Application of ERH Gene in the Preparation of Bladder Cancer Diagnosis and Treatment Products

20220065859 · 2022-03-03

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention relates to the application of the ERH gene in the preparation of bladder cancer diagnosis and treatment products. The ERH gene is found to have a good correlation with bladder cancer. In addition, an RNA interference vector is constructed to perform cell function experiments to study the effect of ERH gene on the proliferation and clonality of bladder cancer cells. The present invention provides a research basis for clinical diagnosis and treatment of bladder cancer and has a good application prospect.

    Claims

    1. A method of treating or preventing bladder cancer comprising the step of reducing expression of ERH gene or protein in a subject in need thereof.

    2. The method of claim 1, wherein the expression of the ERH gene or protein is downregulated by one or more steps selected from the group consisting of: activating an inhibitor gene of the ERH gene; activating a protein that inhibits expression of an ERH gene; introducing antisense oligonucleotides or interfering RNA targeting ERH that inhibits ERH expression; introducing an antisense oligonucleotide that inhibits ERH expression; introducing a vector that inhibits ERH expression; activating a microRNA that promotes degradation of ERH mRNA; introducing molecules that promote degradation of ERH proteins; suppressing the expression of factors and proteins that promote the expression level of ERH genes; inhibiting the activity of promoter or enhancer of ERH genes; enhancing the activity of ERH gene silencer; introducing antibodies or immunologically active fragments that bind to ERH proteins.

    3. The method of claim 2, wherein the expression of the ERH gene or protein is downregulated by introducing antisense oligonucleotides or interfering RNA targeting ERH.

    4. The method of claim 2, wherein the target sequence of the interfering RNA targeting ERH is SEQ ID NO.15.

    5. The method of claim 4, wherein the sequences of the interfering RNA are SEQ ID NO.18 and SEQ ID NO.19.

    6. The method of claim 1, wherein the method further comprising the step of determining the expression level of ERH gene or protein in a sample obtained from the subject and diagnosing the subject as having a bladder cancer if the ERH gene or protein expression level of the sample is above a ERH gene or protein expression level of a control subject.

    7. The method of claim 6, wherein determining the expression level of ERH gene in a sample obtained from the subject by fluorescence quantitative PCR method or gene chip method.

    8. The method of claim 7, wherein the fluorescence quantitative PCR method contains a pair of primers that specifically amplify the ERH gene.

    9. The method of claim 8, wherein the primer sequences are SEQ ID NO.11 and SEQ ID NO.12.

    10. The method of claim 7, wherein the gene chip includes a probe that hybridizes to the nucleic acid sequence of the ERH gene.

    11. The method of claim 6, wherein determining the expression level of ERH protein in a sample obtained from the subject by immunization method.

    12. The method of claim 11, wherein the immunization method refers to the detection of ERH protein expression level by ELISA or colloidal gold method, preferably, the commercially available ERH monoclonal antibody is detected by ELISA or colloidal gold method.

    13. An interfering RNA, wherein the sequences of the interfering RNA are SEQ ID NO.18 and SEQ ID NO.19.

    14. A vector, wherein the vector contains encoding the interfering RNA as claimed in claim 15.

    15. The vector of claim 14, wherein the vector is a lentiviral vector.

    16. A composition for treating or preventing bladder cancer, comprising a pharmaceutically effective amount of the interfering RNA of claim 13 as an active ingredient.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0073] FIG. 1 shows the GV115 vector;

    [0074] FIG. 2 shows the construction of RNA interference vectors and the identification of positive clones;

    [0075] FIG. 3 shows the GV112 vector;

    [0076] FIG. 4 shows a microscopic fluorescence image after lentivirus infection;

    [0077] FIG. 5 is a graph showing the ERH gene knockdown efficiency of mRNA levels after lentivirus infection;

    [0078] FIG. 6 is a graph showing the effects of ERH gene knockdown on cell proliferation detected by Celigo;

    [0079] FIG. 7 is a graph showing the effects of ERU gene knockdown on cell proliferation detected by BRDU;

    [0080] FIG. 8 is a graph detecting the effect of ERH gene ablation on cell clone formation;

    [0081] FIG. 9 is a graph showing the efficacy of ERH knockdown on cell proliferation detected by MTT; and

    [0082] FIG. 10 is a graph showing the target reduction ERH gene protein expression level detected by WB.

    DETAILED DESCRIPTION OF THE EMBODIMENT

    [0083] The present invention is illustrated in detail in conjunction with the specific embodiments, and the embodiment has been explained to facilitate understanding of the present invention but not to limit the scope of the invention. Those of ordinary skill in the art can understand that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principle and spirit of the present invention, and the scope of the present invention is defined by the claims and their equivalents. The experimental methods that do not specify the specific conditions in the following examples are generally tested according to conventional conditions or according to the manufacturer's recommended conditions.

    Example 1 Tissue Sample RNA Extraction and Fluorescence Quantitative PCR

    [0084] Thirty-two pairs of samples of bladder cancer and paracancerous tissue were prepared. Case samples were confirmed by pathological examination. Sample RNA was extracted using TRIzol method, followed by agarose gel electrophoresis after RNA extraction, and RNA sample extraction was performed using the NanoDrop1000 spectrophotometer. Among them, 12 pairs of samples of cancer tissues and paracancerous tissues were all qualified for the test. See Table 1 for follow-up fluorescence quantitative detection experiments.

    TABLE-US-00001 TABLE 1 RNA test results Concentration Concentration Sample Sample number (ng/μl) 260/280 Sample Type Sample No. (ng/μl) 260/280 Type Cancer1 668.6 2.06 RNA Cancer7 400.7 2 RNA paracancerous 1 150 1.99 RNA Cancer adjacent 417.4 2.04 RNA 7 Cancer 2 373.4 2.08 RNA Cancer 8 312.6 1.9 RNA paracancerous 2 246 2 RNA Cancer adjacent 209.5 1.9 RNA 8 Cancer 3 378.5 1.97 RNA Cancer 9 440.7 1.9 RNA paracancerous 3 343.6 1.99 RNA Cancer adjacent 288.3 2.0 RNA 9 Cancer 4 520.5 1.89 RNA Cancer 10 727.8 1.95 RNA paracancerous 4 458.3 2.02 RNA Cancer adjacent 496.4 2.06 RNA 10 Cancer 5 297.1 1.99 RNA Cancer 11 728 1.95 RNA paracancerous 5 560.3 2.01 RNA Cancer adjacent 496.2 2.06 RNA 11 Cancer 6 379.6 2 RNA Cancer 12 562.8 1.95 RNA paracancerous 6 300 1.93 RNA Cancer adjacent 435.6 2.06 RNA 12

    Example 2 Fluorescent Quantitative PCR

    1. Obtaining cDNA by Reverse Transcription

    [0085] Use the Promega M-MLV kit, for details, see the kit instructions.

    2. Designing Primer

    [0086]

    TABLE-US-00002 TABLE 2  Fluorescent quantitative PCR primers Amplified target Upstream primer  Downstream primer  fragment gene Accession sequences sequences size MKI67 NM_002417 GCTTCTCTTCTGACCCTG CTGATGGTTGAGGCTGTTC 213 bp ATG (SEQ ID NO. 1) C (SEQ ID NO. 2) EGFR NM_005228 GGTGACCGTTTGGGAGTT CCTGAATGACAAGGTAGCG 245 bp (SEQ ID NO. 3) (SEQ ID NO. 4) TP53 NM_001126112 GAGGTTGGCTCTGACTGT TCCGTCCCAGTAGATTACC 133 bp ACC (SEQ ID NO. 5) AC (SEQ ID NO. 6) ERBB2 NM_004448 GGAAGGTGAAGGTGCTTG TAGGGCATAAGCTGTGTCA 247 bp GATC (SEQ ID NO. 7) CCAG (SEQ ID NO. 8) PCNA NM_002592 TGAAGCACCAAACCAGGAG GAAGGCATCTTTACTACAC 114 bp (SEQ ID NO. 9) AGC (SEQ ID NO. 10) ERH NM_004450 GCTGCTGTAGCGAAGAGA GGCTGGTATGTCTGGGTAT 270 bp (SEQ ID NO. 11) (SEQ ID NO. 12) GAPDH TGACTTCAACAGCGACAC CACCCTGTTGCTGTAGCCA 121 bp CCA (SEQ ID NO. 13) AA (SEQ ID NO. 14)

    3. Detecting Real-Time PCR

    [0087] 12 μl of the reaction system was configured with TAKARA Fluorescent Quantitative Reagent (cat. No. DRR041B): each tube was added SYBR premix ex taq 6 μl; Primer mix (5 μM) 0.3 μl; Reverse transcript cDNA 0.6 μl; RNase-free water 5.1 μl. Two-step Real-time PCR: predegeneration 95° C. 30 s; 40 cycles (denaturation 95° C. 5 s; annealing and extension 60° C. 30 s). And made the dissolution curve.

    4. Analyzing Data

    [0088] The results showed that the real-time quantitative PCR amplification curve had good overall parallelism, indicating that the amplification efficiency of each reaction tube was similar, the inflection point of the amplification curve was clear, the limit is flat and there was no upward trend, and the slope of the curve index period was large, indicating that the amplification efficiency was higher; The dissolution profile of the amplification product was a single peak, indicating that the amplification product was unique, and was a specific amplification; Relative quantification formula of RT-PCR: ΔCt=target gene Ct value-GAPDH Ct value; −ΔΔCt=same number of paracancerous tissue ΔCt−the same serial number of each sample ΔCt; 2.sup.−ΔΔct reflected the relative expression levels of target genes in the same serial cancer tissue samples relative to the paracancerous tissue samples. The relative expression levels of ERH, MKI67, EGFR, ERBB2, TP53 and PCNA genes in 12 pairs of bladder cancer tissues and paracancerous tissues were calculated.

    TABLE-US-00003 TABLE 3 Fluorescent Quantitative Detection of Gene Expression in Bladder Cancer and Paracancerous Tissues MKI EGFR ERBB2 TP53 PCNA Samples GAPDH Ct ERH Ct ΔCt 67 Ct ΔCt Ct ΔCt Ct ΔCt Ct ΔCt Ct ΔCt Cancer1 14.18 22.27 8.09 24.97 10.79  20.27 6.09 19.77 5.59 21.3  7.12 20.33 6.15 Para- 17.62 26.55 8.93 23.73 6.11 24.3  6.68 24.85 7.23 25.54 7.92 24.22 6.6  cancerous 1 Cancer 2 14.97 20.92 5.95 24.67 9.7  18.83 3.86 18.65 3.68 19.58 4.61 20.61 5.64 Para- 17.26 25.48 8.22 23.08 5.82 23.45 6.19 24.18 6.92 24.58 7.32 23.73 6.47 cancerous 2 Cancer 3 15.77 22.6  6.83 25.86 10.09  21.81 6.04 21.91 6.14 21.95 6.18 20.97 5.2  Para- 18.2  25.81 7.61 26.22 8.02 23.58 5.38 23.75 5.55 25.15 6.95 24.73 6.53 cancerous 3 Cancer 4 17.27 25.91 8.64 21.1  3.83 25.08 7.81 27.42 10.15  22.18 4.91 25.44 8.17 Para- 16.88 23.99 7.11 25.1  8.22 22.27 5.39 23.48 6.6  23.26 6.38 21.84 4.96 cancerous 4 Cancer 5 15.81 22.71 6.9  23.03 7.22 21.65 5.84 21.88 6.07 22.58 6.77 21.78 5.97 Para- 15.44 24.28 8.84 23.81 8.37 23.79 8.35 21.49 6.05 24.83 9.39 20.94 5.5  cancerous 5 Cancer 6 17.81 25.84 8.03 23.29 5.48 26.28 8.47 26.83 9.02 25.49 7.68 23.86 6.05 Para- 18.68 28.67 9.99 24.45 5.77 26.6  7.92 25.79 7.11 28.11 9.43 23.62 4.94 cancerous 6 Cancer 7 16.33 23.9  7.57 24.12 7.79 21.65 5.32 21.71 5.38 22.11 5.78 21.97 5.64 Para- 15.52 23.56 8.04 24.23 8.71 22.21 6.69 21.64 6.12 24.31 8.79 21.62 6.1  cancerous 7 Cancer 8 17.28 24.22 6.94 24.65 7.37 23.13 5.85 22.19 4.91 22.5  5.22 23.25 5.97 Para- 16.46 23.03 6.57 23.25 6.79 22.29 5.83 21.71 5.25 22.12 5.66 21.97 5.51 cancerous 8 Cancer 9 18.91 26.8  7.89 24.23 5.32 26.74 7.83 28.07 9.16 25.79 6.88 25.11 6.2  Para- 17.2  23.58 6.38 24.53 7.33 23.23 6.03 22.82 5.62 23.76 6.56 21.15 3.95 cancerous 9 Cancer 10 15.68 22.79 7.11 24.76 9.08 20.91 5.23 24.66 8.98 23.46 7.78 21.29 5.61 Para- 16.01 23.9  7.89 23.89 7.88 24.47 8.46 24.79 8.78 24.27 8.26 23.14 7.13 cancerous 10 Cancer 11 16.83 23.77 6.94 23.71 6.88 23.86 7.03 22.61 5.78 24.25 7.42 23.29 6.46 Para- 16.76 23.28 6.52 25.27 8.51 22.52 5.76 23.01 6.25 26.73 9.97 22.42 5.66 cancerous 11 Cancer 12 15.22 21.64 6.42 24.63 9.41 20.84 5.62 21.23 6.01 27.05 11.83  20.24 5.02 Para- 16.85 24.16 7.31 24.86 8.01 23.63 6.78 24.11 7.26 24.22 7.37 23.76 6.91 cancerous 12

    [0089] Further, using MKI67, EGFR, ERBB2, TP53, and PCNA as marker genes, the influence of the sample on gene expression was corrected.

    TABLE-US-00004 TABLE 4 Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer Cancer Gene 1 2 3 4 5 6 7 8 9 10 11 12 MKI67 √ √ √ √ √ √ EGFR √ √ √ √ √ √ ERBB2 √ √ √ √ √ √ TP53 √ √ √ √ √ √ √ √ √ √ PCNA √ √ √ √ √ √ Reference Strong Strong Weak Weak Strong Weak Strong Weak No Strong Strong Strong degree ERH √ √ √ √ √ √ √ √

    [0090] The “√” of Marker gene indicated that the gene's expression level in this sample was consistent with known reports. The weak reference referred to the sample with the positive marker number=2, the strong reference referred to the sample with the positive marker number ≥3, and “No” referred to a sample with a positive marker of <2, which was not acted as a reference.

    [0091] According to the detection of the expression of 12 pairs of sample candidate genes, 7 pairs of samples were strong reference samples. The ERH gene was up-regulated in 6 pairs of strong reference samples and 2 pairs of weak reference samples, indicating that the ERH gene had a good correlation with bladder cancer. The combined detection of ERH gene and MKI67, EGFR, ERBB2, TP53 and PCNA would further improve the detection accuracy of bladder cancer.

    Example 3 RNA Interference Lentiviral Vector Preparation of ERH Gene

    1. RNA Interference Target Design and Double-Stranded DNA Oligo Preparation

    [0092] ERH (NM_004450 Homo sapiens Homo sapiens enhancer of rudimentary homolog (ERH), mRNA), according to the principles of RNA interference sequence design, the ERH gene was used as a template to design multiple 19-21 nt RNA interference target sequences. After the design software evaluates the assay, the following sequence was selected as the interference target:

    TABLE-US-00005 (SEQ ID NO. 15) Target sequence: CTGGTTTACCGAGCTGATA

    [0093] The shRNA interference sequences were designed based on the selected target sequences and appropriate restriction endonuclease cutting sites were added at both ends to complete vector construction. In addition to this, a TTTTT termination signal was added at the 3′ end of the positive strand and a termination signal complementary sequence was added at the 5′ end of the reverse strand. After the design was completed, Czech company synthesized single-stranded DNA oligo.

    TABLE-US-00006 TABLE 5  5′ 3′ additional Additional base STEM Loop STEM base CCGG GCCTGGTTTAC CTCGA TATCAGCTCGG TTTTTG CGAGCTGATA G TAAACCAGGC AATTCAAAA GCCTGGTTTAC CTCGA TATCAGCTCGG A CGAGCTGATA G TAAACCAGGC Note: CCGG: AgeI restriction site; AATTC: EcoRI restriction site; G: EcoRI restriction site complementary sequence.

    [0094] The synthesized single-stranded DNA oligo powder was dissolved in annealing buffer (final concentration 100M) and bathed at 90° C. for 15 min. After spontaneous cooling to room temperature, double bonds with sticky ends were formed.

    2. Linear Preparation of GV115 Vector

    [0095] A 50 μl reaction system was prepared according to the NEB instructions, and the GV115 vector was double-enzymatically digested with AgeI and EcoRI (vector shown in FIG. 1) to linearize it (GV115 vector was provided by Shanghai GK Genentech Co., Ltd.). The reaction was performed at 37° C. (optimum temperature) for 1 h, and the target fragment was recovered by cutting the gel.

    3. Construction of RNA Interference Lentiviral Vector

    [0096] A 20 μl reaction system was prepared according to the Fermentas T4 DNA Ligase instructions and the double-stranded DNA oligo was ligated to the linearized vector. The reaction was performed at 16° C. for 1 h to 3 h, and the ligation product was named as psc2903, after which transformation experiments were performed. The ligation product was transformed into E. coli competent cells. Positive clones were identified by PCR and the primers were identified as follows:

    TABLE-US-00007 (SEQ ID NO. 16) Upstream Primer: CCTATTTCCCATGATTCCTTCATA (SEQ ID NO. 17) Downstream primers: GTAATACGGTTATCCACGCG

    [0097] The positive clones were sequenced with the identification primers, and the clones with the same sequence as the target sequence were selected for plasmid extraction. The schematic diagram of the RNA interference vector construction and positive clone identification was shown in FIG. 2.

    Example 4 Detection of Target Gene Expression in Target Cells by RT-PCR

    [0098] The RNA of human bladder cancer cell lines 5637 and T24 was extracted by using TRIzol method, and the mRNA abundance of ERH gene in human bladder cancer cells 5637 and T24 was detected by RT-PCR. Referred to Example 2 for the specific procedure. The results were shown in Table 6. Both bladder cancer cells expressed ERH gene with high abundance.

    TABLE-US-00008 TABLE 6 Sample ΔCt STDEV 5637 2.61 0.040 T24 4.57 0.170

    [0099] Remarks: ΔCt=target gene Ct value—reference gene Ct value; when the ΔCt value ≤12, the gene expression abundance in the cell is high; when 12<ΔCt value <16, the gene expression abundance in the cell is medium; When the ΔCt value ≥16, the gene expression abundance in this cell is low.

    Example 5 Construction and Packaging of RNAi Lentiviral Vector

    1. Vector Digestion

    [0100] The vector GV112 was digested with restriction enzyme (AgeI, EcoRI enzyme) (provided by Shanghai GK Gene Chemical Technology Co., Ltd., the vector map was shown in FIG. 3), and the enzyme digestion system was: 10×buffer, 5 μl; 1 μl each of AgeI, EcoRI enzyme (10 U/μl); 2 μg of the purified vector plasmid; buffered with deionized water to 50 μl. After reacting at 37° C. for 3 hours or overnight, a linearized vector was obtained and subjected to agarose gel electrophoresis to recover the target band.

    2. Synthesis of the Target Fragment

    [0101] Synthetic Single-Stranded Primers

    TABLE-US-00009 GV112-ERH-1: (SEQ ID NO. 18) 5′-CCGGGCCTGGTTTACCGAGCTGATACTCGAG TATCAGCTCGGTAAACCAGGC TTTTTG-3′  GV112-ERH-2: (SEQ ID NO. 19) 5′-AATTCAAAAAGCCTGGTTTACCGAGCTGATACTCGAG TATCAGCTCGGTAAACCAGGC-3′ 

    [0102] The primers were annealed to form double-stranded DNA, after synthesis, the paired primer powders were dissolved in annealing buffer and bathed at 90° C. for 15 min, and then naturally cooled to room temperature. GV112-ERH-1 and GV112-ERH-2 were paired.

    3. Connecting Annealed Product and Vector

    [0103] The reaction system was formulated with a linearized vector and an annealing product, and the double-encoded linearized vector and the annealed double-stranded DNA were ligated by T4 DNA ligase, ligated at 16° C. for 1-3 h, or ligated overnight.

    4. Conversion

    [0104] The reaction product was added to competent cells of E. coli and mixed under light bollards and placed on ice for 30 min. Heat shock at 42° C. for 90 s and incubate in ice bath for 2 min. The LB medium was added and the plate was shaken at 37° C. for 1 h. The appropriate amount of broth was evenly spread on the plate containing the corresponding antibiotics, and incubating in a constant temperature incubator for 12-16 h.

    5. Colony PCR Identification

    [0105] Identification Primers:

    TABLE-US-00010 (SEQ ID NO. 20) Upstream Primer: 5′-CCATGATTCCTTCATATTTGC-3′  (SEQ ID NO. 21) Downstream primer: 5′-GTAATACGGTTATCCACGCG-3′

    [0106] A single clone on the plate was picked for PCR identification. The identification primers were SEQ ID NO.20 and SEQ ID NO.21. The positive clones were sequenced and the results were analyzed. The correct cloning bacteria solution was expanded and extracted to obtain high-purity plasmids for downstream viral packaging.

    Example 6 Lentiviral Infects Target Cells and Gene Knockout Efficiency

    1. Preparing the Target Cells

    [0107] Removed the human bladder cancer cell T24 cryovial from the liquid nitrogen tank and quickly placed it in a 37° C. water bath and shook it to thaw as soon as possible. After completely thawing, centrifuged at 1300 rpm for 3 min. Disinfected the freezing tube and moved to biological safety cabinet; aspirated the supernatant, resuspending the cells by adding 1 mL of fresh complete medium (1640+10% FBS), and inoculated the cell suspension to 6-cm dish containing 3 mL of complete medium. In the dish, gently shook it and place it in a 37° C., 5% CO.sub.2 incubator. After 24 hours, replaced the culture solution with another culture medium and continue the culture until the cell confluence reached 80% to maintain the cells in a good state of growth.

    2. Cell Lentivirus Infection

    [0108] The cells in the logarithmic growth phase were digested with trypsin, and the complete culture medium was made into 3-5×10.sup.4 cells/mL cell suspension, and the appropriate number of cells was inoculated into the culture plate (recommended 6-well plate 2 mL inoculation area, 1 mL change volume), continued to culture to ensure that the amount of plating reaches about 15-30% when infected; replaced the infection medium, add the optimal amount of virus for infection (control group virus titer 5×10.sup.8 TU/ml, the amount of infection 4 μl; the virus titer of experimental group was 1×10.sup.9 TU/ml and the infection dose was 2 μl). The optimal time after infection was chosen to change to regular culture medium and continue culture (usually about 8-12 h after infection).

    [0109] Observing the Cells State and Infection Efficiency after Infection

    [0110] The cells were in good condition and there was no large number of deaths, especially in the control group (normal target cells, plus negative control virus infected cell group, shCtrl) and experimental groups (normal target cells, Cell group infected with shRNA of ERH gene, shERH) had a similar cell state; the fluorescent-tagged lentivirus infected about 72 hours after infection, the expression of the reporter gene was observed under a fluorescent microscope, the fluorescence rate was a positive infection rate.

    3. Gene Knockdown Efficiency

    [0111] Total RNA was extracted from the control group and the experimental group and RT-PCR was performed after reverse transcription. The specific procedures referred to the foregoing embodiments.

    4. Experimental Results

    [0112] In the control group and experimental group, the objective virus was infected by lentivirus after 72 hours under the microscope. The observation results showed that the cell infection efficiency reached 80% or more, and the cell state was normal. The results were shown in FIG. 4.

    [0113] Quantitative PCR results showed that after shRNA lentivirus infection, the expression level of ERH mRNA in experimental group T24 cells was inhibited (p<0.05), knockdown efficiency reached 92.1%, as shown in FIG. 5.

    Example 7 Celigo Cell Count Detects Growth

    1. Experimental Procedure

    [0114] 1) After the trypsin digestion of the control and experimental cells in the logarithmic growth phase, the complete medium was resuspended into a cell suspension and counted;

    [0115] 2) The plating cell density was determined by the speed of cell growth (most cell plating was set at 2000 cell/well). For each group of 3 wells, the culture system was 100 μL/well. During the plating process, it was necessary to ensure that the number of cells added per well was the same, 37° C., 5% CO.sub.2 incubator;

    [0116] 3) Starting from the second day after plating, Celigo detected the plate once a day and continuously detected the plate for 3-5 days;

    [0117] 4) Accurately calculated the number of cells with green fluorescence in each scanning well by adjusting the input parameters of the analysis settings; performed statistical plotting of the data and drew a 5 days cell proliferation curve.

    2. Data Analysis and Experimental Results

    [0118] According to the cell count value and time point, the cell growth curve based on the cell count value was plotted, and the ratio of the cell count value at each time point of each group of cells to the cell count value of the first day was calculated, and the proliferation of the cells at each time point was obtained. In multiples, a growth curve based on the cell proliferation factor was drawn based on the multiplying factor and the time point, as shown in FIG. 6. The results showed that the proliferation of shERH cells was significantly inhibited compared with the shCtrl group, indicating that knockdown of ERH affected cell proliferation.

    Example 8 Brdu Detection

    [0119] BrdU could be competitively incorporated into the S-phase single-stranded DNA nucleotide sequence in place of thymidine, using the antibody ligase or fluorescein as an indicator system to label Brdu, and when Brdu was incorporated in cells that were actively dividing, Brdu-containing cells could be detected and used to determine the number of cells. The absorbance (OD value) was measured with a microplate reader at a wavelength of 450 nm. The level of OD was used to reflect the number of synthetic DNA cells, reflecting the amount of cells that were in the proliferative state.

    [0120] According to Example 6, the target cells of the control group and the experimental group were infected with lentivirus and subjected to Brdu assay. For the specific experimental procedure, referred to the instructions of Roche Brdu kit (article number 11647229001). The experimental results showed that compared with the shCtrl control group, the proliferation of cells in the shERH experimental group was slowed (P<0.05 on the first day), as shown in FIG. 7 (OD450/fold was the OD450 multiple of day 1 and day 3 of each experimental group relative to day 1, indicating the multiplier for each day).

    Example 9 Apoptosis Detection

    [0121] According to Example 6, the cells infected with the lentivirus in the control group and the experimental group were passaged on the 4th day after the cell lentivirus infection, and on the 5th day, the degree of cell fusion was 85%. For specific procedures, referred to the eBioscience Apoptosis Kit (Art. No. 88-8007) instructions.

    [0122] The results showed that shRNA lentivirus infected T24 cells. After 5 days of culture, the average percentages of apoptotic cells in the control (shCtrl) and experimental (shERH) groups were 4.21% and 11.03%, respectively. Compared with the control group, the number of apoptotic cells in the shERH group increased (P<0.05).

    Example 10 Clone Formation Assay

    1. Experimental Procedure

    [0123] (1) Preparing post-infectious cells: the objective cells were infected with lentivirus in the control group and the experimental group according to Example 6, and the cells in each experimental group in the logarithmic growth phase were trypsinized and resuspended in the complete culture medium to prepare a cell suspension, and count.

    [0124] (2) Seeding the cells: each experimental group was inoculated with 400-1000 cells/well (determined according to cell growth) in a 6-well plate culture plate, and 3 replicate wells were set in each experimental group.

    [0125] (3) Further culturing the inoculated cells in the incubator for 14 days or the number of cells in most of the individual clones was greater than 50, and the medium was changed and observed every 3 days.

    [0126] (4) Photographing the cell clones under a fluorescence microscope before the termination of the experiment, and the cells were washed once with PBS.

    [0127] (5) Adding 1 mL of 4% paraformaldehyde per well, fixed the cells for 30-60 min, and washed cells once with PBS.

    [0128] (6) Adding 500 μL of clean, non-impurity GIEMSA dye solution to each well and stained the cells for 10-20 min.

    [0129] (7) Washing the cells several times with ddH.sub.2O, air dried, took a photo with a digital camera, and counted the clones.

    2. Experimental Results

    [0130] The ability of the cells to grow tumorigenicity after lentivirus infection was demonstrated by the ability of the cells to colonize on the cell culture plate after infection. After shRNA lentivirus infection of T24 cells, the number of clones in the shERH group was significantly reduced compared with the shCtrl group (P<0.05), See FIG. 8 for details.

    Example 11 MTT Detection

    [0131] According to Example 6, the target cells of the control group and the experimental group were infected with lentivirus, and the detection was performed 24 to 120 hours after the plate was separated. The specific procedure was followed by the MTT kit (article number: JT343) instructions of Genview. The OD490/fold was the OD490 multiple of the first day to the fifth day of each experimental group relative to the first day, indicating the multiple of proliferation on each day. FIG. 9 showed the time-dependent change in the absorbance change of the shERH group and the control group (shCtrl) in the plate reader at a wavelength of 490 nm. OD490 here reflected the number of viable cells. The results showed that the proliferation of cells in the shERH group was slower compared to the shCtrl group.

    Example 12 Detection of Targets by Western Blot Reduces Expression of Target Gene Proteins

    1. Total Protein Extraction

    [0132] Lentivirus infection was performed in the control group and the experimental group, and the objective cells in a good growth state after infection with lentivirus were collected, protein was extracted, and the protein concentration was determined by the BCA method (Biyuntian BCA Protein Assay Kit, Cat. No. P0010S). Adjusted the protein concentration of each sample to 2 μg/μL and stored at −80° C. until use.

    2. SDS-PAGE

    [0133] According to the size of the protein molecular weight, a concentration of 10% separation gel and 5% concentration gel was formulated. After the gel had solidified, removed the comb, washed the sample well with electrophoresis buffer, and loaded the prepared sample. Stacking gel 80 mA for 20 min; separation gel 120 mA for 1 h.

    3. Immunoblotting

    [0134] After the electrophoresis was completed, the protein was transferred to a PVDF membrane by using a transfer electrophoresis apparatus (Bio-Rad, Richmoad, Calif.) and electroconversion at 300 mA under a constant current of 4° C. for 120 min.

    4. Immunological Coloration

    [0135] 1) Blocking: Blocked PVDF membranes at room temperature for 1 h or 4° C. overnight with blocking solution (containing 5% skim milk in TBST);

    [0136] 2) Incubating primary antibody: blocking antibody dilution (primary antibody Sigma Mouse Anti-Flag, Catalog No. F1804, 1:2000, primary Santa-Cruz Mouse anti-GAPDH Cat. No. sc-32233, 1:2000), and then sealed PVDF membrane incubate at room temperature for 2 h or 4° C. overnight;

    [0137] 3) Washing the membrane: TBST washed the membrane 3 times, each 10 min;

    [0138] 4) Incubating secondary antibody: The corresponding secondary antibody (second antibody Santa-Cruz Goat Anti-Mouse IgG cat. No. sc-2005, 1:2000) was diluted with a blocking solution, and the PVDF membrane was incubated at room temperature for 2 hours.

    [0139] 5) Washing film: TBST washed 3 times, each 10 min;

    [0140] 6) X-ray developing: Using Thermo's Pierce™ ECL Western Blotting Substrate Kit.

    [0141] (1) Placed the PVDF membrane on the prefabricated fresh-keeping film, and mixed the liquid A and B in a ratio of 1:40. The mixture was uniformly added to the PVDF membrane and protected from light for 3-5 minutes.

    [0142] (2) Took out the membrane, drained the excess ECL substrate reaction solution slightly, put it into the cassette, covered with plastic wrap (to avoid air bubbles), put the X-ray film (to avoid the movement of the X-ray film), closed the cassette, and exposed 1-2 min.

    [0143] (3) Took out the X-ray film, put it into the developer solution, removed it after about 1 minute, rinsed it in clean water for a few seconds, and put it into the fixing solution for at least 2 minutes.

    [0144] (4) Removed the X-ray film, dried it, and analyzed.

    5. Experimental Results

    [0145] Western Blot results showed that the target vector shERH had a significant inhibitory effect on the expression of the target gene, and thus the target of the present invention was an effective target. The specific results were shown in FIG. 10.