of the acquired genes to overcome limitations in expression, and/or selection of mutations in the acquired or native genes that enable new functions.

    [0094] In particular, here we have identified variants of the ADP1 muconate MFS transporter MucK that are more efficient at importing TPA. It should be stressed that this discovery would not have been possible without amplification of the tph catabolic genes by EASy, which enabled the growth on TPA that was needed to initiate ALE. Of note, WGS data hint that GudP, another MFS [major facilitator superfamily] transporter predicted to transport glutarate/galactarate, could have also evolved to transport TPA in the engineered strains. The fact that both transporters are involved in the uptake of dicarboxylic acid suggests that they have a latent activity towards TPA that was improved through ALE. As there are no predicted TTTs in ADP1, it is possible that the transmembrane proteins TpiBA from Comamonas sp. E6 are not properly folded or sufficiently active in the heterologous host, and that ADP1 would instead favor MFS transporters to import TPA. However, alignments for MucK and GudP against known TPA MFS transporters (i.e. TpaK) from Rhodococcus sp. or P. xenovorans show sequence identities below 26% (see FIG. 18). Therefore, the prediction of this latent function by sequence analysis alone would have been improbable. The improved MucK variants identified here expand the known toolset of transporters that can be expressed in heterologous hosts to enable TPA uptake.

    [0095] In this work, we have also discovered that the transcription factor DcaS represses expression of MucK and that PCA, a metabolite generated during TPA catabolism, could also inhibit the expression of this transporter. Cross-regulation between the catechol (cat gene cluster) and PCA (pca gene cluster) branches of the β-ketoadipate pathway in ADP1, which will favor the former, are well documented in the literature (Bleichrodt et al., 2010; Brzostowicz et al., 2003; Siehler et al., 2007). However, their interaction with the dca gene cluster, involved in the catabolism of saturated C.sub.6-C.sub.10 dicarboxylic acids (Parke et al., 2001), has not been extensively studied. It should be noted that the dca gene cluster encodes another IclR-type regulator, DcaR (Fischer et al., 2008), that could add another layer of regulation that has not been elucidated in the present study (see FIG. 14A). Further analysis of the cross-talk between the different branches of the β-ketoadipate pathway would be of interest when engineering the metabolism of ADP1 towards substrates that are funneled through this pathway such as TPA, as cross-regulation could affect productivity and yields in bioprocesses aimed at the conversion of these substrates into value-added bioproducts (Beckham et al., 2016; Johnson et al., 2019).

    Materials and Methods:

    [0096] Strains and Culture Media:

    [0097] A. baylyi ADP1 (American Type Culture Collection ATCC 33305) and derived strains were routinely grown aerobically at 30° C. in minimal medium (MM) (Shanley et al., 1986), consisting of 0.5 M KH.sub.2PO.sub.4, 0.5 M Na.sub.2HPO.sub.4, 10% (NH.sub.4).sub.2SO.sub.4, and 1 mL concentrated base solution. Concentrated base solution contained (per liter): 20 g nitriloacetic acid (dissolved in 600 mL H.sub.2O with 14.6 g KOH); 28.9 g MgSO.sub.4; 6.67 g CaCl.sub.2.2H.sub.2O; 18.5 mg Mo.sub.7O.sub.24.4H.sub.2O; 198 mg FeSO.sub.4.7H.sub.2O; and 100 mL of Metals 44 solution. The Metals 44 solution contained (per liter): 2.5 g EDTA; 10.95 g ZnSO.sub.4.7H.sub.2O; 5 g FeSO.sub.4.7H.sub.2O; 1.54 g MnSO.sub.4.7H.sub.2O; 392 mg CuSO.sub.4.5H.sub.2O; 250 mg Co(NO.sub.3).sub.2.6H.sub.2O; and 177 mg Na.sub.2B.sub.4O.sub.7.10H.sub.2O. Minimal medium was supplemented with 20 mM pyruvate (hereafter MMP) or 5 or 10 mM TPA as carbon sources, unless otherwise indicated. For growth on plates, 1.5% w/v agar was added. When noted, the media was adjusted to pH 6 by changing the ratio of phosphate salts. Comamonas sp. E6 (Biological Resource Center, NITE, strain number 107749) and Rhodococcus jostii RHA1 (kindly provided by Dr. Lindsay Eltis from the University of British Columbia) were grown in lysogeny broth (LB) or MM supplemented with 10 mM TPA. Escherichia coli NEB 5-alpha F′ I.sup.q and NEB 5-alpha cells (New England Biolabs) were grown in LB broth. Antibiotic concentrations used for ADP1 were 25 μg/mL (standard) or 1 mg/mL (high) kanamycin (Km), and 25 μg/mL streptomycin (Sm). For E. coli, 100 μg/mL ampicillin (Ap), and 50 μg/mL Km or Sm were used.

    [0098] Plasmid Construction:

    [0099] Routine PCR amplifications were carried out using Phusion High-Fidelity DNA polymerase (New England Biolabs) and primers synthesized by Integrated DNA Technologies (IDT) or Eurofins. Synthetic, double-stranded DNA fragments (gBlocks) were also synthesized by IDT. Plasmids were constructed either by NEBuilder HiFi DNA assembly or by ligation with T4 DNA ligase (both from New England Biolabs). Plasmids containing P.sub.tac were transformed and maintained in NEB 5-alpha F′ I.sup.q cells. All plasmid inserts were verified by Sanger sequencing, performed by GENEWIZ. Details on plasmid construction and primer and gBlock sequences can be found in Tables 5-7.

    TABLE-US-00005 TABLE 5 Plasmids used in this study. For the purpose of standardized nomenclature, tphA genes are numbered in subscript to differentiate them from mutated alleles. Plasmid ID Description and construction details References pUC19 Cloning vector. Ap.sup.R. (Norranderet al., 1983) PUI1637 Source for ΩKm.sup.R cassette. Ap.sup.R Km.sup.R. (Eraso and Kaplan, 1994) pBAV1K-lacI-P.sub.trc- Broad host range vector for inducible expression in ADP1. Addgene 30503 (Murin et al., gusA Km.sup.R. 2012) pBAV1K- P.sub.T5-gfp Broad host range vector for constitutive expression in ADP1. Addgene 26702 (Bryksin and Km.sup.R. Matsumura, 2010) pTargetF Source for Sm.sup.R gene with promoter sequence. Sm.sup.R. Addgene 62226 (Jiang et al., 2015) pBTL-2 Broad host range expression vector. Km.sup.R. Addgene 22806 (Lynch and Gill, 2006) pBTL-2-tphR-sfGFP tphR gene along with tphR-tphC intergenic region (P.sub.tph) was This study amplified from Comamonas testosteroni genome (ATCC 700441D-5). The spacer between the start codon of tphC and RBS site in P.sub.tph was changed from CAAG to TATACAT (represented as P.sub.tph-RBS) using oRJ125/oRJ122. The tphR-P.sub.tph-RBS was then PCR assembled with the sfGFP coding sequence to create the sensor-reporter cassette (tphR-P.sub.tph-RBS-sfGFP). The pBTL-2 backbone (PCR amplified using oRJ17-03 + oRJ17-04) and the sensor-reporter cassette were assembled into a circular plasmid using the NEBuilder HiFi assembly kit. The resultant plasmid showed the sensor-reporter cassette between tonB and soxR terminators. pCJ050 Modified pK18mobsacB vector with EcoRI/Pstl/Xbal/BamHI (Schäfer et al., 1994), this study sites replacing the P.sub.lac:lacZ cassette. oCJ345 and oCJ289 were used to amplify pK18mobsacB, excluding the P.sub.lac:lacZ cassette, and the product was re-circularized using the KLD enyzyme mix from New England Biolabs. Km.sup.R. pIP019 pUC19 vector carrying P.sub.tac:tphA.sub.2A.sub.3BA.sub.1:tpiBA:Km.sup.R. gBlocks This study IP_tph_tpi-Opt_ADP1-1, IP_tph_tpi-Opt_ADP1-2, and IP_tph_tpi-Opt_ADP1-3, and the Km.sup.R:T0 fragment amplified from pBAV1K-lacI-P.sub.trc-gusA with oIP037 + oIP038, were assembled into pUC19 digested with BamHI-HF and HindIII- HF. Two single nucleotide deletions in tphA2 were corrected by site-directed mutagenesis. For this, three overlapping fragments were amplified with oIP042.1 + oIP129, oIP128 + oIP131 and oIP130 + oIP043, respectively. These were assembled by SOE and the resulting cassette cloned by NEBuilder HiFi DNA assembly into the original plasmid, previously linearized with Smal and Xhol. Ap.sup.R Km.sup.R. pIP020 pUC19 vector carrying P.sub.tac:tphA.sub.2A.sub.3BA.sub.1:tpiBA flanked by ~2 This study kbp targeting regions for integration between pobA and hcaG loci in ADP1. Upstream and downstream targeting regions were amplified from ADP1 gDNA with oIP117 + oIP089 and oIP119 + oIP120, respectively. P.sub.tac:tphCA2A3BA1:tpiBA was amplified from pIP019 with oIP090 + oIP118. PCR products were assembled into pUC19 digested with BamHI and HindIII. Ap.sup.R. pIP021 pIP020 plasmid carrying ΔKm.sup.R cassette downstream tpiA. This study pIP020 and pUI1637 were digested with Pmel, and the mucKKm.sup.R cassette ligated into linear pIP020. Km.sup.R gene is in convergent orientation with respect to synthetic genes. Ap.sup.R Km.sup.R. pIP031 pUC19 vector carrying P.sub.tac:tphA.sub.2A.sub.3BA.sub.1:tpiBA flanked by ~2 This study kbp targeting regions for integration between pobA and hcaG loci in ADP1. Includes weak RBS sequences of reduced TIR for tpiBA and GTG start codon for tpiB. tpiB, flanked by new RBS sequences for tpiB (2840.59 TIR with GTG start codon) and tpiA (496.23 TIR), was amplified from pIP020 with oIP160 + oIP163, and assembled into pIP020 linearized by PCR with oIP162 + oIP161. Ap.sup.R. pIP032 pIP031 plasmid carrying ΩKm.sup.R cassette downstream tpiA. This study pIP031 and pUI1637 were digested with SpeI, and the ΩKm.sup.R cassette ligated into linear pIP031. Km.sup.R gene is in convergent orientation with respect to synthetic genes. Ap.sup.R Km.sup.R. pIP037 pBAV1K-lacI vector carrying P.sub.trc:tpiBA with weak RBSs and This study alternative start codon. tpiBA was amplified from pIP032 with oIP185 + oIP186 and assembled into pBAV1K-lacI-P.sub.trc, previously linearized with oIP183 + oIP184. Km.sup.R. pIP040 pUC19 vector carrying P.sub.tac:tphA.sub.2A.sub.3BA.sub.1 P.sub.trc:tpiBA (with weak This study RBSs and alternative start codon) flanked by ~2 kbp targeting regions for integration between pobA and hcaG loci in ADP1. P.sub.trc:tpiBA was amplified from pIP037 with oIP189 + oIP190 and assembled into pIP031, previously linearized with oIP187 + oIP188. Ap.sup.R. pIP041 pIP040 plasmid carrying ΩKm.sup.R cassette between tphA.sub.1 and This study P.sub.trc:tpiBA. pIP040 and pUI1637 were digested with ApaI, and the ΩKm.sup.R cassette ligated into linear pIP040. Km.sup.R gene is in convergent orientation with respect to tph genes. Ap.sup.R Km.sup.R. pIP055 Modified pBAV1K-P.sub.T5-gfp with Sm.sup.R instead of Km.sup.R (backbone This study hereafter referred to as pBAV1S vector). pBAV1K- P.sub.T5-gfp was digested with Xbal and Sacl to remove Km.sup.R and its promoter sequence. Sm.sup.R with its promoter was obtained by digestion of pTargetF with Xbal and Sacl, and ligated into the linear vector backbone. Sm.sup.R. pIP064 pUC19 vector carrying P.sub.tac:tphC:P.sub.trc:tpiBA (with weak RBSs This study and alternative start codon) flanked by ~2 kbp targeting regions for integration between pobA and hcaG loci in ADP1. pUC19 with P.sub.tac:tphC and targeting regions was amplified by PCR from pIP031 with oIP187 + oIP292. P.sub.trc:tpiBA was amplified from pIP037 with oIP291 + oIP190. Products were assembled with the NEBuilder HiFi DNA assembly kit. Ap.sup.R. pIP065 pUC19 vector carrying P.sub.tac:tphC:P.sub.trc:tpiBA297 (with weak This study RBSs and alternative start codon) flanked by ~2 kbp targeting regions for integration between pobA and hcaG loci in ADP1. pUC19 with P.sub.tac:tphC and targeting regions was amplified by PCR from pIP031 with oIP187 + oIP292. P.sub.trc:tpiBA297 was amplified from pIP037 with oIP291 + oIP306. Products were assembled with the NEBuilder HiFi DNA assembly kit. Ap.sup.R. pIP073 pIP064 carrying ΩKm.sup.R cassette between tphC and P.sub.trc:tpiBA. This study pIP064 and pUI1637 were digested with ApaI, and the ΩKm.sup.R cassette ligated into linear pIP064. Km.sup.R gene is in convergent orientation with respect to tphC. Ap.sup.R Km.sup.R. pIP075 pIP065 carrying ΩKm.sup.R cassette between tphC and This study P.sub.trc:tpiBA297. pIP064 and pUI1637 were digested with ApaI, and the ΩKm.sup.R cassette ligated into linear pIP065. Km.sup.R gene is in convergent orientation with respect to tphC. Ap.sup.R Km.sup.R. pIP088 pCJ050-based vector with Sm.sup.R replacing Km.sup.R. pCJ050 was This study linearized by PCR with oIP340 + oIP341. Sm.sup.R and promoter region were amplified from pTargetF with oIP342 + oIP343. Products were assembled with NEBuilder HiFi DNA assembly kit. Sm.sup.R. pIP089 pUC19 vector carrying P.sub.tac:tphC:SmP:sacB:P.sub.trc:tpiBA flanked This study by ~2 kbp targeting regions for integration between pobA and hcaG loci in ADP1. pIP041 was linearized by PCR with oIP345 + oIP344. Sm.sup.R:sacB was amplified from pIP088 with oIP346 + oIP002. Products were assembled with NEBuilder HiFi DNA assembly kit. Ap.sup.R Sm.sup.R. pIP102 pUC19 vector carrying Sm.sup.R:sacB cassette flanked by ~1 kbp This study targeting regions for replacement of dcaS. Sm.sup.R:sacB cassette was amplified from pIP088 with oIP346 + oIP002. Upstream and downstream targeting regions were respectively amplified from IP148 gDNA with oIP393 + oIP395 and oIP396 + oIP394. PCR products were assembled into pUC19, previously linearized with BamHI and HindIII. Ap.sup.R Sm.sup.R. pIP103 pUC19 vector carrying Sm.sup.R:sacB cassette flanked by ~1 kbp This study targeting regions for replacement of mucK. Sm.sup.R:sacB cassette was amplified from pIP088 with oIP346 + oIP002. Upstream and downstream targeting regions were respectively amplified from IP148 gDNA with oIP402 + oIP404 and oIP405 + oIP403. PCR products were assembled into pUC19, previously linearized with BamHI and HindIII. Ap.sup.R Sm.sup.R. pIP104 pUC19 vector carrying ~1 kbp targeting regions for dcaS This study deletion. Upstream and downstream targeting regions were respectively amplified from IP148 gDNA with oIP393 + oIP397 and oIP398 + oIP394. PCR products were assembled into pUC19, previously linearized with BamHI and HindIII. Ap.sup.R. pIP105 pUC19 carrying mucK258 flanked by ~1 kbp targeting regions This study for replacement of wild-type mucK. mucK with upstream and downstream targeting regions was amplified from IP148 gDNA in two fragments with oIP402 + oIP428 and oIP427 + oIP403. PCR products were assembled into pUC19, previously linearized with BamHI and HindIII. Ap.sup.R. pIP106 pUC19 carrying mucK243 flanked by ~1 kbp targeting regions This study for replacement of wild-type mucK. mucK with upstream and downstream targeting regions was amplified from IP148 gDNA in three fragments with oIP402 + oIP418, oIP417 + oIP420 and oIP419 + oIP403. PCR products were assembled into pUC19, previously linearized with BamHI and HindIII. Ap.sup.R. pIP107 pUC19 carrying mucK255 variant flanked by ~1 kbp targeting This study regions for replacement of wild-type mucK. mucK with upstream and downstream targeting regions was amplified from IP148 gDNA in three fragments with oIP402 + oIP424, oIP423 + oIP426, and oIP425 + oIP403. PCR products were assembled into pUC19, previously linearized with BamHI and HindIII. Ap.sup.R. pIP108 pUC19 carrying mucK246 variant flanked by ~1 kbp targeting This study regions for replacement of wild-type mucK. mucK with upstream and downstream targeting regions was amplified from IP148 gDNA in two fragments with oIP402 + oIP422 and oIP421 + oIP403. PCR products were assembled into pUC19, previously linearized with BamHI and HindIII. Ap.sup.R. pTPA1 1.sup.st generation TPA sensor for use in ADP1. pBAV1S vector This study carrying the sensor reporter cassette tphR-P.sub.tph-RBs-sfGFP. The sensor-reporter cassette was amplified from pBTL-2-tphR- sfGFP with oIP305 + oIP262 and assembled into pIP055 linearized with Xbal and Spel. Sm.sup.R. pTPA-Lib1 Library of plasmids derived from pTPA1 with partial This study randomization of the -35 and -10 sites. oRJ146 and oRJ147 were mixed and PCR amplified to obtain a double stranded, diversified Ptph library. The vector backbone with TphR and sfGFP coding genes was amplified with oRJ012 + oRJ150 using pTPA1 as template. PCR products were assembled using NEBuilder HiFi DNA assembly. Sm.sup.R. pTPA2 2.sup.nd generation TPA sensor for use in ADP1, isolated from This study pTPA-Lib1 by FACS. Contains mutations in the -10 site of P.sub.tph with respect to pTPA1. Sm.sup.R. pTPA-Lib2 Library of plasmids derived from pTPA2 with complete This study randomization of the -35 site. Products from PCR amplification of pTPA1 with oRJ17-01 + oRJ152 and pTPA2 with oRJ151 + oRJ130 were assembled into the vector backbone, obtained by PCR linearization of pTPA1 with oRJ112 + oRJ17- 04. Sm.sup.R. pTPA-Lib3 Library of plasmids derived from pTPA2 with complete This study randomization of the -10 site. Products from PCR amplification of pTPA1 with oRJ17-01 + oRJ154 and oRJ153 + oRJ130 were assembled into the vector backbone, obtained by PCR linearization of pTPA1 with oRJ112 + oRJ17-04. Sm.sup.R. pTPA3 3.sup.rd generation TPA sensor for use in ADP1, isolated from This study pTPA-Lib2 by FACS. Contains mutations in the -35 site of P.sub.tph with respect to pTPA2, and a single base-pair deletion between the operator and -35 sites. Sm.sup.R.

    TABLE-US-00006 TABLE 6 Oligonucleotides used for plasmid and strain construction. Overlaps for assembly are underlined. Inserted restriction sites are shown in bold. Site-directed mutations are shown in red. Forward and reverse primers are respectively indicated with (F) and (R). Oligo ID Sequence Description oCJ289 ctaactcacattaattgcgttgcgctcactg Amplification of pK18mobsacB backbone (R) oCJ345 GAATTCcustom-character TCTAGAGGATCCctagcttcacgctgccgcaag Amplification pK18mobsacB with EcoRI Pstl, Xbal, and BamHI sites (F) oIP002 atcggcattttcttttgcg Amplification of Km.sup.R:sacB or Sm.sup.R:sacB from pCJ050 and pIP088, respectively (R) oIP018 atttaagcactgcactcacc Amplification of 5′- homogy arm for integration downstream pobA (R) oIP031 agcaaggtgagatgacagg Amplification of 3′-end of ΩKm.sup.R Cassette for SBF construction (F) oIP037 atggctaaaatgagaatatcacc Amplification of Km.sup.R:T0 from pBAV1K (F) oIP038 acagctatgaccatgattacgccAAGCTTGagtgcttggattctcaccaa Amplification of Km.sup.R:T0 from pBAV1K (R) with pUC19 overlap and HindIII site oIP042.1 gtgaattcgagctcggtacc Amplification of gBlock IP_tph_tpi-Opt_ADP1-1 for cloning into pUC19 (F) oIP043 ggtgatattctcattttagccat Amplification of gBlock IP_tp_tpi-Opt_ADP1-3 for cloning upstream of Km.sup.R:T0 from pBAV1K into pUC19 (R) oIP089 cgttttatttgatgtctgqttagctggcatgttttaaatagtcaag Amplification of 5′- targeting region for integration downstream pobA (R), with rmB T1 overlap oIP090 gactatttaaaacatgccagctaaccagacatcaaataaaacg Amplification of rmB T1:P.sub.tac:tphA2A3BA1 (F) with pobA overlap oIP096 taatgcaagcacgtgagc Amplification primer. Binds pobA (F) oIP117 GTGAATTCGAGCTCGGTACCCGGGGATCCGTTTAAACCAAATTACGCAGCTCATTC Amplification of 5′- targeting region for integration downstream pobA (F) with pUC19 overlap and Pmel site oIP118 gctctctttttgttttaACTAGTtcaatcttctacaaaggcc Amplification of P.sub.tac:tphA2A3BA1:tpiBA (R) with Spel site and overlap with downstream pobA sequence oIP119 ggcctttgtagaagattgaACTAGTtaaAACAAAAAGAGAGCGATTAG Amplification of 3′- targeting region for integration downstream pobA (F) with tpiA overlap and Spel site oIP120 aacagctatgaccatgattacgccaagcttGTTTAAACAGGCATAAGGATATTGCAATG 2 kbp downstream ADP1 pobA amplification (R) with pUC19 overlap and Pmel site oIP128 ctcagaaattacctaataaCtggaaactttattttgaaaatg Mutagenic primer (F), corrects c590 deletion in tphA2 oIP129 cattttcaaaataaagtttccaGttattaggtaatttctgag Mutagenic primer (R), corrects c590 deletion in tphA2 oIP130 gcagaacaacgtaaagtTcgtcttaaacaagctaatctg Mutagenic primer (F), corrects t1013 deletion in tphA2 oIP131 cagattagcttgtttaagacgaActttacgttgttctgc Mutagenic primer (R), corrects t1013 deletion in tphA2 oIP145 ggttcgcttgctgtccattcatgcctgcatttcttgtc Amplification of pobA:P.sub.tac:tphC:tphA2 (R) with Km.sup.R:sacB overlap for stepwise integration of TPA degradation cluster oIP146 cgcaaaagaaaatgccgatgttaaaacaaaaagagagcgattag Amplification of downstream ADP1 pobA flanking region from pIP021 with KmR/SacB overlap (F), for stepwise integration of TPA degradation cluster in ADP1 oIP160 cctacaggtcaccactagCGGAACGGCGATgtgaaaattaaaagtcaaaaag Amplification of tpiB (F) for insertion of synthetic RBS with 1952.24 TIR and alternative start codon gtg contains overlap with tphA2 oIP161 ctttttgacttttaattttcacATCGCCGTTCCGctagtggtgacctgtagg Linearization of pIP021 (R) for insertion of synthetic RBS with 1952.24 TIR upstream tpiB and alternative start codon gtg contains overlap with tpiB oIP162 catttatcgcgggttaaCCGGTAAGCGGCatggatcttattcaaaac Linearization of pIP021 (F) for insertion of synthetic RBS with 496.23 TIR upstream tpiA contains overlap with tpiB oIP163 gttttgaataagatccatGCCGCTTACCGGttaacccgcgataaatg Amplification of tpiB (R) for insertion of synthetic RBS with 496.23 TIR upstream tpiA contains overlap with tpiA oIP180 cgttttatttgatgtctggcgataccgtcgacctc Amplification of 3′-end of ΩKm.sup.R cassette for SBF construction (R), contains overlap with 5′- end of P.sub.tac:tph cassette oIP181 gaggtcgacggtatcgccagAcatcaaataaaacg Amplification of 5′-end of P.sub.tac:tph cassette for SBF construction (F), contains overlap with 3′- end of ΩKm.sup.R cassette oIP182 aagggcaagagccatc Amplification of 5′-end of P.sub.tac:tph cassette for SBF construction (R) oIP183 aaaggagaagcttactagtagc Linearization of pBAV1K- P.sub.trc for assembly (F) oIP184 gtgtgaaattgttatccgctc Linearization of pBAV1K- P.sub.trc for assembly (R) oIP185 gagcggataacaatttcacacTGGAGCGCACACgtgaaaattaaaagtcaaaaag Amplification of tpiB (F) with P.sub.trc overlap and synthetic RBS with 1705.68 TIR oIP186 gctactagtaagcttctccttttcaatcttctacaaaggcctc Amplification of tpiA (R) with pBAV1K overlap oIP187 actagttaaaacaaaaagagagc Linearization of pIP031 for assembly (F) oIP188 GGGCCCctagtggtgacctgtagg Linearization of pIP031 for assembly (R), introduces Apal site oIP189 tcctacaggtcaccactagGGGCCCgagctgttgacaattaatcatC Amplification of P.sub.trc:tpiBA (F) with Apal site and pIP031 overlap oIP190 tcgctctctttttgttttaactagttcaatcttctacaaaggcctc Amplification of P.sub.trc:tpiBA (R) with pIP031 overlap 01P262 gccctgaggcctgcagcggccgcTACTAGTttacctaggtgtgaattcagaac Amplification of tphR- sfGFP (R), contains Spel site and pBAV overlap oIP291 gagctgttgacaattaatcatcc Amplification of P.sub.trc:tpiBA (F) oIP292 gatgattaattgtcaacagctcGGGCCCttaaagttttacgtttgctgc Amplification of tphC (R) with Apal site and P.sub.trc overlap oIP305 agatctaagcttctgcaggtcgacTCTAGAcggatccccctcaagtc Amplification of tphR- sfGFP (F) with Xbal site and pBAV overlap oIP306 tcgctctctttttgttttaACTAGTTacatgcttgcaataagacc Amplification of truncated tpiA (R), contains Spel site and overlap with downstream pobA sequence oIP340 tgagcgggactctgg Linearization of pCJ050 (R oIP341 gcagcgtgaagctagg Linearization of pCJ050 (F). oIP342 gatccctagcttcacgctgccctgttatccctactcgag Amplification of Sm.sup.R(F) with pCJ050 overlap oIP343 gaaccccagagtcccgctcatttgccgactaccttgg Amplification of Sm.sup.R(R) with pCJ050 overlap oIP344 taaaaacgcaaaagaaaatgccgatgtctagctatcgccatg Linearization of pIP041 (R) with sacB overlap oIP345 taacagggcagcgtgaagctagggattaaagttttacgtttgctgc Linearization of pIP041 (F) with Sm.sup.R overlap oIP346 tccctagcttcacgctgc Amplification of SM.sup.R:sacB (F) oIP393 GTGAATTCGAGCTCGGTACCCGGGGATCCcustom-character cactgtcaaagctcaacc Amplification of upstream targeting region targeting dcaS (F), contains BamHI and Pmel sites, and pUC19 overlap oIP394 AACAGCTATGACCATGATTACGCCAAGCTTcustom-character ttattggcatctttgggtttac Amplification of downstream targeting region targeting dcaS (R), contains HindIII and Pmel sites, and pUC19 overlap oIP395 gcagcgtgaagctagggacataggaaagagtatactcaactc Amplification of upstream targeting region targeting dcaS (R) contains overlap with Sm.sup.R oIp396 cgcaaaagaaaatgccgattaaaaaatatcgcaaaatgcgtac Amplification of downstream targeting region targeting dcaS (F) contains overlap with sacB oIP397 attttgcgatattttttacataggaaagagtatactcaactc Amplification of upstream targeting region targeting dcaS (R) contains overlap with downstream targeting region oIP398 gagtatactctttcctatgtaaaaaatatcgcaaaatgcgtac Amplification of downstream targeting region targeting dcaS (F) contains overlap with upstream targeting region. oIP402 gtgaattcgagctcggtacccggGGATCCcustom-character agatactgtttgatcagtgg Amplification of downstream targeting region targeting muck (F), contains BamHI and Pmel sites, and pUC19 overlap oIP403 aacagctatgaccatgattacgccAAGCTTcustom-character caggtactttacctgaagc Amplification of upstream targeting region targeting muck (R), contains HindIII and Pmel sites and pUC19 overlap oIP404 gcagcgtgaagctagggataacttataaatgcttatacacttc Amplification of downstream targeting region targeting muck (R) contains overlap with Sm.sup.R oIP405 cgcaaaagaaaatgccgatcatagctatattcctttagcaaag Amplification of upstream targeting region of targeting muck (F) contains overlap for assembly with sacB oIP417 ggaagctttctAtcatgtaagttgc muck mutagenic primer, encodes T342I (R) oIP418 cttacatgaTagaaagcttcccaac muck mutagenic primer, encodes T342I (F) oIP419 gagagcaacaAcaggtctgctcc muck mutagenic primer, encodes M43L (R) oIP420 ggagcagacctgTtgttgctctc muck mutagenic primer, encodes M43L (F) oIP421 gttggaacaCattcggccatgag muck mutagenic primer, encodes Y133C (R) oIP422 ctcatggccgaatGtgttccaacaaaatac muck mutagenic primer, encodes Y133C (F) oIP423 gtttttctttgGtaaacagtgctgg muck mutagenic primer, encodes I403T (R) oIP424 ccagcactgtttaCcaaagaaaaacaatatg muck mutagenic primer, encodes I403T (F) oIP425 atagccaacagtAcagccagcctg muck mutagenic primer, encodes W150C (R) oIP426 caggctggctgTactgttggctatattg muck mutagenic primer, encodes W150C (F) oIP427 ctcagctttaatactgtttaaactataagagagcaaTatcaggtctgctc muck mutagenic primer, encodes M341 (R) and contains overlap with oIP428. oIP428 ttaaacagtattaaagctgagtttaatttaagtacagttgGagctggaatg muck mutagenic primer, encodes E53G (F) and contains overlap with oIP427. oIP475 aacttctaaaaattaacgcatagc Amplification of rpoD with targeting regions (F) oIP476 gtcactgggtatgagaatatg Amplification of rpoD with targeting regions (F) oRJ17- tgctatggaggtcaggtatg Sequencing primer, 01 binds downstream of tonB terminator in pBTL- 2 or pTPA plasmids (F) oRJ17- gatatcattcaggacgagcctcagactcc Amplification of pBTL-2 03 backbone (F) oRJ17- aatcatacctgacctccatagcagaaagtcaaaag Amplification of pBTL-2 04 or pTPA backbone (R) oRJ17- gaggctcgtcctgaatgatatcttacctaggtgtgaattcagaac Ampliification of sfGFP 08 gene; provides overlapping sequence with pBTL-2 backbone for NEBuilder HiFi assembly (R) oRJ012 AAGGAGAtatacatatggctagcaaaggagaagaac Amplification of sfGFP gene with a canonical RBS site at the 5′ end (F) oRJ112 catggcatggatgagctctac Amplification of vector backbone; binds 3′ end of the sfGFP gene (F) oRJ122 tttgctagccatatgtataTCTCCTTcttgtgtggggaactgcag Amplification of P.sub.tph with an overlapping sequence with sfGFP gene and canonical RBS (R) oRJ125 tgctatggaggtcaggtatgattctacaacccctgcggat Amplification of tphR gene; provides overlapping sequence with pBTL-2 backbone for NEBuilder HiFi assembly (F) oRJ130 ttacctaggtgtgaattcagaacc Amplification of sfGFP gene from 3′ end (R) oRJ146 tttgctagccatatgtatatctccttcttgtgtggngaactgcaNTNTNAggatgtcgtactttg Partially randomized P.sub.tph at −10 site for pTPA-Lib1 (R), contains overlap with oRJ147 oRJ147 gttttcaacatttttgcgcatagcgcaaaaacaggtNTNANAcaaagtacgacatcct Partially randomized P.sub.tph at −35 site for pTPA-Lib1 (F), contains overlap with oRJ146 oRJ150 atgcgcaaaaatgttgaaaac Amplification of pTPA1 backbone including tphR and sfGFP gene (R) oRJ151 caaagtacgacatccttacaatg Amplification of P.sub.tph downstream of −35 site for construction of pTPA- Lib2 (F) oRJ152 cattgtaaggatgtcgtactttgNNNNNNacctgtttttgcgctatgc Completely randomized P.sub.tph at −35 site for construction of pTPA- Lib2 (R) oRJ153 gtttaacacaaagtacgacatcctNNNNNNgcagttccccacacaag Completely randomized P.sub.tph at −10 site for construction of pTPA- Lib3 (F) oRJ154 aggatgtcgtactttgtgttaaac Amplification of P.sub.tph upstream of −10 site for construction of pTPA- Lib3 (R)

    TABLE-US-00007 TABLE 7 Synthetic DNA fragment (gBlock) sequences used in this study. For the purpose of standardized nomenclature, tphA genes are numbered in subscript to differentiate them from mutated alleles. gBlock ID Description IP_tph_tpi- The second terephthalate GTGAATTCGAGCTCGGTACCCGGGCCAGACATCAAATAAAACGAAAGGCTCAG Opt_ADP1-1 degradation cluster TCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGGTCTCAT tphCA.sub.2A.sub.3BA.sub.1 and TPA TAATTAATCCAGAGGCATGAGCTGTTGACAATTAATCATCGGCTCGTATAATG transporter components TGTGGAATTGTGAGCGGATAACAATTTCACACAGGAGAGTCTATATatgCGTA tpiBA from Comamonas sp. ACGAATCTATCCGTCGTCGTGAAGCGTTAATTGGTATCGCTGCAGCAGTTGCA E6 (Hosaka et al., GCAACTGGTTCACTCGCTCAAAGTAACCAACCACTGAAAATCGTTGTGCCTTT 2013; Sasoh et al., 2006) TTCTGCAGGTGGTACAGCGGACGTATTACCACGTCTTGTCGCTGAAAAAATCC were codon optimized for GTGCCGATTATGCTGGTGGTGTTATCATCGAAAACAAACCAGGTGCAGGTGGT expression in A. baylyi ADP1, AATATTGGTGCAGATCTAGTTTTCCGTGCTCCACCAGACGGTATGACGGTTTT using the guided random AGCTTCACCACCTGGTCCTATCGCTATTAATCACAATCTTTATCAAAAATTAT codon optimizer tool CTTTCGATCCTACTCGTTGGGTACCAGTAACCATTCTGGCAACAGTTCCTAAC at http://genomes.urv.es/ GTACTTGTAATTAACCCAAAACTACCTGTTAAAAGCCTTGGCGAATTTATCGC OPTIMIZER/ (Puigbò et al., 2007). ATACGCAAAAGCAAATCCAAAGAAAGTAACCGTAGCGACTCAAGGTGACGGTT Synthetic RBS were CTACTTCACACCTTACAGCAGCAATGTTTATGCAATTAACTGGTACAGAACTA designed for all CDS using ACTGTTATCCCATACAAAGGTACAGCACCAGCTTTAATCGATCTTATTGGTGG the Salis Lab RBS calculator TAATGTAGACGTGTTTTTCGATAATATCAGCTCTTCTGCAACTTATCACCAAG with constraints tool CAGGAAAAGTTCGTATTCTTGCAGTTGCTGATGAACAACGTTCACAAATTCTT (Espah Borujeni et al., CCACAAGTTCCAACGTTCGCAGAACAACAGTGGCCAGCAATGCAAGCTGTGAC 2014, 2013) targeting a ATTTTTCTCAGTAGTGGCACCTCCTGGTACATCAGCAGAAATCGCACAAAAAC TIR of 10,000 A.U. TTCAAAAACAGATGGCTCTTGCCCTTTCTTCGAACGATATTCGTAAGCACTTC (version 1.1), except CAGGAACAAGGTGCTGTGCCATGTGGTTGGGATCCAAGTAAAACTGCTCAATT for tpiA for which the TATTCGTCAGGAAACCGAAAAATGGAAGAAAGTACTCAAAGCAGCAAACGTAA native RBS from Comamonas AACTTtaaGAGAGGAAAGCAatgCAGGAAAGCATTATTCAATGGCATGGTGCG sp. E6 was maintained ACCAACACACGCGTTCCATTTGGTATCTATACAGATACCGCAAATGCTGACCA (predicted TIR > 10,000 A.U.). AGAACAACAGCGTATTTACCGTGGCGAAGTATGGAATTACCTTTGTTTGGAAT Forward rmB T1 terminator CAGAAATCCCAGGAGCGGGTGATTTTCGTACCACATTTGCGGGTGAAACACCT and P.sub.tac promoter were ATTGTCGTAGTTCGTGATGCTGATCAAGAAATTTATGCTTTCGAAAATCGTTG included upstream of TGCTCACCGTGGTGCTTTAATTGCATTAGAAAAGAGCGGTCGTACTGATTCTT tphC. Constructions were TTCAATGTGTTTATCATGCATGGTCATATAACCGTCAGGGTGACCTTACGGGT initially designed for GTGGCTTTCGAAAAAGGCGTAAAAGGTCAGGGTGGTATGCCAGCTAGTTTCTG cloning into pUC19 TAAAGAAGAACATGGTCCACGTAAACTTCGCGTAGCAGTGTTCTGCGGCTTGG together with Km.sup.R:T0 TTTTCGGTTCTTTTTCTGAAGACGTTCCAAGTATTGAAGATTATTTGGGTCCG (amplified from pBAV1K GAAATTTGTGAACGTATCGAACGTGTTCTCCATAAGCCTGTAGAAGTTATCGG and including a synthetic TCGTTTTACTCAGAAATTACCTAATAACTGGAAACTTTATTTTGAAAATGTAA RBS upstream Km.sup.R) AAGATAGCTACCATGCATCTCTTTTACACATGTTTTTCACAACTTTCGAACTG downstream of tpiA. AACCGTTTATCTCAGAAAGGCGGTGTTATTGTGGATGAGTCTGGCGGCCATCA Construct was divided into TGTATCCTATAGTATGATTGATCGTGGGGCCAAGGATGATTCATATAAAGATC 3 overlapping gBlock AAGCTATTCGTTCTGACAATGAACGTTATCGTTTGAAAGATCCTAGCTTACTA fragments (total size: GAAGGTTTTGAAGAATTCGAAGATGGTGTAACGCTTCAAATTCTTAGCGTATT 6964 bp). gBlock-1 is CCCAGGGTTTGTTTTGCAACAAATCCAAAACAGTATTGCAGTGCGTCAGTTAT 2325 bp long. rmB T1 TGCCAAAAAGTATTTCTAGTTCTGAATTGAACTGGACTTATTTAGGTTATGCC sequence is shown in GATGATAGCGCAGAACAACGTAAAGTTCGTCTTAAACAAGCTAATCTGATTGG lighter text. P.sub.tac, lac ACCTGCTGGATTCATTTCAATGGAAGATGGTGCAGTCGGCGGTTTCGTGCAGC operator, and a spacer GTGGTATTGCAGGCGCTGCTAACCTTGATGCAGTAATCGAAATGGG sequence is shown italicized. RBS sequences are shown in italicized and underlined. Overlaps for assembly are underlined. Start and stop codons for CDSs are shown in lowercase bold. IP_ph_tpi- See description for CCTTGATGCAGTAATCGAAATGGGCGGTGATCATGAAGGCAGCTCTGAAGGTC Opt_ADP1-2 IP_tph_tpi-Opt_ADP1-1. GCGCTACTGAAACTtcaGTACGTGGCTTTTGGAAAGCATATCGTAAACATATG gBlock22 is 2325 bp long. GGACAAGAAATGCAGGCAtgaGGAGTCCCTAAACAatgATCAATGAAATACAG RBS sequences are ATCGCAGCATTTAATGCAGCATATGCAAAAACTATTGACTCTGATGCTATGGA shown italicized and ACAATGGCCTACCTTTTTTACTAAAGATTGCCATTATTGTGTAACGAATGTAG underlined. Overlaps for ATAATCATGATGAGGGTTTAGCTGCTGGTATAGTTTGGGCAGATTCACAGGAC assembly are underlined. ATGTTGACTGATCGTATCTCAGCTTTGCGTGAAGCGAACATTTACGAACGTCA Start and stop codons CCGCTATCGTCACATCTTAGGTCTGCCATCAATTCAATCAGGTGATGCAACGC for CDS are shown AGGCATCAGCTAGCACACCTTTCATGGTTCTTCGTATCATGCATACTGGCGAA in lowercase bold. ACGGAGGTTTTCGCATCGGGTGAATATCTCGATAAATTCACTACTATTGATGG TAAATTGCGCCTTCAGGAACGTATTGCTGTTTGTGACTCTACAGTAACCGATA CCTTAATGGCATTGCCATTAtgaAAGGAGGTAACAatgAACGCAATTGTTCAC CGCCGTCTTGCACTTGCAATTGGTGATCCACATGGTATTGGTCCTGAAATCGC ATTGAAAGCTcttCAACAGCTTTCGGTAACTGAACGTAGCTTAATTAAAGTAT ACGGTCCGTGGTCTGCACTTGAACAAGCAGCACGCGTTTGCGAAATGGAACCA CTCTTACAAGATATCGTACACGAAGAAGCAGGTACCTTGACCCAACCAGTACA GTGGGGTGAAATTACACCACAAGCTGGTCTTAGTACAGTACAATCAGCTACTG CTGCGATCCGTGCATGTGAAAATGGTGAGGTAGATGCAGTTATTGCGTGTCCA CACCATGAAACTGCAATCCACCGTGCTGGTATCGCCTTCTCTGGTTATCCAAG CcttTTAGCGAATGTGTTGGGTATGAACGAAGATCAAGTTTTTCTTATGTTGG TTGGTGCTGGTCTTCGTATCGTTCATGTGACTCTACACGAATCTGTACGTTCT GCACTTGAACGTCTTTCTCCACAACTTGTTGTAAATGCAGCACAAGCAGCAGT TCAAACCTGTACATTGCTTGGTGTTCCTAAACCGAAAGTGGCAGTGTTCGGCA TTAACCCACATGCATCAGAAGGTCAACTTTTCGGCTTGGAAGATAGCCAAATT ACCGTTCCAGCAGTTGAAACCCTTCGTAAACGTGGTCTAGCTGTTGATGGTCC AATGGGTGCGGATATGGTACTGGCACAACGTAAACATGATTTATATGTTGCGA TGCTTCATGATCAGGGTCATATACCAATTAAACTTCTTGCACCAAATGGTGCG AGTGCTCTCTCAATCGGTGGTCGTGTTGTATTGTCATCAGTTGGACACGGCAG CGCAATGGACATCGCTGGCCGTGGCGTAGCTGATGCCACTGCTCTTTTACGTA CCATTGCTCTTCTTGGCGCTCAGCCAGTTtgaGGTCCCTCCCAAatgAACCAT CAAATCCACATCCATGACTCAGATATTGCATTTCCATGTGCACCTGGTCAATC AGTTTTGGATGCGGCCTTACAAGCAGGTATCGAATTGCCTTATAGCTGCCGTA AAGGTTCATGTGGGAATTGTGCAAGTACTCTTTTAGATGGTAATATTGCATCT TTCAACGGTATGGCTGTTCGTAATGAATTATGTGCGTCTGAACAAGTGTTATT GTGTGGTTGCACGGCGGCATCTGATATACGTATTCATCCTTCTTCTTTCCGTC GTCTTGACCCAGAAGCTCGTAAACGTTTCACTGCTAAGGTATATTCAAATACT CTTGCTGCTCCAGATGTATCTCTTCTCCGTCTCCGTTTACCTGTTGGTAAACG TGCTAAATTTGAAGCTGGTCAATATTTACTAATCCACTTAGATGACGGTGAGA GCCGTAGCTACAGCATGGCAAATCCACCACATGAATCTGATGGTATCACCTTA CATGTTCGTCATGTTCCAGGTGGGCGTTTTAGTACTATTGTACAACAATTGAA ATCAGGAGATACTTTGGACATTGAATTACCTTTTGGTTCTATTGCGCTTAAAC CTGATGACGCTCGTCCTCTGATCTGTGTAGCTGGTGGTACCGGCTTTGCTCCA ATCAAATCCGTTTTAGACGATCTCGCGAAACGTAAAGTACAGCGCGATATCAC ACTTATCTGGGGCGCACGCAATCCATCTGGCTTATATCTTCCATCAGCTATCG ATAAGTGG IP_tph_tpi- See description for CTTCCATCAGCTATCGATAAGTGGCGTAAGGTATGGCCACAATTCCGTTACAT Opt_ADP1-3 IP_tph_tpi-Opt_ADP1-1. CGCCGCTATCACTGATCTTGGGGATATGCCAGCTGATGCACACGCTGGTCGTG gBlock-3 is 2347 bp long. TGGACGACGCATTACGTACTCATTTTGGTAATCTGCATGATCATGTTGTTCAT RBS sequences are TGTTGTGGTTCGCCTGCTCTAGTTCAAAGTGTCCGTACAGCCGCCTCGGACAT shown italicized and GGGTCTACTAGCGCAAGATTTCCATGCAGATGTATTTGCAACTGGTCCTACAG underlined. Overlaps for GTCACCACtagGGGGCGGAACAAatgAAAATTAAAAGTCAAAAAGATTTTTTT assembly are underlined. TCTGGTTTGATGTTCCTTGCAGTTGGTTTAGCATTTGCAATTGGTGCTTCAAA Start and stop TTATACTATTGGTACTGGTGCTCGTATGGGTCCAGGTTATTTCCCTCTTATAC codons for CDS are TTGGTGTACTGATGGCGATTCTAGGTGCAGCTATCTGTGTTGGTGGTCTTACT shown in lowercase bold. AAAGGTCCAGAGGGTGGTGATAAAATTGGTAAATGGGCATGGCGTCAAGTTTT A Xhol site is shown TTTTATCTTGGCAGCAAATTTTGCATTCGGCATTTTGTTAGTGGGTGTACCAG in italicized. CAGTTGGTATTCCACAATTTGGTCTTATTATCGCAATTTATGCGTTAGTCTTC ATCGCGTCTTTGGGTGGCCACTCTTTCAACTTCAAAGAAACCGCGATCCTTGC AACGGTGCTTGCAGTTGGTTCTTACTTCGCTTTTGTTTGGGCATTAAACTTAC AATTCCCAGTATGGCCATCATTTATCGCGGGTtaaTCAGGAGCATCGTCCatg GATCTTATTCAAAACTTAAGTACCGGCTTCGGTGTGGCTTTCACTTTCCAAAA TTTGATTTATTGTTTCGTTGGTTGTCTTTTAGGTACTTTAATTGGCGTACTTC CAGGCATTGGTCCAGTTGCTACAATTGCAATGTTATTGCCTGCAACCTATGCT TTACCACCAGTGGCTGCATTGATTATGTTGGCTGGTATCTACTATGGTGCGCA GTATGGTGGTAGTACTACTGCTATTTTGGTAAATCTTCCGGGTGAATCTTCTT CTGTAGTCACCGTTATCGATGGTTACCAAATGGCTCGTAAAGGTCGTGCAGGT CCAGCGCTTGCTGCTGCTGGTATTGGTTCTTTTTTCGCAGGTTGTGTTGGTAC AGTGATCTTAGCGGCTTTCGCTCCACCTCTCACGGAAGTTGCATTCAAGTTTG GACCTGCAGAGTATTTTTCTTTAATGACATTGGGTCTAATTGGTGCAGTTGTC CTTGCTTCAGGCTCTTTGCTCAAAGCAATTGCAATGATCGTACTCGGTCTTTT GCTTGGCATGGTTGGTACGGACGTAAATTCAGGTGTAGCGCGTTACTCATTTG ACATTCCAGAGCTAACAGATGGTATTGATTTTGTTGTGATCGCAATGGGTGTT TTTGGTTACGGTGAAATTATTGCAAATCTTTCAAAGCCTGATGATGAACGTGA GGTTTTTGCAGCGAAAGTGACTGGTCTTCTTCCAACAAGTGAAGACTTCAAAC GTATGTTGCCAGCAATGTTGCGTGGTACAGCATTAGGTTCAGCTTTAGGAATT TTGCCAGGTGGTGGTGCTATGTTGAGTGCATTTGCAGCTTATACAATTGAAAA AAAAACCAAATTAAAACCTGGTGAAGTACCATTTGGTCAGGGCAATATTCGTG GCGTTTGCGCTCCGGAATCAGCAAACAACGCTGGTAGTCAAACATCTTTCATT CCACTGTTAACATTGGGCATTCCTCCAAACGCCGTAATGGCTCTCATGGTAGG CGCAATGACTATTCACAACATTCAACCAGGACCACAAGTGATGACATCTAACC CTGAACTATTTTGGGGTCTTATTGCAAGCATGTGGATTGGTAATTTGATGTTA ATTATTTTGAACCTACCACTTATCGGTGTGTGGATCAAGTTGCTTACAGTACC ATATCGTTGGTTGTTTCCATCTATCGTATTATTTTGTGCAATTGGTGTGTATG GTACTAATAACAACGTTTGGGATGTTTGGATGGTAGGTATTTTTGGTTTCATT GGTTATGTATTCCACAAGTTAGGGACTGAACCTGCTCCTTTGTTGTTGGGTTT CATTTTAGGTCCAATGATGGAAGAAAACCTTCGCCGTGCTCTATTGCTATCGC GTGGCGACTGGTCTGTATTTGTTACGCGTCCAATTAGTGCATGCTTACTGGCA GCGGCTGTTGTGCTTCTTGTAATCGTTCTTATGCCTGCAGTTAAGAATAAACG TGAAGAGGCCTTTGTAGAAGATtgaCTCGAGGACGAGGCGCATACatgGCTAA AATGAGAATATCACC

    [0100] Strain Construction:

    [0101] Chromosomal modifications were engineered in A. baylyi by natural transformation of recipient strains with linear DNA fragments. These DNA fragments were obtained by PCR or from restriction enzyme digestion of plasmids. To increase transformation efficiency, cells were grown in MMP instead of LB broth. To facilitate efficient homologous recombination, the transforming DNA carried 1-2 kbp of sequence that was identical to the chromosomal target on each side of the mutated region. A. baylyi mutants were selected on MMP plates with the appropriate antibiotic, or on YT+25% sucrose (10 g/L yeast extract, 20 g/L tryptone, 250 g/L sucrose, and 18 g/L agar) in the case of sacB counterselection. Genotypes were confirmed by colony PCR with MyTaq HS Red Mix (Bioline) and, in some cases, Sanger sequencing of localized regions. A brief description of the strains used in this study is provided in Table 3 and FIG. 7. Details on strain construction can be found in Table 8.

    TABLE-US-00008 TABLE 8 A. balylyi strains, isolates and lineages used in this study. ADP1-derived strains constructed during the stepwise integration of tph and tpi genes (see FIG. S1) and strains expressing tph genes from a single copy are IP101, IP103, IP115, IP130, and IP148. ADP1-derived strains expressing different alleles of the TPA-TTT from Comamonas sp. E6 are IP297, IP313, IP337, AND IP348. IP148-derived dcaS and mucK mutants are IP367, IP378, IP387, IP398, IP400, IP402, IP411, IP413, IP415, IP417, and IP419. ADP1-derived dcaS and mucK mutants are IP461, and IP492-IP499. IP148-derived Tpa.sup.+ isolates and lineages expressing tph genes from multiple copies are the remainder in the table starting with TPA_1. For the purpose of standardized nomenclature, tphA genes are numbered in subscript to differentiate them from mutated alleles. Identifier Relevant characteristics Construction details Strains ADP1 Wild type IP101 poBA:P.sub.tac:tphCA.sub.2:Km.sup.R:sacB P.sub.tac:tphCA.sub.2 with upstream targeting region was amplified from pIP021 with oIP096 + oIP145. Km.sup.R:sacB cassette was amplified from pCJ050 with oIP001 + oIP002. Downstream targeting region was amplified from pIP021 with oIP146 + oIP018. Fragments were assembled by SOE PCR and transformed into ADP1 for integration between pobA and hcaG loci. IP103 pobA:P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1 tphA.sub.2A.sub.3BA.sub.1 and downstream targeting region were amplified from pIP021 with oIP103 + oIP147 and oIP148 + oIP018. Fragments were assembled by SOE PCR and integrated into IP101. IP115 pobA:P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:tpiBA:ΩKm.sup.R TphA.sub.1:ΩKmR with downstream targeting region was amplified from pIP024 with oIP106 + oIP018 and integrated into IP103. IP130 pobA:P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:tpiBA:ΩKm.sup.R tpiBA:ΩKm.sup.R fragment with synthetic RBS sequences, flanked by targeting regions, was amplified from pIP032 with oIP106 + oIP108 and integrated into IP103. IP148 pobA:P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:P.sub.trc:tpiBA1481:tpiA1482 ΩKm.sup.R:p.sub.trc:tpiBA with synthetic RBS sequences, [tpiA1481 encodes TpiA(W366*); tpiA1482 encodes flanked by targeting regions arm, was amplified from TpiA(Δ1-370)]; rpoD148 [encodes RpoD(A87E)[ pIP041 with oIP106 + oIP018 and integrated into IP103. IP297 pobA:P.sub.tac:tphC:ΩKm.sup.R:P.sub.trc:tpiBA1481 P.sub.tac:tphC:ΩKm.sup.R:P.sub.trc:tpiBA1481 flanked by targeting regions was amplified from pIP075 with oIP018 + oIP096 and integrated into ADP1. IP313 pobA:P.sub.tac:tphC:ΩKm.sup.R:P.sub.trc:tpiBA P.sub.tac:tphC:ΩKm.sup.R:P.sub.trc:tpiBA flanked by targeting regions was excised from pIP073 with Pmel digestion and integrated into ADP1. IP337 pobA:P.sub.tac:tphC:ΩKm.sup.R:P.sub.trc:tpiBA1481:tpiA1482; A Sm.sup.R:sacB cassette, flanked by targeting regions, rpoD148 was excised from pIP089 with Smal + Sall and transformed into IP148 to replace tphA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R. The resulting strain was then transformed with a ΩKm.sup.R cassette flanked by targeting regions, amplified from pIP073 with oIP102 + oIP347, to replace SmR:sacB. IP348 pobA:P.sub.tac:tphC:ΩKm.sup.R:P.sub.trc:tpiBA1481:tpiA1482 P.sub.tac:tphC:ΩKm.sup.R:P.sub.trc:tpiBA.sup.W366*, flanked by targeting regions, was amplified from IP337 gDNA with oIP018 + oIP096 and integrated into ADP1. IP367 pobA:P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R:P.sub.trc:tpiBA1481:tpiA1482; Sm.sup.R:sacB cassette flanked by targeting regions for ΔmucK::Sm.sup.R:sacB; rpoD148 mucK replacement was excised from pIP103 with BamHI + EcoRV and integrated into IP148. IP378 pobA:P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R:P.sub.trc:tpiBA1481:tpiA1482; Sm.sup.R:sacB flanked by targeting regions for dcaS ΔdcaS; rpoD148 replacement was excised from pIP102 with BamHI + HindIII and integrated into IP148. The resulting strain was then transformed with fused upstream and downstream targeting regions, excised from pIP104 with BamHI + HindIII. IP387 pobA:P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R:P.sub.trc:tpiBA1481:tpiA1482; Sm.sup.R:sacB cassette flanked by targeting regions for ΔdcaS; ΔmucK::Sm.sup.R:sacB; rpoD148 mucK replacement was excised from pIP103 with BamHI + EcoRV and integrated into IP378. IP398 pobA:P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R:P.sub.trc:tpiBA1481:tpiA1482; mucK258 flanked by targeting regions was excised ΔmucK::mucK258 [encodes MucK(M34I E53G)]; rpoD148 from pIP105 with BamHI + EcoRV and integrated into IP367. IP400 pobA:P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R:P.sub.trc:tpiBA1481:tpiA1482; mucK243 flanked by targeting regions was excised ΔmucK::mucK243 [encodes MucK(M34L T342I)]; rpoD148 from pIP106 with BamHI + EcoRV and integrated into IP367. IP402 pobA:P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R:P.sub.trc:tpiBA1481:tpiA1482; mucK255 flanked by targeting regions was excised ΔmucK::mucK255 [encodes MucK(W150C I403T)]; rpoD148 from pIP107 with BamHI + EcoRV and integrated into IP367. IP411 pobA:P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R:P.sub.trc:tpiBA1481:tpiA1482; mucK246 flanked by targeting regions was excised ΔmucK::mucK246 [encodes MucK(Y133C)]; rpoD148 from pIP108 with BamHI + EcoRV and integrated into IP367. IP413 pobA:P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R:P.sub.trc:tpiBA1481:tpiA1482; mucK258 flanked by targeting regions was excised ΔdcaS; ΔmucK::mucK258; rpoD148 from pIP105 with BamHI + EcoRV and integrated into IP387. IP415 pobA:P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R:P.sub.trc:tpiBA1481:tpiA1482; mucK243 flanked by targeting regions was excised ΔdcaS; ΔmucK::mucK243; rpoD148 from pIP106 with BamHI + EcoRV and integrated into IP387. IP417 pobA:P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R:P.sub.trc:tpiBA1481:tpiA1482; mucK255 flanked by targeting regions was excised ΔdcaS; ΔmucK::mucK258; rpoD148 from pIP107 with BamHI + EcoRV and integrated into IP387. IP419 pobA:P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R:P.sub.trc:tpiBA1481:tpiA1482; mucK246 flanked by targeting regions was excised ΔdcaS; ΔmucK::mucK258; rpoD148 from pIP108 with BamHI + EcoRV and integrated into IP387. IP461 ΔdcaS Sm.sup.R:sacB flanked by targeting regions for dcaS replacement was excised from pIP102 with BamHI + HindIII and integrated into wild-type ADP1. The resulting strain was then transformed with fused upstream and downstream targeting regions, excised from pIP104 with BamHI + HindIII. IP492 ΔmucK::mucK258 Sm.sup.R:sacB flanked by targeting regions for mucK replacement was excised from pIP103 with BamHI + EcoRV and integrated into wild-type ADP1. The resulting strain was then transformed with mucK variant M34I E53G flanked by targeting regions, excised from pIP105 with BamHI + EcoRV. IP493 ΔmucK::mucK243 Sm.sup.R:sacB flanked by targeting regions for mucK replacement was excised from pIP103 with BamHI + EcoRV and integrated into wild-type ADP1. The resulting strain was then transformed with mucK variant M34L T342I flanked by targeting regions, excised from pIP106 with BamHI + EcoRV. IP494 ΔmucK::mucK255 Sm.sup.R:sacB flanked by targeting regions for mucK replacement was excised from pIP103 with BamHI + EcoRV and integrated into wild-type ADP1. The resulting strain was then transformed with mucK variant W150C I403T flanked by targeting regions, excised from pIP107 with BamHI + EcoRV. IP495 ΔmucK::mucK246 Sm.sup.R:sacB flanked by targeting regions for mucK replacement was excised from pIP103 with BamHI + EcoRV and integrated into wild-type ADP1. The resulting strain was then transformed with mucK variant Y133C flanked by targeting regions, excised from pIP108 with BamHI + EcoRV. IP496 ΔdcaS ΔmucK::mucK258 Sm.sup.R:sacB flanked by targeting regions for mucK replacement was excised from pIP103 with BamHI + EcoRV and integrated into IP461. The resulting strain was then transformed with mucK258 flanked by targeting regions, excised from pIP105 with BamHI + EcoRV. IP497 ΔdcaS ΔmucK::mucK243 Sm.sup.R:sacB flanked by targeting regions for mucK replacement was excised from pIP103 with BamHI + EcoRV and integrated into IP461. The resulting strain was then transformed with mucK243 flanked by targeting regions, excised from pIP106 with BamHI + EcoRV. IP498 ΔdcaS ΔmucK::mucK255 Sm.sup.R:sacB flanked by targeting regions for mucK replacement was excised from pIP103 with BamHI + EcoRV and integrated into IP461. The resulting strain was then transformed with mucK255 flanked by targeting regions, excised from pIP107 with BamHI + EcoRV. IP499 ΔdcaS ΔmucK::mucK246 Sm.sup.R:sacB flanked by targeting regions for mucK replacement was excised from pIP103 with BamHI + EcoRV and integrated into IP461. The resulting strain was then transformed with mucK246 flanked by targeting regions, excised from pIP108 with BamHI + EcoRV. Tpa+ isolates and ALE lineages with (multiple copies of tph genes) TPA_1 pobA:[P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R].sub.n; IP148 transformed with SBF. Tpa.sup.+ isolate 1. P.sub.trc:tpiBA1481:tpiA1482; rpoD148 TPA_2 pobA:[P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R].sub.n; IP148 transformed with SBF. Tpa.sup.+ isolate 2. P.sub.trc:tpiBA1481:tpiA1482; rpoD148 TPA_3 pobA:[P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R].sub.n; IP148 transformed with SBF. Tpa.sup.+ isolate 3. P.sub.trc:tpiBA1481:tpiA1482; rpoD148 TPA_4 pobA:[P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R].sub.n; IP148 transformed with SBF. Tpa.sup.+ isolate 4. P.sub.trc:tpiBA1481:tpiA1482; rpoD148 IP243 pobA:[P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R].sub.n; Evolved isolate from lineage TPA_1.6. See P.sub.trc:tpiBA1481:tpiA1482; dcaS243 [encodes supplementary Excel file for complete genotype. DcaS(V101G)]; mucK243; rpoD148 IP246 pobA:[P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R].sub.n; Evolved isolate from population TPA_1.7. See P.sub.trc:tpiBA1481:tpiA1482; dcaS246 [encodes supplementary Excel file for complete genotype. DcaS(V101G A134E)]; mucK243 IP247 pobA:[P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R].sub.n; Evolved isolate from population TPA_2.6. See P.sub.trc:tpiBA1481:tpiA1482; gudP247 [encodes supplementary Excel file for complete genotype. GudP(R289C)]; gud-247 (ACIAD_RS00620 encodes FadR-family transcription regulator potentially lacking residues 152-237); rpoD148 IP250 pobA:[P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R].sub.n; Evolved isolate from population TPA_2.7. See P.sub.trc:tpiBA1481:tpiA1482; gudP250 [encodes R447L)]; supplementary Excel file for complete genotype. gud-247; rpoD148 IP251 pobA:[P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R].sub.n; Evolved isolate from population TPA_3.6. See P.sub.trc:tpiBA1481:tpiA1482; ~60 kpb amplicon from supplementary Excel file for complete genotype. ACIAD_RS07670 to ACIAD_RS07925; rpoD148 IP254 pobA:[P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R].sub.n; Evolved isolate from population TPA_3.7. See P.sub.trc:tpiBA1481:tpiA1482; ~60 kpb amplicon from supplementary Excel file for complete genotype. ACIAD_RS07670 to ACIAD_RS07925; rpoD148 IP255 pobA:[P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R].sub.n; Evolved isolate from population TPA_4.6. See P.sub.trc:tpiBA1481:tpiA1482; dcaS255 [encodes supplementary Excel file for complete genotype. DcaS(Δ169-282)]; mucK255; rpoD148 IP258 pobA:[P.sub.tac:tphCA.sub.2A.sub.3BA.sub.1:ΩKm.sup.R].sub.n; Evolved isolate from population TPA_4.7. See P.sub.trc:tpiBA1481:tpiA1482; dcaS255; mucK25; supplementary Excel file for complete genotype. rpoD148

    [0102] Chromosomal Gene Amplification and Adaptive Laboratory Evolution by EASy:

    [0103] Chromosomal amplification was achieved by natural transformation of IP148 with a synthetic bridging fragment (SBF) and selecting on high-Km. The SBF defines the chromosomal region to be amplified and promotes duplication and further amplification through homologous recombination. For the construction of a SBF, the first and last ˜1000 bp of the synthetic P.sub.tac:tphCA2A3BA1:Δ Km.sup.R cassette were amplified by PCR and fused tail-to-head by overlap extension PCR. The resulting ˜2 kbp SBF was transformed into strain IP148 and mutants with increased gene copy number were selected on MMP plates supplemented with 1 mg/mL Km. Growth on high-Km is presumably due to multiple copies of the Km.sup.R gene, resulting from the chromosomal amplification of a region encompassing it. This region (the amplicon) also encompasses the genes needed for TPA consumption. Individual colonies confirmed by colony PCR to have integrated the SBF were re-streaked on a new high-Km plate and grown at 30° C. By scraping cells from the high-Km plate and streaking on a MM plate with 5 mM TPA as the carbon source (and no antibiotic pressure), selection for optimal copy number of the tandemly arrayed amplicon is altered, and changes in gene dosage can thereby enable the new phenotype, i.e. growth on TPA (Tpa.sup.+). In this fashion, four Tpa.sup.+ colony isolates, designated TPA_1 to TPA_4, were selected and confirmed to contain the SBF by colony PCR.

    [0104] After growth on a second TPA plate, each isolate was used in adaptive laboratory evolution (ALE) conducted by serial transfer in MM with 5 or 10 mM TPA as the carbon source. Each isolate was evolved at pH 6 and pH 7 in parallel (8 lineages in total). Two-mL cultures (in 13 mm test tubes) were grown at 30° C. with shaking (225 rpm). When cultures reached stationary phase, cells were diluted 100 or 200-fold in 2 mL of fresh medium. Weekly, glycerol stocks were prepared, and genomic DNA from each culture was extracted with the Quick-DNA Miniprep Plus kit (Zymo Research) for quantitation of the average gene copy number.

    [0105] Gene Copy Number Analysis by Quantitative PCR:

    [0106] Quantitative PCR (qPCR) was carried out using 6FAM-MGBNFQ labelled TaqMan probes and TaqMan Gene Expression Master Mix (Thermo Scientific) in a Bio-Rad CFX96 thermocycler. Primer and probe sequences are provided in Table 9. To evaluate changes in amplicon copy number during ALE, relative amounts of the Km.sup.R gene were calculated with respect to rpoA, as previously described. For spontaneous amplification mutants not obtained by transformation with the SBF, primers and a probe specific for the synthetic tphA.sub.2 gene were used. All reactions were carried out with four technical replicates per genomic DNA sample, with single-copy parent strain IP148 included as control.

    TABLE-US-00009 TABLE 9 Sequences for primers and probes used for quantitative PCR (qPCR). Oligo ID Sequence Description oIP082 gctcgacgccttctatttcaa rpoA qPCR forward primer oIP083 tttacgtcgcattctattgtcttctt rpoA qPCR reverse primer qIP004 tcaaccacagcagcgccaggc rpoA 6FAM-MGBNFQ qPCR probe oIP141 gcgttggctacccgtgata Km.sup.R qPCR forward primer oIP142 ggaagcggtcagcccatt Km.sup.R qPCR reverse primer qiP005 tgaagagcttggcggc Km.sup.R 6FAM-MGBNFQ qPCR probe oIP456 tggacctgctggattcatttc tphA.sub.2 qPCR forward primer oIP457 tcaccgcccatttcgattac tphA.sub.2 qPCR reverse primer qIP006 ctgcaataccacgctgcacgaaac tphA.sub.2 6FAM-MGBNFQ qPCR probe oIP484 attcggccatgagggtattg muck qPCR forward primer oIP485 ccttggattgactcagagcttta muck qPCR reverse primer qIP007 acctaaaccgagtgaagcgaagaaacg muck 6FAM-MGBNFQ qPCR probe

    [0107] Whole-Genome Sequencing and Variant Analysis:

    [0108] After ˜750 generations of ALE, cells from each individual lineage were diluted 10.sup.7-fold and 100 μL plated on MM agar with 5 mM TPA. Two individual colonies from each lineage were selected and the amplicon copy number verified by qPCR. The clone with the lowest copy number from each linage was selected for whole-genome sequencing and phenotypic characterization. Approximately 1 μg of genomic DNA was fragmented by sonication to an average size of 300-500 bp. End repair, A-tailing, and adapter ligation reactions were performed on the fragmented DNA using the NEBNext Ultra II kit (New England Biolabs). Illumina paired-end sequencing was performed on a NextSeq500 device at the Georgia Genomics Facility (University of Georgia). Sequence analysis and variant calling (minimal frequency set at 0.25) was performed with Geneious Prime software against the theoretical genome sequence of IP148 parent strain and a modified sequence presenting two copies of the amplicon. The wild-type ADP1 genome sequence (National Center for Biotechnology Information accession number NC_005966) was used as reference.

    [0109] Evaluation of Growth and TPA Consumption by Cultures Grown in Microtiter Plates and Shake-Flasks:

    [0110] To evaluate growth of A. baylyi mutants, cultures in microtiter plates were analyzed with a Bioscreen C MBR plate-reader (Growth Curves USA). Cells for inoculation were grown overnight in MMP at 30° C. and 225 rpm. After collection by centrifugation, cells were washed with MM (no carbon source) and added to 300 μL media to an OD.sub.600 of 0.05 (per well). Cells were incubated at 30° C. with shaking and OD.sub.420-580 measured at 15-minute intervals.

    [0111] For shake-flask cultures, cells for inoculation were grown overnight in MMP (A. baylyi) or LB broth (Comamonas sp. E6 and R. jostii RHA1) at 30° C. and 225 rpm. After collection by centrifugation, cells were washed with MM (no carbon source). For wild-type ADP1 and single-copy mutants, cells were inoculated to an OD.sub.600 of 0.02 in 25 mL MMP supplemented with 5 mM TPA (pH 6 and 7) in 125-mL flasks. For Tpa.sup.+ A. baylyi mutants, Comamonas sp. E6, and R. jostii RHA1, cells were inoculated to an OD.sub.600 of 0.02 in 50 mL MM with 10 mM TPA (pH 6 or 7) in 250-mL flasks. In all cases, cells were grown at 30° C., 225 rpm, and sampled regularly by removing 1 mL aliquots for OD.sub.600 measurements and HPLC analysis. Standard curves were made to correlate cell dry weight to OD.sub.600 for strains A. baylyi IP148, Comamonas sp. E6, and R. jostii RHA1.

    [0112] HPLC Analysis:

    [0113] HPLC analysis of samples was performed on an Agilent 1260 LC system (Agilent Technologies) equipped with a G7117C diode array detector (DAD). All samples and standards were injected at a volume of 10 μL onto a Phenomenex Luna C18(2), 5 μm, 4.6×150 mm column. The column temperature was maintained at 30° C. and the buffers used to separate the analytes of interest were (A) 20 mM phosphate buffer in water and (B) methanol. The separation was carried out using a gradient program of: (A)=80% and (B)=20% at time t=0; (A)=35% and (B)=65% at time t=15 min; and (A)=80% and (B)=20% at t=15.01 min through 20 min. The flow rate was held constant at 0.6 mL/min for a total run time of 20 min. DAD wavelength of 240 nm was used for analysis of TPA while pyruvic acid signal was collected at 210 nm. Calibration curve concentration for each analyte varied between the ranges of 0.1-2500 μg/L. A minimum of 5-6 calibration levels was used with an R.sup.2 coefficient of 0.995 or better for each analyte. A check calibration standard was analyzed every 10-20 samples to ensure the integrity of the initial calibration.

    [0114] Transformation of Biosensor Plasmid Libraries into A. baylyi:

    [0115] For the transformation of biosensor plasmid libraries, the natural transformation protocol was used, with slight modifications. A. baylyi cultures were started from glycerol stocks in 1 mL MMP and grown overnight at 30° C. under constant shaking. A small volume of the overnight culture (70 μL) was then added to 1 mL fresh MMP and mixed with ˜100 ng of plasmid DNA. The cells were incubated at 30° C. under constant shaking for 2-6 h, spun down at 5000 rpm for 3 minutes in a tabletop centrifuge at ambient temperature, and the concentrated pellet plated on MMP+Sm. In order to cover a large library diversity, overnight cells were concentrated 10-fold. Then, 70 μL of the concentrated cells were mixed with up to 300 ng of plasmid DNA in 1 mL MMP and incubated as described above. Multiple parallel transformations were carried out for larger libraries. Plates were incubated overnight at 30° C. Colonies from plates were then scraped and resuspended in 2 mL of liquid media, rotated gently for 15 minutes for homogeneity, and subsequently saved as glycerol stocks.

    [0116] Flow Cytometry and Cell Sorting:

    [0117] A. baylyi mutants transformed with biosensor plasmid libraries were pooled by scraping from plates and diluted to an OD.sub.600 of ˜0.05. After growth for 2-4 hours, TPA was added at various concentrations (in the range of 0-3 mM) to induce expression of the sfGFP gene. The cultures were grown overnight at 30° C. and analyzed by fluorescence-activated cell sorting (FACS) on a FACSAria III flow cytometer (BD Biosciences), using the standard settings for GFP fluorescence (488 nm excitation laser and 530/30 nm bandpass emission filter). The cells were gated based on forward and side light scatter (FSC/SSC). Based on the theoretical diversity of the libraries, two to three rounds of sorting were performed. These rounds consisted of positive (top 1-3% fluorescent cells from an induced population) and negative (bottom 50-80% low fluorescent cells from an uninduced population) cell sorting. In any round of sorting, 25-50 thousand cells were collected. Finally, the sorted cells were grown on MMP+Sm plates and colonies picked for individual clone verification.

    [0118] Individual colonies were inoculated into 600 μL of MMP in a 96 deep-well v-bottom plate (Agilent) and grown for 6 hours at 30° C. and 1000 rpm in a deep-well maximizer shaker (Taitec Bioshaker MBR-022UP). The cultures were then split into replicate wells, after which one of the two sets was provided with 0.3 mM TPA to induce expression of the sfGFP gene. After overnight growth, cells were diluted 20- to 50-fold in phosphate buffer saline (PBS) and analyzed on an Accuri C6 flow cytometer (BD Biosciences) under the standard settings for GFP measurements (excitation 488 nm and emission 533/30 nm). The cells were gated based on FSC/SSC, and the clones with the highest contrast ratios (induced/uninduced fluorescence response) were selected for further evaluation.

    [0119] Dose Response and Specificity Testing of the TPA Sensor:

    [0120] A. baylyi mutants were transformed with selected plasmids and grown on MMP+Sm plates. Three colonies were picked and grown overnight as seed cultures. These cultures were diluted 50-fold into 10 mL MMP+Sm and grown for 2-4 h in a 50-mL conical tube to an OD.sub.600 of ˜0.6. The culture was then split into triplicate wells in a 96 deep-well v-bottom plate. Into each well (containing 270 μL of culture), 30 μL of 10× stock solutions of possible inducers of sfGFP gene expression were added (in the range of 0-100 mM for each). Cultures were grown overnight and analyzed using an Accuri C6 flow cytometer (BD Biosciences), following the protocol described above.

    [0121] Evaluation of TPA Transport in A. baylyi with the TPA Sensor:

    [0122] A. baylyi mutants were naturally transformed with plasmids encoding the TPA biosensors. After selection on MMP+Sm plates, transformants were grown overnight in the same medium at 30° C. with shaking, collected by centrifugation, and washed with MM. Cells were then used to inoculate, to an OD.sub.600 of 0.05, 200 μL of medium per well of 96-well black, clear flat-bottom plates (Corning). Cultures contained MMP+Sm with varied concentrations of TPA. Plates were incubated at 30° C. with shaking in an Infinite®F500 Tecan plate reader for 24 hours. The OD.sub.600 and fluorescence at 520 nm (excitation at 488 nm) were measured at 15-minute intervals. The gain used for fluorescence reads was adjusted manually.

    [0123] Gene Expression Analysis by Reverse Transcriptase-Quantitative PCR (RT-qPCR):

    [0124] Wild-type ADP1 and Δ dcaS mutant IP461 were grown overnight in MMP at 30° C., 225 rpm. Cells were harvested by centrifugation, washed with MM, and inoculated in triplicate to an OD.sub.600 of 0.1 in 25 mL MM with either 20 mM pyruvate, 5 mM muconate, or 5 mM PCA as the carbon source, in 125-mL flasks. Cells were grown at 30° C., 225 rpm, to an OD.sub.600 of ˜0.6, after which cells were harvested by centrifugation, flash-frozen in liquid nitrogen, and stored at −80° C. For RNA extraction, cells were lysed by bead-beating and RNA purified with a QIAGEN RNeasy Mini kit. Genomic DNA was digested with a TURBO DNA-free kit (Thermo Scientific) and cDNA was synthesized with iScript Reverse Transcription Supermix using random primers (Bio-Rad). qPCR was performed in triplicate for each biological sample with 6FAM-MGBNFQ labelled TaqMan probes and TaqMan Gene Expression Master Mix (Thermo Scientific). Primer and probe sequences are provided in Table 9. Expression of mucK relative to rpoA was calculated using the 2.sup.−ΔΔCt method.

    [0125] The foregoing discussion and examples have been presented for purposes of illustration and description. The foregoing is not intended to limit the aspects, embodiments, or configurations to the form or forms disclosed herein. In the foregoing Detailed Description for example, various features of the aspects, embodiments, or configurations are grouped together in one or more embodiments, configurations, or aspects for the purpose of streamlining the disclosure. The features of the aspects, embodiments, or configurations, may be combined in alternate aspects, embodiments, or configurations other than those discussed above. This method of disclosure is not to be interpreted as reflecting an intention that the aspects, embodiments, or configurations require more features than are expressly recited in each claim. Rather, as the following claims reflect, inventive aspects lie in less than all features of a single foregoing disclosed embodiment, configuration, or aspect. While certain aspects of conventional technology have been discussed to facilitate disclosure of some embodiments of the present invention, the Applicants in no way disclaim these technical aspects, and it is contemplated that the claimed invention may encompass one or more of the conventional technical aspects discussed herein. Thus, the following claims are hereby incorporated into this Detailed Description, with each claim standing on its own as a separate aspect, embodiment, or configuration.