HUMAN COAGULATION FACTOR VII POLYPEPTIDES

Abstract

The present invention relates to novel human coagulation Factor VIIa variants having coagulant activity as well as polynucleotide constructs encoding such variants, vectors and host cells comprising and expressing the polynucleotide, pharmaceutical compositions, uses and methods of treatment.

Claims

1. A Factor VII polypeptide comprising one or more substitutions relative to the amino acid sequence of SEQ ID NO:1, wherein said substitutions are replacement with any other amino acid of one or more amino acids at a position selected from the group consisting of position 172, 173, 175, 176, 177, 196, 197, 198, 199, 200, 203, 235, 237, 238, 239, 240, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 297, 299, 319, 320, 321, 327, 341, 363, 364, 365, 366, 367, 370, and 373 corresponding to amino acid positions of SEQ ID NO:1 and wherein said Factor VII polypeptide exhibits increased resistance to inactivation by an endogenous inhibitor of said FVII polypeptide relative to wild-type human FVIIa.

2. The Factor VII polypeptide according to claim 1, wherein said Factor VII polypeptide has increased functional in vivo half-life relative to human wild-type Factor VIIa.

3. The Factor VII polypeptide according to claim 1, wherein the ratio between the activity of said Factor VII polypeptide and the activity of the native Factor VIIa polypeptide shown in SEQ ID NO:1 is at least about 1.25.

4. The Factor VII polypeptide according to claim 3, wherein said ratio is at least about 2.0.

5. The Factor VII polypeptide according to claim 1, which is selected from the group consisting of Q176A-FVII, Q176L-FVII, L177S-FVII, D196A-FVII, K197A-FVII, K199A-FVII, T238A-FVII, T239I-FVII, T239Y-FVII, Q286A-FVII, D289E-FVII, D289R-FVII, R290Q-FVII, M327Q-FVII, M327N-FVII, K341A-FVII, K341E-FVII, K341Q-FVII, S363M-FVII, S363A-FVII, W364H-FVII, and Q366E-FVII.

6. A polynucleotide construct encoding a Factor VII polypeptide according to claim 1.

7. The polynucleotide construct according to claim 6, which is a vector.

8. A host cell comprising the polynucleotide construct according to claim 6.

9. The host cell according to claim 8, which is a eukaryotic cell.

10. The host cell according to claim 9, which is of mammalian origin.

11. The host cell according to claim 10, wherein the cell is selected from the group consisting of CHO cells, HEK cells and BHK cells.

12. A transgenic animal containing and expressing the polynucleotide construct as defined in claim 6.

13. A transgenic plant containing and expressing the polynucleotide construct as defined in claim 6.

14. A method for producing the Factor VII polypeptide, the method comprising cultivating a cell as defined in claim 8 in an appropriate growth medium under conditions allowing expression of the polynucleotide construct and recovering the resulting polypeptide from the culture medium.

15. A pharmaceutical composition comprising a Factor VII polypeptide as defined in claim 1, and a pharmaceutically acceptable carrier.

16. A method for the treatment of bleeding disorders or bleeding episodes in a subject or for the enhancement of the normal haemostatic system, the method comprising administering a therapeutically or prophylactically effective amount of a Factor VII polypeptide as defined in claim 1 to a subject in need thereof.

17. The Factor VII polypeptide according to claim 1, wherein the Factor VII polypeptide comprises one or more further substitutions relative to the amino acid sequence of SEQ ID NO:1 at position 158, 296, and/or 298.

18. The Factor VII polypeptide according to claim 1, wherein the Factor VII polypeptide is V158D/E296V/Q286N/M298Q-FVIIa.

19. The Factor VII polypeptide of claim 1, wherein the Factor VII polypeptide is Q286N-FVIIa.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0342] FIG. 1. shows the full amino acid sequence of native (wild type) human coagulation Factor VII (SEQ ID NO:1).

[0343] FIG. 2. The graph illustrates the loss of activity upon ATIII inhibition (relative to WT FVIIa) plotted against the FX activation data (relative to WT FVIIa) for all the FVIIa mutants generated according to example 7. The coloured box marks the area of the plot with FVIIa mutants having high proteolytic activity and slow inhibition by ATIII. WT FVIIa is marked by a filled black circle. The filled grey/red circles indicate the four most interesting FVIIa mutants.

EXAMPLES

Example 1

Site-Directed Mutagenesis:

[0344] In the following, both FVIIa numbering and chymotrypsin numbering may be used. The chymotrypsin numbering is written in parentheses after the FVIIa numbering and is marked with c and the residue number, e.g. Asp289 (c146). Residues important in the substrate specificity of FVIIa were identified by site-directed mutagenesis.

[0345] Mutations were introduced in the FVII gene using QuikChange® II Site-Directed Mutagenesis Kit (Stratagene) according to the manufacturers' recommendations. Briefly, PCR-reactions contained 25 ng of plasmid pLN174, 10 pmol of each mutagenic oligonucleotide primer, 5 μl of 10× reaction buffer, 1 μl of dNTP mix, and 1 μl of PfuUltra High-Fidelity DNA polymerase (2.5 U/μl) in a total volume of 50 μl. The PCR conditions consisted of 30 seconds of heating at 95° C. followed by 18 cycles consisting of 30 seconds at 95° C., an annealing step for 1 minute at 55° C. and an extension step for 7 minutes at 68° C. Following amplification, 1 μl of DpnI (10 U/μl) was added and the PCR-tubes were incubated for 1 hour at 37° C. in order to digest non-mutated supercoiled double stranded DNA. DpnI-treated DNA (1 μl) was transformed into 50 μl of XL1-Blue supercompetent cells by the heat-shock procedure and then plated on LB agar plates containing 100 μg/ml carbenicillin. All mutant plasmids were sequenced to verify the mutations.

TABLE-US-00002 Mutagenic primers from MWG-Biotech AG (Germany): oT239I-f (SEQ ID NO: 2): CGTACGTCCCGGGCACCATCAACCACGACATCGCG oT239I-r (SEQ ID NO: 3): CGCGATGTCGTGGTTGATGGTGCCCGGGACGTACG oT239Y-f (SEQ ID NO: 4): CGTACGTCCCGGGCACCTACAACCACGACATCGCG oT239Y-r (SEQ ID NO: 5): CGCGATGTCGTGGTTGTAGGTGCCCGGGAC- GTACG oD289E-f (SEQ ID NO: 6): GCTGGGGCCAGCTGCTGGAACGTGGCGCCAC- GGCC oD289E-r (SEQ ID NO: 7): GGCCGTGGCGCCACGTTCCAG- CAGCTGGCCCCAGC oD289R-f (SEQ ID NO: 8): GCTGGGGCCAGCTGCTGAGACGTGGCGCCAC- GGCC oD289R-r (SEQ ID NO: 9): GGCCGTGGCGCCACGTCTCAG- CAGCTGGCCCCAGC oK341A-f (SEQ ID NO: 10): GCAGCAAGGACTCCTGCGCAGGGGACAGTG- GAGGCCC oK341A-r (SEQ ID NO: 11): GGGCCTCCACTGTCCCCTGCGCAGGAGTCCTT- GCTGC oK341E-f (SEQ ID NO: 12): GCAGCAAGGACTCCTGCGAAGGGGACAGTG- GAGGCCC oK341E-r (SEQ ID NO: 13): GGGCCTCCACTGTCCCCTTCGCAGGAGTCCTT- GCTGC oK341Q-f (SEQ ID NO: 14): GCAGCAAGGACTCCTGCCAAGGGGACAGTG- GAGGCCC oK341Q-r (SEQ ID NO: 15): GGGCCTCCACTGTCCCCTTGGCAGGAGTCCTT- GCTGC oM327N-f (SEQ ID NO: 16): CCCCAAATATCACGGAG- TACAACTTCTGTGCCGGC oM327N-r (SEQ ID NO: 17): GCCGGCACAGAAGTTGTACTCCGTGATATTT- GGGG oM327Q-f (SEQ ID NO: 18): CCCCAAATATCACGGAGTACCAG- TTCTGTGCCGGC oM327Q-r (SEQ ID NO: 19): GCCGGCACAGAACTGGTACTCCGTGATATTT- GGGG oS363A-f (SEQ ID NO: 20): CCTGACGGGCATCGTCGCCTGGGGCCAGGGC oS363A-r (SEQ ID NO: 21): GCCCTGGCCCCAGGCGACGATGCCCGTCAGG oS363M.f (SEQ ID NO: 22): CCTGACGGGCATCGTCATGTGGGGCCAGGGC oS363M-r (SEQ ID NO: 23): GCCCTGGCCCCACATGACGATGCCCGTCAGG oW364H-f (SEQ ID NO: 24): GACGGGCATCGTCAGCCACGGCCAGGGCTGCGC oW364H-r (SEQ ID NO: 25): GCGCAGCCCTGGCCGTGGCTGACGATGCCCGTC oQ366E-f (SEQ ID NO: 26): GGCATCGTCAGCTGGGGCGAAGGCTGCG- CAACCG oQ366E-r (SEQ ID NO: 27): CGGTTGCGCAGCCTTCGCCCCAGCTGACGATGCC

Example 2

Mammalian Expression of FVII Mutants:

[0346] Baby Hamster Kidney cells (BHK) were transfected with 1.5 μg DNA of each mutant FVII expression plasmid. 5.Math.10.sup.6 BHK-cells were seeded in a T175 Nunc Easy Flask with culture medium (Dubeccos Modified Eagles medium (DMEM) with glutamax-1 from Gibco (containing sodium pyruvate, pyridoxine and 4500 g/L glucose), 10% Fetal Bovine Serum (FBS) and 1% penicillin and streptomycin). After three days of incubation in the CO.sub.2-incubator, the cells were trypsinated and 0.5.Math.10.sup.6 cells per T25 Nunc Easy Flask were seeded in 5 ml of culture medium.

[0347] The FVII mutants were transfected using the FuGene™ 6 Transfection Reagent from Roche. 155 μl of DMEM was mixed with 3 μl of FuGene6 Transfection Reagent in a small cryo tube and incubated for 5 minutes at room temperature. 1.5 μg DNA of each mutant was pipetted into a new cryo tube and the DMEM-FuGene6 transfection mix was added drop wise to the DNA. After 15 minutes of incubation at room temperature the FuGene6/DMEM/DNA mixture was added drop wise to a T25 Nunc flask seeded with BHK cells. An extra T25 flask not transfected was included as control.

[0348] After over night incubation in the CO.sub.2-incubator the media was changed to selection media (DMEM, 10% FBS, 1% penicillin and streptomycin and 1 μM methotrexate (MTX)). MTX is an inhibitor of dihydrofolate reductase. Only transfected cells are expected to survive the MTX treatment since the mutant FVII plasmids express highly elevated levels of dihydrofolate reductase thereby selecting for MTX-resistant cells. The selection media was changed approximately every second day for 2 weeks. At confluence, the cells were trypsinated and transferred to T175 flasks with 30 ml of selection medium. After 2-3 days of incubation in the CO.sub.2-incubator, the cells were trypsinated and transferred to 1×3 layer cell factories with 100 ml of culture medium (DMEM, 10% FBS, 1% Penicillin and Streptomycin). At confluence, the media was removed and 100 ml of production media (DMEM, 2% FBS, 1% Penicillin and Streptomycin and 2.5 μl of Vitamin K per 500 ml DMEM) was added to each cell factory. After two days of incubation the supernatants were harvested and 100 ml of new production media was added to each 1×3 layer flask. Harvest and addition of new production media were done 3 times pr. week (total 5 times).

Example 3

Purification of FVII Mutants:

[0349] The FVII mutants were purified by a two-step procedure using an AKTA Explorer from Amersham Biosciences: [0350] 1. Ion exchange chromatography using a Q-Sepharose Fast Flow column (anion exchanger) ˜50 ml (Amersham Biosciences) [0351] 2. Affinity chromatography using a F1A2 Sepharose 4B anti-FVII Antibody Column ˜10 ml.

[0352] The five harvested supernatants from each mutant were pooled and adjusted to pH 8 and a final concentration of 10 mM Tris and 5 mM EDTA. The conductivity was adjusted to λ=11.6 mS/cm with deionised water. The supernatants were applied to the Q-Sepharose Fast Flow column equilibrated with 10 mM Tris, 50 mM NaCl pH 8.0. FVII has an isoelectric point of 7 at pH=8 allowing FVII to bind to the Q-Sepharose column. After washing with equilibration buffer until baseline was low, the proteins were eluted with a linear gradient with 10 mM Tris, 50 mM NaCl, 25 mM CaCl.sub.2) pH 8.0. The top fractions were pooled and adjusted to pH 7.5 and applied to the antibody column equilibrated with 50 mM Hepes, 100 mM NaCl, 10 mM CaCl.sub.2) pH 7.5. The column was washed with equilibration buffer until baseline was low and high NaCl buffer (50 mM Hepes, 2 M NaCl, 10 mM CaCl.sub.2), pH 7.5) was run on the column followed by wash with equilibration buffer. The proteins were eluted with a linear gradient with 50 mM Hepes, 100 mM NaCl, 10 mM EDTA pH 7.5. The top fractions were pooled and 1 M CaCl.sub.2) was added to a final concentration of 15 mM. The purified mutants were concentrated to a volume of ˜1 ml with a Millicon15 from Millipore removing components below 15000 Da. The FVII mutants were left for auto-activation at room temperature for a few days. The mutants that were unable to auto-activate as elucidated by SDS-PAGE, were activated by immobilised FXa by coupling FXa to CnBr activated Sepharose from Amersham Biosciences.

Example 4

Amidolytic Activity of FVIIa Mutants:

[0353] The amidolytic activity of mutant FVIIa towards the chromogenic substrate S-2288 (Chromogenix) was assayed at substrate concentrations ranging from 0.2-10 mM in buffer containing 50 mM HEPES, pH 7.4, 100 mM NaCl, 5 mM CaCl.sub.2), 1 mg/ml BSA. Reactions were initiated by addition of enzyme to final concentrations of 100 nM and 10 nM in the absence or presence of 100 nM sTF, respectively. Product formation was monitored continuously at 405 nm in a Spectramax 340 Microplate spectrophotometer. Initial velocities were plotted against the substrate concentrations and the data were fitted to the Michaelis-Menten equation using non-linear regression analysis to obtain the k.sub.cat and K.sub.M values. When K.sub.M>5 mM, only k.sub.cat/K.sub.M were determined by linear fit of data at low substrate concentrations. A standard curve generated with concentrations of pNA from 0.06-0.6 mM was used to convert the absorbance units into molar concentrations.

Results:

Amidolytic Activity as Measured by the “In Vitro Hydrolysis Assay”:

S-2288 Hydrolysis:

[0354]

TABLE-US-00003 K.sub.M k.sub.cat k.sub.cat/K.sub.M Fold enhancenment (mM) (s.sup.−1) (mM.sup.−1 .Math. s.sup.−1) by sTF FVIIa  0.92 ± 0.007 FVIIa-sTF 1.27 ± 0.13 33.17 ± 0.91 26.12 ± 2.77  28.39 T238A-sTF 37.71 ± 2.82  T239A-sTF 5.45 ± 0.15 T239G-sTF  2.40 ± 0.036 T239I  0.29 ± 0.014 T239I-sTF 12.72 ± 0.33 19.71 ± 2.26  67.97 T239Y  0.031 ± 0.0015 T239Y-sTF 2.47 ± 0.18 79.68 D289E 1.43 ± 0.09 D289E-sTF  0.66 ± 0.037 21.93 ± 0.32 33.23 ± 1.93  23.24 K341A 0.63 ± 0.02 K341A-sTF 1.45 ± 0.15 29.96 ± 0.98 20.66 ± 2.24  32.79 K341E 2.99 ± 0.28 K341E-sTF 1.04 ± 0.13 23.51 ± 0.89 22.60 ± 2.95  7.56 K341Q 1.05 ± 0.05 K341Q-sTF 0.81 ± 0.06 26.60 ± 0.54 32.83 ± 2.52  31.27 M327N  0.048 ± 0.0008 M327N-sTF 0.97 ± 0.01 20.21 M327Q  0.17 ± 0.003 M327Q-sTF 1.79 ± 0.06 10.53 S363M-sTF  0.36 ± 0.002 W364H  0.11 ± 0.002 W364H-sTF  0.92 ± 0.002 8.36 Q366E 1.11 ± 0.02 Q366E-sTF 1.46 ± 0.15 28.95 ± 0.89 19.83 ± 2.13  17.86

Example 5

Proteolytic Activity of FVIIa Mutants as Measured by “In Vitro Proteolysis Assay”:

[0355] Kinetic parameters of FX activation were determined using a two-stage assay. Each variant (10 nM) was incubated with 100 nM sTF and 0.1-6.4 μM FX (Enzyme Research Laboratories Ltd) in a total volume of 100 μl for 20 min at room temperature. Reactions were quenched by addition of 50 μl stop buffer (50 mM Hepes pH 7.4, 100 mM NaCl, 20 mM EDTA) and the amount of FXa generated determined by addition of 50 μl 2 mM chromogenic substrate S-2765 (Chromogenix). S-2765 cleavage was monitored at 405 nm using a Spectramax 340 Microplate spectrophotometer. The amount of FXa generated on a molar basis was estimated from standard curves using final concentrations of 0.5-10 nM FXa (Enzyme Research Laboratories Ltd). Pseudo first-order kinetics was assumed since less than 10% of the total amount of FX was converted to FXa during the assay. k.sub.cat/K.sub.M values were determined by linear fits of the initial velocities.

Results:

Proteolytic Activity:

FX Activation:

[0356]

TABLE-US-00004 k.sub.cat/K.sub.M (M.sup.−1 .Math. s.sup.−1) FVIIa-sTF 2329 ± 65  T238A-sTF 419 ± 27 T239A-sTF 69 ± 5 T239G-sTF .sup. 23 ± 0.6 T239I-sTF 1930 ± 117 T239Y-sTF 2099 ± 1  D289E-sTF 3707 ± 24  K341A-sTF 397 ± 18 K341E-sTF 24 ± 1 K341Q-sTF 509 ± 27 M327Q-sTF 515 ± 24 M327N-sTF 465 ± 37 S363M-sTF   5 ± 0.3 W364H-sTF 596 ± 18 Q366E-sTF 1391 ± 10  S363M-sTF 112 ± 1 

Example 6

Inhibition of FVIIa-sTF by ATIII:

[0357] The rate of inactivation of FVIIa and FVIIa mutants by ATIII (American Diagnostica Inc.) was measured under pseudo-first-order conditions by a continuous assay method in the presence of low molecular weight (LMW) heparin (Calbiochem) and sTF. All reagents were equilibrated at room temperature and the assay was performed in a buffer containing 50 mM Hepes pH 7.4, 100 mM NaCl, 5 mM CaCl.sub.2), 1 mg/ml BSA, 0.1% PEG 8000. To maintain pseudo-first order conditions during the reaction, >10-fold molar excess of inhibitor over protease was used. Equal volumes of FVIIa (final concentration 40 nM) and sTF (final concentration 400 nM) were combined at pre-equilibrated 30 min at room temperature prior to assay initiation. In 96-well plates 20 μl of LMW Heparin (final concentration 3 μM) was mixed with 20 μl of ATIII in varying concentrations (final concentrations 50-750 nM) in a total volume of 130 μl resulting in 10-150 fold excess of ATIII over FVIIa. A blank without ATIII was included to show a linear initial rate throughout the assay. The reactions were started by addition of 50 μl of the FVIIa-sTF mixture to each well resulting in a final concentration of 5 nM FVIIa and 50 nM sTF followed by addition of 20 μl S-2288 (final concentration 200 μM). Kinetics was monitored for 30 minutes at 405 nm using a Spectramax 340 Microplate spectrophotometer to obtain progress curves at each inhibitor concentration. The progress curves were fitted to Eq. 1 to determine the k.sub.obs values:

[00001]$\begin{array}{cc}{\left[\mathrm{Pr}\right]}_t={\left[\mathrm{Pr}\right]}_0+\frac{V_0}{{\kappa }_{obs}}\left(1-\exp \left(-k_{obs}t\right)\right)& \mathrm{Eq}.1\end{array}$

[0358] Here, [Pr].sub.0 and [Pr] represent the concentration of product at time zero and t, respectively. To obtain K.sub.D and k.sub.Lim values Eq. 2 was fitted to a plot of the estimated k.sub.obs values against the inhibitor concentrations.

[00002]$\begin{array}{cc}{k}_{obs}=\frac{{k_{L\mathrm{im}}\left[I\right]}_0}{K_D\left(1+\frac{{\left[S\right]}_0}{K_M}\right)+{\left[I\right]}_0}& \mathrm{Eq}.2\end{array}$

[0359] Here, K.sub.D represents the dissociation constant of the non-covalent enzyme-inhibitor Michaelis-type complex and k.sub.Lim is the observed rate constant for formation of the irreversible inhibitor-protease complex. The apparent second order rate constant of inhibition, kink, is then given by:

[00003]$k_{inh}=\frac{k_{L\mathrm{im}}}{K_D}$

First Order Rate Constant of Complex Breakdown, k.sub.brkdn:

[0360] FVIIa (500 nM) was reacted with 2000 nM of sTF, 1250 or 2500 nM of ATIII and a four fold excess of LMW Heparin over ATIII. Reactions were incubated at room temperature for an hour at which time the reaction had run to completion. Each reaction was then diluted 400, 450 and 500 times into 200 μl reaction mixtures in a 96-well plate containing a final concentration of 4 mM S-2288 and 100 μg/ml of Polybrene (heparin chelating agent from Sigma). The absorbance increase at 405 nm was measured for 12 hours at 405 nm using a Spectramax 340 Microplate spectrophotometer. The absorbance curves were plotted against the time and first-order rate constants of complex breakdown were determined by fitting the curves to a single exponential function. The observed first order rate constants (k) were converted to half lives (T.sub.1/2) according to the relationship k=ln(2)/T.sub.1/2.

Results:

ATIII Inhibition of FVIIa Mutants:

Rate Constants for ATIII Inhibition:

[0361]

TABLE-US-00005 Relative inhibition k.sub.inh (k.sub.inh/ k.sub.Lim (s.sup.−1) K.sub.D (M) (M.sup.−1 .Math. s.sup.−1) k.sub.inh(wtFVIIa) FVIIa 0.00488 ± 0.000315 1.812 .Math. 10.sup.−7 ± 3.326 .Math. 10.sup.−8 26917 ± 1019 1.00 T238A 0.0074 ± 0.00043 2.39 .Math. 10.sup.−7 ± 3.58 .Math. 10.sup.−8 30844 ± 4947 1.15 T239A 0.0016 ± 0.00010 2.60 .Math. 10.sup.−7 ± 4.14 .Math. 10.sup.−8  6160 ± 1058 0.23 T239G 0.0015 ± 0.00014 1.14 .Math. 10.sup.−7 ± 7.12 .Math. 10.sup.−8  4688 ± 1155 0.17 T239Y 0.00533 ± 0.000294 1.743 .Math. 10.sup.−7 ± 2.659 .Math. 10.sup.−8 30591 ± 805  1.14 T239I 0.00254 ± 0.000074 1.678 .Math. 10.sup.−7 ± 1.271 .Math. 10.sup.−8 15146 ± 100  0.56 D289E 0.00322 ± 0.000132 6.742 .Math. 10.sup.−8 ± 1.155 .Math. 10.sup.−8 47786 ± 1481 1.78 Q366E 0.00255 ± 0.000106 2.489 .Math. 10.sup.−7 ± 2.631 .Math. 10.sup.−8 10229 ± 132  0.38

First Order Rate Constants and Half Life for Breakdown of ATIII-FVIIa Complexes:

[0362]

TABLE-US-00006 k.sub.brkdn (s.sup.−1) T.sub.1/2 (hours) FVIIa 3.43 .Math. 10.sup.−5 5.63 T238A 3.39 .Math. 10.sup.−5 5.7 T239A 2.85 .Math. 10.sup.−5 6.8 T239G 1.61 .Math. 10.sup.−5 12.0 D289E 9.16 .Math. 10.sup.−5 2.12 T239I 1.02 .Math. 10.sup.−4 1.93 T239Y 2.08 .Math. 10.sup.−5 9.32 Q366E 2.31 .Math. 10.sup.−5 8.36
Rate constants were measured in the presence of sTF and LMW heparin.

Example 7

Screening of Transiently Expressed FVII Mutants

[0363] A high throughput system for screening of FVIIa mutants was employed based on the FreeStyle™ 293-F transient expression system from Invitrogen. An enteropeptidase cleavage site had been engineered into a FVII expression plasmid by replacing amino acids 148-151 with four Asp residues setup previously in the laboratory. To prevent further proteolysis at the Arg290-Gly291 (c147-c149) bond by enteropeptidase, the mutation D289A (c146) was also introduced into the expression plasmid. A model of the ATIII-FVIIa-sTF complex was generated from the crystal structure of a trypsin-serpin complex. The productive loop conformation of the RCL of the serpin was modelled to ATIII and the final complex was generated based on the trypsin-serpin structure. Based on the model of the ATIII-FVIIa-sTF complex, a total of 26 FVII mutants were generated in the FVII D289A (c146) enteropeptidase background by QuickChange site-directed mutagenesis (Table 3).

[0364] The FVII variants were transiently expressed in human embryonic kidney cells in serum-free expression media yielding expression levels of 2-3 mg FVII per litre media for the majority of the FVIIa variants as deduced from ELISA determinations. Expression level of V172A (c35), Q176L (c40), D196A (c60), T293L (c151), D319A (c170G)<0.2 mg per litre. The activated fraction representing functional FVIIa for each FVIIa mutant was characterized with respect to amidolytic and proteolytic activity and ATIII inhibition (Table 3).

[0365] The amidolytic activity towards S-2288 was measured in the presence of sTF. The proteolytic activity as measured by activation of FX could not be determined in the presence of sTF due to tiny amounts of cell components present in the media accelerating the auto-activation of FX by providing a phospholipid surface. Instead, FX activation was performed in the presence of relipidated TF (Innovin). The low-expression mutants (V172A (c35), Q176L (c40), D196A (c60), T293L (c151), D319A (c170G)) could only be characterized with respect to the proteolytic activity. V235A (c95) showed no activity towards S-2288; therefore only FX activation was performed for this mutant.

[0366] The majority of the FVIIa mutants had amidolytic and proteolytic activities >75% relative to WT FVIIa. Only V235A (c95), N240D (c100), T293A (c151), G367E (c219) and H373K (c224) and the low-expression mutants (V172A (c35), Q176L (c40), D196A (c60), T293L (c151), D319A (c170G)) showed proteolytic activities <60% relative to WT FVIIa. The rate of ATIII inhibition was determined by measuring the loss of amidolytic activity after 30 minutes of incubation with a 10-fold excess of ATIII relative to FVIIa in the presence of sTF and LMW heparin. The absolute loss of activity ranged from 2% for H373K (c224) to 55% for P321A (c170I).

[0367] Table 3. Kinetic analysis of WT FVIIa (D289A (c146) background) and a total of 26 FVIIa mutants expressed in a transient expression system with respect to 1) hydrolysis of 1 mM S-2288, 2) activation of 150 nM FX and 3) inhibition by 100 nM ATIII-LMW heparin. The amidolytic assay and the ATIII assay was performed in the presence of a ten fold excess of sTF relative to FVIIa. The proteolytic assay was performed in the presence of relipidated TF. All assays were performed in 50 mM Hepes, 100 mM NaCl, 5 mM CaCl.sub.2), 1 mg/ml BSA, pH 7.4. Abbreviations: N.D.: Not determined because of low expression level.

TABLE-US-00007 Amidolytic FX Chymo- activity activation ATIII inhibition FVII trypsin Relative to Relative to Loss of Relative to numbering numbering WT (%) WT (%) activity (%) WT (%) WT FVIIa WT FVIIa 100 100 36 100  V172A V35A N.D. 19 N.D. N.D. N173A N37A 121 90 22 61 A175K A39K 131 105 37 104  Q176A Q40A 114 75  6 17 Q176L Q40L N.D. 8 N.D. N.D. L177F L41F 119 77 35 97 D196A D60A N.D. 8 N.D. N.D. K197A K60(A)A 160 70 30 84 I198A I60(B)A  95 86 19 53 K199A K60(C)A 110 98 15 43 N200A N60(D)A  92 91 35 99 N203A V63A 163 98 28 78 V235A V95A N.D. 2 N.D. N.D. T238K T98K 108 92 41 115  N240D N100D  49 58 15 42 Q286A Q143A  95 83 27 77 R290K R147K 117 76 18 51 T293A T151A  86 59  4 12 T293L T151L N.D. 6 N.D. N.D. D319A D170(G)A N.D. 8 N.D. N.D. S320A S170(H)A 146 90 35 99 P321A P170(I)A  80 82 55 155  P321G P170(I)G  74 73 23 64 G367E G219E  16 10  5 13 T370A T221A 152 81 42 117  H373K H224K  16 40  2  4

[0368] To identify FVIIa mutants able to activate FX at a reasonable rate but less prone to inhibition by ATIII, the loss of activity upon ATIII inhibition (relative to WT FVIIa) was plotted against the FX activation data (relative to WT FVIIa) for all the FVIIa mutants as illustrated in FIG. 2. The coloured box in FIG. 2 marks FVIIa mutants showing high proteolytic activity and slow inhibition by ATIII relative to WT FVIIa.

Embodiments According the Invention

[0369] 1. A Factor VII polypeptide comprising one or more substitutions relative to the amino acid sequence of SEQ ID NO:1, wherein said substitutions are replacement with any other amino acid of one or more amino acids at a position selected from the group consisting of position 172, 173, 175, 176, 177, 196, 197, 198, 199, 200, 203, 235, 237, 238, 239, 240, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 297, 299, 319, 320, 321, 327, 341, 363, 364, 365, 366, 367, 370, 373 corresponding to amino acid positions of SEQ ID NO:1 and wherein said Factor VII polypeptide exhibits increased resistance to inactivation by an endogenous inhibitor of said FVII polypeptide relative to wild-type human FVIIa.
2. The Factor VII polypeptide according to embodiment 1, wherein said Factor VII poly-peptide has increased functional in vivo half-life relative to human wild-type Factor VIIa.
3. The Factor VII polypeptide according to embodiments 1 or 2, wherein A175 is replaced with any other amino acid.
4. The Factor VII polypeptide according to any one of embodiments 1-3, wherein Q176 is replaced with any other amino acid.
5. The Factor VII polypeptide according to any of embodiments 1-4, wherein L177 is re-placed with any other amino acid.
6. The Factor VII polypeptide according to any of embodiments 1-5, wherein D196 is re-placed with any other amino acid.
7. The Factor VII polypeptide according to any of embodiments 1-6, wherein K197 is re-placed with any other amino acid.
8. The Factor VII polypeptide according to any of embodiments 1-7, wherein 1198 is re-placed with any other amino acid.
9. The Factor VII polypeptide according to any of embodiments 1-8, wherein K199 is re-placed with any other amino acid.
10. The Factor VII polypeptide according to any of embodiments 1-9, wherein G237 is re-placed with any other amino acid.
11. The Factor VII polypeptide according to any of embodiments 1-10, wherein T238 is replaced with any other amino acid.
12. The Factor VII polypeptide according to any of embodiments 1-11, wherein T239 is replaced with any other amino acid.
13. The Factor VII polypeptide according to any of embodiments 1-12, wherein Q286 is replaced with any other amino acid.
14. The Factor VII polypeptide according to any of embodiments 1-13, wherein L287 is replaced with any other amino acid.
15. The Factor VII polypeptide according to any of embodiments 1-14, wherein L288 is replaced with any other amino acid.
16. The Factor VII polypeptide according to any of embodiments 1-15, wherein D289 is replaced with any other amino acid.
17. The Factor VII polypeptide according to any of embodiments 1-16, wherein R290 is replaced with any other amino acid.
18. The Factor VII polypeptide according to any of embodiments 1-17, wherein G291 is replaced with any other amino acid.
19. The Factor VII polypeptide according to any of embodiments 1-18, wherein A292 is replaced with any other amino acid.
20. The Factor VII polypeptide according to any of embodiments 1-19, wherein T293 is replaced with any other amino acid.
21. The Factor VII polypeptide according to any of embodiments 1-20, wherein A294 is replaced with any other amino acid.
22. The Factor VII polypeptide according to any of embodiments 1-21, wherein L295 is replaced with any other amino acid.
23. The Factor VII polypeptide according to any of embodiments 1-22, wherein L297 is replaced with any other amino acid.
24. The Factor VII polypeptide according to any of embodiments 1-23, wherein V299 is replaced with any other amino acid.
25. The Factor VII polypeptide according to any of embodiments 1-24, wherein M327 is replaced with any other amino acid.
26. The Factor VII polypeptide according to any of embodiments 1-25, wherein K341 is replaced with any other amino acid.
27. The Factor VII polypeptide according to any of embodiments 1-26, wherein S363 is replaced with any other amino acid.
28. The Factor VII polypeptide according to any of embodiments 1-27, wherein W364 is replaced with any other amino acid.
29. The Factor VII polypeptide according to any of embodiments 1-28, wherein G365 is replaced with any other amino acid.
30. The Factor VII polypeptide according to any of embodiments 1-29, wherein Q366 is replaced with any other amino acid.
31. The Factor VII polypeptide according to any of embodiments 1-30, wherein V172 is replaced with any other amino acid.
32. The Factor VII polypeptide according to any of embodiments 1-31, wherein N173 is replaced with any other amino acid.
33. The Factor VII polypeptide according to any of embodiments 1-32, wherein N200 is replaced with any other amino acid.
34. The Factor VII polypeptide according to any of embodiments 1-33, wherein N203 is replaced with any other amino acid.
35. The Factor VII polypeptide according to any of embodiments 1-34, wherein V235 is replaced with any other amino acid.
36. The Factor VII polypeptide according to any of embodiments 1-35, wherein N240 is replaced with any other amino acid.
37. The Factor VII polypeptide according to any of embodiments 1-36, wherein D319 is replaced with any other amino acid.
38. The Factor VII polypeptide according to any of embodiments 1-37, wherein S320 is replaced with any other amino acid.
39. The Factor VII polypeptide according to any of embodiments 1-38, wherein P321 is replaced with any other amino acid.
40. The Factor VII polypeptide according to any of embodiments 1-39, wherein G367 is replaced with any other amino acid.
41. The Factor VII polypeptide according to any of embodiments 1-40, wherein T370 is replaced with any other amino acid.
42. The Factor VII polypeptide according to any of embodiments 1-41, wherein H373 is replaced with any other amino acid.
43. The Factor VII polypeptide according to embodiment 12, wherein T239 is replaced with any other amino acid selected from Gly, Ala, Val, Leu, Ile, Phe, Met, Trp, Tyr, Asp, Asn, Glu, Gln, His, Lys, Arg, Cys, Ser
44. The Factor VII polypeptide according to embodiment 16, wherein D289 is replaced with any other amino acid selected from Gly, Ala, Val, Leu, Ile, Phe, Met, Trp, Tyr, Asn, Glu, Gln, His, Lys, Arg, Cys, Ser, Thr
45. The Factor VII polypeptide according to embodiment 25, wherein M327 is replaced with any other amino acid selected from Gly, Ala, Val, Leu, Ile, Phe, Trp, Tyr, Asp, Asn, Glu, Gln, His, Lys, Arg, Cys, Ser, Thr.
46. The Factor VII polypeptide according to embodiment 26, wherein K341 is replaced with any other amino acid selected from Gly, Ala, Val, Leu, Ile, Phe, Met, Trp, Tyr, Asp, Asn, Glu, Gln, His, Arg, Cys, Ser, Thr.
47. The Factor VII polypeptide according to embodiment 27, wherein S363 is replaced with any other amino acid selected from Gly, Ala, Val, Leu, Ile, Phe, Met, Trp, Tyr, Asp, Asn, Glu, Gln, His, Lys, Arg, Cys, Thr.
48. The Factor VII polypeptide according to embodiment 31, wherein V172 is replaced with any other amino acid selected from Gly, Ala, Leu, Ile, Phe, Met, Trp, Tyr, Asp, Asn, Glu, Gln, His, Lys, Arg, Cys, Ser, Thr
49. The Factor VII polypeptide according to embodiment 32, wherein N173 is replaced with any other amino acid selected from Gly, Ala, Val, Leu, Ile, Phe, Met, Trp, Tyr, Asp, Glu, Gln, His, Lys, Arg, Cys, Ser, Thr
50. The Factor VII polypeptide according to embodiment 33, wherein N200 is replaced with any other amino acid selected from Gly, Ala, Val, Leu, Ile, Phe, Met, Trp, Tyr, Asp, Glu, Gln, His, Lys, Arg, Cys, Ser, Thr
51. The Factor VII polypeptide according to embodiment 34, wherein N203 is replaced with any other amino acid selected from Gly, Ala, Val, Leu, Ile, Phe, Met, Trp, Tyr, Asp, Glu, Gln, His, Lys, Arg, Cys, Ser, Thr
52. The Factor VII polypeptide according to embodiment 35, wherein V235 is replaced with any other amino acid selected from Gly, Ala, Leu, Ile, Phe, Met, Trp, Tyr, Asp, Asn, Glu, Gln, His, Lys, Arg, Cys, Ser, Thr
53. The Factor VII polypeptide according to embodiment 36, wherein N240 is replaced with any other amino acid selected from Gly, Ala, Val, Leu, Ile, Phe, Met, Trp, Tyr, Asp, Glu, Gln, His, Lys, Arg, Cys, Ser, Thr
54. The Factor VII polypeptide according to embodiment 37, wherein D319 is replaced with any other amino acid selected from Gly, Ala, Val, Leu, Ile, Phe, Met, Trp, Tyr, Asn, Glu, Gln, His, Lys, Arg, Cys, Ser, Thr
55. The Factor VII polypeptide according to embodiment 38, wherein S320 is replaced with any other amino acid selected from Gly, Ala, Val, Leu, Ile, Phe, Met, Trp, Tyr, Asp, Asn, Glu, Gln, His, Lys, Arg, Cys, Thr
56. The Factor VII polypeptide according to embodiment 39, wherein P321 is replaced with any other amino acid selected from Gly, Ala, Val, Leu, Ile, Phe, Met, Trp, Tyr, Asp, Asn, Glu, Gln, His, Lys, Arg, Cys, Ser, Thr
57. The Factor VII polypeptide according to embodiment 40, wherein G367 is replaced with any other amino acid selected from Ala, Val, Leu, Ile, Phe, Met, Trp, Tyr, Asp, Asn, Glu, Gln, His, Lys, Arg, Cys, Ser, Thr
58. The Factor VII polypeptide according to embodiment 41, wherein T370 is replaced with any other amino acid selected from Gly, Ala, Val, Leu, Ile, Phe, Met, Trp, Tyr, Asp, Asn, Glu, Gln, His, Lys, Arg, Cys, Ser.
59. The Factor VII polypeptide according to embodiment 42, wherein H373 is replaced with any other amino acid selected from Gly, Ala, Val, Leu, Ile, Phe, Met, Trp, Tyr, Asp, Asn, Glu, Gln, Lys, Arg, Cys, Ser, Thr
60. The Factor VII polypeptide according to any of embodiments 1-59, wherein at least one amino acid in the remaining positions in the protease domain has been re-placed with any other amino acid.
61. The Factor VII polypeptide according to embodiments 60, wherein at the most 20 additional amino acids in the remaining positions in the protease domain have been replaced with any other amino acids.
62. The Factor VII polypeptide according to any of embodiments 1-61, wherein at least one amino acid corresponding to an amino acid at a position selected from 157-170 of SEQ ID NO:1 has been replaced with any other amino acid.
63. The Factor VII polypeptide according to any of embodiments 1-62, wherein at least one amino acid corresponding to an amino acid at a position selected from 290-305 of SEQ ID NO:1 has been replaced with any other amino acid.
64. The Factor VII polypeptide according to any of embodiments 1-63, wherein R304 has been replaced by an amino acid selected from the group consisting of Tyr, Phe, Leu, and Met.
65. The Factor VII polypeptide according to any of embodiments 1-64, wherein at least one amino acid corresponding to an amino acid at a position selected from 306-312 of SEQ ID NO:1 has been replaced with any other amino acid.
66. The Factor VII polypeptide according to any of embodiments 1-64, wherein M306 has been replaced by an amino acid selected from the group consisting of Asp, and Asn.
67. The Factor VII polypeptide according to any of embodiments 1-66, wherein D309 has been replaced by an amino acid selected from the group consisting of Ser, and Thr.
68. The Factor VII polypeptide according to any of embodiments 1-67, wherein at least one amino acid corresponding to an amino acid at a position selected from 330-339 of SEQ ID NO:1 has been replaced with any other amino acid.
69. The Factor VII polypeptide according to any of embodiments 1-68, wherein A274 has been replaced with any other amino acid.
70. The Factor VII polypeptide according to embodiment 69, wherein said A274 has been replaced by an amino acid selected from the group consisting of Met, Leu, Lys, and Arg.
71. The Factor VII polypeptide according to any of embodiments 1-70, wherein K157 has been replaced by an amino acid selected from the group consisting of Gly, Val, Ser, Thr, Asn, Gln, Asp, and Glu.
72. The Factor VII polypeptide according to any of embodiments 1-71, wherein K337 has been replaced by an amino acid selected from the group consisting of Ala, Gly, Val, Ser, Thr, Asn, Gln, Asp, and Glu.
73. The Factor VII polypeptide according to any of embodiments 1-72, wherein D334 has been replaced by an amino acid selected from the group consisting of Gly, and Glu.
74. The Factor VII polypeptide according to any of embodiments 1-73, wherein S336 has been replaced by an amino acid selected from the group consisting of Gly, and Glu.
75. The Factor VII polypeptide according to any of embodiments 1-74, wherein V158 has been replaced by an amino acid selected from the group consisting of Ser, Thr, Asn, Gln, Asp, and Glu.
76. The Factor VII polypeptide according to any of embodiments 1-75, wherein E296 has been replaced by an amino acid selected from the group consisting of Arg, Lys, Ile, Leu and Val.
77. The Factor VII polypeptide according to any of embodiments 1-76, wherein M298 has been replaced by an amino acid selected from the group consisting of Lys, Arg, Gln, and Asn.
78. The Factor VII polypeptide according to any of embodiments 1-77, wherein L305 has been replaced by an amino acid selected from the group consisting of Val, Tyr and Ile.
79. The Factor VII polypeptide according to any of embodiments 1-78, wherein S314 has been replaced by an amino acid selected from the group consisting of Gly, Lys, Gln and Glu.
80. The Factor VII polypeptide according to any of embodiments 1-79, wherein F374 has been replaced by an amino acid selected from the group consisting of Pro, and Tyr.
81. The Factor VII polypeptide according to embodiment 80, wherein said F374 has been replaced by Tyr.
82. The Factor VII polypeptide according to any of embodiments 1-81, wherein the amino acid has been replaced with any other amino acid which can be encoded by polynucleotide constructs.
83. The Factor VII polypeptide according to any of embodiments 1-82, wherein said Fac-tor VII polypeptide is human Factor VII.
84. The Factor VII polypeptide according to any of embodiments 1-83, wherein said Fac-tor VII polypeptide is human Factor VIIa.
85. The Factor VII polypeptide according to any of embodiments 1-84, wherein the ratio between the activity of said Factor VII polypeptide and the activity of the native Factor VIIa polypeptide shown in SEQ ID NO:1 is at least about 1.25.
86. The Factor VII polypeptide according to embodiment 85, wherein said ratio is at least about 2.0, preferably at least about 4.0.
87. The Factor VII polypeptide according to embodiment 1, which is selected from Q176A-FVII, Q176L-FVII L177S-FVII, D196A-FVII, K197A-FVII, K199A-FVII, T238A-FVII, T239I-FVII, T239Y-FVII, Q286A-FVII, D289E-FVII, D289R-FVII, R290Q-FVII, M327Q-FVII, M327N-FVII, K341A-FVII, K341E-FVII, K341Q-FVII, S363M-FVII, S363A-FVII, W364H-FVII, Q366E-FVII.
88. A polynucleotide construct encoding a Factor VII polypeptide according to any of embodiments 1-87.
89. The polynucleotide construct according to embodiment 88, which is a vector.
90. A host cell comprising the polynucleotide construct according to any one of the embodiments 88-89.
91. The host cell according to embodiment 90, which is a eukaryotic cell.
92. The host cell according to embodiment 91, which is of mammalian origin.
93. The host cell according to embodiment 92, wherein the cell is selected from the group consisting of CHO cells, HEK cells and BHK cells.
94. A transgenic animal containing and expressing the polynucleotide construct as defined in embodiment 88.
95. A transgenic plant containing and expressing the polynucleotide construct as defined in embodiment 88.
96. A method for producing the Factor VII polypeptide defined in any of embodiments 1-87, the method comprising cultivating a cell as defined in any one of embodiments 90-93 in an appropriate growth medium under conditions allowing expression of the polynucleotide construct and recovering the resulting polypeptide from the culture medium.
97. A method for producing the Factor VII polypeptide defined in any of embodiments 1-87, the method comprising recovering the Factor VII polypeptide from milk produced by the transgenic animal defined in embodiment 94.
98. A method for producing the Factor VII polypeptide defined in any of embodiments 1-87, the method comprising cultivating a cell of a transgenic plant as defined in embodiment 95, and recovering the Factor VII polypeptide from the plant.
99. A pharmaceutical composition comprising a Factor VII polypeptide comprising one or more substitutions relative to the amino acid sequence of SEQ ID NO:1, wherein said substitutions are replacement with any other amino acid of one or more amino acids at a position selected from the group consisting of position 172, 173, 175, 176, 177, 196, 197, 198, 199, 200, 203, 235, 237, 238, 239, 240, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 297, 299, 319, 320, 321, 327, 341, 363, 364, 365, 366, 367, 370, 373 corresponding to amino acid positions of SEQ ID NO:1 and wherein said Factor VII polypeptide exhibits increased resistance to inactivation by an endogenous inhibitor of said FVII polypeptide relative to wild-type human FVIIa; and, optionally, a pharmaceutically acceptable carrier.
100. A pharmaceutical composition comprising a Factor VII polypeptide as defined in any of embodiments 1-87, and, optionally, a pharmaceutically acceptable carrier.
101. Use of a Factor VII polypeptide comprising one or more substitutions relative to the amino acid sequence of SEQ ID NO:1, wherein said substitutions are replacement with any other amino acid of one or more amino acids at a position selected from the group consisting of position 172, 173, 175, 176, 177, 196, 197, 198, 199, 200, 203, 235, 237, 238, 239, 240, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 297, 299, 319, 320, 321, 327, 341, 363, 364, 365, 366, 367, 370, 373 corresponding to amino acid positions of SEQ ID NO:1 and wherein said Factor VII polypeptide exhibits increased resistance to inactivation by an endogenous inhibitor of said FVII polypeptide relative to wild-type human FVIIa; for the preparation of a medicament for the treatment of bleeding disorders or bleeding episodes or for the enhancement of the normal haemostatic system.
102. Use of a Factor VII polypeptide as defined in any of embodiments 1-87 for the preparation of a medicament for the treatment of bleeding disorders or bleeding episodes or for the enhancement of the normal haemostatic system.
103. Use according to any of embodiments 101-102 for the treatment of haemophilia A or B.
104. A method for the treatment of bleeding disorders or bleeding episodes in a subject or for the enhancement of the normal haemostatic system, the method comprising administering a therapeutically or prophylactically effective amount of a Factor VII polypeptide comprising one or more substitutions relative to the amino acid sequence of SEQ ID NO:1, wherein said substitutions are replacement with any other amino acid of one or more amino acids at a position selected from the group consisting of position 172, 173, 175, 176, 177, 196, 197, 198, 199, 200, 203, 235, 237, 238, 239, 240, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 297, 299, 319, 320, 321, 327, 341, 363, 364, 365, 366, 367, 370, 373 corresponding to amino acid positions of SEQ ID NO:1 and wherein said Factor VII polypeptide exhibits increased resistance to inactivation by an endogenous inhibitor of said FVII polypeptide relative to wild-type human FVIIa; to a subject in need thereof.
105. A method for the treatment of bleeding disorders or bleeding episodes in a subject or for the enhancement of the normal haemostatic system, the method comprising administering a therapeutically or prophylactically effective amount of a Factor VII polypeptide as defined in any of embodiments 1-87 to a subject in need thereof.
106. A Factor VII polypeptide as defined in any of embodiments 1-87 for use as a medicament.
107. The Factor VII polypeptide according to any of embodiments 1-106, wherein said Factor VII polypeptide is not a Factor VII polypeptide selected from the list consisting of Q366E-FVII, Q366A-FVII, and Q366G-FVII.