APPLICATION OF PCSK9 INHIBITORS IN THE PREPARATION OF DRUGS FOR THE TREATMENT OF INFLAMMATORY AND IMMUNE DISEASES

20220073647 · 2022-03-10

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention belongs to the biopharmaceutical. It involves the role and mechanism of PCSK9 in inflammatory immune diseases, and the application of PCSK9 inhibitors to the preparation of drugs for the treatment of inflammatory immune diseases mediated by T cells. In particular, it involves the use of PCSK9 monoclonal antibody, PCSK9 interference RNA and PCSK9 small molecule inhibitors for treating psoriasis, atopic dermatitis, or urticaria. The invention uses psoriasis as an embodiment for the study of inflammatory and immune diseases. It is found that PCSK9 plays an important role in the treatment of inflammatory immune diseases. The PCSK9 monoclonal antibody, PCSK9 interference RNA, and PCSK9 small molecule inhibitor can be further developed for treating inflammatory immune-diseases, such as psoriasis with fewer adverse reactions, at low cost, and with good efficacy.

    Claims

    1. A method of treating an inflammatory immune disease by administration of a therapeutically effective amount of a proprotein convertase subtilisin kexin 9 (PCSK9) inhibitor selected from the group consisting of PCSK9 monoclonal antibodies, PCSK9 small molecule interfering RNAs, and a PCSK9 vaccine, and the inflammatory immune disease is selected from the group consisting of psoriasis, psoriatic arthritis, eczema, atopic dermatitis, urticaria, glucocorticoid dependent dermatitis, rheumatoid arthritis, scleroderma, diabetes, chronic liver disease, and lymphoma.

    2. The method of claim 1, wherein the PCSK9 inhibitor is one or more of the PCSK9 monoclonal antibodies.

    3. The method of claim 2, wherein the inflammatory immune disease is psoriasis, atopic dermatitis or urticaria, and the PCSK9 inhibitor is topically, systemically or subcutaneously administered.

    4. The method of claim 3, wherein the inflammatory immune disease is psoriasis.

    5. The method of claim 3, wherein the PCSK9 inhibitor is administered once per day.

    6. The method of claim 2, wherein the PCSK9 inhibitor is topically administered.

    7. The method of claim 5, wherein the PCSK9 monoclonal antibodies are administered as an ointment in a concentration of 0.001-0.05%.

    8. The method of claim 1, wherein the PCSK9 inhibitor is one or more of the small molecule interference RNAs.

    9. The method of claim 8, wherein the one or more small molecule interference RNAs significantly inhibit abnormal proliferation of human keratinocytes and promote their apoptosis through an NFkb pathway.

    10. The method of claim 8, wherein the inflammatory immune disease is selected from the group consisting of psoriasis, psoriatic arthritis, eczema, atopic dermatitis, urticaria, glucocorticoid dependent dermatitis, and scleroderma.

    11. The method of claim 10, wherein the therapeutically effective amount of the PCSK9 inhibitor is administered topically.

    12. The method of claim 11, wherein the PCSK9 inhibitor is administered as a cream or ointment containing the PCSK9 inhibitor in a concentration of 0.001-0.05%.

    13. The method of claim 11, wherein the PCSK9 inhibitor is administered once per day.

    14. The method of claim 8, wherein the therapeutically effective amount of the PCSK9 inhibitor is administered subcutaneously.

    15. The method of claim 14, wherein the PCSK9 inhibitor is administered at a concentration of 8 mg/kg or in a dose of 5 mg.

    16. The method of claim 8, wherein the PCSK9 inhibitor is administered subcutaneously, topically or systemically.

    17. The method of claim 16, wherein the PCSK9 inhibitor is administered (i) topically as a cream or ointment containing the PCSK9 inhibitor in a concentration of 0.001-0.05% or (ii) subcutaneously at a concentration of 8 mg/kg or in a dose of 5 mg.

    18. The method of claim 1, wherein the PCSK9 inhibitor is a PCSK9 vaccine.

    19. The method of claim 18, wherein the therapeutically effective amount of the PCSK9 inhibitor is administered subcutaneously.

    Description

    III. BRIEF DESCRIPTION OF THE DRAWINGS

    [0011] FIG. 1: Mild skin inflammation was observed in IMQ treatment region of PCSK9 knockout mice. After 5 days of continuous coating, marked erythema, thickening of scales and lesions were observed and measured in the coating area of at the back of C57BL/6 mice. In PCSK9 knockout mice, there were only slight erythema, thickening of scales and lesions.

    [0012] FIG. 2: The score of skin inflammation (erythema+scale+infiltration) in PCSK9 knockout mice were significantly lower than that in control group (P<0.05). A daily score was given on the skin lesions of the drug-coated area on the back of the mice, the erythema, scale, lesion thickening and total score of C57BL/6 mice were significantly higher than those of PCSK9 gene knockout mice (P<0.05).

    [0013] FIG. 3: The histopathological changes of skin in the IMQ treatment region of PCSK9 knockout mice were closer to normal. After 5 days' coating, the skin tissue (treated and non-treated) of mice back were stained with HE. The skin of IMQ treatment area of C57BL/6 mice showed typical psoriasis pathological changes, such as skin thickening, dermatoid lengthening, thickening of spinous layer, hyperkeratosis with incomplete keratosis, Kogoj abscess and Munro abscess. However, the skin of PCSK9 gene knockout mice showed mild epidermis thickening and hyperkeratosis, no extension of dermatoid, thickening of spinous layer, hyperkeratosis with incomplete keratosis, and typical psoriatic pathological changes, such as Kogoj abscess and Munro abscess. The untreated skin of both groups showed normal skin structure.

    [0014] FIG. 4: Immunofluorescence assay showed: Compared with PCSK9 knockout mice, the expression of PCSK9 in the control group was upregulated in the skin of the inflammatory area. The expression of PCSK9 in IMQ treated area of C57BL/6 mice was significantly higher than that in untreated area. However, there was no PCSK9 expression in the skin of IMQ treated and untreated regions of PCSK9 knockout mice.

    [0015] FIG. 5: The expression of NF-kB in the skin of PCSK9 knockout mice was significantly lower than that of the control group. The expression of NF-kB in the skin of C57BL/6 mice and PCSK9 knockout mice was significantly higher than that of the untreated regions in the skin of C57BL/6 mice and PCSK9 knockout mice respectively. However, the expression of NF-kB in the skin of PCSK9 knockout mice was significantly lower than that of C57BL/6 mice.

    [0016] FIG. 6: si-PCSK9 transfection significantly inhibited cell viability of human keratinocytes. The survival number of primary keratinocytes transfected with si-PCSK9 was significantly lower than that of si-Con transfection (P<0.001).

    [0017] FIG. 7: si-PCSK9 transfection significantly promoted apoptosis and inhibited the proliferation of human keratinocytes. The apoptosis of primary keratinocytes transfected with si-PCSK9 increased significantly (P<0.05), while proliferating (the proportion of S+G2/M phase cells) decreased significantly (P<0.05).

    [0018] FIG. 8: Immunohistochemically staining showed that the expression of PCSK9 in psoriatic lesions was significantly higher than that in psoriatic non-lesions and normal controls. PCSK9 positive expression cells were mainly distributed in epidermis, and dermis near the epidermis, but not in dermis vessels.

    [0019] FIG. 9: The results of Q-PCR (quantative PCR) showed that the expression of PCSK9 in psoriatic lesions (PP) group was significantly higher than that in psoriatic non-lesion (PN) group and normal control (NN) group (P<0.001).

    [0020] FIG. 10: The expression of PCSK9 in peripheral blood of patients with psoriasis, eczema and urticaria was significantly higher than that of normal controls (P<0.05).

    [0021] FIG. 11: PCSK9 protein can significantly promote the secretion of IL-17, IL-2 and IFN-Gamma (P<0.01) by CD4 T cells isolated from peripheral blood of patients with psoriasis, eczema and urticaria.

    [0022] FIG. 12: Subcutaneous injection of PCSK9 small molecule inhibitor and PCSK9 monoclonal antibody can reduce the score of erythema, scale and infiltration induced by IMQ in mice skin (P<0.01).

    [0023] FIG. 13: External use of PCSK9 small molecule inhibitors and PCSK9 monoclonal antibodies can significantly reduce the score of skin erythema, scale, and infiltration of IMQ induced mice. The efficacy of PCSK9 small molecule inhibitor is better than that of PCSK9 monoclonal antibody (P<0.01).

    [0024] FIG. 14: Compared with control siRNA(siCon), siPCSK9 could significantly reduce the expression of PCSK9 in mouse skin one day after the application, and the inhibition rate was more than 80%.

    [0025] FIG. 15: siPCSK9 can inhibit the expression of NF kappa B, IL-17, IL-22, IL-23 and other inflammatory factors after a day of skin treatment.

    [0026] FIG. 16: After induction of IMQ, the skin psoriasis lesion, erythema, scale and infiltration score of mice treated with siPCSK9 were significantly lower than those of the control group (P<0.01).

    [0027] FIG. 17: On days 2-6 after induction of IMQ, compared with the control group, the skin erythema, scales and infiltration of BALB mice induced by IMQ were significantly inhibited by siPCSK9.

    IV. DETAILED DESCRIPTION OF THE INVENTION

    Technical Issues

    [0028] The problems to be solved in the present invention: the role and mechanism of PCSK9 in the treatment of inflammatory immune diseases and the application of PCSK9 inhibitors in the preparation of drugs for the treatment of inflammatory immune diseases. The invention uses psoriasis as an example for the study of inflammatory immune diseases, and finds that PCSK9 plays an important role in the treatment of a variety of inflammatory immune diseases.

    Technical Solution

    [0029] We first found that PCSK9 plays an important role in the treatment of a variety of inflammatory immune diseases. We used PCSK9 knockout transgenic mice to establish psoriatic like inflammatory model induced by imiquimod, which proves that inhibition of PCSK9 has a very obvious therapeutic effect on psoriatic inflammatory lesions. A study on the mechanism of inhibiting PCSK9 in the treatment of inflammatory immune diseases by cultured human keratinocytes found that knock-down of PCSK9 expression by siRNA could significantly inhibit the abnormal proliferation of keratinocyte and promote its apoptosis through NFkb pathway.

    [0030] To further confirm the role of PCSK9 in the pathogenesis of psoriasis, the invention collected lesions and non-lesions from 30 psoriasis patients, and skin samples from 30 normal human subjects. The immunohistochemistry results showed: the expression of PCSK9 in psoriatic lesions was significantly higher than that in non-lesions and normal controls (p<0.05). PCSK9 positive cells were mainly distributed in epidermis and dermis near the epidermis, but not in dermis vessels. Detected by real-time fluorescence quantitative nucleic acid amplification detection system (Q-PCR), it was found that the expression of PCSK9 was found in the skin of both patients and normal subjects, but it was significantly higher in the psoriasis patients than in the normal controls (P<0.01). No expression of PCSK9 was found in the peripheral blood mononuclear cells (PBMC) of patients with psoriasis, eczema, and urticaria and the control group by Q-PCR. However, the expression of PCSK9 in blood in patients with psoriasis, eczema and urticaria was significantly higher than that in the control group by ELISA (P<0.05).

    [0031] Next, we isolated CD4 T cells from peripheral blood of patients with active psoriasis, eczema and urticaria and found PCSK9 protein could significantly promote the secretion of IL-17, IL-2 and IFN-Gamma by CD4 T cells, and increased the expression of NFkb, especially in psoriatic patients.

    [0032] In all PCSK9 inhibitors, representative monoclonal antibodies, small interfering RNA and small molecular inhibitors were selected herein. Treated psoriasis-like mice model by subcutaneous injection (the dose is the same as the known LDL cholesterol experiment) in comparison with control group. The results showed that the therapeutic effect of PCSK9 monoclonal antibody group and PCSK9 small molecule inhibitor group was significantly better than that of control group. There were no obvious adverse reactions in PCSK9 monoclonal antibody group and PCSK9 small molecule inhibitor group. The results showed that the systemic use of PCSK9 small molecule inhibitors and PCSK9 monoclonal antibodies had obvious therapeutic effects on psoriasis-like inflammation and the therapeutic effect was significantly better than that of the control group.

    [0033] In some embodiments, representative PCSK9 small molecule inhibitors and PCSK9 monoclonal antibodies were prepared for use as an external ointment (drug concentration 0.001-0.05%) and applied to IMQ induced inflammatory psoriasis like lesions in mice once a day in comparison with external ointment without drugs as controls. The results showed that the efficacy of PCSK9 monoclonal antibody group and PCSK9 small molecule inhibitor group was significantly better than that of control group. The effect of PCSK9 small molecule inhibitor group was better than that of PCSK9 monoclonal antibody group, and there was no obvious adverse reaction in each group. It was proved that topical use of PCSK9 small molecule inhibitor and PCSK9 monoclonal antibody had obvious therapeutic effect on psoriasis-like inflammation and their efficacy was better than that of control group.

    [0034] In some embodiments, representative PCSK9 small molecule interference RNA (siPCSK9) was applied to IMQ induced psoriasis like inflammatory lesions in mice, once a day. Compared with the control group, the lesions of the siPCSK9 group were improved obviously, and no obvious adverse reaction was found.

    [0035] For the first time, it was found that: 1. Both systemic and topical use of PCSK9 monoclonal antibody, PCSK9 small molecule inhibitor, and siPCSK9 have therapeutic effects on psoriatic lesions, which are significantly superior to those of the control group. In some embodiments, the invention relates to the treatment of psoriatic lesion by a PCSK9 inhibitor selected from the group consisting of representative PCSK9 monoclonal antibody, PCSK9 small molecule inhibitor and siPCSK9.

    [0036] Because of its high inhibiting efficiency, selectivity and good efficacy, monoclonal antibody has been widely used in the research of new drugs. Our study also found that, small molecular inhibitors and small interfering RNA aimed at PCSK9 were more effective than monoclonal antibodies in the treatment of psoriasis-like inflammation. Generally, monoclonal antibodies have fewer side effects than small molecular inhibitors, and are more stable than small interfering RNA preparations. However, according to our data, small molecular PCSK9 inhibitors and siPCSK9 not only have a good efficacy in the treatment of psoriasis like inflammation, but also have mild side effects.

    [0037] It is well known to one skilled in this field that, based on the above mechanism of PCSK9, PCSK9 inhibitors have therapeutic effect on other T cell mediated chronic immune diseases. These include, but are not limited to, psoriasis, psoriatic arthritis, eczema (atopic dermatitis), urticaria, glucocorticoid dependent dermatitis, rheumatoid arthritis, scleroderma, diabetes, chronic liver disease and lymphoma, etc. In some embodiments, the invention relates to the treatment of a T-cell medicated chronic immune disease, wherein the T-cell medicated chronic immune disease is selected from psoriasis, psoriatic arthritis, eczema (atopic dermatitis), urticaria, glucocorticoid dependent dermatitis, rheumatoid arthritis, scleroderma, diabetes, chronic liver disease, and lymphoma; wherein the PCSK9 inhibitor is a PCSK9 small molecule inhibitor, a PCSK9 monoclonal antibody or a siPCSK9; wherein the PCSK9 inhibitor can be used alone or in combination with other therapeutic agents, including traditional drugs and other new biological agents.

    [0038] In some embodiments, PCSK9 inhibitor comprising the PCSK9 monoclonal antibody, PCSK9 small molecule interfered RNA and PCSK9 small molecule inhibitors are used for treating psoriasis, atopic dermatitis or urticaria. In some embodiment, the PCSK9 inhibitor was applied topically on the skin.

    [0039] In an embodiment, the invention relates to a method of treating psoriasis by topical use of a PCSK9 inhibitor, wherein the PCSK9 inhibitor is selected from the group consisting of a PCSK9 monoclonal antibody, a siPCSK9 and a PCSK9 small molecule inhibitor. In an embodiment, the PCSK9 inhibitor is a PCSK9 vaccine.

    [0040] In an embodiment, the inhibition of PCSK9 expression by siPCSK9 can significantly inhibit the abnormal proliferation of human keratinocytes and promote their apoptosis through NFkb pathway. In an embodiment, the invention relates to a method of treating keratinocytes by the use of siPCSK9.

    [0041] In an embodiment, the PCSK9 small molecule inhibitor is selected from the group consisting of

    ##STR00001## ##STR00002##

    [0042] In an embodiment, the PCSK9 small molecule inhibitor is selected from the compounds listed in Table 1. The patent application number cited in Table 1 are incorporated by reference in their entirety.

    TABLE-US-00001 TABLE 1 Compound No. Structural formula CAS patent application No. 1 [00003]embedded image 1632250- 49-7 WO2014170786 CN105143203 2 [00004]embedded image 1629166- 02-4 US20150376139 WO2016107603 WO2016107602 WO2014150395 3 [00005]embedded image SBC115076 US2014022957 CN105228616 4 [00006]embedded image 1962177- 03-2 WO2016107603 5 [00007]embedded image 1000339- 97-8 WO2017034997 6 [00008]embedded image 7 [00009]embedded image 2087490- 99-9 WO2017034994 8 [00010]embedded image 2087440- 16-0 WO2017034990 WO2017034994 9 [00011]embedded image 423148- 46-3 WO2017222953 10 [00012]embedded image 130305- 64-5 EP372776

    [0043] In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody selected from the group consisting of Alirocumab, Evolocumab, Bococizumab, DS-001, CA-001, MS-001, LY3015014, NS-001, and antigen binding fragments, variants, conjugates or biosimilars thereof.

    [0044] In an embodiment, the PCSK9 inhibitor is Alirocumab or antigen binding fragments, variants, conjugates or biosimilars thereof. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising SEQ ID NO:1 and SEQ ID NO:2. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 99% identical to SEQ ID NO:1 and SEQ ID NO:2. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 95% identical to SEQ ID NO:1 and SEQ ID NO:2. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 90% identical to SEQ ID NO:1 and SEQ ID NO:2.

    [0045] In an embodiment, the PCSK9 inhibitor is Evolocumab or antigen binding fragments, variants, conjugates or biosimilars thereof. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 99% identical to SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 95% identical to SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 90% identical to SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6.

    [0046] In an embodiment, the PCSK9 inhibitor is Bococizumab or antigen binding fragments, variants, conjugates or biosimilars thereof. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, and SEQ ID NO:15. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 99% identical to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, and SEQ ID NO:15. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 95% identical to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, and SEQ ID NO:15. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 90% identical to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, and SEQ ID NO:15.

    [0047] In an embodiment, the PCSK9 inhibitor is DS-001 or antigen binding fragments, variants, conjugates or biosimilars thereof. In an embodiment, DS-001 is a PCSK9 antibody comprising SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, and SEQ ID NO:19. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 99% identical to SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, and SEQ ID NO:19. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 95% identical to SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, and SEQ ID NO:19. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 90% identical to SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, and SEQ ID NO:19.

    [0048] In an embodiment, the PCSK9 inhibitor is CA-001 or antigen binding fragments, variants, conjugates or biosimilars thereof. In an embodiment, CA-001 is a PCSK9 antibody comprising SEQ ID NO:20, and SEQ ID NO:21. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 99% identical to SEQ ID NO:20, and SEQ ID NO:21. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 95% identical to SEQ ID NO:20, and SEQ ID NO:21. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 90% identical to SEQ ID NO:20, and SEQ ID NO:21.

    [0049] In an embodiment, the PCSK9 inhibitor is MS-001 or antigen binding fragments, variants, conjugates or biosimilars thereof. In an embodiment, MS-001 is a PCSK9 antibody comprising SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, and SEQ ID NO:33. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 99% identical to SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, and SEQ ID NO:33. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 95% identical to SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, and SEQ ID NO:33. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 90% identical to SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, and SEQ ID NO:33.

    [0050] In an embodiment, the PCSK9 inhibitor is LY3015014 or antigen binding fragments, variants, conjugates or biosimilars thereof. In an embodiment, LY3015014 is a PCSK9 antibody comprising SEQ ID NO:34 and SEQ ID NO:35. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 99% identical to SEQ ID NO:34 and SEQ ID NO:35. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 95% identical to SEQ ID NO:34 and SEQ ID NO:35. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 90% identical to SEQ ID NO:34 and SEQ ID NO:35.

    [0051] In an embodiment, the PCSK9 inhibitor is NS-001 or antigen binding fragments, variants, conjugates or biosimilars thereof. In an embodiment, NS-001 is a PCSK9 antibody comprising SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, and SEQ ID NO:41. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 99% identical to SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, and SEQ ID NO:41. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 95% identical to SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, and SEQ ID NO:41. In an embodiment, the PCSK9 inhibitor is a PCSK9 antibody comprising sequences at least 90% identical to SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, and SEQ ID NO:41.

    TABLE-US-00002 TABLE 2 SEQ ID NO. Description Sequence 1 Alirocumab Glu Met Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Variable zone in Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser heavy chain Ser His Trp Met Lys Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala Asn Ile Asn Gln Asp Gly Ser Glu Lys Tyr Tyr Val Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Phe Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Asp Ile Val Leu Met Val Tyr Asp Met Asp Tyr Tyr Tyr Tyr Gly Met Asp Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 2 Alirocumab Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly Variable zone in Gln Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser light chain Asn Gly Asn Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Thr Leu Gln Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 3 Evolocumab Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Variable zone in Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser heavy chain Ser Tyr Ser Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ser Ile Ser Ser Ser Ser Ser Tyr Ile Ser Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Phe Cys Ala Arg Asp Tyr Asp Phe Trp Ser Ala Tyr Tyr Asp Ala Phe Asp Val Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser 4 Evolocumab Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Gly Ala Pro Gly Gln Variable zone in Arg Val Thr Ile Ser Cys Thr Gly Ser Ser Ser Asn Ile Gly Ala Gly light chain Tyr Asp Val His Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu Ile Ser Gly Asn Ser Asn Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Thr Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Asp Ser Ser Leu Ser Gly Ser Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 5 Evolocumab Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Variable zone in Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Leu Thr Ser heavy chain Tyr Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Gly Gly Leu Glu Trp Met Gly Trp Val Ser Phe Tyr Asn Gly Asn Thr Asn Tyr Ala Gln  Lys Leu Gln Gly Arg Gly Thr Met Thr Thr Asp Pro Ser Thr Ser Thr Ala Tyr Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly Tyr Gly Met Asp Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 6 Evolocumab Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln Variable zone in Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Val Gly Gly Tyr light chain Asn Ser Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu Met Ile Tyr Glu Val Ser Asn Arg Pro Ser Gly Val Ser Asn Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Asn Tyr Thr Ser Thr Ser Met Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 7 Bococizumab Ser Tyr Tyr Met His Heavy chain: CDR1 8 Bococizumab Gly Tyr Thr Phe Thr Ser Tyr Tyr Met His Heavy chain: CDR1 9 Bococizumab Gly Tyr Thr Phe Thr Ser Tyr Heavy chain: CDR1 10 Bococizumab Ser Pro Phe Gly Gly Arg Heavy chain: CDR2 11 Bococizumab Glu Ile Ser Pro Phe Gly Gly Arg Thr Asn Tyr Asn Glu Lys Phe Heavy chain: Lys CDR2 12 Bococizumab Glu Arg Pro Leu Tyr Ala Ser Asp Leu Heavy chain: CDR3 13 Bococizumab Arg Ala Ser Gln Gly Ile Ser Ser Ala Leu Ala Light chain: CDR1 14 Bococizumab Ser Ala Ser Tyr Arg Tyr Thr Light chain: CDR2 15 Bococizumab Gln Gln Arg Tyr Ser Leu Trp Arg Thr Light chain: CDR3 16 DS-001 Ala Ser Asp Glu Glu Ile Gln Asp Val Ser Gly Thr Trp Tyr Leu Lys Ala Met Thr Val Asp Arg Phe Lys Ile Ala Ser Trp Pro Arg Ser Val Thr Pro Met Thr Leu Thr Thr Leu Glu Gly Gly Asn Leu Glu Ala Lys Val Thr Met Asn Trp Trp Gly Arg Ser Gln Gln Val Lys Ala Val Leu Glu Arg Thr Asp Glu Pro Gly Lys Tyr Thr Ala Gln Gly Asp Arg His Val Ala Tyr Ile Ile Arg Ser Pro Val Lys Asp His Tyr Ile Phe Tyr Ser Glu Gly Asn Leu Gln Gly Glu Thr Val Pro Gly Val Trp Leu Val Gly Arg Asp Pro Lys Asn Asn Leu Glu Ala Leu Glu Asp Phe Glu Lys Ala Ala Gly Ala Arg Gly Leu Ser Thr Glu Ser Ile Leu Ile Pro Arg Gln Ser Glu Thr Ser Ser Pro Gly 17 DS-001 Gly Ala Ser Asp Glu Glu Ile Gln Asp Val Ser Gly Thr Trp Tyr Leu Lys Ala Met Thr Val Asp Arg Phe Lys Ile Ala Ser Trp Pro Arg Ser Val Thr Pro Met Thr Leu Thr Thr Leu Glu Gly Gly Asn Leu Glu Ala Lys Val Thr Met Asn Trp Trp Gly Arg Ser Gln Glu Val Lys Ala Val Leu Glu Arg Thr Asp Glu Pro Gly Lys Tyr Thr Ala Gln Gly Asp Arg His Val Ala Tyr Ile Ile Arg Ser His Val Lys Asp His Tyr Ile Phe Tyr Ser Glu Gly Asn Leu Gln Gly Glu Thr Val Pro Gly Val Trp Leu Val Gly Arg Asp Pro Lys Asn Asn Leu Glu Ala Leu Glu Asp Phe Glu Lys Ala Ala Gly Ala Arg Gly Leu Ser Thr Glu Ser Ile Leu Ile Pro Arg Gln Ser Glu Thr Ser Ser Pro Gly 18 DS-001 Ala Ser Asp Glu Glu Ile Glu Asp Val Ser Gly Thr Trp Tyr Leu Lys Ala Met Thr Val Asp Arg Phe Lys Ile Ala Ser Trp Pro Arg Ser Val Thr Pro Met Thr Leu Thr Thr Leu Glu Gly Gly Asn Leu Glu Ala Lys Val Thr Met Asn Trp Trp Gly Arg Ser Gln Gln Val Lys Ala Val Leu Glu Arg Thr Asp Glu Pro Gly Lys Tyr Thr Ala Gln Gly Asp Arg His Val Ala Tyr Ile Ile Arg Ser Pro Val Lys Asp His Tyr Ile Phe Tyr Ser Glu Gly Asn Leu Gln Gly Glu Thr Val Pro Gln Val Trp Leu Val Gly Arg Asp Pro Lys Asn Asn Leu Glu Ala Leu Glu Asp Phe Glu Lys Ala Ala Gly Ala Arg Gly Leu Ser Thr Glu Ser Ile Leu Ile Pro Arg Gln Ser Glu Thr Ser Ser Pro Gly Gly Gly Gly Ser Leu Ala Glu Ala Lys Glu Ala Ala Asn Ala Glu Leu Asp Ser Tyr Gly Val Ser Asp Phe Tyr Lys Arg Leu Ile Asp Lys Ala Lys Thr Val Glu Gly Val Glu Ala Leu Lys Asp Ala Ile Leu Ala Ala Leu Pro Gly 19 DS-001 Gly Ala Ser Asp Glu Glu Ile Gln Asp Val Ser Gly Thr Trp Tyr Leu Lys Ala Met Thr Val Asp Arg Phe Lys Ile Ala Ser Trp Pro Arg Ser Val Thr Pro Met Thr Leu Thr Thr Leu Glu Gly Gly Asn Leu Glu Ala Lys Val Thr Met Asn Trp Trp Gly Arg Ser Gln Glu Val Lys Ala Val Leu Glu Arg Thr Asp Glu Pro Gly Lys Tyr Thr Ala Gln Gly Asp Arg His Val Ala Tyr Ile Ile Arg Ser His Val Lys Asp His Tyr Ile Phe Tyr Ser Glu Gly Asn Leu Gln Gly Glu Thr Val Pro Gly Val Trp Leu Val Gly Arg Asp Pro Lys Asn Asn Leu Glu Ala Leu Glu Asp Phe Glu Lys Ala Ala Gly Ala Arg Gly Leu Ser Thr Glu Ser Ile Leu Ile Pro Arg Gln Ser Glu Thr Ser Pro Gly Lys Leu Gly Gly Gly Gly Ser Leu Ala Glu Ala Lys Glu Ala Ala Asn Ala Glu Leu Asp Ser Tyr Gly Val Ser Asp Phe Tyr Lys Arg Leu Ile Asp Lys Ala Lys Thr Val Glu Gly Val Glu Ala Leu Lys Asp Ala Ile Leu Ala Ala Leu Pro Gly Lys Leu Asn 20 CA-001 Met Gly Arg Gln Leu Ala Gly Cys Gly Asp Ala Gly Lys Lys Ala Ser Phe Lys Met Ser Thr Val His Glu Ile Leu Cys Lys Leu Ser Leu Glu Gly Asp His Ser Thr Pro Pro Ser Ala Tyr Gly Ser Val Lys Ala Tyr Thr Asn Phe Asp Ala Glu Arg Asp Ala Leu Asn Ile Glu Thr Ala Ile Lys Thr Lys Gly Val Asp Glu Val Thr Ile Val Asn Ile Leu Thr Asn Arg Ser Asn Ala Gln Arg Gln Asp Ile Ala Phe Ala Tyr Gln Arg Arg Thr Lys Lys Glu Leu Ala Ser Ala Leu Lys Ser Ala Leu Ser Gly His Leu Glu Thr Val Ile Leu Gly Leu Leu Lys Thr Pro Ala Gln Tyr Asp Ala Ser Glu Leu Lys Ala Ser Met Lys Gly Leu Gly Thr Asp Glu Asp Ser Leu Ile Glu Ile Ile Cys Ser Arg Thr Asn Gln Glu Leu Gln Glu Ile Asn Arg Val Tyr Lys Glu Met Tyr Lys Thr Asp Leu Glu Lys Asp Ile Ile Ser Asp Thr Ser Gly Asp Phe Arg Lys Leu Met Val Ala Leu Ala Lys Gly Arg Arg Ala Glu Asp Gly Ser Val Ile Asp Tyr Glu Leu Ile Asp Gln Asp Ala Arg Asp Leu Tyr Asp Ala Gly Val Lys Arg Lys Gly Thr Asp Val Pro Lys Trp Ile Ser Ile Met Thr Glu Arg Ser Val Pro His Leu Gln Lys Val Phe Asp Arg Tyr Lys Ser Tyr Ser Pro Tyr Asp Met Leu Glu Ser Ile Arg Lys Glu Val Lys Gly Asp Leu Glu Asn Ala Phe Leu Asn Leu Val Gln Cys Ile Gln Asn Lys Pro Leu Tyr Phe Ala Asp Arg Leu Tyr Asp Ser Met Lys Gly Lys Gly Thr Arg Asp Lys Val Leu Ile Arg Ile Met Val Ser Arg Ser Glu Val Asp Met Leu Lys Ile Arg Ser Glu Phe Lys Arg Lys Tyr Gly Lys Ser Leu Tyr Tyr Tyr Ile Gln Gln Asp Thr Lys Gly Asp Tyr Gln Lys Ala Leu Leu Tyr Leu Cys Gly Gly Asp Asp 21 CA-001 Met Ser Thr Val His Glu Ile Leu Cys Lys Leu Ser Leu Glu Gly Asp His Ser Thr Pro Pro Ser Ala Tyr Gly Ser Val Lys Ala Tyr Thr Asn Phe Asp Ala Glu Arg Asp Ala Leu Asn Ile Glu Thr Ala Ile Lys Thr Lys Gly Val Asp Glu Val Thr Ile Val Asn Ile Leu Thr Asn Arg Ser Asn Ala Gln Arg Gln Asp Ile Ala Phe Ala Tyr Gln Arg Arg Thr Lys Lys Glu Leu Ala Ser Ala Leu Lys Ser Ala Leu Ser Gly His Leu Glu Thr Val Ile Leu Gly Leu Leu Lys Thr Pro Ala Gln Tyr Asp Ala Ser Glu Leu Lys Ala Ser Met Lys Gly Leu Gly Thr Asp Glu Asp Ser Leu Ile Glu Ile Ile Cys Ser Arg Thr Asn Gln Glu Leu Gln Glu Ile Asn Arg Val Tyr Lys Glu Met Tyr Lys Thr Asp Leu Glu Lys Asp Ile Ile Ser Asp Thr Ser Gly Asp Phe Arg Lys Leu Met Val Ala Leu Ala Lys Gly Arg Arg Ala Glu Asp Gly Ser Val Ile Asp Tyr Glu Leu Ile Asp Gln Asp Ala Arg Asp Leu Tyr Asp Ala Gly Val Lys Arg Lys Gly Thr Asp Val Pro Lys Trp Ile Ser Ile Met Thr Glu Arg Ser Val Pro His Leu Glu Lys Val Phe Asp Arg Tyr Lys Ser Tyr Ser Pro Tyr Asp Met Leu Glu Ser Ile Arg Lys Glu Val Lys Gly Asp Leu Glu Asn Ala Phe Leu Asn Leu Val Gln Cys Ile Gln Asn Lys Pro Leu Tyr Phe Ala Asp Arg Leu Tyr Asp Ser Met Lys Gly Lys Gly Thr Arg Asp Lys Val Leu Ile Arg Ile Met Val Ser Arg Ser Glu Val Asp Met Leu Lys Ile Arg Ser Glu Phe Lys Arg Lys Tyr Gly Lys Ser Leu Tyr Tyr Tyr Ile Gln Gln Asp Thr Lys Gly Asp Tyr Gln Lys Ala Leu Leu Tyr Leu Cys Gly Gly Asp Asp 22 MS-001 Met Glu Lys Met Leu Ala Gly Cys Phe Leu Leu Ile Leu Gly Gln Ile Val Leu Leu Pro Ala Glu Ala Arg Glu Arg Ser Arg Gly Arg Ser Ile Ser Arg Gly Arg His Ala Arg Thr His Pro Gln Thr Ala Leu Leu Glu Ser Ser Cys Glu Asn Lys Arg Ala Asp Leu Val Phe Ile Ile Asp Ser Ser Arg Ser Val Asn Thr His Asp Tyr Ala Lys Val Lys Glu Phe Ile Val Asp Ile Leu Gln Phe Leu Asp Ile Gly Pro Asp Val Thr Arg Val Gly Leu Leu Gln Tyr Gly Ser Thr Val Lys Asn Glu Phe Ser Leu Lys Thr Phe Lys Arg Lys Ser Glu Val Glu Arg Ala Val Lys Arg Met Arg His Leu Ser Thr Gly Thr Met Thr Gly Leu Ala Ile Gln Tyr Ala Leu Asn Ile Ala Phe Ser Glu Ala Glu Gly Ala Arg Pro Leu Arg Glu Asn Val Pro Arg Val Ile Met Ile Val Thr Asp Gly Arg Pro Gln Asp Ser Val Ala Glu Val Ala Ala Lys Ala Arg Asp Thr Gly Ile Leu Ile Phe Ala Ile Gly Val Gly Gln Val Asp Phe Asn Thr Leu Lys Ser Ile Gly Ser Glu Pro His Glu Asp His Val Phe Leu Val Ala Asn Phe Ser Gln Ile Glu Thr Leu Thr Ser Val Phe Gln Lys Lys Leu Cys Ile Asn Ile Met Cys Ser Thr Leu Glu His Asn Cys Ala His Phe Cys Ile Asn Ile Pro Gly Ser Tyr Val Cys Arg Cys Lys Gln Gly Tyr Ile Leu Asn Ser Asp Gln Thr Thr Cys Arg Ile Gln Asp Leu Cys Ala Met Glu Asp His Asn Cys Glu Gln Leu Cys Val Asn Val Pro Gly Ser Phe Val Cys Gln Cys Tyr Ser Gly Tyr Ala Leu Ala Glu Asp Gly Lys Arg Cys Val Ala Val Asp Tyr Cys Ala Ser Glu Asn His Gly Cys Glu His Glu Cys Val Asn Ala Asp Gly Ser Tyr Leu Cys Gln Cys His Glu Gly Phe Ala Leu Asn Pro Asp Lys Lys Thr Cys Thr Lys Ile Asp Tyr Cys Ala Ser Ser Asn His Gly Cys Gln His Glu Cys Val Asn Thr Asp Asp Ser Tyr Ser Cys His Cys Leu Lys Gly Phe Thr Leu Asn Pro Asp Lys Lys Thr Cys Arg Arg Ile Asn Tyr Cys Ala Leu Asn Lys Pro Gly Cys Glu His Glu Cys Val Asn Met Glu Glu Ser Tyr Tyr Cys Arg Cys His Arg Gly Tyr Thr Leu Asp Pro Asn Gly Lys Thr Cys Ser Arg Val Asp His Cys Ala Gln Gln Asp His Gly Cys Glu Gln Leu Cys Leu Asn Thr Glu Asp Ser Phe Val Cys Gln Cys Ser Glu Gly Phe Leu Ile Asn Glu Asp Leu Lys Tyr Cys Ser Arg Val Asp Tyr Cys Leu Leu Ser Asp His Gly Cys Glu Tyr Ser Cys Val Asn Met Asp Arg Ser Phe Ala Cys Gln Cys Pro Glu Gly His Val Leu Arg Ser Asp Gly Lys Thr Cys Ala Lys Leu Asp Ser Cys Ala Leu Gly Asp His Gly Cys Glu His Ser Cys Val Ser Ser Glu Asp Ser Phe Val Cys Gln Cys Phe Glu Gly Tyr Ile Leu Arg Glu Asp Gly Lys Thr Cys Arg Arg Lys Asp Val Cys Gln Ala Ile Asp His Gly Cys Glu His Ile Cys Val Asn Ser Asp Asp Ser Tyr Thr Cys Glu Cys Leu Glu Gly Phe Arg Leu Ala Glu Asp Gly Lys Arg Cys Arg Arg Lys Asp Val Cys Lys Ser Thr His His Gly Cys Glu His Ile Cys Val Asn Asn Gly Asn Ser Tyr Ile Cys Lys Cys Ser Glu Gly Phe Val Leu Ala Glu Asp Gly Arg Arg Cys Lys Lys Cys Thr Glu Gly Pro Ile Asp Leu Val Phe Val Ile Asp Gly Ser Lys Ser Leu Gly Glu Glu Asn Phe Glu Val Val Lys Gln Phe Val Thr Gly Ile Ile Asp Ser Leu Thr Ile Ser Pro Lys Ala Ala Arg Val Gly Leu Leu Gln Tyr Ser Thr Gln Val His Thr Glu Phe Thr Leu Arg Asn Phe Asn Ser Ala Lys Asp Met Lys Lys Ala Val Ala His Met Lys Tyr Met Gly Lys Gly Ser Met Thr Gly Leu Ala Leu Lys His Met Phe Glu Arg Ser Phe Thr Gln Gly Glu Gly Ala Arg Pro Leu Ser Thr Arg Val Pro Arg Ala Ala Ile Val Phe Thr Asp Gly Arg Ala Gln Asp Asp Val Ser Glu Trp Ala Ser Lys Ala Lys Ala Asn Gly Ile Thr Met Tyr Ala Val Gly Val Gly Lys Ala Ile Glu Glu Glu Leu Gln Glu Ile Ala Ser Glu Pro Thr Asn Lys His Leu Phe Tyr Ala Glu Asp Phe Ser Thr Met Asp Glu Ile Ser Glu Lys Leu Lys Lys Gly Ile Cys Glu Ala Leu Glu Asp Ser Asp Gly Arg Gln Asp Ser Pro Ala Gly Glu Leu Pro Lys Thr Val Gln Gln Pro Thr Glu Ser Glu Pro Val Thr Ile Asn Ile Gln Asp Leu Leu Ser Cys Ser Asn Phe Ala Val Gln His Arg Tyr Leu Phe Glu Glu Asp Asn Leu Leu Arg Ser Thr Gln Lys Leu Ser His Ser Thr Lys Pro Ser Gly Ser Pro Leu Glu Glu Lys His Asp Gln Cys Lys Cys Glu Asn Leu Ile Met Phe Gln Asn Leu Ala Asn Glu Glu Val Arg Lys Leu Thr Gln Arg Leu Glu Glu Met Thr Gln Arg Met Glu Ala Leu Glu Asn Arg Leu Arg Tyr Arg 23 MS-001 Met Glu Lys Met Leu Ala Gly Cys Phe Leu Leu Ile Leu Gly Gln Ile Val Leu Leu Pro Ala Glu Ala Arg Glu Arg Ser Arg Gly Arg Ser Ile Ser Arg Gly Arg His Ala Arg Thr His Pro Gln Thr Ala Leu Leu Glu Ser Ser Cys Glu Asn Lys Arg Ala Asp Leu Val Phe Ile Ile Asp Ser Ser Arg Ser Val Asn Thr His Asp Tyr Ala Lys Val Lys Glu Phe Ile Val Asp Ile Leu Gln Phe Leu Asp Ile Gly Pro Asp Val Thr Arg Val Gly Leu Leu Gln Tyr Gly Ser Thr Val Lys Asn Glu Phe Ser Leu Lys Thr Phe Lys Arg Lys Ser Glu Val Glu Arg Ala Val Lys Arg Met Arg His Leu Ser Thr Gly Thr Met Thr Gly Leu Ala Ile Gln Tyr Ala Leu Asn Ile Ala Phe Ser Glu Ala Glu Gly Ala Arg Pro Leu Arg Glu Asn Val Pro Arg Val Ile Met Ile Val Thr Asp Gly Arg Pro Gln Asp Ser Val Ala Glu Val Ala Ala Lys Ala Arg Asp Thr Gly Ile Leu Ile Phe Ala Ile Gly Val Gly Gln Val Asp Phe Asn Thr Leu Lys Ser Ile Gly Ser Glu Pro His Glu Asp His Val Phe Leu Val Ala Asn Phe Ser Gln Ile Glu Thr Leu Thr Ser Val Phe Gln Lys Lys Leu Cys Thr Ala His Met Cys Ser Thr Leu Glu His Asn Cys Ala His Phe Cys Ile Asn Ile Pro Gly Ser Tyr Val Cys Arg Cys Lys Gln Gly Tyr Ile Leu Asn Ser Asp Gln Thr Thr Cys Arg Ile Gln Asp Leu Cys Ala Met Glu Asp His Asn Cys Glu Gln Leu Cys Val Asn Val Pro Gly Ser Phe Val Cys Gln Cys Tyr Ser Gly Tyr Ala Leu Ala Glu Asp Gly Lys Arg Cys Val Ala Val Asp Tyr Cys Ala Ser Glu Asn His Gly Cys Glu His Glu Cys Val Asn Ala Asp Gly Ser Tyr Leu Cys Gln Cys His Glu Gly Phe Ala Leu Asn Pro Asp Lys Lys Thr Cys Thr Lys Ile Asp Tyr Cys Ala Ser Ser Asn His Gly Cys Gln His Glu Cys Val Asn Thr Asp Asp Ser Tyr Ser Cys His Cys Leu Lys Gly Phe Thr Leu Asn Pro Asp Lys Lys Thr Cys Arg Arg Ile Asn Tyr Cys Ala Leu Asn Lys Pro Gly Cys Glu His Glu Cys Val Asn Met Glu Glu Ser Tyr Tyr Cys Arg Cys His Arg Gly Tyr Thr Leu Asp Pro Asn Gly Lys Thr Cys Ser Arg Val Asp His Cys Ala Glu Glu Asp His Gly Cys Glu Gln Leu Cys Leu Asn Thr Glu Asp Ser Phe Val Cys Gln Cys Ser Glu Gly Phe Leu Ile Asn Glu Asp Leu Lys Thr Cys Ser Arg Val Asp Tyr Cys Leu Leu Ser Asp His Gly Cys Glu Tyr Ser Cys Val Asn Met Asp Arg Ser Phe Ala Cys Gln Cys Pro Glu Gly His Val Leu Arg Ser Asp Gly Lys Thr Cys Ala Lys Leu Asp Ser Gly Ala Leu Gly Asp His Gly Cys Glu His Ser Cys Val Ser Ser Glu Asp Ser Phe Val Cys Gln Cys Phe Glu Gly Tyr Ile Leu Arg Glu Asp Gly Lys Thr Cys Arg Arg Lys Asp Val Cys Gln Ala Ile Asp His Gly Cys Glu His Ile Cys Val Asn Ser Asp Asp Ser Tyr Thr Cys Glu Cys Leu Glu Gly Phe Arg Leu Ala Glu Asp Gly Lys Arg Cys Arg Arg Lys Asp Val Cys Lys Ser Thr His His Gly Cys Glu His Ile Cys Val Asn Asn Gly Asn Ser Tyr Ile Cys Lys Cys Ser Glu Gly Phe Val Leu Ala Glu Asp Gly Arg Arg Cys Lys Lys Cys Thr Glu Gly Pro Ile Asp Leu Val Phe Val Ile Asp Gly Ser Lys Ser Leu Gly Glu Glu Asn Phe Glu Val Val Lys Gln Phe Val Thr Gly Ile Ile Asp Ser Leu Thr Ile Ser Pro Lys Ala Ala Arg Val Gly Leu Leu Gln Tyr Ser Thr Gln Val His Thr Glu Phe Thr Leu Arg Asn Phe Asn Ser Ala Lys Asp Met Lys Lys Ala Val Ala His Met Lys Tyr Met Gly Lys Gly Ser Met Thr Gly Leu Ala Leu Lys His Met Phe Glu Arg Ser Phe Thr Gln Gly Glu Gly Ala Arg Pro Leu Ser Thr Arg Val Pro Arg Ala Ala Ile Val Phe Thr Asp Gly Arg Ala Gln Asp Asp Val Ser Glu Trp Ala Ser Lys Ala Lys Ala Asn Gly Ile Thr Met Tyr Ala Val Gly Val Gly Lys Ala Ile Glu Glu Glu Leu Gln Glu Ile Ala Ser Glu Pro Thr Asn Lys His Leu Phe Tyr Ala Glu Asp Phe Ser Thr Met Asp Glu Ile Ser Glu Lys Leu Lys Lys Gly Ile Cys Glu Ala Leu Glu Asp Ser Asp Gly Arg Gln Asp Ser Pro Ala Gly Glu Leu Pro Lys Thr Val Gln Gln Pro Thr Val Gln His Arg Tyr Leu Phe Glu Glu Asp Asn Leu Leu Arg Ser Thr Gln Lys Leu Ser His Ser Thr Lys Pro Ser Gly Ser Pro Leu Glu Glu Lys His Asp Gln Cys Lys Cys Glu Asn Leu Ile Met Phe Gln Asn Leu Ala Asn Glu Glu Val Arg Lys Leu Thr Gln Arg Leu Glu Glu Met Thr Gln Arg Met Glu Ala Leu Glu Asn Arg Leu Arg Tyr Arg 24 MS-001variable Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly zone in heavy Glu Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr chain Asn Tyr Trp Ile Ser Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met Gly Ile Ile Tyr Pro Gly Asp Ser Tyr Thr Asn Tyr Ser Pro Ser Phe Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys Ala Arg Asp Tyr Trp Tyr Lys Pro Leu Phe Asp Ile Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 25 MS-001variable Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu zone in light Gly Glu Arg Ala Thr Ile Asn Cys Arg Ser Ser Gln Ser Val Leu Tyr chain Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Ser Ser Phe Pro Ile Tyr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg 26 MS-001variable Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly zone in heavy Gly Ser Leu Arg Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ser chain Ser Tyr Gly Met Tyr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile Gly Trp Ile Asp Pro Gly Ser Gly Gly Thr Lys Tyr Asn Glu Lys Phe Lys Gly Lys Ala Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Glu Arg Tyr Gly Tyr Tyr Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser 27 MS-001variable Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly zone in heavy Gly Ser Leu Arg Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ser chain Ser Tyr Gly Met Tyr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile Gly Trp Ile Asp Pro Gly Ser Gly Gly Thr Lys Tyr Asn Glu Lys Phe Lys Gly Lys Ala Thr Ile Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Glu Arg Tyr Gly Tyr Tyr Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 28 MS-001variable Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly zone in light Glu Arg Ala Thr Ile Thr Cys Arg Ala Ser Gln Tyr Val Gly Ser Tyr chain Leu Asn Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile Tyr Asp Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Val Trp Asp Ser Ser Pro Pro Val Val Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 29 MS-001variable Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly zone in heavy Gly Ser Leu Arg Leu Ser Cys Lys Ala Ser Gly Phe Thr Phe Thr chain Ser Tyr Tyr Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile Gly Arg Ile Asn Pro Asp Ser Gly Ser Thr Lys Tyr Asn Glu Lys Phe Lys Gly Arg Ala Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly Gly Arg Leu Ser Trp Asp Phe Asp Val Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 30 MS-001variable Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly zone in light Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Arg Tyr chain Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Ala Ala Tyr Asp Tyr Ser Leu Gly Gly Tyr Val Phe Gly Asp Gly Thr Lys Val Glu Ile Lys 31 MS-001variable Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly zone in light Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Ser Arg Tyr chain Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Ala Ala Tyr Asp Tyr Ser Leu Gly Gly Tyr Val Phe Gly Gly Gly Thr Lys Val Glu Ile Lys 32 MS-001variable Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly zone in heavy Ser Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Asn Ser chain His Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Gly Ile Asn Pro Ile Leu Gly Ile Ala Asn Tyr Ala Gln Lys Phe Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg His Tyr Glu Ile Gln Ile Gly Arg Tyr Gly Met Asn Val Tyr Tyr Leu Met Tyr Arg Phe Ala Ser Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 33 MS-001variable Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly zone in light Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Arg Ser Ala chain Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Asn Gly Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Phe Asp Gly Asp Pro Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg 34 LY3015014 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Heavy chain Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Pro Phe Ser Lys Leu Gly Met Val Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Thr Ile Ser Ser Gly Gly Gly Tyr Thr Tyr Tyr Pro Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Glu Gly Ile Ser Phe Gln Gly Gly Thr Tyr Thr Tyr Val Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Ala Ala Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly 35 LY3015014 Light Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly chain Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Arg Asn Gly Ile Thr Tyr Ser Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser Pro Gln Leu Leu Ile Tyr Gln Leu Ser Asn Leu Ala Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Tyr Gln Asn Leu Glu Leu Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 36 NS-001 variable Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly zone in heavy Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ser Thr chain Met Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Arg Ile Asp Pro Ala Asn Glu His Thr Asn Tyr Ala Gln Lys Phe Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr Met Glu Leu Ser Arg Leu Thr Ser Asp Asp Thr Ala Val Tyr Tyr Cys Ala Arg Ser Tyr Tyr Tyr Tyr Asn Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 37 NS-001 variable Gln Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly zone in light Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Tyr chain Met His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile Tyr Gly Val Phe Arg Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Gly Arg Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Leu Gln Trp Ser Ser Asp Pro Pro Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 38 NS-001 variable Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly zone in  heavy Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ser Thr chain Met Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Arg Ile Asp Pro Ala Asn Glu His Thr Asn Tyr Ala Gln Lys Phe Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr Met Glu Leu Ser Arg Leu Thr Ser Asp Asp Thr Ala Val Tyr Tyr Cys Ala Arg Ser Tyr Tyr Tyr Tyr Asn Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 39 NS-001 variable Glu Ile Val Met Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly zone in light Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Tyr chain Met His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile Tyr Gly Val Phe Arg Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Gly Arg Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Leu Gln Trp Ser Ser Asp Pro Pro Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 40 NS-001 variable Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly zone in heavy Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ser Thr chain Met Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Arg Ile Asp Pro Ala Asn Glu His Thr Asn Tyr Ala Gln Lys Phe Gln Gly Arg Val Thr Met Thr Asg Asp Thr Ser Ile Ser Thr Ala Tyr Met Glu Leu Ser Arg Leu Thr Ser Asp Asp Thr Ala Val Tyr Tyr Cys Ala Arg Ser Tyr Tyr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 41 NS-001 variable Gln Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly zone in light Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Tyr chain Met His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile Tyr Gly Val Phe Arg Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Gly Arg Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Leu Gln Trp Ser Ser Asp Pro Pro

    Beneficial Effect

    [0052] The invention provides a new and better treatment method for the treatment of inflammatory immune diseases. Through the disclosure of the invention, the system or topical PCSK9 inhibitor can be further prepared, and a new monomer drug or compound preparation containing various PCSK9 inhibitors can be developed. Furthermore, new monomers or compound formulations containing all kinds of PCSK9 inhibitors have been developed for the treatment of various types of inflammatory immune diseases, especially psoriasis, eczema and urticaria. Clinical trials have shown that these drugs, which contain PCSK9 inhibitors, are effective, have little adverse reactions, and are well tolerated in patients. In particular, topical use alone can significantly improve lesions in immune diseases such as psoriasis. It is very suitable for the current clinical demand and is expected to have great application prospect, which will bring more advantages to the patients with inflammatory and immunological diseases.

    V. EXAMPLES

    [0053] The following specific examples illustrate the embodiments of this invention. Technical personnel in this field can easily understand the other advantages and effects of the invention from the contents disclosed in this invention. The invention is not limited to the embodiments described herein. Before further describing the embodiments of this invention, it should be understood that the scope of protection of the invention is not limited to the following specific embodiment. It should be also understood that the term used in the specific examples of the invention is used to describe a specific embodiment rather than to limit the protection scope of the invention. In the description and claims of the invention, unless expressly stated in the text, the singular form “one” and “this” include plural forms.

    [0054] It should be understood that when a numerical range is given in an example, unless stated by the invention, the two endpoints and any between the two endpoints of each numerical range can be selected. Unless defined herein, all technical and scientific terms used in the invention have the same meaning as those commonly understood by those in the technical field. Except for specific methods, equipment, materials used in the embodiment, according to the description of the invention, one skilled in the art would understand the use of the equivalents of the methods, equipment, and materials described herein.

    Example 1

    PCSK9 Knockout Significantly Alleviates Psoriasis-Like Inflammation Reaction Induced by IMQ in Mice

    [0055] Reagents: 5% imiquimod cream (IMQ), PCSK9 antibody (abcam), NF-kB antibody(abcam)

    [0056] Experimental animal: C57BL/6 (B6) mice, 7 male; C57BL/6-PCSK9-r-mice, 5 males and 5 females. The mice were purchased at the Jackson Institute in Maine, USA (The Jackson Laboratory).

    [0057] Experimental Methods:

    [0058] 1. After two groups of mice with different genotypes were treated with back hair removal, 5% Imiquimod cream of 62.5 mg was applied daily for 5 days.

    [0059] 2. Scores (the score of erythema, scales, skin lesions thickening and total score) were taken and archived (the score was obtained by two researchers respectively then average score was calculated) before and after the application.

    [0060] 3. On the last day of the experiment, all the mice were eulogized and the skin tissue of the back (treated and untreated) was taken.

    [0061] 4. The morphology of skin lesions in each group was observed by HE staining and the expression and distribution of PCSK9 and NF-kB in skin lesions of 4 groups were measured by immunofluorescence method.

    [0062] Experimental Results:

    [0063] 1. After 5 days of continuous application, there were obvious erythema, scales and infiltration in the back of 7 C57BL/6 mice, which were in accordance with the appearance of psoriasis-like skin lesions. In 10 PCSK9 knockout mice, there were only slight erythema, scales and infiltration in the back coating area (See FIG. 1).

    [0064] 2. A daily score was given on the skin lesions of the drug-coated area on the back of the mice, the score of erythema, scale, infiltration and total score of C57BL/6 mice were significantly higher than those of PCSK9 knockout mice (P<0.05).

    [0065] 3. After 5 days of application, the skin tissues of the mice's back (treated and untreated) were taken for HE staining and pathological changes were observed. The skin of IMQ treatment area of C57BL/6 mice showed typical psoriasis pathological changes, such as skin thickening, dermatoid lengthening, thickening of spinous layer, hyperkeratosis with incomplete keratosis, Kogoj abscess and Munro abscess, etc. However, the skin of PCSK9 gene knockout mice showed mild epidermis thickening and hyperkeratosis, no typical pathological changes of psoriasis, such as extension of dermatoid, thickening of spinous layer, hyperkeratosis with incomplete keratosis, Kogoj abscess and Munro abscess. The untreated skin of both groups showed normal skin structure (see FIG. 3).

    Example 2

    Transfection of Si-PCSK9 Enhances Apoptosis and Inhibits Proliferation of Human Keratinocytes.

    [0066] Experimental Materials and Reagents:

    [0067] (1) Human primary keratinocytes (Lifeline Cell Technology, FC-0064)

    [0068] (2) DermaLife Culture medium of keratinocyte (Lifeline Cell Technology, LL-0007), si-PCSK9 (Santa Cruz,sc-45482), Lipofectamine 3000 transfection reagent (ThermalFisher, L-3000001), AnnexinV (BD), PI(BD).

    [0069] Experimental Methods:

    [0070] 1. Cultured human keratinocytes were replanted in 6 wells plates. When the cell density was 60-70%, si-RNA (si-Con and siPCSK9) transfection was carried out. After 24 h/48 h/72 h of transfection, measured the cell activity of each pore by MTT method. 3 wells were selected at each time point for each group, the average value was taken and the cell activity curve was plotted.

    [0071] 2. Cultured human keratinocytes were replanted in 6 wells plates. When the cell density was 60-70%, si-RNA (si-Con & si-PCSK9) transfection was carried out. After 24 h/48 h/72 h of transfection, cells were harvested respectively for AnnexinV and PI staining to detect cell apoptosis and cell cycle. 3 wells were selected at each time point for each group, the average value was taken.

    [0072] Experimental Results:

    [0073] 1. The number of survival cells of human primary keratinocytes transfected with si-PCSK9 was significantly lower than that of si-Con transfection (P<0.05, See FIG. 6).

    [0074] 2. The apoptosis of primary keratinocytes transfected with si-PCSK9 was significantly higher than that of si-Con transfection (P<0.05), while proliferating (the proportion of S+G2/M phase cells) decreased significantly (see FIG. 7).

    Example 3

    [0075] The Expression of PCSK9 in Psoriatic Lesions was Significantly Higher than that in Non-Lesions and Normal Controls.

    [0076] Experiment materials: lesions and non-lesion from 30 psoriasis patients, skin samples from 30 normal people were treated with PCSK9 antibody (abcam).

    [0077] Methods: immunohistochemistry, real time quantitative-PCR.

    [0078] Results: the skin of patients with skin lesions and non-lesions was extracted by drilling method. The skin of normal people originated from the redundant skin of cosmetic surgery. The results of immunohistochemistry showed that the expression of PCSK9 in psoriatic lesions was significantly higher than that in non-lesions and normal controls. PCSK9 positive cells were mainly distributed in epidermis and dermis near epidermis, but not in dermis vessels (see FIG. 8). RNA was extracted from skin homogenate. Q-PCR detection showed that the expression of PCSK9 in psoriatic lesions group was higher than that in psoriatic non-lesion group and normal control group (P<0.05) (see FIG. 9). The results of immunohistochemistry and Q-PCR were consistent.

    Example 4

    [0079] Expression of PCSK9 in Peripheral Blood Mononuclear Cells and Plasma in Patients with Psoriasis, Eczema and Urticaria.

    [0080] Materials: 5 ml peripheral blood from 30 cases of psoriasis, 30 cases of eczema, 30 cases of urticaria, and 30 cases of normal persons was collected respectively.

    [0081] Empirical Method:

    (1) Separation of plasma and separation of peripheral PBMC by density gradient method.
    (2) Detection of PCSK9 expression in PBMC by real-time quantitative Q-PCR.
    (3) The expression of PCSK9 in plasma was detected by enzyme linked immunosorbent assay (Elisa) (PCSK9 Quantikine ELISA Kit, America R&D)
    (4) Results: (1) No PCSK expression was detected in PBMC of the samples of psoriasis, eczema, urticarial and normal people.
    (5) PCSK expression in the samples of psoriasis, eczema, and urticaria are much higher than that in the sample of the normal people. PCSK expression is the highest in the samples of psoriasis.

    Example 5

    [0082] Effect of PCSK9 Protein on the Secretion of IL-17 and IL-2 from Peripheral CD4+ T Cells in Patients with Psoriasis, Eczema or Urticaria.

    [0083] Materials: peripheral blood of 10 cases of psoriasis, 10 cases of eczema, 10 cases of urticaria, and 10 cases of normal people. ELISA kit was purchased from Raybiotech Company of USA.

    [0084] Experimental Methods:

    [0085] (1) Isolation of CD4.sup.+T cells from peripheral blood:

    [0086] After PBMC was isolated by Ficoll-Hypaque from human peripheral blood by density gradient centrifugation, washed with 10 times volume 1×BD beads buffer. Then 50 ul BD IMag TM CD4 beads were added to each 107 cells. The beads were mixed well and incubated at room temperature for 30 minutes. 1 ml 1×BD magnetic bead buffer solution was added, and the cells were transferred to the round bottom tube and placed in the magnetic frame for 8 to 10 minutes. And then the supernatant was discarded and removed the test tube from the magnetic field. After resuspension of cells attached to tube wall with 1 ml 1×BD magnetic bead buffer, the tubes were placed in magnetic field for 2-4 min again. The supernatant was discarded removed it out of the magnetic field, resuspended the cells and placed the tube in the magnetic field for 2-4 min. The cells obtained from the supernatant can be used in subsequent experiments. BD IMag TM CD4 separation system was purchased from BD Biosciences Company.

    [0087] (2) Determination of Cytokines Secreted by CD4.sup.+T cells in Peripheral Blood

    [0088] The supernatant was collected after cell culture under different conditions. IFN-Gamma represented TH1 type cytokines, IL-4 represented TH2 type cytokines, and IL-17 represented TH17 cytokines. The detection of IFN-Gamma, IL-4, IL-17 was conducted by ELISA.

    [0089] Results: Compared to the normal patients, PCSK9 protein can significantly promote the secretion of IL-17, IL-2 and IFN-Gamma (P<0.01) by CD4 T cells isolated from peripheral blood of patients with psoriasis, eczema and urticaria (FIG. 11).

    Example 6

    [0090] Subcutaneous Injection of PCSK9 Small Molecule Inhibitor and PCSK9 Monoclonal Antibody Significantly Alleviated Systemic Immune Abnormalities and Skin Lesions Induced by IMQ in Mice. The Efficacy of PCSK9 Small Molecule Inhibitor is Better than that of Subcutaneous Injection of PCSK9 Monoclonal Antibody.

    [0091] Reagents:

    The PCSK9 small molecule inhibitor used for this example has the formula of:

    ##STR00013##

    [0092] The PCSK9 monoclonal antibody used for this example is Evolocumab. 40 SPF female BALB/c mice aged 6-8 weeks were randomly divided into normal control group, model group, PCSK9 small molecule inhibitor group and PCSK9 monoclonal antibody group. There were 10 mice for each group. After intraperitoneal injection of pentobarbital sodium 80 mg/kg, the back was shaved with an area of about 2 cm×3 cm. The mice were feed separately for 1 day.

    [0093] (1) In normal control group, Vaseline was applied locally. In model group, inhibitor group and monoclonal antibody group, 62.5 mg of 5% imiquimod cream was applied on the back every day for 6 consecutive days, photos were taken and the PASI score was evaluated.

    [0094] (2) On the first day, normal saline was subcutaneously administrated to normal control group and model group, PCSK9 small molecule inhibitor was subcutaneously administrated (8 mg/kg, Purchased from Selleck Inc.) to inhibitor group, and PCSK9 monoclonal antibody was subcutaneously administrated to monoclonal antibody group (10 mg/kg, Purchased from abcam Inc.)

    [0095] Experimental Results:

    [0096] (1) After 6 days of continuous application, there were marked erythema, scales and infiltration in the back of the mice in the model group. However, in PCSK9 small molecule inhibitor group and PCSK9 monoclonal antibody group, there was only mild erythema, scales and infiltration in the back coating area of mice. The effect of PCSK9 small molecule inhibitor group was better than that of PCSK9 monoclonal antibody group. No lesions were observed in the vaseline group (FIG. 12).

    [0097] (2) A daily scoring was given on the skin lesions of the drug-coated area on the back of the mice. The score of erythema, scales, infiltration and total score of PCSK9 small molecule inhibitor group (erythema+scales+infiltration) were significantly lower than that of PCSK9 monoclonal antibody group (P<0.01).

    Example 7

    [0098] Both PCSK9 Small Molecule Inhibitor and PCSK9 Monoclonal Antibody Improved the IMQ Induced Psoriatic Lesions of Mice, and the Efficacy of Small Molecule Inhibitor was Better than that of Monoclonal Antibody

    [0099] Reagents:

    [0100] The PCSK9 small molecule inhibitor used for this example has the formula of:

    ##STR00014##

    The PCSK9 monoclonal antibody used for this example is Evolocumab.

    [0101] (1) 40 SPF female BALB/c mice aged 6-8 weeks were randomly divided into normal control group, model group, PCSK9 inhibitor group and PCSK9 monoclonal antibody group. There were 10 mice for each group. After intraperitoneal injection of pentobarbital sodium 80 mg/kg, the back was shaved with an area of about 2 cm×3 cm. The mice were feed separately for 1 day.

    [0102] (2) In normal control group, vaseline was applied locally. In model group, small molecule inhibitor group and monoclonal antibody group, 62.5 mg of 5% imiquimod cream was applied on the back every day for 6 consecutive days, and photos were taken and the PASI score was evaluated.

    [0103] (3) Pretreatment: vaseline was applied on the back skin with mics in normal control group and model group, PCSK9 small molecule inhibitor cream (0.01% concentration) was applied to inhibitor group once daily. And, PCSK9 monoclonal antibody cream (0.01% concentration) was applied to monoclonal antibody group once daily.

    [0104] (4) After 7 days pretreatment, vaseline was applied on the back skin with mice in normal control group. At the same time, 62.5 mg 5% imiquimod cream was regularly applied daily on the back with mice in model group, small molecule inhibitor group and monoclonal antibody group. PCSK9 small molecule inhibitor cream or PCSK9 monoclonal antibody cream was applied after one hour. For 6 consecutive days, photos were taken and the PASI score was evaluated.

    [0105] Experimental Results:

    [0106] 1. After 6 days of continuous administration, erythema, scales and infiltration were observed in the coating areas at the back of the mics in the model group. However, there were only slight erythema, scales and infiltration in the back of the mice in the PCSK9 small molecule inhibitor group and the PCSK9 monoclonal antibody group. The effect of PCSK9 small molecule inhibitor group was better than that of PCSK9 monoclonal antibody group. No lesion was observed in the vaseline group (See FIG. 13).

    [0107] 2. A daily score was given on the skin lesions of the drug-coated area on the back of the mice. The score of erythema, scales, infiltration and total score (erythema+scales+infiltration) in PCSK9 small molecule inhibitor group was significantly lower than that in PCSK9 monoclonal antibody group (P<0.01).

    Example 8

    [0108] External Use of siRNA for PCSK9 could Significantly Reduce Psoriatic Lesions Induced by IMQ in Mice.

    [0109] Materials and Methods:

    [0110] 1. Animal models: two types of mice models, C57BL/6J (B6) and Balb/cByJ (BALB) were used in this study. The mice was purchased at the Jackson Institute in Maine, USA. (The Jackson Laboratory). The strain number was 000664, 001026 and 005993 respectively (www.jax.org). All the mice in this experiment were female, aged 3-8 months, 5 mice for each group.

    [0111] 2. Psoriatic lesions induced by IMQ: the back hair of B 6 mice was removed one day before the experiment. During the experiment, 62.5 mg imiquimod (IMQ, 3 M pharmaceuticals) were smeared on the skin of each mouse with an area of 2 cm.sup.2 on the back. In some mice, right auricle was also smeared with 5 mg IMQ to detect skin thickening easily. After 24 hours, score of the skin color, thickness and scales degree was evaluated.

    [0112] 3. Inhibition of PCSK9 by siRNA and its effect on psoriatic lesions induced by IMQ: Two siRNAs for PCSK9 (siPCSK9-1, 2) and a random sequence siRNA (siCon), used as a control trial, was synthesized by Sigma-Aldrich company (Sigma-Aldrich, USA). The sequence was shown in Table 3. Mixed siPCSK9-1 and 2 equally and diluted it to 20 μM with normal saline. 12.5 μl diluted siPCSK9 was evenly mixed with 7.5 μl moisturizer (CVS Pharmacy, Baby Lotion), so it was done with siCon. Applied 20 μl siRNA-moisturizer mixture to the skin 1 hour before IMQ was applied. PCSK9 monoclonal antibody was purchased from abcam Company and was evenly mixed with PCSK9 moisturizer (CVS pharmacy, Baby Lotion) to generate an equal concentration emulsion with siPCSK9 emulsion.

    [0113] 4. From the first day, siCON was applied on the back skin of B6 mice in model group after 1 hour-vaseline treatment. B6 mice in siPCSK9 group were smeared with 5% imiquimod cream on their back, then 1 hour thereafter, siPCSK9 was applied once daily. In PCSK9 monoclonal antibody group, 5% imiquimod cream was applied on the back skin of B6 mice, then 1 hour thereafter, PCSK9 monoclonal antibody was applied once daily.

    [0114] 5. Gene expression detection by semi quantitative (real-time PCR): Primer sequence was shown in Table 3

    TABLE-US-00003 TABLE 3 siRNA sequence and modification Gene 5′-3′ Sense 5′-3′ Antisense siPCSK9-1 GccuGGAGuuuAuu UUCCgAAuAAACUC cGGAAdT*dT cAGGCdT*dT (SEQ ID NO: 42) (SEQ ID NO: 45) siPCSK9-2 AGGuGuAucuccuA GUGUCuAGGAGAuA GAcAcdT*dT cACCUdT*dT (SEQ ID NO: 43) (SEQ ID NO: 46) siCON cuuAcGcuGAGuAc UCGAAGuACUcAGC uucGAdT*dT GuAAGdT*dT (SEQ ID NO: 44) (SEQ ID NO: 47) Note: lowercase letters denote 2′-OMe modification. All sequences were connected with phosphorothioate at the end of the sequence.

    TABLE-US-00004 TABLE 4 Primer sequence Gene Forward Sequence Reverse Sequence PCSK9 TTGCAGCAGCTGGGAACTT CCGACTGTGATGACCTCTGGA (SEQ ID NO: 48) (SEQ ID NO: 53) NFkB CTGGTGGACACATACAGGAA ATAGGCACTGTCTTCTTTCAC GAC (SEQ ID NO: 49) CTC (SEQ ID NO: 54) IL-17A TTTTCAGCAAGGAATGTGGA TTCATTGTGGAGGGCAGAC (SEQ ID NO: 50) (SEQ ID NO: 55) IL-22 TTTCCTGACCAAACTCAGCA CTGGATGTTCTGGTCGTCAC (SEQ ID NO: 51) (SEQ ID NO: 56) IL-23 CACCTCCCTACTAGGACTCA TGGGCATCTGTTGGGTCT GC (SEQ ID NO: 52) (SEQ ID NO: 57)

    [0115] Experimental Results:

    [0116] 1. siPCSK9 can significantly reduce the expression of PCSK9 in the skin of B6 mice one day after being applied to the skin (p<0.05); inhibition rate is over 80% (FIG. 14). A day after siPCSK9 treatment of skin, it can inhibit the expression of NF K B, IL-17, IL-22, IL-23 and other immune factors (Figure. 15). The expression of these inflammatory factors is closely related to the pathogenesis and severity of psoriasis, suggesting that siPCSK9 can inhibit the occurrence of psoriasis and alleviate the pathological reaction.

    [0117] 2. After 6 days of continuous application, there were significant erythema, scales and infiltration in the coating area of the model group, but only slight erythema, scale and infiltration in the siPCSK9 group (see FIG. 16). The therapeutic effect of siPCSK9 group on psoriasis lesions in mice was significantly better than that in control group (P<0.01), but no lesions were found in Vaseline group.

    [0118] 3. Daily scoring of skin lesions in B6 mice showed that the scores of erythema, scale, infiltration and the total scores (erythema+scale+infiltration) in siPCSK9 group were significantly lower than those in control group (P<0.01) (FIG. 16).

    [0119] 4. To further verify the inhibitory effect of siPCSK9 on psoriatic lesions induced by IMQ, we repeated the experiment in FIG. 16 in another wild mice BALB using the same treatment, and the results was very similar (FIG. 17).

    [0120] The specific embodiments are described above in detail. Within the knowledge of the technical personnel in this field, various changes can also be made without departing from the concept of the invention.