COMPOUNDS COMPRISING STAPLED OR STITCHED PEPTIDES FOR IMPROVED DRUG DELIVERY

Abstract

The invention relates to improvements in drug delivery and to the use of Cell Penetrating Agents (CPA's) or Cell Penetrating Peptides (CPP's) which have been stabilized by, for example: i) stapling two amino acids to form Stapled CPP's (StaP's) or ii) stitching three or more amino acids to form stitched CPP's (StiP's). More particularly there is provided a drug carrying cell penetrating molecule (DCCPM) comprising: a biologically active compound (BAC), and a cell penetrating agent (CPA), which BAC and CPA are linked directly or via a bi-functional linker (BFL). The CPA is a stabilized peptide (CPP) which has a conformation imposed upon it by stapling to form a stapled peptide (StaP) or stitching to form a stitched peptide (StiP). The StiP or StaP comprise a cross link or bridge between at least two amino acids of the peptide and the cross link or bridge provides a cyclisation between at least two amino acids which are not formed by an olefin metathesis. Cyclisation may be achieved by one or more of: condensation of an aldehyde or ketone with a hydrazine or protected hydrazine; a thiol-ene Michael addition; a di-sulfide formation; a Huisgen 1,3 di-polar cycloaddition; a reaction between an amine and carboxylic acid; a singlet or triplet based carbine reaction; or a Suzuki or Sonogashira coupling.

Claims

1. A drug carrying cell penetrating molecule (DCCPM) comprising: i. a biologically active compound (BAC), and ii. a cell penetrating agent (CPA), wherein the BAC and CPA are linked directly or via a bi-functional linker (BFL), the CPA is a stabilized peptide (CPP) which has a conformation imposed upon it by stapling to form a stapled peptide (StaP) or stitching to form a stitched peptide (StiP), the StiP or StaP comprises a cross link or bridge between at least two amino acids of the peptide and the cross link or bridge provides a cyclisation between the at least two amino acids which are not formed by an olefin metathesis.

2. The DCCPM as claimed in claim 1, wherein the cyclisation is achieved by one or more of: i. condensation of an aldehyde or ketone with a hydrazine or protected hydrazine; ii. a thiol-ene Michael addition; iii. a di-sulfide formation; iv. a Huisgen 1,3 di-polar cycloaddition; v. a reaction between an amine and carboxylic acid; vi. a singlet or triplet based carbine reaction; or vii. a Suzuki or Sonogashira coupling.

3. The DCCPM as claimed in claim 2, wherein in iv) a triazole is formed between an azide or electron deficient nitrile containing amino acid and a propygyl containing amino acid.

4. The DCCPM as claimed in claim 3, wherein the azide is azidolysine.

5. The DCCPM as claimed in claim 3, wherein the propygyl containing amino acid is lysine, glutamic acid or aspartic acid.

6. The DCCPM as claimed in claim 2, wherein in v) a lactam is formed between a free amine containing amino acid and a carboxylic acid containing amino acid, optionally wherein the lactam is formed by cross linking a lysine and glutamic or aspartic acid.

7. (canceled)

8. The DCCPM as claimed in claim 1, wherein each crosslink has a nominal sequential length of from 2-20 atoms.

9. The DCCPM as claimed in claim 1, wherein the stabilized peptide comprises at least one alpha helix, extended 3.sub.10-helix or poly (Pro) II helix, or at least one beta sheet or hairpin or turn.

10. (canceled)

11. The DCCPM as claimed in claim 9, wherein the stabilized peptide comprises at least one alpha helix, extended 3.sub.10-helix or poly (Pro) II helix and one beta sheet, turn or hairpin.

12. The DCCPM as claimed in claim 1, wherein the BAC is an oligonucleotide (ON).

13.-18. (canceled)

19. The DCCPM as claimed in claim 1, wherein the BAC alters the expression of an endogenous or exogenous gene.

20. (canceled)

21. The DCCPM as claimed in claim 1, wherein the BFL comprises a chemistry selected from the chemistries of Table 6.

22.-29. (canceled)

30. The DCCPM as claimed in claim 1 which is of a size greater than 1.5 KDa.

31. A method for facilitating the uptake of a biologically active compound (BAC) into a cell comprising conjugating the biologically active compound to a cell penetrating agent (CPA) which is a stabilized peptide having a conformation imposed upon it by stapling to form a stapled peptide (StaP) or stitching to form a stitched peptide (StiP), wherein the StiP or StaP comprises a cross link or bridge between at least two amino acids of the peptide and the cross link or bridge provides a cyclisation between the at least two amino acids which are not formed by an olefin metathesis, directly or via a bi-functional linker (BFL) to form a drug carrying cell penetrating molecule (DCCPM); and presenting said DCCPM to said cell in a suitable vehicle.

32. A method of treating a disease in a subject comprising administering to the subject a DCCPM as claimed in claim 1, wherein the disease requires alteration of the expression of an endogenous or exogenous gene.

33. The method of claim 32, wherein the disease is neuromuscular disease, a metabolic disease, cancer, an age-related degenerative disease or an acquired viral infection.

34. The method of claim 32, wherein the disease is Duchenne's muscular dystrophy.

35. The method of claim 34, wherein the DCCPM comprises an AO targeting the dystrophin gene.

36. A method comprising: linking a drug or BAC to a CPP which is a stabilized peptide which has a conformation imposed upon it by stapling to form a stapled peptide (StaP) or stitching to form a stitched peptide (StiP), wherein the StiP or StaP comprises a cross link or bridge between at least two amino acids of the peptide and the cross link or bridge provides a cyclisation between the at least two amino acids which are not formed by an olefin metathesis, and administering the linked drug or BAC to a subject, wherein the method improves the bioavailability of the drug or BAC, or introduces the drug or BAC to a site which is refractory to the drug or BAC in its native state.

37. (canceled)

38. The method as claimed in claim 36 wherein the tissue is one of heart, brain, muscle or liver.

39. (canceled)

40. A composition comprising the DCCPM as claimed in claim 1, wherein the composition comprises one or more pharmaceutically acceptable excipients.

41. (canceled)

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0143] Embodiments of the invention are further described hereinafter with reference to the accompanying drawings, in which:

[0144] FIGS. 1a-c illustrate examples of un-cyclised CPPs (left) and some of the resulting stabilized structures (right) that can be formed therefrom;

[0145] FIGS. 2a-d illustrate examples of stitched CPA's: FIG. 2a is formed by cyclizing two sets of orthogonal amino acid that are consecutively placed in the peptide sequence; FIG. 2b illustrates stitched CPA's formed by cyclizing two different sets of orthogonal amino acids not consecutively placed in the peptide sequence; FIG. 2c illustrates a stitched CPA where two sets of amino acids to be cross-linked originate from one amino acid; and FIG. 2d illustrates two alternative sets of amino acids that originate form one amino acid that can be cross linked to form a continuous stitched CPA;

[0146] FIG. 3 exemplifies the structure of an amino acid that can be incorporated into CPPs with varying functional groups as defined in Table 1. The functional groups presented by X and X.sub.1 can be cross-linked to form CPAs and can also be used for bio-conjugation;

[0147] FIG. 4 illustrates the direct conjugation of a stabilized CPP to a BAC without the use of BFL;

[0148] FIG. 5 illustrates the connectivity of BFLs and overall structure of DCCPM and DTCPM.

[0149] FIG. 5a is a schematic diagram of a DCCPM illustrating the connectivity of BFL with non-limiting examples from Table 5 where the BAC is an antisense oligonucleotide (AO) or an oligonucleotide (ON);

[0150] FIGS. 5b-c are schematic diagrams of a DCCPM illustrating the connectivity of BFL with non-limiting examples from Table 5 where the BAC is an AO or an ON where the CPA has been stabilized by a either a 1,4 substituted or a 1,5 substituted 1,2,3 triazole;

[0151] FIG. 5d is a schematic diagram of a DTCPM illustrating the connectivity of BFL with non-limiting examples from Table 5 where oligonucleotide constitute part of the delivery molecule; a non-limiting list of BAC's delivered by this technology includes DNA, RNA or protein molecules (in effect the ON is part of the BFL and connects to the BAC);

[0152] FIG. 6 illustrates some preferred embodiments of DCCPMs incorporating different BFLs.

[0153] FIG. 6a is a general schematic of a DCCPM and illustrates connectivity of BFL defined but not limited to Table 5;

[0154] FIG. 6b is a schematic diagram illustrating a preferred embodiment of an DCCPM with an lactam stabilized CPP with an incorporated PEG.sub.5 which is terminated with a thiol containing molecule (cysteine) and conjugated to the BAC using the heterobifunctional protein cross linker Succinimidyl-4-[N-maleimidomethyl] cyclohexane-1-carboxylate (SMCC);

[0155] FIG. 6c is a schematic diagram illustrating a preferred embodiment of a DCCPM with an lactam stabilized CPP with an incorporated PEG.sub.5 which is terminated with a hydryzynal nicotinic acid (HNA) and subsequently conjugated to a BAC which has been modified with 4-formyl benzoic acid;

[0156] FIG. 6d is a schematic diagram illustrating a preferred embodiment of an DCCPM with an lactam stabilized CPP which is terminated with a thiol containing molecule (cysteine) and conjugated to the BAC using the heterobifunctional protein cross linker Succinimidyl-4-[N-maleimidomethyl] cyclohexane-1-carboxylate (SMCC);

[0157] FIG. 7 illustrates some preferred embodiments of DCCPMs incorporating CPPs stabilized by crosslinking lysine and glutamic residues forming a lactam;

[0158] FIG. 7a is a schematic of a CPP stabilized by cyclisation between two proteogenic amino acids to form a lactam;

[0159] FIG. 7b illustrates the incorporation of PEG.sub.5 to the N terminus of the CPA and its termination with a thiol containing molecule (cysteine);

[0160] FIG. 7c illustrated the incorporation of the hetero bi-functional linker SMCC into the DCCPM;

[0161] FIG. 7d is a schematic diagram illustrating a preferred embodiment of a DCCPM with an K-E stabilized CPP with an incorporated PEG.sub.5 which is terminated with a thiol containing molecule (cysteine) and subsequently conjugated to a BAC using the heterobifunctional protein cross linker Succinimidyl-4-[N-maleimidomethyl] cyclohexane-1-carboxylate (SMCC);

[0162] FIG. 8 illustrates some preferred embodiments of DCCPMs incorporating CPPs stabilized by crosslinking lysine and glutamic residues forming a lactam;

[0163] FIG. 8a is a schematic of a CPP stabilized by cyclisation between two proteogenic amino acids to form a lactam;

[0164] FIG. 8b is a schematic diagram illustrating a preferred embodiment of an DCCPM with an lactam stabilized CPP with an incorporated PEG.sub.5 which is terminated with a hydrazynal nicotinic acid (HNA) and subsequently conjugated to a 4-formyl benzoic modified BAC;

[0165] FIG. 8c a schematic diagram of a 4-formyl benzoic modified BAC;

[0166] FIG. 8d is a schematic diagram illustrating a preferred embodiment of a DCCPM with an lactam stabilized CPP with an incorporated PEG.sub.5 which is terminated with a hydryzynal nicotinic acid (HNA) and subsequently conjugated to a BAC which has been modified with 4-formyl benzoic acid;

[0167] FIG. 9 is a schematic diagram illustrating a preferred embodiment of a directly conjugated lactam containing CPP to a BAC;

[0168] FIG. 10 are schematic diagrams illustrating the conjugation of a 1,4 substituted triazole stabilised CPP to a BAC to form a preferred embodiment of a DCCPM;

[0169] FIG. 10a is a schematic diagram of a 1,4 substituted triazole stabilised CPP;

[0170] FIG. 10b is a schematic diagram of a 1,4 substituted triazole stabilised CPP with an incorporated PEG.sub.5 and terminated with a thiol-containing molecule (cysteine);

[0171] FIG. 10c is a schematic diagram of a 1,4 substituted triazole stabilised CPP and illustrates the incorporation of the heterobifunctional protein cross linker Succinimidyl-4-[N-maleimidomethyl] cyclohexane-1-carboxylate (SMCC);

[0172] FIG. 10d is a schematic diagram illustrating a 1,4 substituted triazole stabilized CPP as part of a DCCPM. It should be noted that the 1,2,3 triazole could contain other isomers e.g. 1,5 substituted triazole;

[0173] FIG. 11a illustrates connectivity of 1,4 substituted triazole containing CPP;

[0174] FIG. 11b is a schematic diagram illustrating a preferred embodiment of a DCCPM with a triazole stabilized CPP with an incorporated PEG.sub.5 which is terminated with a hydrazynal nicotinic acid (HNA) and subsequently conjugated to a 4-formyl benzoic modified BAC;

[0175] FIG. 11c a schematic diagram of a 4-formyl benzoic modified BAC;

[0176] FIG. 11d is a schematic diagram illustrating a preferred embodiment of a DCCPM with a 1,4 substituted triazole stabilized CPP with an incorporated PEG.sub.5 which is terminated with a hydryzynal nicotinic acid (HNA) and subsequently conjugated to a BAC which has been modified with 4-formyl benzoic acid;

[0177] FIG. 12a is circular dichroism spectra of FITC-K1E4-CP8M, FITC-K1E5-CP8M and FITC-K1E6-CP8M blanked to D2O and collected at room temperature and in triplicate. FITC-K1E4-CP8M and FITC-K1E5-CP8M displays random coils and FITC-K1E6-CP8M exhibits a degree of α-helicity.

[0178] FIG. 12b is circular dichroism spectra of K1E4-CP8M, K1E5-CP8M and K1E6-CP8M blanked to D2O and collected at room temperature and in triplicate. K1E5 displays a random coil, where as K1E4 and K1E6 show extended Pi helices;

[0179] FIG. 13 is flow cytometry data for HeLa pLuc 705 cells incubated in the presence of FITC labeled CPAs;

[0180] FIG. 13a(i) is a comparison of FL1+ cells of HeLa pLuc 705 cells incubated with K1E4-P8M-FITC or K1E4-P8M-FITC-NC 4 hours n=4, error bars show standard deviation 2 way ANOVA was performed and showed no interaction affect. Data illustrates that there was no significant difference in the number of FL1 positive cells when K1E4-P8M-FITC was cyclized;

[0181] FIG. 13a(ii) is a comparison of FL1+ cells of HeLa pLuc 705 cells incubated with K1E5-P8M-FITC or K1E5-P8M-FITC-NC 4 hours n=4, error bars show standard deviation 2 way ANOVA was performed and showed no interaction affect. Data illustrates that there was no significant difference in the number of FL1 positive cells when K1E5-P8M-FITC was cyclized;

[0182] FIG. 13a(iii) is a comparison of FL1+ cells of HeLa pLuc 705 cells incubated with K1E6-P8M-FITC or K1E6-P8M-FITC-NC for 4 hours. n=4, error bars show standard deviation 2 way ANOVA was performed * represents p<0.05, ** represents p<0.001. Data illustrates that there is a significant increase in the number of FL1 positive cells at a given concentration when K1E6-P8M-FITC is cyclized;

[0183] FIG. 13b(i) is a comparison of MFI of HeLa pLuc 705 cells incubated with K1E4-P8M-FITC or K1E4-P8M-FITC-NC for 4 hours. n=4, error bars show standard deviation. 2 way ANOVA was performed and showed no interaction affect;

[0184] FIG. 13b(ii) is a comparison of MFI of HeLa pLuc 705 cells incubated with K1E5-P8M-FITC or K1E5-P8M-FITC-NC for 4 hours. n=4, error bars show standard deviation. 2 way ANOVA was performed and showed no interaction affect;

[0185] FIG. 13b(iii) is a comparison of MFI of HeLa pLuc 705 cells incubated with K1E6-P8M-FITC or K1E6-P8M-FITC-NC for 4 hours. n=4, error bars show standard deviation. 2 way ANOVA was performed * represents p<0.05;

[0186] FIG. 13c is a comparison % viable cells judged by gated cells compared to negative controls of HeLa pLuc 705 cells incubated with (i) K1E4-P8M-FITC versus K1E4-P8M-FITC-NC, (ii) K1E5-P8M-FITC versus K1E5-P8M-FITC-NC and (iii) K1E6-P8M-FITC versus K1E4-P8M-FITC-NC for 4 hours. n=4, error bars show standard deviation. Data shows that there is no significant difference in the % of cells recovered when normalized to untreated controls;

[0187] FIG. 14 is a Micrograph of PC3-705 cells treated with PMO conjugated to either K1E4, K1E5 or K1E6 CP8M. Cells were treated to for 4 hours without transfection reagents then images captured. Images were captured using either brightfield objective or using epifluorescence to show FITC labeled PMO. Images were subsequently merged to show cellular localization. There is significant intracellular PMO signal evident in PC3-705 cells treated with PMO conjugated to either K1E4, K1E5 or K1E6 CP8M only. Unconjugated PMO gives no intracellular signal;

[0188] FIGS. 15a-c are flow cytometry data for HeLa pLuc 705 cells incubated in the presence of FITC labeled CPAs;

[0189] FIG. 15a is a comparison of FL1+ cells of HeLa pLuc 705 cells incubated with RCM1,5-P8M-FITC-3+, RCM1,5-P8M-FITC-2+, RCM1,5-P8M-FITC-1+, RCM1,5-P8M-FITC-0+, for 4 hours. n=5, error bars show standard deviation. * represents p<0.05, ** represents p<0.001. *a represents an interaction between RCM1,5-P8M-FITC-1+ and all other groups, *b represents an interaction between RCM1,5-P8M-FITC-0+ and all other groups. Data shows that RCM1,5-P8M-FITC-1+ has a significant reduction in FL1+ cells compared to other treatments over a range of concentrations. RCM1,5-P8M-FITC-0+ shows in increase in the number of FL1+ cells over a range of concentrations compared to other treatments;

[0190] FIG. 15b is a comparison of MFI of HeLa pLuc 705 cells incubated with RCM1,5-P8M-FITC-3+, RCM1,5-P8M-FITC-2+, RCM1,5-P8M-FITC-1+, RCM1,5-P8M-FITC-0+ for 4 hours. n=5, error bars show standard deviation. * represents p<0.05, ** represents p<0.001. There is no significant difference in the MFI between RCM, 1,5-P8M-FITC-0+, 1+ and 2+ at a given concentration. However RCM1,5-P8M-FITC-3+ shows an increase in MFI at higher concentrations >1 μM;

[0191] FIG. 15c is a comparison of % viable cells judged by gated cells compared to negative controls of HeLa pLuc 705 cells incubated with RCM1,5-P8M-FITC-3+[RKF(S5RLFS5)], RCM1,5-P8M-FITC-2+[RIF(S5RLFS5)], RCM1,5-P8M-FITC-1+[IIF(S5RLFS5)], RCM1,5-P8M-FITC-0+[IIF(S5ILFS5)] for 4 hours. n=3, error bars show standard deviation * represents p<0.05. *a represents an difference between RCM1,5-P8M-FITC-3+ and RCM1,5-P8M-FITC-2+, *b represents an difference between RCM1,5-P8M-FITC-2+ and RCM1,5-P8M-FITC-0+ and *c represents an difference between RCM1,5-P8M-FITC-0+ and RCM1,5-P8M-FITC-3+. Data shows that at highest concentration 100 μM a significant loss in the number of viable cells recovered when comparing RCM1,5-CP8M-FITC-3+ to RCM1,5-CP8M-FITC-2+ and an increase in the number of cells when comparing RCM1,5-CP8M-FITC-2+ to RCM1,5-CP8M-FITC-0+. Similarly at 33 μM RCM1,5-CP8M-FITC-3+ compared to RCM1,5-CP8M-FITC-2+ and RCM1,5-CP8M-FITC-0+ showed a decrease in the % viable cells. At all other concentration no other significant affects were observed apart from at 0.05 μM. At 0.05 μM RCM1,5-CP8M-FITC-0+ showed an increase in viable cells over RCM1,5-CP8M-FITC-3+ and RCM1,5-CP8M-FITC-2;

[0192] FIG. 16 illustrates % cell viability of HeLa pLuc 705 cells when comparing treatment with RCM1,5-P8M-3+-FITC to K1E5-P8M-FITC for 4 hours. n=3-4, error bars show standard deviation * represents p<0.001. At all concentrations an increase in viability was observed when comparing K1E5-P8M-FITC to RCM1,5-P8M-FITC-3+.

DETAILED DESCRIPTION

[0193] The invention demonstrates that different stapling and stitching chemistries (to that disclosed in applicants earlier application PCT/GB2016/054028) can be used to produce drug carrying cell penetrating molecule (DCCPM) and that these stabilized peptides can confer different and potentially beneficial effects such as, for example, lower toxicity.

[0194] An exemplary drug carrying cell penetrating molecule (DCCPM) was produced with a FITC label in order to demonstrate cellular uptake.

[0195] The exemplary DCCPM comprises: [0196] i) a biologically active compound (BAC); [0197] ii) a cell penetrating agent (CPA) which is a stabilized peptide; and [0198] iii) a bi-functional linker (BFL).

[0199] The three components forming the DCCPM are described in more detail below, and particularly favored embodiments are illustrated by way of reference to FIGS. 7a-d and FIGS. 8a-d.

1. The Biologically Active Compound

[0200] The biologically active compound is any compound that can exert a biological effect within a biological cell. Preferably, though not essentially, the BAC is one which will impact on the expression of one or more endogenous or exogenous genes. Examples include nucleic acids, DNAzymes, ribozymes, aptamers and pharmaceuticals. Preferred biologically active compounds for use in the present invention include electrically neutral oligonucleotides (charge −1 to +1 at physiological pH—about 7.5) such as peptide nucleic acids (PNAs) or PMOs or their modified derivatives that might impart a small electric charge (either positive or negative).

[0201] The biologically active compound may be used as a steric blocking compound to suppress or enhance: i) RNA splicing; ii) protein translation or iii) other nucleic acid:nucleic acid or nucleic acid:protein interactions, altering the gene expression of endogenous or exogenous (pathogen derived) genes.

[0202] The hybridisation of ON's to specific RNA sequence motifs prevents correct assembly of the spliceosome, so that it is unable to recognise the target exon(s) in the pre-mRNA and hence excludes these exon in the mature gene transcript. Exclusion of an in-frame exon can lead to a truncated yet functional gene product; exclusion of an out of frame exon results in a frame-shift of the transcript, potentially leading to a premature stop codon and a reduction in the target gene expression level.

[0203] Additionally, ON's can be designed to target 5′ translation initiation start sites of endogenous or viral gene transcript(s) to prevent binding of the translational machinery. Using AO to suppress viral translation is a well-established technology and has progressed into clinical trials for viral haemorrhagic fevers such as Marburg and Ebola.

[0204] Also, ON can be designed to target 3′ untranslated region of an endogenous transcript that alters the nuclear export, translation and stability of the transcript. Such targets include, but are not limited to polyadenylation and/or cleavage sites of the transcript.

[0205] Also, ON can be designed to form aptamers such that the secondary and tertiary structures can bind proteins or other cellular targets thus impacting on specific gene expression levels.

[0206] Non-limiting exemplary ON chemistries are illustrated in Table 4.

[0207] In the non-limiting example illustrated, the target is exon 51 of the dystrophin gene and comprises the sequence:

TABLE-US-00006 Sequence id 1: 5′ CUCCAACAUCAAGGAAGAUGGCAUUUCUAG 3′

2. The Cell Penetrating Agent (CPA) which is a Stabilized Peptide

[0208] The cell penetrating agents of the invention are stabilized peptides.

[0209] The peptides may be stabilized by cross linking of 2 amino acids, modified amino acids or un-natural amino acids, to form a stapled peptide (StaP) or crosslinking 3 or more residues to form a stitched peptide (StiP).

[0210] Crosslinking by stapling and stitching may confer a property, e.g. a solvated conformation such as, but not limited to, an alpha helix, extended 3.sub.10-helix or poly (Pro) II helix, a turn (for example, but not limited to, α, β, γ, δ or π), several turns to form a beta sheet or a hairpin, or a combination of one or more of: an alpha helix, extended 3.sub.10-helix or poly (Pro) II helix, turn, or beta sheet, an energetic conformational bias dependent on solvation environment e.g. interaction with plasma membrane, cellular penetrance, and biological activity.

[0211] Non-limiting examples of alternative chemistries to that described in PCT/GB2016/054028 for producing StaP and StiP are illustrated in Table 6 and include peptide sequences with nominal position for cross linking by amino acid, modified amino acids or unnatural amino acids illustrated by X and refereeing to functional groups defined but not limited to Table 1.

[0212] Stabilisation of peptides e.g. stitching or stapling, can be performed by a variety of means dependent on the functional group incorporated into the peptide. Non-limiting examples of functional groups are demonstrated in Table 2. Some reactions require catalyst or have preferential reagents for stabilization and are illustrated in Table 6 below.

TABLE-US-00007 TABLE 6 Table 1 Catalyst or Entry Brief description desirable reagent 1 Condensation of aldehyde or Aniline as a catalyst ketone with hydrazine or protected hydrazine 2 Thiol-ene Michael addition Reducing agent such a immobilized TCEP or suitable base or nucleophile. 3 Di-sulfide formation Reducing agent such as DTT or TCEP. 4 Huisgen 1,3 di-polar Typically Cu or Ru catalyzed cycloaddition. reaction between azide and alkyene, but can include electron deficient nitriles. 5 Amide from corridponding Standard peptide coupling amine and carboxylic acid conditions eg coupling reagent HATU, HOBt, COMU with base. 6 Singlet or triplet based UV irridation at ≈ 355 nm carbene reaction 7 Olefin metathesis Ruthenium based grubbs generation 1 and 2 and Grubbs-Hoyveda gen 1 and 2 8 Suziki or Sonogashira Palladium based catalysts coupling

[0213] All the peptide components (amino acids, unnatural amino acids, unstapled/unstitched, partially stapled/stitched and stapled/stitched peptides) may exist in specific geometric or stereoisomeric forms. All compounds include cis- and trans-isomers, (R)- and (S)-enantiomers, diastereoisomers and racemic mixtures thereof.

[0214] Preferred isomer/enantiomers will be enriched to give a greater proportion of one particular isomer or enantiomer. Embodiments thereof may be made of greater than 90%, 95%, 98% or 99%, by weight, of a preferred isomer/enantiomer.

[0215] Non-limiting examples of unnatural amino acids used in stabilising a peptide structure are illustrated in Table 1.

[0216] In PCT/GB2016/054028 the applicant employed α,α-disubstituted unnatural amino acids bearing all-hydrocarbon tethers (e.g. α-methyl, α-pentenyl glycine).

[0217] In the present invention the applicant in the alternative employs the chemistries disclosed in Table 6.

[0218] In one preferred embodiment they form a cross link by coupling two naturally occurring amino acid (e.g. lysine and glutamic acid) in the sequence RKF-[E-RLF-K]. Alternatively, these naturally occurring amino acids could be lysine and aspartic acid.

[0219] In yet another embodiment the applicant employs a cross link between a modified natural amino acid (N.sup.6-diazolysine) and a non-natural amino acid (S)-2-Amino-2-methyl-4-pentynoic acid such as the sequence RKF—[K(N.sub.3)—RLF-B] where B represents (S)-2-Amino-2-methyl-4-pentynoic acid and K(N.sub.3) represent N.sup.6-diazolysine.

[0220] In one embodiment the cell penetrating agent has a staple or stitch peptide comprising the sequence RFK—X-RLF-X, where X represents an amino acid that is able to be cross linked.

[0221] In another embodiment the sequence RFK—[X-RLF-X] could have the relative position of the cross linking residues moved, for example, but not limited to RF—[X—KRLF-X] or RFKR—[X-LF-X].

[0222] In another embodiment the peptide is a branched stapled peptide. The branched stapled peptide comprises of 2 or more chains of peptides. Branched peptides may be formed using any method know to the art; in one embodiment a lysine residue is used to branch two peptide chains.

[0223] Functional derivatives of disclosed peptide sequences could be used. Functional derivatives may have representative fragments or homologues or peptides that include insertions to the original peptide. Typical derivative would have 70%, 80%, 90% or more of the original peptide sequence and may have up to 200% of the number of amino acids of the original peptide. The derivatives would be used to enhance the delivery of a biologically active compound.

[0224] Peptide sequence can include modified amino acids (Table 1) to include functional groups that permit the addition of other moieties. Non-limiting examples of such moieties include an acetyl, a cholesterol, a fatty acid, a polyethylene glycol, a polysaccharide, an aminoglycan, a glycolipid, a phospholipid, a polyphenol, a nuclear localising signal, a nuclear export signal, an antibody and a targeting molecule.

3. Bi-Functional Linker

[0225] A bi-functional linker may be used to link the BAC to the CPA.

[0226] Preferred linkers will link between, for example, an amine group on the BAC and a sulfhydryl (thiol) group (usually a cysteine residue) on the CPA terminus. Examples of substrates to achieve this include, but are not limited to, SMCC (succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate), AMAS (N-α-maleimidoacet-oxysuccinimide ester, BMPS (N-β-maleimidopropyl-oxysuccinimide ester), GMBS (N-γ-aleimidobutyryl-oxysuccinimide ester), DMVS (N-□-maleimidovaleryl-oxysuccinimide ester, EMCS (N-ε-maleimidocaproyl-oxysuccinimide ester), and LC-SMCC (Succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxy-(6-amidocaproate) as exemplified in Table 5.

[0227] Another preferred linker system is hydrazynal nicotinic acid (HNA), however if the BAC is a PMO, the PMO is modified to incorporate 4 formyl benzoic acid.

[0228] Other linkers such as DSG (disuccinimidyl glutarate) and DSCDS (disuccinimidyl-cyclohexl-1,4-diester) will include the ability to link the 5′-amino group of the BAC to the N-terminus of the CPA (Table 5, entries 9 and 10).

[0229] Linkers may include other elements that confer a desirable property on the DCCPM e.g. spacer between ON and CPA or an element that will enhance solubility, for example a PEGylated element. Non-limiting examples are shown in Table 5.

[0230] The biologically active compound is covalently attached to the chimeric cell delivery peptide. Again, this can be done using any method known in the art. Preferably, the cell delivery peptide is attached to the biologically active compound by means of a disulphide bridge or a thiol maleimide linker e.g. SMCC; the attachment may be by means of an amide linker or an oxime linker or a thioether linker.

EXAMPLES

Proof of Principal Provided in PCT/GB2016/054028 with PMO CP8M and PMO HP8M which Serve as Comparators to the Alternative Chemistries Described Herein

[0231] DCCPM to enhance RNA steric blocking in treating Duchenne muscular dystrophy (DMD)

Introduction

[0232] Duchenne muscular dystrophy (DMD) is the most common inherited lethal childhood disease in the world, with a worldwide incidence of approximately 1 in 4000 live births.sup.37. This severe muscle-wasting disorder is caused in the majority of families by gene mutations leading to disruption of the reading frame and premature truncation of the protein dystrophin.sup.38,39.

[0233] RNA splicing suppression of the DMD transcript has particular promise. The hybridisation of AOs to specific RNA sequence motifs prevents correct assembly of the spliceosome, so that it is unable to recognise the target exon(s) in the pre-mRNA and hence excludes them in the mature gene transcript. AO-mediated RNA splicing suppression resulting in the re-expression of a truncated, yet functional dystrophin protein has been demonstrated in vitro and in the pre-clinical mdx mouse model.sup.32,40-45, which led to clinical development programs.sup.2,10.

[0234] Although intravenously administered PMOs have demonstrated a dose-dependent increase in dystrophin re-expression with some functional benefit.sup.2,46, skeletal muscle dystrophin restoration is still very variable between patients after many multiple administrations. Importantly, many other target tissues (e.g. brain and heart) remain refractory to PMO transfection even when repeat administration or high dose strategies are employed.sup.30,32.

[0235] To date unmodified CPA conjugation improves PMO bio-distribution and serum stability.sup.33-35, however toxicity is still a major roadblock for pipeline development.sup.20.

[0236] The applicant hypothesised that a CPA based upon a stabilized e.g. StaP (or StiP) conjugated to a PMO known to cause RNA splicing suppression of the DMD transcript, would lead to a greater level of dystrophin restoration and re-expression of dystrophin in tissues refractory to naked PMO without the potential for CPA related toxicity. We bring data forward that demonstrate novel CPA have attractive biological and toxicological properties, such that these novel DCCPMs or DTCPMs are clinically relevant.

Materials and Methods

General Peptide Synthesis Procedure

[0237] For ring closing metathesis peptides, all peptides were synthesized following an established protocol using standard Fmoc-peptide chemistry on Rink amide MBHA resin. The coupling reactions were performed by the addition of a mixture of 10 equivalents of the amino acids, 9.9 equivalents of HCTU and 20 equivalents of DIPEA in NMP (equivalents relative to initial loading of Rink amide MBHA resin). The reactions were allowed to proceed for at least one hour. Coupling of non-natural amino acids (R/S5, R/S8 or B5) was performed with 4 equivalents of the amino acid, 3.9 equivalents of HCTU and 10 equivalents of DIPEA in NMP for two hours. The ring closing metathesis reaction of the olefin-containing non-natural amino acids was facilitated with Grubbs I catalyst (benzylidene-bis(tricyclohexylphosphine)-dichlororuthenium) dissolved to approximately 10 mg/mL in 1,2-dichloroethane (DCE) for two hours under nitrogen bubbling. Subsequently, excess catalyst was washed from the resin with DCE and then coupled with an N-terminal FITC. Upon completion, peptides were simultaneously cleaved from the resin and de-protected using a cleavage cocktail containing 95% TFA, 2.5% TIS and 2.5% water. Crude peptides were dissolved in 50% acetonitrile/water, passed through a 0.2 μm syringe filter, and purified by reverse phase HPLC using a C-18 column (Agilent, Palo Alto, Calif.). Compound identification and purity was assessed using coupled LC/MS (Agilent, Palo Alto, Calif.). Purified fractions were pooled and evaporated to remove acetonitrile and trace TFA by Speedvac and then lyophilized to dryness. A non-ring closed peptide was also produced as a control.

[0238] All peptides were synthesized following an established protocol using standard Fmoc-peptide chemistry on Rink amide MBHA resin or 2-chlorotrytyl resin for the free acid variants. The coupling reactions were performed by the addition of a mixture of 10 equivalents of the amino acids, 9.9 equivalents of HCTU and 20 equivalents of DIPEA in NMP (equivalents relative to initial loading of Rink amide MBHA resin). The reactions were allowed to proceed for at least one hour.

Synthesis of Peptide Containing Modified Amino Acids and Un-Natural Amino Acids.

[0239] Deprotection of the temporary Fmoc group was achieved by 2×20 min treatments of the resin-bound peptide with 20% (v/v) piperidine in DMF. After extensive flow washing with DMF, coupling of each successive amino acid was achieved with 1×30 min incubation with the appropriate preactivated NR-Fmoc-amino acid derivative. All protected amino acids (1 mmol) were dissolved in the cartridge with 3.8 mL of 0.25 M DEPBT in DMF as part of the synthesizer program immediately before delivery to the reaction vessel. Subsequently, 1 mL of DIEA was added directly to the cartridge to effect activation no more than two minutes prior to transfer of the coupling solution to the NR-deprotected resin-bound peptide. After coupling was complete, the resin was extensively flow washed in preparation for the next deprotection/coupling cycle.

Synthesis for Lactam Containing Amino Acids (e.g. K1E5)

[0240] Side-chain protection of glutamic acid and lysine consisted of Fm and Fmoc groups, respectively. After acetylation amino terminus with Ac.sub.2O/NMM (2 mmol each, 114 and 189 μL, respectively) in a manner similar to any other NR-Boc-amino acid, Fmoc, and Fm side-chain protecting groups were removed with 20% piperidine, the resin-bound peptide was washed with DMF and then treated for 2 h with 1.9 mmol of HBTU (3.8 mL×0.5 M in DMF) and 1.9 mmol of DIEA to effect the lactam formation.

Selective Transformation of Lysine to N.sup.6-diazolysine

[0241] The target lysine residue for transformation was protected with an Mtt protecting group where as other lysine residues that do not require transformation are protected with Boc protecting group. The resin-bound peptide (0.31 mmol/g, 300 mg) in this instance the sequence RK(Boc)F—K(Mtt)-RLF-B, where B is the incorporated non-natural amino acid (S)—N-Fmoc-2-(2′-propynyl)alanine was suspended in 1% TFA solution in DCM (10 mL) and was stirred for 3 min. The solution becomes yellow instantaneously. Then the resin was washed with DCM (2×), MeOH (1×), and DCM (2×). The process was repeated 8 times until the solution stayed colorless. The resin-bound peptide was taken to the next step without further manipulations. Triflic acid anhydride (Tf.sub.2O, 316 μL, 1.87 mmol) was added dropwise to a vigorously stirred mixture of NaN3 (600 mg, 9.2 mmol) in H.sub.2O (1.5 mL) and CH.sub.2Cl.sub.2 (3 mL) at 0° C. The resulting mixture was allowed to warm to room temperature and was stirred for 2 h. The water layer was extracted twice with CH.sub.2Cl.sub.2, and the combined organic layers were washed with saturated aqueous Na.sub.2CO.sub.3. The resulting solution of TfN.sub.3 in CH.sub.2Cl.sub.2 was added slowly to the resin-bound peptide suspended in a solution of CuSO.sub.4.5H.sub.2O (2 mg, 8 mmol) and K.sub.2CO.sub.3 (5 mg, 36 mmol) in MeOH (1 mL). This reaction mixture was swirled for 18 h at room temperature. The completeness of the diazo transfer could be followed with the Kaiser test; colorless resin beads implied that the conversion of the amino group into the azido functionality had been completed. The resin was subsequently washed sequentially with DCM, MeOH, DMF, and DCM.

Cleavage and De Protection of the Peptide

[0242] The azide/alkynyl-containing resin-bound peptide was deprotected and cleaved from the solid support by treatment with TFA/TIS/H.sub.2O (95:2.5:2.5 v/v) for 4 h at RT. After filtration of the resin, the TFA solution was concentrated under reduced pressure and precipitated in ether to yield the desired product as a solid which was then purified by reverse phase chromatography.

High Resolution Mass Spectroscopy

[0243] High-resolution mass spectra were recorded on a Thermo scientific LQT Orbitrap XL under electron spray ionization conditions (ESI) or where indicated under Atmospheric Pressure Ionisation (API) condition.

Circular Dichroism (CD) Spectroscopy

[0244] CD analysis was performed on an Applied Photophysics Chirascan Circular Dichroism spectrometer. Samples were dissolved in D.sub.2O at a maximum of 0.125 W/W % and data acquired in triplicate at room temperature and subsequently averaged and smoothed using built in qCD software. Graphs were plotted by subtracting a blank D.sub.2O spectrum from the acquired data to provided blank correction.

Synthesis of PMO-CP8M

[0245] PMO (91.64 mg, 10 μmol) was dissolved in PBS (5 mL, pH 7.2) and incubated at room temp after the addition of SMCC linker (27.2 mg, 50 μM, 5× excess) dissolved in MeCN/H.sub.2O (1:1, 1 mL). After 30 mins the mixture was desalted using sephadex g25 hydrated in conjugation buffer (PBS 1×, pH 6.8) and was also used as the eluent.

[0246] K1E4-CP8M (17.8 mg, 11.4 μmol) was dissolved in milliQ water (4 mL) and EDTA solution (0.1 mL, 100 mM) and mixed with immobilised TCEP (2.5 mL) for 1 h prior. Final concentration of EDTA was 2 mM.

[0247] The freshly desalted SMCC modified PMO had MeCN (8 mL) and EDTA solution (0.1 mL, 100 mM) added before adding peptide the addition of the peptide. The reduced peptide was eluted from the immobilised TCEP into a tube containing the SMCC modified PMO and stirred at RT for 2 hours.

[0248] The solution was loaded on to 3×560 mg HLB columns, and washed with milliQ water to remove any salts, then 10% MeCN in water. When washing with 20% MeCN an amount of PMO was removed from the column. 20% MeCN was sufficient to remove unconjugated PMO from the HLB columns. Columns were washed with 20% MeCN until the eluent ran clear. Finally PMO conjugate was eluted with 50% MeCN in water. The eluted products then underwent size exclusion chromatography using sephadex superfine g25 hydrated in milliQ water also used as the eluent.

Synthesis of PMO-HP8M and Modification of PMO to PMO-4FB.

[0249] 4-FB (250 mg, 1.5 mM) was dissolved in DMF with COMU (1.2 g, 2.6 mM) and NHS (230 mg, 2.0 mM) and stirred for a few mins. 4-FB did not fully dissolve until DIEA was added. DIEA (0.54 mL 3.0 mM) was then added upon which the reaction mixture changed from colourless to pale yellow/orange. The reaction mixture was stirred for 1 h and monitored by TLC using 5% MeOH in DCM. The mixture was separated over DCM to remove DMF then purified by flash chromatography using DMC to elute the top spot staining positive with 2,4 DNP. Product was collected as an off white solid 112 mg (30%).

[0250] PMO (30.4 mg, 3 μM) was added to a solution of 4-FB and dissolved in 10 Carbonate buffer:MeCN (50% MeCN) and NHS activated 4-FB (10 mg, 32 μM) was added and stirred overnight. The mixture was then desalted using sephadex G25 superfine with water:MeCN as an eluent. MeCN was removed by rotary evaporation and the remaining eluent was then freeze dried. Freeze dried product yielded 24 mg 83% yield.

Conjugation of PMO-4FB to HP8M

[0251] HP8M was dissolved in milliQ ultra-pure water (100 μL) to give a solution of 12 mg/mL. Aldehyde modified PMO (7 mg, 0.76 μM) was dissolved in water/MeCN (300 μL, 1:1) and desalted using sephadex G25 superfine and water/MeCN (1:1) as the eluent. The collected fraction was then diluted to 1 mL total volume in water:MeCN mix (1:1) and PMO content was analysed by UV/vis and found to be 6.5 mg/mL or 705 μM. HNA peptide and Analine (10 mM final conc) was then added and UV/vis monitored for evidence of A.sub.354 and used to calculate the conjugation of PMO to peptide.

Cell Culture and Transfection

[0252] HeLa pLuc705 cells were cultured in high glucose DMEM supplemented with 10% foetal calf serum (Sigma, UK) at 37° C. under an 8% CO.sub.2/92% air atmosphere.

[0253] HeLa pLuc705 cells were setup in 96 well plates with the appropriate dilutions of test compounds either FITC labeled peptides or FITC labeled PMO conjugates diluted into complete culture media (up to 100□M). Cells were then then trypsinised, diluted to 4×10.sup.5 cells per mL and 100 μL added to each well giving a final volume of 200 μL in each well. Cells were then incubated for either 4 or 24 hours at either 4 or 37° c.

Flow Cytometry

[0254] Uptake of fluorescently-labelled PMO and peptides was determined by flow cytometry using an Accuri C6 flow cytometer. Cells were washed with PBS and glycine buffer then released with trypsin, and kept on ice before analysis in PBS containing 2.5% FBS. Cell fluorescence in single live cells was determined using FlowJo software after appropriate gating. Untreated cells were used to establish gating settings for the determination of the % fluorescein-positive cells, mean fluorescent intensity (MFI) was also calculated. Uptake was determined by gating cells that were able exclude cell-impermanent die (To-pro-3) indicating the ability of cells to retain membrane integrity.

HPLC Analysis

[0255] Samples were run on a Kinetex, 2.6 μM particles size, XB—C18 modified with 100 Å pores. Samples were run on a gradient of 0-80% MeCN over 8 mins at a flow rate of 1.5 mL/min at 60° C.

Statistical Analysis

[0256] All data are reported as mean values±SEM or standard deviation as indicated. Statistical differences between treatment groups and control groups were evaluated by SigmaStat (Systat Software, UK) and student's t test was applied or 2 way ANOVA. Significance was accepted for p-values<0.05 using a bonferroni post hoc analysis.

Results

[0257] Solid phase synthesis of stabilised peptides K1E4/5/6-P8M-FITC and the non-cyclised equivalents K1E4/5/6-P8M-NC—FITC, RCM1,5-P8M-FITC and equivalent non cyclised RCM1,5-P8M-FITC-NC, RCM1,5-CP8M and equivalent non cyclised RCM-CP8M-NC and RCM1,5-HP8M was performed with standard Fmoc chemistry on Rink amide resin and yielded the desired product identified by LC-MS in Table 7 below.

TABLE-US-00008 TABLE 7 Calculated Observed Molecular Molecular Sample Formula mass (Av) Mass (Av) K1E4-P8M-FITC C.sub.89H.sub.125N.sub.19O.sub.21S 1829.1510 1829.353 K1E4-FITC-NC C.sub.89H.sub.127N.sub.19O.sub.22S 1847.1660 1847.353 K1E5-FITC C.sub.89H.sub.125N.sub.19O.sub.21S 1829.1510 1829.353 K1E5-FITC-NC C.sub.89H.sub.127N.sub.19O.sub.22S 1847.1660 1847.353 K1E6-FITC C.sub.89H.sub.125N.sub.19O.sub.21S 1829.1510 1829.353 K1E6-FITC-NC C.sub.89H.sub.127N.sub.19O.sub.22S 1847.1660 1847.353 RCM1,5-P8M-FITC C.sub.92H.sub.130N.sub.18O.sub.20S 1840.2180 1840.387 RCM1,5-P8M-NC-FITC C.sub.94H.sub.134N.sub.18O.sub.20S 1868.2720 1868.387 RCM1,5-CP8M C.sub.74H.sub.124N.sub.18O.sub.16S 1553.9760 1554.150

[0258] HPLC analysis of un-cyclised peptides K1E4/5/6-CP8M-FITC-NC showed elution time of 6.22-6.29 mins using a 0-80% gradient over 8 mins.

[0259] HPLC analysis of cyclised peptides K1E4/5/6-CP8M-FITC showed in increase in elution time over the un-cyclised peptide (Table 8).

[0260] HPLC analysis of RCM1,5-CP8M showed a decrease in retention time of the cyclised product compared to un-cyclised product with a similar retention time to K1E4-CP8M and K1E6-CP8M peptides as illustrated in Table 8 below.

TABLE-US-00009 TABLE 8 Peptide Not-Cyclised retention time Cyclised retention time K1E4 6.295 6.625 K1E5 6.284 6.820 K1E6 6.225 6.571 RCM1,5 6.858 6.723

[0261] Circular dichroism data indicates the solvated structure of K1E4/5/6-CP8M peptides can be influenced by both the presence of a charged fluorochrome or the position of the cross-link (FIGS. 12a and 12b).

[0262] K1E4-CP8M exhibits an extended 3.sub.10Helix/Poly (pro)II helix with maxima at 219 nm and minima of 196 nm. K1E6-CP8M show similar characteristic maxima and minima (FIG. 12).

[0263] K1E5-CP8M displays characteristics of random coil or disordered structure (FIG. 12) displayed by the low near 8 elipicity above 210 nm and a minima around 196 nm.

[0264] HeLa pLuc 705 cells incubated in the presence of K1E4/5-CP8M-FITC and K1E4/5/6-CP8M-NC—FITC showed no difference in the uptake of stabilised peptides vs non-stabilised peptides (FIG. 13ai-aii). Surprisingly, K1E6-CP8M did show a significant difference in uptake compared to the non-stabilised peptide (FIG. 13aiii; n=4, error bars show standard deviation 2 way ANOVA was performed * represents p<0.05, ** represents p<0.001). A 22% increase in FL1+ cells was observed at 11.1 μM when comparing K1E6-CP8M-FITC to the uncyclised control. The difference in FL1+ cells further increased to 43% difference at 3.7 μM and at the largest difference of 65% at 1.23 μM and remained constantly higher at all tested concentration. This demonstrates that the position of the cross link that influences cellular uptake is not intuitive between different cyclisation technologies as PCT/GB2016/054028 demonstrates that ring closing metathesis between amino acids a position 1 and 5 within a peptide are efficient at cellular entry.

[0265] HeLa pLuc 705 cells incubated in the presence of K1E4/5-CP8M-FITC and K1E4/5/6-CP8M-NC—FITC demonstrated that a significant increase of over 2 logs in mean fluorescent intensity was only observed for K1E6-CP8M-FITC peptide (compared to it non cyclised control) at concentration greater than 10 μM; FIG. 13bi-biii; n=4, error bars show standard deviation. 2 way ANOVA was performed * represents p<0.05).

[0266] HeLa pLuc 705 cells incubated in the presence of K1E4/5-CP8M-FITC and K1E4/5/6-CP8M-NC—FITC demonstrate no adverse cellular toxicity across all concentration ranges (0.05□M to 100□M; FIG. 13ci-iii).

[0267] HeLa pLuc 705 cells incubated in the presence of K1E4/5/6-CP8M-conjugated PMO demonstrated an increase in intracellular uptake compared to unconjugated PMO (FIG. 14).

[0268] Hela pLuc 705 cells incubated in the presence of RCM1,5-CP8M-FITC labelled peptide shows a dose dependent uptake of peptide at similar levels to K1E6-CP8M-FITC peptide.

[0269] Hela pLuc 705 cells incubated in the presence of FITC labelled peptides based on charge variants of RCM1,5-CP8M-FITC (FIG. 14a; i.e. RCM1,5-CP8M-FITC 3+, RCM1,5-CP8M-FITC 2+, RCM1,5-CP8M-FITC 1+ and RCM1,5-CP8M-FITC 0+). FIG. 15a demonstrated a differential response to peptide dose and cell viability. Data shows that RCM1,5-P8M-FITC-1+ has a significant reduction in FL1+ cells at all concentration below 33 μM compared to other treatments, ranging from 2% difference to 60% difference of FL1 positive cells. RCM1,5-P8M-FITC-0+ shows in increase in the number of FL1+ cells over a range of concentrations compared to other treatments ranging from a 10% increase to 40% increase at the largest difference at 0.41 μM (n=5, error bars show standard deviation. * represents p<0.05, ** represents p<0.001, *a represents an interaction between RCM1,5-P8M-FITC-1+ and all other groups, *b represents an interaction between RCM1,5-P8M-FITC-0+ and all other groups).

[0270] Hela pLuc 705 cells incubated in the presence of FITC labelled peptides based on charge variants of RCM1,5-CP8M-FITC had differential mean fluorescent intensities (FIG. 15b). There is no significant difference in the MFI between RCM1,5-P8M-FITC-0+, 1+ and 2+ at a given concentration. However RCM1,5-P8M-FITC-3+ shows an increase in MFI at higher concentrations >1 μM maximally about 1 log increase (n=5, error bars show standard deviation. * represents p<0.05, ** represents p<0.001).

[0271] FIG. 15c is a comparison of % viable cells judged by gated cells compared to negative controls of HeLa pLuc 705 cells incubated with RCM1,5-P8M-FITC-3+, RCM1,5-P8M-FITC-2+, RCM1,5-P8M-FITC-1+, RCM1,5-P8M-FITC-0+ for 4 hours (n=3, error bars show standard deviation * represents p<0.05, *a represents an interaction between RCM1,5-P8M-FITC-3+ and RCM1,5-P8M-FITC-2+, *b represents an interaction between RCM1,5-P8M-FITC-2+ and RCM1,5-P8M-FITC-0+ and *c represents an interaction between RCM1,5-P8M-FITC-0+ and RCM1,5-P8M-FITC-3+). Data shows that at highest concentration 100 μM a significant loss in the number of viable cells recovered when comparing RCM1,5-CP8M-FITC-3+ to RCM1,5-CP8M-FITC-2+(32% reduction) and an increase in the number of cells when comparing RCM1,5-CP8M-FITC-2+ to RCM1,5-CP8M-FITC-0+(20% increase). Similarly at 33 μM RCM1,5-CP8M-FITC-3+ compared to RCM1,5-CP8M-FITC-2+ and RCM1,5-CP8M-FITC-0+ showed a 20% decrease in the % viable cells. At all other concentration no other significant affects were observed apart from at 0.05 μM. At 0.05 μM RCM1,5-CP8M-FITC-0+ showed an increase of 23% in viable cells over RCM1,5-CP8M-FITC-3+ and RCM1,5-CP8M-FITC-2+. This has important implications for clinical translation of reduce charge RCM based CPP variants.

[0272] Comparisons of HeLa pLuc 705 cell viability when incubated with either RCM1,5-P8M-FITC-3+ or any of the K1E4/5/6-CP8M-FITC series of peptide demonstrates that at dose ranges 0.05 □100 □M, that the K1E4/5/6-CP8M-FITC do not have any negative impact on cell viability (FIG. 16). Comparing RCM1,5-P8M-FITC to K1E5-P8M-FITC peptides show an increase in viability of 70-99% over the range of concentrations. This has important implications for clinical translation of lactamisation based CPPs.

CONCLUSION

[0273] From the data generated it can be seen that a CPA stabilized by stapling via alternate cross linking technologies to that the applicant disclosed in PCT/GB2016/054028 are effective at cell entry in vitro.

[0274] The importance of position of the crosslink within the peptide sequence has been illustrated as chemistry specific and can greatly influence the solvated conformation of the stabilised peptide and subsequently the cellular uptake as measured by flow cytometry. Thus, surprisingly, it is not intuitive that crosslinks based on different chemical cyclisation technologies, orthogonal to the sequence, generate peptides with either the same conformation or the same cell entry properties. This may be true for other cyclisation chemistries.

[0275] CPAs stabilized by lactamisation cyclisation chemistry stabilize into helical structures and the structures are not □-helical. K1E4-CP8M and K1E6-CP8M exhibits an extended 3.sub.10Helix/Poly (pro)II helix structure.

[0276] CPAs stabilized by lactamisation cyclisation chemistry does not cause cellular death in vitro. This has important clinical translation implication for DCCPMs based on this technology.

[0277] HPLC analysis of cyclised and non-cyclised K1E4/5/6-CP8M peptides illustrated the similar retention time of non-cyclised peptide 6.22 min (Table 8), however the cyclisation process and resulting stabilised peptides showed an increase in retention times (Table 8). Peptides with inferred conformation of an 3.sub.10Helix/Poly (pro)II helix had broadly similar retention times K1E4-CP8M=6.62 and K1E6-CP8M=6.57 mins highlighting the potential use of HPLC for identifying changes in conformation.

[0278] CPAs stabilized by lactamisation cyclisation chemistry when conjugated to a PMO facilitates the cellular entry of the PMO.

[0279] Reduced charge variants of CPAs stabilized by a ring closing metathesis cyclisation chemistry are efficient cell entry peptides and have improved toxicological profiles in vitro. This has important clinical translation implication for DCCPMs based on this technology.

REFERENCES

[0280] 1 Chiriboga, C. A. et al. Results from a phase 1 study of nusinersen (ISIS-SMN(Rx)) in children with spinal muscular atrophy. Neurology 86, 890-897, doi:10.1212/WNL.0000000000002445 (2016). [0281] 2 Mendell, J. R. et al. Eteplirsen for the treatment of Duchenne muscular dystrophy. Ann Neurol 74, 637-647, doi:10.1002/ana.23982 (2013). [0282] 3 Iversen, P. L. et al. Discovery and early development of AVI-7537 and AVI-7288 for the treatment of Ebola virus and Marburg virus infections. Viruses 4, 2806-2830, doi:10.3390/v4112806 (2012). [0283] 4 Heald, A. E. et al. Safety and pharmacokinetic profiles of phosphorodiamidate morpholino oligomers with activity against ebola virus and marburg virus: results of two single-ascending-dose studies. Antimicrob Agents Chemother 58, 6639-6647, doi:10.1128/aac.03442-14 (2014). [0284] 5 Warren, T. K. et al. Advanced antisense therapies for postexposure protection against lethal filovirus infections. Nat Med 16, 991-994, doi:10.1038/nm.2202 (2010). [0285] 6 Campbell, J. M., Bacon, T. A. & Wickstrom, E. Oligodeoxynucleoside phosphorothioate stability in subcellular extracts, culture media, sera and cerebrospinal fluid. Journal of biochemical and biophysical methods 20, 259-267 (1990). [0286] 7 Agrawal, S., Mayrand, S. H., Zamecnik, P. C. & Pederson, T. Site-specific excision from RNA by RNase H and mixed-phosphate-backbone oligodeoxynucleotides. Proc Natl Acad Sci USA 87, 1401-1405 (1990). [0287] 8 Tereshko, V. et al. Correlating structure and stability of DNA duplexes with incorporated 2′-O-modified RNA analogues. Biochemistry 37, 10626-10634, doi:10.1021/bi980392a (1998). [0288] 9 Shibahara, S. et al. Inhibition of human immunodeficiency virus (HIV-1) replication by synthetic oligo-RNA derivatives. Nucleic Acids Res 17, 239-252 (1989). [0289] 10 Goemans N, C. C., Kraus J E, et al. Drisapersen efficacy and safety in Duchenne muscular dystrophy: results of a phase III, randomized, double-blind, placebo-controlled trial (study DMD114044). World Muscle Society Congress; Asilomar, Calif., USA; Oct. 1-5, 2013 (2103). [0290] 11 Goemans, N. M. et al. Long-Term Efficacy, Safety, and Pharmacokinetics of Drisapersen in Duchenne Muscular Dystrophy: Results from an Open-Label Extension Study. PLoS One 11, e0161955, doi:10.1371/journal.pone.0161955 (2016). [0291] 12 Dirin, M. & Winkler, J. Influence of diverse chemical modifications on the ADME characteristics and toxicology of antisense oligonucleotides. Expert Opin Biol Ther 13, 875-888, doi:10.1517/14712598.2013.774366 (2013). [0292] 13 Sazani, P. et al. Repeat-dose toxicology evaluation in cynomolgus monkeys of AVI-4658, a phosphorodiamidate morpholino oligomer (PMO) drug for the treatment of duchenne muscular dystrophy. Int J Toxicol 30, 313-321, doi:10.1177/1091581811403505 (2011). [0293] 14 Sazani, P., Weller, D. L. & Shrewsbury, S. B. Safety pharmacology and genotoxicity evaluation of AVI-4658. Int J Toxicol 29, 143-156, doi:10.1177/1091581809359206 (2010). [0294] 15 Heemskerk, H. A. et al. In vivo comparison of 2′-O-methyl phosphorothioate and morpholino antisense oligonucleotides for Duchenne muscular dystrophy exon skipping. J Gene Med 11, 257-266, doi:10.1002/jgm.1288 [doi] (2009). [0295] 16 Kreutz, M. et al. Antibody-antigen-adjuvant conjugates enable co-delivery of antigen and adjuvant to dendritic cells in cis but only have partial targeting specificity. PLoS One 7, e40208, doi:10.1371/journal.pone.0040208 (2012). [0296] 17 Derossi, D., Joliot, A. H., Chassaing, G. & Prochiantz, A. The third helix of the Antennapedia homeodomain translocates through biological membranes. J Biol Chem 269, 10444-10450 (1994). [0297] 18 Gautam, A. et al. CPPsite: a curated database of cell penetrating peptides. Database the journal of biological databases and curation 2012, bas015, doi:10.1093/database/bas015 (2012). [0298] 19 Hirose, H. et al. Transient focal membrane deformation induced by arginine-rich peptides leads to their direct penetration into cells. Mol Ther 20, 984-993, doi:10.1038/mt.2011.313 (2012). [0299] 20 Moulton, H. M. & Moulton, J. D. Morpholinos and their peptide conjugates: therapeutic promise and challenge for Duchenne muscular dystrophy. Biochim Biophys Acta 1798, 2296-2303, doi:10.1016/j.bbamem.2010.02.012 (2010). [0300] 21 Tunnemann, G. et al. Live-cell analysis of cell penetration ability and toxicity of oligo-arginines. J Pept Sci 14, 469-476, doi:10.1002/psc.968 (2008). [0301] 22 Chu, Q. et al. Towards understanding cell penetration by stapled peptides. MedChemComm 6, 111-119, doi:10.1039/C4MD00131A (2015). [0302] 23 Hilinski, G. J. et al. Stitched α-Helical Peptides via Bis Ring-Closing Metathesis. Journal of the American Chemical Society 136, 12314-12322, doi:10.1021/ja505141j (2014). [0303] 24 Cantel, S. et al. Synthesis and conformational analysis of a cyclic peptide obtained via i to i+4 intramolecular side-chain to side-chain azide-alkyne 1,3-dipolar cycloaddition. The Journal of organic chemistry 73, 5663-5674, doi:10.1021/jo800142s (2008). [0304] 25 Bracken, C., Gulyas, J., Taylor, J. W. & Baum, J. Synthesis and Nuclear Magnetic Resonance Structure Determination of an .alpha.-Helical, Bicyclic, Lactam-Bridged Hexapeptide. Journal of the American Chemical Society 116, 6431-6432, doi:10.1021/ja00093a052 (1994). [0305] 26 Lehto, T. et al. Cellular trafficking determines the exon skipping activity of Pip6α-PMO in mdx skeletal and cardiac muscle cells. Nucleic Acids Res 42, 3207-3217, doi:10.1093/nar/gkt1220 (2014). [0306] 27 Nakase, I. et al. Interaction of arginine-rich peptides with membrane-associated proteoglycans is crucial for induction of actin organization and macropinocytosis. Biochemistry 46, 492-501, doi:10.1021/bi0612824 (2007). [0307] 28 Chang, Y. S. et al. Stapled alpha-helical peptide drug development: a potent dual inhibitor of MDM2 and MDMX for p53-dependent cancer therapy. Proc Natl Acad Sci USA 110, E3445-3454, doi:10.1073/pnas.1303002110 (2013). [0308] 29 Vitiello, L. et al. In vivo delivery of naked antisense oligos in aged mdx mice: analysis of dystrophin restoration in skeletal and cardiac muscle. Neuromuscul Disord 18, 597-605, doi:S0960-8966(08)00141-7 [pii]10.1016/j.nmd.2008.05.011 [doi] (2008). [0309] 30 Jearawiriyapaisarn, N., Moulton, H. M., Sazani, P., Kole, R. & Willis, M. S. Long-term improvement in mdx cardiomyopathy after therapy with peptide-conjugated morpholino oligomers. Cardiovasc Res 85, 444-453, doi:cvp335 [pii]10.1093/cvr/cvp335 [doi] (2010). [0310] 31 Wu, B. et al. One-year treatment of morpholino antisense oligomer improves skeletal and cardiac muscle functions in dystrophic mdx mice. Mol Ther 19, 576-583, doi:10.1038/mt.2010.288 (2011). [0311] 32 Wu, B. et al. Effective rescue of dystrophin improves cardiac function in dystrophin-deficient mice by a modified morpholino oligomer. Proc Natl Acad Sci USA 105, 14814-14819, doi:0805676105 [pii]10.1073/pnas.0805676105 [doi] (2008). [0312] 33 Jearawiriyapaisarn, N. et al. Sustained dystrophin expression induced by peptide-conjugated morpholino oligomers in the muscles of mdx mice. Mol Ther 16, 1624-1629, doi:mt2008120 [pii]10.1038/mt.2008.120 [doi] (2008). [0313] 34 Betts, C. et al. Pip6-PMO, A New Generation of Peptide-oligonucleotide Conjugates With Improved Cardiac Exon Skipping Activity for DMD Treatment. Molecular therapy. Nucleic acids 1, e38, doi:10.1038/mtna.2012.30 (2012). [0314] 35 Ivanova, G. D. et al. Improved cell-penetrating peptide-PNA conjugates for splicing redirection in HeLa cells and exon skipping in mdx mouse muscle. Nucleic Acids Res 36, 6418-6428 (2008). [0315] 36 Lautrette, G., Touti, F., Lee, H. G., Dai, P. & Pentelute, B. L. Nitrogen Arylation for Macrocyclization of Unprotected Peptides. J Am Chem Soc 138, 8340-8343, doi:10.1021/jacs.6b03757 (2016). [0316] 37 Mendell, J. R. et al. Evidence-based path to newborn screening for Duchenne muscular dystrophy. Ann Neurol 71, 304-313, doi:10.1002/ana.23528 (2012). [0317] 38 Hoffman, E. P., Brown, R. H., Jr. & Kunkel, L. M. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell 51, 919-928. (1987). [0318] 39 Monaco, A. P., Bertelson, C. J., Liechti-Gallati, S., Moser, H. & Kunkel, L. M. An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics 2, 90-95 (1988). [0319] 40 Aartsma-Rus, A. et al. Therapeutic antisense-induced exon skipping in cultured muscle cells from six different DMD patients. Hum Mol Genet 12, 907-914 (2003). [0320] 41 Alter, J. et al. Systemic delivery of morpholino oligonucleotide restores dystrophin expression bodywide and improves dystrophic pathology. Nat Med 12, 175-177 (2006). [0321] 42 Kinali, M. et al. Local restoration of dystrophin expression with the morpholino oligomer AVI-4658 in Duchenne muscular dystrophy: a single-blind, placebo-controlled, dose-escalation, proof-of-concept study. Lancet Neurol 8, 918-928, doi:S1474-4422(09)70211-X [pii]10.1016/S1474-4422(09)70211-X [doi] (2009). [0322] 43 Lu, Q. L. et al. Systemic delivery of antisense oligoribonucleotide restores dystrophin expression in body-wide skeletal muscles. Proc Natl Acad Sci USA 102, 198-203 (2005). [0323] 44 van Deutekom, J. C. et al. Local dystrophin restoration with antisense oligonucleotide PRO051. N Engl J Med 357, 2677-2686, doi:357/26/2677 [pii]10.1056/NEJMoa073108 [doi] (2007). [0324] 45 Wu, B. et al. Dose-dependent restoration of dystrophin expression in cardiac muscle of dystrophic mice by systemically delivered morpholino. Gene Ther 17, 132-140, doi:gt2009120 [pii]10.1038/gt.2009.120 [doi] (2010). [0325] 46 Cirak, S. et al. Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study. Lancet 378, 595-605, doi:10.1016/s0140-6736(11)60756-3 (2011).