HSP90 COMBINATION THERAPY
20220074941 · 2022-03-10
Inventors
Cpc classification
A61P1/04
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61P43/00
HUMAN NECESSITIES
A61P1/18
HUMAN NECESSITIES
A61P1/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61P1/16
HUMAN NECESSITIES
A61P15/00
HUMAN NECESSITIES
International classification
A61K45/06
HUMAN NECESSITIES
Abstract
This invention concerns a method for selecting an inhibitor of a cancer-implicated pathway or of a component of a cancer-implicated pathway for coadministration, with an inhibitor of HSP90, to a subject suffering from a cancer which comprises the following steps: (a) contacting a sample containing cancer cells from a subject with an inhibitor of HSP90 or an analog, homolog or derivative of an inhibitor of HSP90 under conditions such that one or more cancer pathway components present in the sample bind to the HSP90 inhibitor or the analog, homolog or derivative of the HSP90 inhibitor; (b) detecting pathway components bound to the HSP90 inhibitor or to the analog, homolog or derivative of the HSP90 inhibitor; (c) analyzing the pathway components detected in step (b) so as to identify a pathway which includes the components detected in step (b) and additional components of such pathway; and (d) selecting an inhibitor of the pathway or of a pathway component identified in step (c). This invention further concerns a methods of treating a cancer patient by coadministering an inhibitor of HSP90 and an inhibitor of a cancer-implicated pathway or component thereof.
Claims
1. A method for selecting an inhibitor of a cancer-implicated pathway, or of a component of a cancer-implicated pathway, for coadministration with an inhibitor of Hsp90, to a subject suffering from a cancer which comprises the following steps: (a) contacting a sample containing cancer cells from the subject with (i) an inhibitor of Hsp90 which binds to Hsp90 when such Hsp90 is bound to cancer pathway components present in the sample; or (ii) an analog, homolog, or derivative of such Hsp90 inhibitor which binds to Hsp90 when such Hsp90 is bound to such cancer pathway components in the sample; (b) detecting pathway components bound to Hsp90; (c) analyzing the pathway components detected in step (b) so as to identify a pathway which includes the components detected in step (b) and additional components of such pathway; and (d) selecting an inhibitor of the pathway or of a pathway component identified in step (c).
2. (canceled)
3. (canceled)
4. The method of claim 1, wherein the cancer-implicated pathway or the component of the pathway is involved with a cancer selected from the group consisting of colorectal cancer, pancreatic cancer, thyroid cancer, a leukemia including acute myeloid leukemia and chronic myeloid leukemia, basal cell carcinoma, melanoma, renal cell carcinoma, bladder cancer, prostate cancer, a lung cancer including small cell lung cancer and non-small cell lung cancer, breast cancer, neuroblastoma, myeloproliferative disorders, gastrointestinal cancers including gastrointestinal stromal tumors, esophageal cancer, stomach cancer, liver cancer, gallbladder cancer, anal cancer, brain tumors including gliomas, lymphomas including follicular lymphoma and diffuse large B-cell lymphoma, and gynecologic cancers including ovarian, cervical, and endometrial cancers.
5. (canceled)
6. The method of claim 1, wherein in step (a) the subject is the same subject to whom the selected inhibitor is to be administered.
7. (canceled)
8. The method of claim 1, wherein in step (a) the sample comprises a tumor tissue.
9.-77. (canceled)
78. A composition comprising an inhibitor of JAK for the treatment of an oncogenic Hsp90 dependent cancer in a subject, wherein the composition is coadministered to the subject with PU-H71.
79. The composition of claim 78, wherein the inhibitor of JAK is selected from the group consisting of AT9283, AG-490, INCB018424 (Ruxolitinib), AZD1480, LY2784544, NVP-BSK805, TG101209, and TG-101348.
80. The composition of claim 78, wherein coadministration comprises administering PU-H71 and the inhibitor of JAK simultaneously, concomitantly, sequentially, or adjunctively.
81. A method of treatment comprising administering to a subject in need thereof a combination of an inhibitor of JAK and PU-H71.
82. The method of claim 81, wherein the inhibitor of JAK is selected from the group consisting of AT9283, AG-490, INCB018424 (Ruxolitinib), AZD1480, LY2784544, NVP-BSK805, TG101209, and TG-101348.
83. The method of claim 81, wherein the method comprises administering PU-H71 and the inhibitor of JAK simultaneously, concomitantly, sequentially, or adjunctively.
84. A method of treatment comprising administering to a subject in need thereof a combination of an inhibitor of BTK and PU-H71.
85. The method of claim 84, wherein the inhibitor of BTK is PCI-32765.
86. The method of claim 84, wherein the method comprises administering PU-H71 and the inhibitor of JAK simultaneously, concomitantly, sequentially, or adjunctively.
87. In a method of treating cancer with an inhibitor of JAK the improvement comprising administering therapy so that the subject receives the inhibitor of JAK and PU-H71.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054] A primer that amplifies an intergenic region was used as negative control. Results are expressed as percentage of the input for the specific antibody (STAT5 or Hsp90) over the respective IgG control. (g) The transcript abundance of CCND2 and AfYC was measured by QPCR in K562 cells exposed to 1 μM of PU-H71. Results are expressed as fold change compared to baseline (time 0 h) and were normalized to RPL13A. HPRT was used as negative control. Experiments were carried out in biological quintuplicates with experimental duplicates. Data are presented as means±SEM. (h) Proposed mechanism for and Hsp90-facilitated increased STAT5 signaling in CML. Hsp90 binds to and influences the conformation of STAT5 and maintains STAT5 in an active conformation directly within STATS-containing transcriptional complexes.
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062] Gene expression, cell cycle and cellular assembly Individual proteins are displayed as nodes, utilizing gray to represent that the protein was identified in this study. Proteins identified by IPA only are represented as white nodes. Different shapes are used to represent the functional class of the gene product. Proteins are depicted in networks as two circles when the entity is part of a complex; as a single circle when only one unit is present; a triangle pointing up or down to describe a phosphatase or a kinase, respectively; by a horizontal oval to describe a transcription factor; and by circle to depict “other” functions. The edges describe the nature of the relationship between the nodes: an edge with arrow-head means that protein A acts on protein B, whereas an edge without an arrow-head represents binding only between two proteins. Direct interactions appear in the network diagram as a solid line, whereas indirect interactions as a dashed line. In some cases a relationship may exist as a circular arrow or line originating from one molecule and pointing back at that same molecule. Such relationships are termed “self-referential” and arise from the ability of a molecule to act upon itself.
[0063]
[0064]
[0065] Quantitative analysis of synergy between mTOR and Hsp90 inhibitors: To determine the drug interaction between pp242 (mTOR inhibitor) and PU-H71 (Hsp90 inhibitor), the combination index (CI) isobologram method of Chou-Talalay was used as previously described. This method, based on the median-effect principle of the law of mass action, quantifies synergism or antagonism for two or more drug combinations, regardless of the mechanisms of each drug, by computerized simulation. Based on algorithms, the computer software displays median-effect plots, combination index plots and normalized isobolograms (where non constant ratio combinations of 2 drugs are used). PU-H71 (0.5, 0.25, 0.125, 0.0625, 0.03125, 0.0125 μM) and pp242 (0.5, 0.125, 0.03125, 0.0008, 0.002, 0.001 μM) were used as single agents in the concentrations mentioned or combined in a non constant ratio (PU-H71:pp242; 1:1, 1:2, 1:4, 1:7.8, 1:15.6, 1:12.5). The Fa (fraction killed cells) was calculated using the formulae Fa=1−Fu; Fu is the fraction of unaffected cells and was used for a dose effect analysis using the computer software (CompuSyn, Paramus, N.J., USA).
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084] 9-(2-Bromoethyl)-8-(6-(dimethylamino)benzo[d][1,3]dioxol-5-ylthio)-9H-purin-6-amine (2a). 1a (29 mg, 0.0878 mmol), Cs.sub.2CO.sub.3 (42.9 mg, 0.1317 mmol), 1,2-dibromoethane (82.5 mg, 37.8 μL, 0.439 mmol) in DMF (0.6 mL) was stirred for 1.5 h at rt. Then additional Cs.sub.2CO.sub.3 (14 mg, 0.043 mmol) was added and the mixture stirred for an additional 20 min. The mixture was dried under reduced pressure and the residue purified by preparatory TLC (CH.sub.2Cb:MeOH:AcOH, 15:1:0.5) to give 2a (24 mg, 63%). .sup.1H NMR (500 MHz, CDCh/MeOH-d.sub.4) 8 8.24 (s, 1H), 6.81 (s, 1H), 6.68 (s, 1H), 5.96 (s, 2H), 4.62 (t, J=6.9 Hz, 2H), 3.68 (t, J=6.9 Hz, 2H), 2.70 (s, 6H); MS (ESI) m/z 437.2/439.1 [M+H].sup.+.
[0085] tert-Butyl (6-((2-(6-amino-8-((6-(dimethylamino)benzo[1,3]dioxol-5-yl)thio)-9H-purin-9-yl)ethyl)amino)hexyl)carbamate (3a). 2a (0.185 g, 0.423 mmol) and text-butyl 6-aminohexylcarbamate (0.915 g, 4.23 mmol) in DMF (7 mL) was stirred at rt for 24 h. The reaction mixture was concentrated and the residue chromatographed [CHCl.sub.3:MeOH:MeOH—NH.sub.3 (7N), 100:7:3] to give 0.206 g (85%) of 3a; MS (ESI) m/z 573.3 [M+H].sup.+.
[0086] (4a). 3a (0.258 g, 0.45 mmol) was dissolved in 15 mL of CH.sub.2Cl.sub.2:TFA (4:1) and the solution was stirred at rt for 45 min. Solvent was removed under reduced pressure and the residue dried under high vacuum overnight. This was dissolved in DMF (12 mL) and added to 25 mL of Affi-Gel 10 beads (prewashed, 3×50 mL DMF) in a solid phase peptide synthesis vessel. 225 μL of N,N-diisopropylethylamine and several crystals of DMAP were added and this was shaken at rt for 2.5 h. Then 2-methoxyethylamine (0.085 g, 97 μl, 1.13 mmol) was added and shaking was continued for 30 minutes. Then the solvent was removed and the beads washed for 10 minutes each time with CH.sub.2Cl.sub.2:Et.sub.3N (9:1, 4×50 mL), DMF (3×50 mL), Felts buffer (3×50 mL) and i-PrOH (3×50 mL). The beads 4a were stored in i-PrOH (beads: i-PrOH (1:2), v/v) at −80° C.
[0087] 9-(3-Bromopropyl)-8-(6-(dimethylamino)benzo[d][1,3]dioxol-5-ylthio)-9H-purin-6-amine (2b). 1a (60 mg, 0.1818 mmol), Cs.sub.2CO.sub.3 (88.8 mg, 0.2727 mmol), 1,3-dibromopropane (184 mg, 93 μL, 0.909 mmol) in DMF (2 mL) was stirred for 40 min. at rt. The mixture was dried under reduced pressure and the residue purified by preparatory TLC (CH.sub.2Cl.sub.2:MeOH:AcOH, 15:1:0.5) to give 2b (60 mg, 73%). .sup.1H NMR (500 MHz, CDCl.sub.3) δ 8.26 (s, 1H), 6.84 (br s, 2H), 6.77 (s, 1H), 6.50 (s, 1H), 5.92 (s, 2H), 4.35 (t, J=7.0 Hz, 2H), 3.37 (t, J=6.6 Hz, 2H), 2.68 (s, 6H), 2.34 (m, 2H); MS (ESI) m/z 451.1/453.1 [M+H].sup.+.
[0088] tert-Butyl (6-((3-(6-amino-8-((6-(dimethylamino)benzo[d][1,3]dioxol-5-yl)thio)-9H-purin-9-yl)propyl)amino)hexyl)carbamate (3b). 2b (0.190 g, 0.423 mmol) and tert-butyl 6-aminohexylcarbamate (0.915 g, 4.23 mmol) in DMF (7 mL) was stirred at rt for 24 h. The reaction mixture was concentrated and the residue chromatographed [CHCl.sub.3:MeOH:MeOH—NH.sub.3 (7N), 100:7:3] to give 0.218 g (88%) of 3b; MS (ESI) m/z 587.3 [M+H].sup.+.
[0089] (4b). 3b (0.264 g, 0.45 mmol) was dissolved in 15 mL of CH.sub.2Cl.sub.2:TFA (4:1) and the solution was stirred at rt for 45 min. Solvent was removed under reduced pressure and the residue dried under high vacuum overnight. This was dissolved in DMF (12 mL) and added to 25 mL of Affi-Gel 10 beads (prewashed, 3×50 mL DMF) in a solid phase peptide synthesis vessel. 225 μL of N,N-diisopropylethylamine and several crystals of DMAP were added and this was shaken at rt for 2.5 h. Then 2-methoxyethylamine (0.085 g, 97 μl, 1.13 mmol) was added and shaking was continued for 30 minutes. Then the solvent was removed and the beads washed for 10 minutes each time with CH.sub.2Cl.sub.2:Et.sub.3N (9:1, 4×50 mL), DMF (3×50 mL), Felts buffer (3×50 mL) and i-PrOH (3×50 mL). The beads 4b were stored in i-PrOH (beads: i-PrOH (1:2), v/v) at −80° C.
[0090] 1-(2-Bromoethyl)-2-((6-(dimethylamino)benzo[d][1,3]dioxol-5-yl)thio)-1H-imidazo[4,5-c]pyridin-4-amine (5a). 1b (252 mg, 0.764 mmol), Cs.sub.2CO.sub.3 (373 mg, 1.15 mmol), 1,2-dibromoethane (718 mg, 329 μL, 3.82 mmol) in DMF (2 mL) was stirred for 1.5 h at rt. Then additional Cs.sub.2CO.sub.3 (124 mg, 0.38 mmol) was added and the mixture stirred for an additional 20 min. The mixture was dried under reduced pressure and the residue purified by preparatory TLC (CH.sub.2Cl.sub.2:MeOH, 10:1) to give 5a (211 mg, 63%); MS (ESI) m/z 436.0/438.0 [M+H].sup.+.
[0091] tert-Butyl (6-((2-(4-amino-2-((6-(dimethylamino)benzo[d][1,3]dioxol-5-yl)thio)-1H-imidazo[4,5-c]pyridin-1-yl)ethyl)amino)hexyl)carbamate (6a). 5a (0.184 g, 0.423 mmol) and tert-butyl 6-aminohexylcarbamate (0.915 g, 4.23 mmol) in DMF (7 mL) was stirred at rt for 24 h. The reaction mixture was concentrated and the residue chromatographed [CHCl.sub.3:MeOH:MeOH—NH.sub.3 (7N), 100:7:3] to give 0.109 g (45%) of 6a; MS (ESI) m/z 572.3 [M+H].sup.+.
[0092] (7a). 6a (0.257 g, 0.45 mmol) was dissolved in 15 mL of CH.sub.2Cl.sub.2:TFA (4:1) and the solution was stirred at rt for 45 min. Solvent was removed under reduced pressure and the residue dried under high vacuum overnight. This was dissolved in DMF (12 mL) and added to 25 mL of Affi-Gel 10 beads (prewashed, 3×50 mL DMF) in a solid phase peptide synthesis vessel. 225 μL of N,N-diisopropylethylamine and several crystals of DMAP were added and this was shaken at rt for 2.5 h. Then 2-methoxyethylamine (0.085 g, 97 μl, 1.13 mmol) was added and shaking was continued for 30 minutes. Then the solvent was removed and the beads washed for 10 minutes each time with CH.sub.2Cl.sub.2:Et.sub.3N (9:1, 4×50 mL), DMF (3×50 mL), Felts buffer (3×50 mL) and i-PrOH (3×50 mL). The beads 7a were stored in i-PrOH (beads: i-PrOH (1:2), v/v) at −80° C.
[0093] The beads 7b were prepared in a similar manner as described above for 7a.
[0094]
[0095] (8a). 2a (3.8 mg, 0.0086 mmol) and EZ-Link® Amine-PEO.sub.3-Biotin (5.4 mg, 0.0129 mmol) in DMF (0.2 mL) was stirred at rt for 24 h. The reaction mixture was concentrated and the residue chromatographed [CHCl.sub.3:MeOH—NH.sub.3 (7N), 10:1] to give 2.3 mg (35%) of 8a. MS (ESI): m/z 775.2 [M+H].sup.+.
[0096] (9a). 5a (3.7 mg, 0.0086 mmol) and EZ-Link® Amine-PEO.sub.3-Biotin (5.4 mg, 0.0129 mmol) in DMF (0.2 mL) was stirred at rt for 24 h. The reaction mixture was concentrated and the residue chromatographed [CHCl.sub.3:MeOH—NH.sub.3 (7N), 10:1] to give 1.8 mg (27%) of 9a. MS (ESI): m/z 774.2 [M+H].sup.+.
[0097] Biotinylated compounds 8b and 9b were prepared in a similar manner from 2b and 5b, respectively.
[0098]
[0099] 2-(3-(6-Amino-8-(6-(dimethylamino)benzo[d][1,3]dioxol-5-ylthio)-9H-purin-9-yl)propyl)isoindoline-1,3-dione. 1a (0.720 g, 2.18 mmol), Cs.sub.2CO.sub.3 (0.851 g, 2.62 mmol), 2-(3-bromopropyl)isoindoline-1,3-dione (2.05 g, 7.64 mmol) in DMF (15 mL) was stirred for 2 h at rt. The mixture was dried under reduced pressure and the residue purified by column chromatography (CH.sub.2Cl.sub.2:MeOH:AcOH, 15:1:0.5) to give 0.72 g (63%) of the titled compound. .sup.1H NMR (500 MHz, CDCl.sub.3/MeOH-d.sub.4): δ 8.16 (s, 1H), 7.85-7.87 (m, 2H), 7.74-7.75 (m, 2H), 6.87 (s, 1H), 6.71 (s, 1H), 5.88 (s, 2H), 4.37 (t, J=6.4 Hz, 2H), 3.73 (t, J=6.1 Hz, 2H), 2.69 (s, 6H), 2.37-2.42 (m, 2H); HRMS (ESI) m/z [M+H].sup.+ calcd. for C.sub.25H.sub.24N.sub.7O.sub.4S, 518.1610; found 518.1601.
[0100] 9-(3-Aminopropyl)-8-(6-(dimethylamino)benzo[d][1,3]dioxol-5-ylthio)-9H-purin-6-amine (10b). 2-(3-(6-Amino-8-(6-(dimethylamino)benzo[d][1,3]dioxol-5-ylthio)-9H-purin-9-yl)propyl)isoindoline-1,3-dione (0.72 g, 1.38 mmol), hydrazine hydrate (2.86 g, 2.78 mL, 20.75 mmol), in CH.sub.2Cl.sub.2:MeOH (4 mL:28 mL) was stirred for 2 h at rt. The mixture was dried under reduced pressure and the residue purified by column chromatography (CH.sub.2Cl.sub.2:MeOH—NH.sub.3(7N), 20:1) to give 430 mg (80%) of 10b. .sup.1H NMR (500 MHz, CDCl.sub.3): δ 8.33 (s, 1H), 6.77 (s, 1H), 6.49 (s, 1H), 5.91 (s, 2H), 5.85 (br s, 2H), 4.30 (t, J=6.9 Hz, 2H), 2.69 (s, 6H), 2.65 (t, J=6.5 Hz, 2H), 1.89-1.95 (m, 2H); .sup.13C NMR (125 MHz, CDCl.sub.3): δ 154.5, 153.1, 151.7, 148.1, 147.2, 146.4, 144.8, 120.2, 120.1, 109.3, 109.2, 101.7, 45.3, 45.2, 40.9, 38.6, 33.3; HRMS (ESI) m/z [M+H].sup.+ calcd. for C.sub.17H.sub.22N.sub.7O.sub.2S, 388.1556; found 388.1544.
[0101] (12b). 10b (13.6 mg, 0.0352 mmol), EZ-Link® NHS-LC-LC-Biotin (22.0 mg, 0.0387 mmol) and DIEA (9.1 mg, 12.3 μL, 0.0704 mmol) in DMF (0.5 mL) was stirred at rt for 1 h. The reaction mixture was concentrated under reduced pressure and the resulting residue was purified by preparatory TLC (CH.sub.2Cl.sub.2:MeOH—NH.sub.3 (7N), 10:1) to give 22.7 mg (77%) of 12b. MS (ESI): m/z 840.2 [M+H].sup.+.
[0102] (14b). 10b (14.5 mg, 0.0374 mmol), EZ-Link® NHS-PEG.sub.4-Biotin (24.2 mg, 0.0411 mmol) and DIEA (9.7 mg, 13 μL, 0.0704 mmol) in DMF (0.5 mL) was stirred at rt for 1 h. The reaction mixture was concentrated under reduced pressure and the resulting residue was purified by preparatory TLC (CH.sub.2Cl.sub.2:MeOH—NH.sub.3 (7N), 10:1) to give 24.1 mg (75%) of 14b. MS (ESI): m/z 861.3 [M+H]′.
[0103] Biotinylated compounds 12a, 13a, 13b, 14a, 15a and 15b were prepared in a similar manner as described for 12b and 14b.
[0104]
[0105] 8-((6-Bromobenzo[d][1,3]dioxol-5-yl)thio)-9-(2-(piperidin-4-yl)ethyl)-9H-purin-6-amine (18). 16 (300 mg, 0.819 mmol), Cs.sub.2CO.sub.3 (534 mg, 1.64 mmol), 17 (718 mg, 2.45 mmol) in DMF (10 mL) was stirred for 1.5 h at rt. The reaction mixture was filtered and dried under reduced pressure and chromatographed (CH.sub.2Cl.sub.2:MeOH, 10:1) to give a mixture of Boc-protected N9/N3 isomers. 20 mL of TFA:CH.sub.2Cl.sub.2 (1:1) was added at rt and stirred for 6 h. The reaction mixture was dried under reduced pressure and purified by preparatory HPLC to give 18 (87 mg, 22%); MS (ESI) m/z 477.0 [M+H].sup.+.
[0106] 6-Amino-1-(4-(2-(6-amino-8-((6-bromobenzo[d][1,3]dioxol-5-yl)thio)-9H-purin-9-yl)ethyl)piperidin-1-yl)hexan-1-one (19). To a mixture of 18 (150 mg, 0.314 mmol) in CH.sub.2Cl.sub.2 (5 ml) was added 6-(Boc-amino)caproic acid (145 mg, 0.628 mmol), EDCI (120 mg, 0.628 mmol) and DMAP (1.9 mg, 0.0157 mmol). The reaction mixture was stirred at rt for 2 h then concentrated under reduced pressure and the residue purified by preparatory TLC [CH.sub.2Cl.sub.2:MeOH—NH.sub.3 (7N), 15:1] to give 161 mg (74%) of 19; MS (ESI) in/z 690.1 [M+H].sup.+.
[0107] (20). 19 (0.264 g, 0.45 mmol) was dissolved in 15 mL of CH.sub.2Cl.sub.2:TFA (4:1) and the solution was stirred at rt for 45 min. Solvent was removed under reduced pressure and the residue dried under high vacuum overnight. This was dissolved in DMF (12 mL) and added to 25 mL of Affi-Gel 10 beads (prewashed, 3×50 mL DMF) in a solid phase peptide synthesis vessel. 225 μL of N,N-diisopropylethylamine and several crystals of DMAP were added and this was shaken at rt for 2.5 h. Then 2-methoxyethylamine (0.085 g, 97 μl, 1.13 mmol) was added and shaking was continued for 30 minutes. Then the solvent was removed and the beads washed for 10 minutes each time with CH.sub.2Cl.sub.2:Et.sub.3N (9:1, 4×50 mL), DMF (3×50 mL), Felts buffer (3×50 mL) and i-PrOH (3×50 mL). The beads 20 were stored in i-PrOH (beads: i-PrOH (1:2), v/v) at −80° C.
[0108]
[0109] (21). 18 (13.9 mg, 0.0292 mmol), EZ-Link® NHS-LC-LC-Biotin (18.2 mg, 0.0321 mmol) and DIEA (7.5 mg, 10.2 μL, 0.0584 mmol) in DMF (0.5 mL) was heated at 35° C. for 6 h. The reaction mixture was concentrated under reduced pressure and the resulting residue was purified by preparatory TLC (CH.sub.2Cl.sub.2:MeOH—NH.sub.3 (7N), 10:1) to give 7.0 mg (26%) of 21. MS (ESI): m/z 929.3 [M+H]′.
[0110] (22). 18 (13.9 mg, 0.0292 mmol), EZ-Link® NHS-PEG.sub.4-Biotin (18.9 mg, 0.0321 mmol) and DIEA (7.5 mg, 10.2 μL, 0.0584 mmol) in DMF (0.5 mL) was heated at 35° C. for 6 h. The reaction mixture was concentrated under reduced pressure and the resulting residue was purified by preparatory TLC (CH.sub.2Cl.sub.2:MeOH—NH.sub.3 (7N), 10:1) to give 8.4 mg (30%) of 22; MS (ESI): m/z 950.2 [M+H].sup.+.
[0111]
[0112] (24). 23 (16.3 mg, 0.0352 mmol), EZ-Link® NHS-LC-LC-Biotin (22.0 mg, 0.0387 mmol) and DIEA (9.1 mg, 12.3 μL, 0.0704 mmol) in DMF (0.5 mL) was stirred at rt for 1 h. The reaction mixture was concentrated under reduced pressure and the resulting residue was purified by preparatory TLC (CH.sub.2Cl.sub.2:MeOH, 10:1) to give 26.5 mg (82%) of 24; MS (ESI): m/z 916.4 [M+H].sup.+.
[0113] (25). 23 (17.3 mg, 0.0374 mmol), EZ-Link® NHS-PEG.sub.4-Biotin (24.2 mg, 0.0411 mmol) and DIEA (9.7 mg, 13 μL, 0.0704 mmol) in DMF (0.5 mL) was stirred at rt for 1 h. The reaction mixture was concentrated under reduced pressure and the resulting residue was purified by preparatory TLC (CH.sub.2Cl.sub.2:MeOH, 10:1) to give 30.1 mg (78%) of 25; MS (ESI): m/z 937.3 [M+H].sup.+.
DETAILED DESCRIPTION OF THE INVENTION
[0114] The present disclosure provides methods of identifying cancer-implicated pathways and specific components of cancer-implicated pathways (e.g., oncoproteins) associated with Hsp90 that are implicated in the development and progression of a cancer. Such methods involve contacting a sample containing cancer cells from a subject suffering from cancer with an inhibitor of Hsp90, and detecting the components of the cancer-implicated pathway that are bound to the inhibitor of Hsp90.
[0115] As used herein, certain terms have the meanings set forth after each such term as follows:
[0116] “Cancer-Implicated Pathway” means any molecular pathway, a variation in which is involved in the transformation of a cell from a normal to a cancer phenotype. Cancer-implicated pathways may include pathways involved in metabolism, genetic information processing, environmental information processing, cellular processes, and organismal systems. A list of many such pathways is set forth in Table 1 and more detailed information may be found about such pathways online in the KEGG PATHWAY database; and the National Cancer Institute's Nature Pathway Interaction Database. See also the websites of Cell Signaling Technology, Beverly, Mass.; BioCarta, San Diego, Calif.; and Invitrogen/Life Technologies Corporation, Clarsbad, Calif. In addition,
TABLE-US-00001 TABLE 1 Examples of Potential Cancer-Implicated Pathways. 1. Metabolism 1.1 Carbohydrate Metabolism Glycolysis/Gluconeogenesis Citrate cycle (TCA cycle) Pentose phosphate pathway Pentose and glucuronate interconversions Fructose and mannose metabolism Galactose metabolism Ascorbate and aldarate metabolism Starch and sucrose metabolism Amino sugar and nucleotide sugar metabolism Pyruvate metabolism Glyoxylate and dicarboxylate metabolism Propanoate metabolism Butanoate metabolism C5-Branched dibasic acid metabolism Inositol phosphate metabolism 1.2 Energy Metabolism Oxidative phosphorylation Photosynthesis Photosynthesis - antenna proteins Carbon fixation in photosynthetic organisms Carbon fixation pathways in prokaryotes Methane metabolism Nitrogen metabolism Sulfur metabolism 1.3 Lipid Metabolism Fatty acid biosynthesis Fatty acid elongation in mitochondria Fatty acid metabolism Synthesis and degradation of ketone bodies Steroid biosynthesis Primary bile acid biosynthesis Secondary bile acid biosynthesis Steroid hormone biosynthesis Glycerolipid metabolism Glycerophospholipid metabolism Ether lipid metabolism Sphingolipid metabolism Arachidonic acid metabolism Linoleic acid metabolism alpha-Linolenic acid metabolism Biosynthesis of unsaturated fatty acids 1.4 Nucleotide Metabolism Purine metabolism Pyrimidine metabolism 1.5 Amino Acid Metabolism Alanine, aspartate and glutamate metabolism Glycine, serine and threonine metabolism Cysteine and methionine metabolism Valine, leucine and isoleucine degradation Valine, leucine and isoleucine biosynthesis Lysine biosynthesis Lysine degradation Arginine and proline metabolism Histidine metabolism Tyrosine metabolism Phenylalanine metabolism Tryptophan metabolism Phenylalanine, tyrosine and tryptophan biosynthesis 1.6 Metabolism of Other Amino Acids beta-Alanine metabolism Taurine and hypotaurine metabolism Phosphonate and phosphinate metabolism Selenoamino acid metabolism Cyanoamino acid metabolism D-Glutamine and D-glutamate metabolism D-Arginine and D-ornithine metabolism D-Alanine metabolism Glutathione metabolism 1.7 Glycan Biosynthesis and Metabolism N-Glycan biosynthesis Various types of N-glycan biosynthesis Mucin type O-Glycan biosynthesis Other types of O-glycan biosynthesis Glycosaminoglycan biosynthesis - chondroitin sulfate Glycosaminoglycan biosynthesis - heparan sulfate Glycosaminoglycan biosynthesis - keratan sulfate Glycosaminoglycan degradation Glycosylphosphatidylinositol(GPI)-anchor biosynthesis Glycosphingolipid biosynthesis - lacto and neolacto series Glycosphingolipid biosynthesis - globo series Glycosphingolipid biosynthesis - ganglio series Lipopolysaccharide biosynthesis Peptidoglycan biosynthesis Other glycan degradation 1.8 Metabolism of Cofactors and Vitamins Thiamine metabolism Riboflavin metabolism Vitamin B6 metabolism Nicotinate and nicotinamide metabolism Pantothenate and CoA biosynthesis Biotin metabolism Lipoic acid metabolism Folate biosynthesis One carbon pool by folate Retinol metabolism Porphyrin and chlorophyll metabolism Ubiquinone and other terpenoid-quinone biosynthesis 1.9 Metabolism of Terpenoids and Polyketides Terpenoid backbone biosynthesis Monoterpenoid biosynthesis Sesquiterpenoid biosynthesis Diterpenoid biosynthesis Carotenoid biosynthesis Brassinosteroid biosynthesis Insect hormone biosynthesis Zeatin biosynthesis Limonene and pinene degradation Geraniol degradation Type I polyketide structures Biosynthesis of 12-, 14- and 16-membered macrolides Biosynthesis of ansamycins Biosynthesis of type II polyketide backbone Biosynthesis of type II polyketide products Tetracycline biosynthesis Polyketide sugar unit biosynthesis Nonribosomal peptide structures Biosynthesis of siderophore group nonribosomal peptides Biosynthesis of vancomycin group antibiotics 1.10 Biosynthesis of Other Secondary Metabolites Phenylpropanoid biosynthesis Stilbenoid, diarylheptanoid and gingerol biosynthesis Flavonoid biosynthesis Flavone and flavonol biosynthesis Anthocyanin biosynthesis Isoflavonoid biosynthesis Indole alkaloid biosynthesis Isoquinoline alkaloid biosynthesis Tropane, piperidine and pyridine alkaloid biosynthesis Acridone alkaloid biosynthesis Caffeine metabolism Betalain biosynthesis Glucosinolate biosynthesis Benzoxazinoid biosynthesis Penicillin and cephalosporin biosynthesis beta-Lactam resistance Streptomycin biosynthesis Butirosin and neomycin biosynthesis Clavulanic acid biosynthesis Puromycin biosynthesis Novobiocin biosynthesis 1.11 Xenobiotics Biodegradation and Metabolism Benzoate degradation Aminobenzoate degradation Fluorobenzoate degradation Chloroalkane and chloroalkene degradation Chlorocyclohexane and chlorobenzene degradation Toluene degradation Xylene degradation Nitrotoluene degradation Ethylbenzene degradation Styrene degradation Atrazine degradation Caprolactam degradation DDT degradation Bisphenol degradation Dioxin degradation Naphthalene degradation Polycyclic aromatic hydrocarbon degradation Metabolism of xenobiotics by cytochrome P450 Drug metabolism - cytochrome P450 Drug metabolism - other enzymes 1.12 Overview Overview of biosynthetic pathways Biosynthesis of plant secondary metabolites Biosynthesis of phenylpropanoids Biosynthesis of terpenoids and steroids Biosynthesis of alkaloids derived from shikimate pathway Biosynthesis of alkaloids derived from ornithine, lysine and nicotinic acid Biosynthesis of alkaloids derived from histidine and purine Biosynthesis of alkaloids derived from terpenoid and polyketide Biosynthesis of plant hormones 2. Genetic 2.1 Transcription Information RNA polymerase Processing Basal transcription factors Spliceosome 2.2 Translation Ribosome Aminoacyl-tRNA biosynthesis RNA transport mRNA surveillance pathway Ribosome biogenesis in eukaryotes 2.3 Folding, Sorting and Degradation Protein export Protein processing in endoplasmic reticulum SNARE interactions in vesicular transport Ubiquitin mediated proteolysis Sulfur relay system Proteasome RNA degradation 2.4 Replication and Repair DNA replication Base excision repair Nucleotide excision repair Mismatch repair Homologous recombination Non-homologous end joining 3. Environmental 3.1 Membrane Transport Information ABC transporters Processing Phosphotransferase system (PTS) Bacterial secretion system 3.2 Signal Transduction Two-component system MAPK signaling pathway MAPK signaling pathway - fly MAPK signaling pathway - yeast ErbB signaling pathway Wnt signaling pathway Notch signaling pathway Hedgehog signaling pathway TGF-beta signaling pathway VEGF signaling pathway Jak-STAT signaling pathway Calcium signaling pathway Phosphatidylinositol signaling system mTOR signaling pathway Plant hormone signal transduction 3.3 Signaling Molecules and Interaction Neuroactive ligand-receptor interaction Cytokine-cytokine receptor interaction ECM-receptor interaction Cell adhesion molecules (CAMs) 4. Cellular 4.1 Transport and Catabolism Processes Endocytosis Phagosome Lysosome Peroxisome Regulation of autophagy 4.2 Cell Motility Bacterial chemotaxis Flagellar assembly Regulation of actin cytoskeleton 4.3 Cell Growth and Death Cell cycle Cell cycle - yeast Cell cycle - Caulobacter Meiosis - yeast Oocyte meiosis Apoptosis p53 signaling pathway 4.4 Cell Communication Focal adhesion Adherens junction Tight junction Gap junction 5. Organismal 5.1 Immune System Systems Hematopoietic cell lineage Complement and coagulation cascades Toll-like receptor signaling pathway NOD-like receptor signaling pathway RIG-I-like receptor signaling pathway Cytosolic DNA-sensing pathway Natural killer cell mediated cytotoxicity Antigen processing and presentation T cell receptor signaling pathway B cell receptor signaling pathway Fc epsilon RI signaling pathway Fc gamma R-mediated phagocytosis Leukocyte transendothelial migration Intestinal immune network for IgA production Chemokine signaling pathway 5.2 Endocrine System Insulin signaling pathway Adipocytokine signaling pathway PPAR signaling pathway GnRH signaling pathway Progesterone-mediated oocyte maturation Melanogenesis Renin-angiotensin system 5.3 Circulatory System Cardiac muscle contraction Vascular smooth muscle contraction 5.4 Digestive System Salivary secretion Gastric acid secretion Pancreatic secretion Bile secretion Carbohydrate digestion and absorption Protein digestion and absorption Fat digestion and absorption Vitamin digestion and absorption Mineral absorption 5.5 Excretory System Vasopressin-regulated water reabsorption Aldosterone-regulated sodium reabsorption Endocrine and other factor-regulated calcium reabsorption Proximal tubule bicarbonate reclamation Collecting duct acid secretion 5.6 Nervous System Long-term potentiation Long-term depression Neurotrophin signaling pathway 5.7 Sensory System Phototransduction Phototransduction - fly Olfactory transduction Taste transduction 5.8 Development Dorso-ventral axis formation Axon guidance Osteoclast differentiation 5.9 Environmental Adaptation Circadian rhythm - mammal Circadian rhythm - fly Circadian rhythm - plant Plant-pathogen interaction
[0117] “Component of a Cancer-Implicated Pathway” means a molecular entity located in a Cancer-Implicated Pathway which can be targeted in order to effect inhibition of the pathway and a change in a cancer phenotype which is associated with the pathway and which has resulted from activity in the pathway. Examples of such components include components listed in
[0118] “Inhibitor of a Component of a Cancer-Implicated Pathway” means a compound (other than an inhibitor of Hsp90) which interacts with a Cancer-Implicated Pathway or a Component of a Cancer-Implicated Pathway so as to effect inhibition of the pathway and a change in a cancer phenotype which has resulted from activity in the pathway. Examples of inhibitors of specific Components are widely known. Merely by way of example, the following U.S. patents and U.S. patent application publications describe examples of inhibitors of pathway components as listed follows: [0119] SYK: U.S. Patent Application Publications US 2009/0298823 A1, US 2010/0152159 A1, US 2010/0316649 A1 [0120] BTK: U.S. Pat. No. 6,160,010; U.S. Patent Application Publications US 2006/0167090 A1, US 2011/0008257 A1 [0121] EGFR: U.S. Pat. Nos. 5,760,041; 7,488,823 B2; 7,547,781 B2 [0122] mTOR: U.S. Pat. No. 7,504,397 B2; U.S. Patent Application Publication US 2011/0015197 A1 [0123] MET: U.S. Pat. No. 7,037,909 B2; U.S. Patent Application Publications US 2005/0107391 A1, US 2006/0009493 A1 [0124] MEK: U.S. Pat. No. 6,703,420 B1; U.S. Patent Application Publication US 2007/0287737 A1 [0125] VEGFR: U.S. Pat. No. 7,790,729 B2; U.S. Patent Application Publications US 2005/0234115 A1, US 2006/0074056 A1 [0126] PTEN: U.S. Patent Application Publications US 2007/0203098 A1, US 2010/0113515 A1 [0127] PKC: U.S. Pat. Nos. 5,552,396; 7,648,989 B2 [0128] Bcr-Abl: U.S. Pat. No. 7,625,894 B2; U.S. Patent Application Publication US 2006/0235006 A1
[0129] Still further a few examples of inhibitors of protein kinases are shown in
[0130] “Inhibitor of Hsp90” means a compound which interacts with, and inhibits the activity of, the chaperone, heat shock protein 90 (Hsp90). The structures of several known Hsp90 inhibitors, including PU-H71, are shown in
Small Molecule Hsp90 Probes
[0136] The attachment of small molecules to a solid support is a very useful method to probe their target and the target's interacting partners. Indeed, geldanamycin attached to solid support enabled for the identification of Hsp90 as its target. Perhaps the most crucial aspects in designing such chemical probes are determining the appropriate site for attachment of the small molecule ligand, and designing an appropriate linker between the molecule and the solid support. Our strategy to design Hsp90 chemical probes entails several steps. First, in order to validate the optimal linker length and its site of attachment to the Hsp90 ligand, the linker-modified ligand was docked onto an appropriate X-ray crystal structure of Hsp90α. Second, the linker-modified ligand was evaluated in a fluorescent polarization (FP) assay that measures competitive binding to Hsp90 derived from a cancer cell extract. This assay uses Cy3b-labeled geldanamycin as the FP-optimized Hsp90 ligand (Du et al., 2007). These steps are important to ensure that the solid-support immobilized molecules maintain a strong affinity for Hsp90. Finally, the linker-modified small molecule was attached to the solid support, and its interaction with Hsp90 was validated by incubation with an Hsp90-containing cell extract.
[0137] When a probe is needed to identify Hsp90 in complex with its onco-client proteins, further important requirements are (1.) that the probe retains selectivity for the “oncogenic Hsp90 species” and (2.) that upon binding to Hsp90, the probe locks Hsp90 in a client-protein bound conformation. The concept of “oncogenic Hsp90” is further defined in this application as well as in
[0138] When a probe is needed to identify Hsp90 in complex with its onco-client proteins by mass spectrometry techniques, further important requirements are (1.) that the probe isolates sufficient protein material and (2.) that the signal to ratio as defined by the amount of Hsp90 onco-clients and unspecifically resin-bound proteins, respectively, be sufficiently large as to be identifiable by mass spectrometry. This application provides examples of the production of such probes.
[0139] We chose Affi-Gel® 10 (BioRad) for ligand attachment. These agarose beads have an N-hydroxysuccinimide ester at the end of a 10C spacer arm, and in consequence, each linker was designed to contain a distal amine functionality. The site of linker attachment to PU-H71 was aided by the co-crystal structure of it bound to the N-terminal domain of human Hsp90a (PDB ID: 2FWZ). This structure shows that the purine's N9 amine makes no direct contact with the protein and is directed towards solvent (
[0140] We also designed a biotinylated derivative of PU-H71. One advantage of the biotinylated agent over the solid supported agents is that they can be used to probe binding directly in cells or in vivo systems. The ligand-Hsp90 complexes can then be captured on biotin-binding avidin or streptavidin containing beads. Typically this process reduces the unspecific binding associated with chemical precipitation from cellular extracts. Alternatively, for in vivo experiments, the presence of active sites (in this case Hsp90), can be detected in specific tissues (i.e. tumor mass in cancer) by the use of a labeled-streptavidin conjugate (i.e. FITC-streptavidin). Biotinylated PU-H71 (7) was obtained by reaction of 2 with biotinyl-3,6,9-trioxaundecanediamine (EZ-Link® Amine-PEO.sub.3-Biotin) (
[0141] From the available co-crystal structure of NVP-AUY922 with Hsp90a (PDB 2VCI,
[0142] Although a co-crystal structure of SNX-2112 with Hsp90 is not publicly available, that of a related tetrahydro-4H-carbazol-4-one (27) bound to Hsp90a (PDB ID: 3D0B,
[0143] Synthesis of PU-H71 beads (6) is shown in
[0144] Synthesis of NVP-AUY922 beads (11) from aldehyde 8 (Brough et al., 2008) is shown in
[0145] Synthesis of SNX-2112 beads (21) is shown in
[0146] Several methods were employed to measure the progress of the reactions for the synthesis of the final probes. UV monitoring of the liquid was used by measuring a decrease in λ.sub.max for each compound. In general, it was observed that that there was no further decrease in the λ.sub.max after 1.5 h, indicating completion of the reaction. TLC was employed as a crude measure of the progress of the reaction whereas LC-MS monitoring of the liquid was used to confirm complete reaction. While on TLC the spot would not disappear since excess compound was used (1.2 eq.), a clear decrease in intensity indicated progress of the reaction.
[0147] The synthesis and full characterization of the Hsp90 inhibitors PU-H71 (He et al., 2006) and NVP-AUY922 (Brough et al., 2008) have been reported elsewhere. SNX-2112 had previously been mentioned in the patent literature (Serenex et al., 2008, WO-2008130879A2; Serenex et al., 2008, US-20080269193A1), and only recently has it been fully characterized and its synthesis adequately described (Huang et al., 2009). At the time this research project began specific details on its synthesis were lacking. Additionally, we had difficulty reproducing the amination of 16 with trans-4-aminocyclohexanol under conditions reported for similar compounds [Pd(OAc).sub.2, DPPF, NaOtBu, toluene, 120° C., microwave]. In our hands, only trace amounts of product were detected at best. Changing catalyst to PdCl.sub.2, Pd(PPh.sub.3).sub.4 or Pd.sub.2(dba).sub.3 or solvent to DMF or 1,2-dimethoxyethane (DME) or base to K.sub.3PO.sub.4 did not result in any improvement. Therefore, we modified this step and were able to couple 16 to trans-4-aminocyclohexanol tetrahydropyranyl ether (24) under Buchwald conditions (Old et al., 1998) using Pd.sub.2(dba).sub.3 and DavePhos in DME to give nitrile 25 (28%) along with amide 26 (17%) for a combined yield of 45% (
[0148] Next, we investigated whether the synthesized beads retained interaction with Hsp90 in cancer cells. Agarose beads covalently attached to either of PU-H71, NVP-AUY922, SNX-2112 or 2-methoxyethylamine (PU-, NVP-, SNX-, control-beads, respectively), were incubated with K562 chronic myeloid leukemia (CML) or MDA-MB-468 breast cancer cell extracts. As seen in
[0149] Further, to probe the ability of these chemical tools to isolate genuine Hsp90 client proteins in tumor cells, we incubated PU-H71 attached to solid support (6) with cancer cell extracts. We were able to demonstrate dose-dependent isolation of Hsp90/c-Kit and Hsp90/IGF-IR complexes in MDA-MB-468 cells (
[0150] Similar experiments were possible with PU-H71-biotin (7) (
[0151] It is important to note that previous attempts to isolate Hsp90/client protein complexes using a solid-support immobilized GM were of little success (Tsaytler et al., 2009). In that case, the proteins bound to Hsp90 were washed away during the preparative steps. To prevent the loss of Hsp90-interacting proteins, the authors had to subject the cancer cell extracts to crosslinking with DSP, a homobifunctional amino-reactive DTT-reversible cross-linker, suggesting that unlike PU-H71, GM is unable to stabilize Hsp90/client protein interactions. We observed a similar profile when using beads with GM directly covalently attached to the Affi-Gel® 10 resin. Crystallographic and biochemical investigations suggest that GM preferentially interacts with Hsp90 in an apo, open-conformation, that is unfavorable for certain client protein binding (Roe et al., 1999; Stebbins et al., 1997; Nishiya et al., 2009) providing a potential explanation for the limited ability of GM-beads to capture Hsp90/client protein complexes. It is currently unknown what Hsp90 conformations are preferred by the other Hsp90 chemotypes, but with the NVP- and SNX-beads also available, as reported here, similar evaluations are now possible, leading to a better understanding of the interaction of these agents with Hsp90, and of the biological significance of these interactions.
[0152] In another application of the chemical tools designed here, we show that PU-H71-biotin (7) can also be used to specifically detect Hsp90 when expressed on the cell surface (
[0153] In summary, we have prepared useful chemical tools based on three different Hsp90 inhibitors, each of a different chemotype. These were prepared either by attachment onto solid support, such as PU-H71 (purine), NVP-AUY922 (isoxazole) and SNX-2112 (indazol-4-one)-beads, or by biotinylation (PU-H71-biotin). The utility of these probes was demonstrated by their ability to efficiently isolate Hsp90 and, in the case of PU-H71 beads (6), isolate Hsp90 onco-protein containing complexes from cancer cell extracts. Available co-crystal structures and SAR were utilized in their design, and docking to the appropriate X-ray crystal structure of Hsp90a used to validate the site of attachment of the linker. These are important chemical tools in efforts towards better understanding Hsp90 biology and towards designing Hsp90 inhibitors with most favorable clinical profile.
Identification of Oncoproteins and Pathways Using Hsp90 Probes
[0154] The disclosure provides methods of identifying components of cancer-implicated pathway (e.g., oncoproteins) using the Hsp90 probes described above. In one embodiment of the invention the cancer-implicated pathway is a pathway involved in metabolism, genetic information processing, environmental information processing, cellular processes, or organismal systems. For example, the cancer-implicated pathway may be a pathway listed in Table 1.
[0155] More particularly, the cancer-implicated pathway or the component of the cancer-implicated pathway is involved with a cancer such as a cancer selected from the group consisting of a colorectal cancer, a pancreatic cancer, a thyroid cancer, a leukemia including an acute myeloid leukemia and a chronic myeloid leukemia, a basal cell carcinoma, a melanoma, a renal cell carcinoma, a bladder cancer, a prostate cancer, a lung cancer including a small cell lung cancer and a non-small cell lung cancer, a breast cancer, a neuroblastoma, myeloproliferative disorders, gastrointestinal cancers including gastrointestinal stromal tumors, an esophageal cancer, a stomach cancer, a liver cancer, a gallbladder cancer, an anal cancer, brain tumors including gliomas, lymphomas including a follicular lymphoma and a diffuse large B-cell lymphoma, and gynecologic cancers including ovarian, cervical, and endometrial cancers.
[0156] The following subsections describe use of the Hsp90 probes of the present disclosure to determine properties of Hsp90 in cancer cells and to identify oncoproteins and cancer-implicated pathways.
Heterogeneous Hsp90 Presentation in Cancer Cells
[0157] To investigate the interaction of small molecule Hsp90 inhibitors with tumor Hsp90 complexes, we made use of agarose beads covalently attached to either geldanamycin (GM) or PU-H71 (GM- and PU-beads, respectively) (
[0158] First we evaluated the binding of these agents to Hsp90 in a breast cancer and in chronic myeloid leukemia (CML) cell lysates. Four consecutive immunoprecipitation (IP) steps with H9010, but not with a non-specific IgG, efficiently depleted Hsp90 from these extracts (
[0159] To exclude the possibility that changes in Hsp90 configuration in cell lysates make it unavailable for binding to immobilized PU-H71 but not to the antibody, we analyzed binding of radiolabeled .sup.131I-PU-H71 to Hsp90 in intact cancer cells (
[0160] Collectively, these data suggest that certain Hsp90 inhibitors, such as PU-H71, preferentially bind to a subset of Hsp90 species that is more abundant in cancer cells than in normal cells (
Onco- and WT-Protein Bound Hsp90 Species Co-Exist in Cancer Cells, but PU-H71 Selects for the Onco-Protein/Hsp90 Species
[0161] To explore the biochemical functions associated with these Hsp90 species, we performed immunoprecipitations (IPs) and chemical precipitations (CPs) with antibody- and Hsp90-inhibitor beads, respectively, and we analysed the ability of Hsp90 bound in these contexts to co-precipitate with a chosen subset of known clients. K562 CML cells were first investigated because this cell line co-expresses the aberrant Bcr-Abl protein, a constitutively active kinase, and its normal counterpart c-Abl. These two Abl species are clearly separable by molecular weight and thus easily distinguishable by Western blot (
[0162] In contrast, PU-bound Hsp90 preferentially isolated the Bcr-Abl protein (
The Onco- but not WT-Protein Bound Hsp90 Species are Most Dependent on Co-Chaperone Recruitment for Client Protein Regulation by Hsp90
[0163] To further differentiate between the PU-H71- and antibody-associated Hsp90 fractions, we performed sequential depletion experiments and evaluated the co-chaperone constituency of the two species (Zuehlke & Johnson, 2010). The fraction of Hsp90 containing the Hsp90/Bcr-Abl complexes bound several co-chaperones, including Hsp70, Hsp40, HOP and HIP (
[0164] These findings suggest the existence of distinct pools of Hsp90 preferentially bound to either Bcr-Abl or Abl in CML cells (
The Onco-Protein/Hsp90 Species Selectivity and the Complex Trapping Ability of PU-H71 are not Shared by all Hsp90 Inhibitors
[0165] We next evaluated whether other inhibitors that interact with the N-terminal regulatory pocket of Hsp90 in a manner similar to PU-H71, including the synthetic inhibitors SNX-2112 and NVP-AUY922, and the natural product GM (Janin, 2010), could selectively isolate similar Hsp90 species (
The Onco-Protein/Hsp90 Species Selectivity and the Complex Trapping Ability of PU-H71 is not Restricted to Bcr-Abl/Hsp90 Species
[0166] To determine whether selectivity towards onco-proteins was not restricted to Bcr-Abl, we tested several additional well-defined Hsp90 client proteins in other tumor cell lines (
PU-H71-Beads Identify the Aberrant Signalosome in CML
[0167] The data presented above suggest that PU-H71, which specifically interacts with Hsp90 (
[0168] Protein cargo isolated from cell lysate with PU-beads or control-beads was subjected to proteomic analysis by nano liquid chromatography coupled to tandem mass spectrometry (nano LC-MS/MS). Initial protein identification was performed using the Mascot search engine, and was further evaluated using Scaffold Proteome Software (Tables 5a-d). Among the PU-bead-interacting proteins, Bcr-Abl was identified (see Bcr and Abl1, Table 5a and
[0169] Ingenuity Pathway Analysis (IPA) was then used to build biological networks from the identified proteins (
[0170] In addition to signaling proteins, we identified proteins that regulate carbohydrate and lipid metabolism, protein synthesis, gene expression, and cellular assembly and organization. These findings are in accord with the postulated broad roles of Hsp90 in maintaining cellular homeostasis and in being an important mediator of cell transformation (Zuehlke & Johnson, 2010; Workman et al., 2007; Dezwaan & Freeman, 2008; McClellan et al., 2007).
[0171] Following identification by MS, a number of key proteins were further validated by chemical precipitation and Western blot, in both K562 cells and in primary CML blasts (
[0172] The top scoring networks enriched on the PU-beads were those used by Bcr-Abl to propagate aberrant signaling in CML: the PI3K/mTOR-, MAPK- and NFκB-mediated signaling pathways (Network 1, 22 focus molecules, score=38 and Network 2, 22 focus molecules, score=36, Table 5f). Connectivity maps were created for these networks to investigate the relationship between component proteins (
The PI3K/mTOR-Pathway
[0173] Activation of the PI3K/mTOR-pathway has emerged as one of the essential signaling mechanisms in Bcr-Abl leukemogenesis (Ren, 2005). Of particular interest within this pathway is the mammalian target of rapamycin (mTOR), which is constitutively activated in Bcr-Abl-transformed cells, leading to dysregulated translation and contributing to leukemogenesis. A recent study provided evidence that both the mTORC1 and mTORC2 complexes are activated in Bcr-Abl cells and play key roles in mRNA translation of gene products that mediate mitogenic responses, as well as in cell growth and survival (Carayol et al., 2010). mTOR and key activators of mTOR, such as RICTOR, RAPTOR, Sin 1 (MAPKAP1), class 3 PI3Ks PIK3C3, also called hVps34, and PIK3R4 (VSP15) (Nobukuni et al., 2007), were identified in the PU-Hsp90 pull-downs (Tables 5a, 5d;
The NF-κB Pathway
[0174] Activation of nuclear factor-κB (NF-κB) is required for Bcr-Abl transformation of primary bone marrow cells and for Bcr-Abl-transformed hematopoietic cells to form tumors in nude mice (McCubrey et al., 2008). PU-isolated proteins enriched on this pathway include NF-κB as well as activators of NF-kB such as IKBKAP, that binds NF-kappa-B-inducing kinase (NIK) and IKKs through separate domains and assembles them into an active kinase complex, and TBK-1 (TANK-binding kinase 1) and TAB1 (TAK1-binding protein 1), both positive regulators of the I-kappaB kinase/NF-kappaB cascade (Häcker & Karin, 2006) (Tables 5a, 5d). Recently, Bcr-Abl-induced activation of the NF-κB cascade in myeloid leukemia cells was demonstrated to be largely mediated by tyrosine-phosphorylated PKD2 (or PRKD2) (Mihailovic et al., 2004) which we identify here to be a PU-H71/Hsp90 interactor (Tables 5a, 5d;
The Raf/MAPK Pathway
[0175] Key effectors of the MAPK pathway, another important pathway activated in CML (Ren, 2005; McCubrey et al., 2008), such as Raf-1, A-Raf, ERK, p90RSK, vav and several MAPKs were also included the PU-Hsp90-bound pool (Tables 5a, 5d;
The STAT-Pathway
[0176] The STAT-pathway is also activated in CML and confers cytokine independence and protection against apoptosis (McCubrey et al., 2008) and was enriched by PU-H71 chemical precipitation (Network 8, 20 focus molecules, score=14, Table 5f,
The Focal Adhesion Pathway
[0177] Retention and homing of progenitor blood cells to the marrow microenvironment are regulated by receptors and agonists of survival and proliferation. Bcr-Abl induces adhesion independence resulting in aberrant release of hematopoietic stem cells from the bone marrow, and leading to activation of adhesion receptor signaling pathways in the absence of ligand binding. The focal adhesion pathway was well represented in PU-H71 pulldowns (Network 12, 16 focus molecules, score=13, Table 5f,
[0178] Other important transforming pathways in CML, those driven by MYC (Sawyers, 1993) (Network 7, 15 focus molecules, score=22,
[0179] In summary, PU-H71 enriches a broad cross-section of proteins that participate in signaling pathways vital to the malignant phenotype in CML (
PU-H71 Identified Proteins and Networks are Those Important for the Malignant Phenotype
[0180] We demonstrate that the presence of these proteins in the PU-bead pull-downs is functionally significant and suggests a role for Hsp90 in broadly supporting the malignant signalosome in CML cells.
[0181] To demonstrate that the networks identified by PU-beads are important for transformation in K562, we next showed that inhibitors of key nodal proteins from individual networks (
[0182] Next we demonstrated that PU-beads identified Hsp90 interactors with yet no assigned role in CML, also contribute to the transformed phenotype. The histone-arginine methyltransferase CARM1, a transcriptional co-activator of many genes (Bedford & Clarke, 2009), was validated in the PU-bead pull-downs from CML cell lines and primary CML cells (
[0183] To demonstrate that the presence of proteins in the PU-pulldowns is due to their participation in aberrantly activated signaling and not merely their abundant expression, we compared PU-bead pulldowns from K562 and Mia-PaCa-2, a pancreatic cancer cell line (Table 5a). While both cells express high levels of STAT5 protein (
[0184] The mTOR pathway was identified by the PU-beads in both K562 and Mia-PaCa-2 cells (
PU-H71 Identifies a Novel Mechanism of Oncogenic STAT-Activation
[0185] PU-bead pull-downs contain several proteins, including Bcr-Abl (Ren, 2005), CAMKIIγ (Si & Collins, 2008), FAK (Salgia et al., 1995), vav-1 (Katzav, 2007) and PRKD2 (Mihailovic et al., 2004) that are constitutively activated in CML leukemogenesis. These are classical Hsp90-regulated clients that depend on Hsp90 for their stability because their steady-state levels decrease upon Hsp90 inhibition (
Hsp90 Binds to and Influences the Conformation of STAT5
[0186] To investigate this hypothesis further we focused on STAT5, which is constitutively phosphorylated in CML (de Groot et al., 1999). The overall level of p-STAT5 is determined by the balance of phosphorylation and dephosphorylation events. Thus, the high levels of p-STAT5 in K562 cells may reflect either an increase in upstream kinase activity or a decrease in protein tyrosine phosphatase (PTPase) activity. A direct interaction between Hsp90 and p-STAT5 could also modulate the cellular levels of p-STAT5.
[0187] To dissect the relative contribution of these potential mechanisms, we first investigated the effect of PU-H71 on the main kinases and PTPases that regulate STAT5 phosphorylation in K562 cells. Bcr-Abl directly activates STAT5 without the need for JAK phosphorylation (de Groot et al., 1999). Concordantly, STAT5-phosphorylation rapidly decreased in the presence of the Bcr-Abl inhibitor Gleevec (
[0188] Thus reduction of p-STAT5 phosphorylation by PU-H71 in the 0 to 90 min interval (
[0189] We therefore examined whether the rapid decrease in p-STAT5 levels in the presence of PU-H71 may be accounted for by an increase in PTPase activity. The expression and activity of SHP2, the major cytosolic STAT5 phosphatase (Xu & Qu, 2008), were also not altered within this time interval (
[0190] Thus no effect on STAT5 in the interval 0-90 min can likely be attributed to a change in kinase or phosphatase activity towards STAT5. As an alternative mechanism, and because the majority of p-STAT5 but not STAT5 is Hsp90 bound in CML cells (
[0191] The activation/inactivation cycle of STATs entails their transition between different dimer conformations. Phosphorylation of STATs occurs in an anti-parallel dimer conformation that upon phosphorylation triggers a parallel dimer conformation. Dephosphorylation of STATs on the other hand require extensive spatial reorientation, in that the tyrosine phosphorylated STAT dimers must shift from parallel to anti-parallel configuration to expose the phosphotyrosine as a better target for phosphatases (Lim & Cao, 2006). We find that STAT5 is more susceptible to trypsin cleavage when bound to Hsp90 (
[0192] To investigate this possibility we used a pulse-chase strategy in which orthovanadate (Na.sub.3VO.sub.4), a non-specific PTPase inhibitor, was added to cells to block the dephosphorylation of STAT5. The residual level of p-STAT5 was then determined at several later time points (
Hsp90 Maintains STAT5 in an Active Conformation Directly within STAT5-Containing Transcriptional Complexes
[0193] In addition to STAT5 phosphorylation and dimerization, the biological activity of STAT5 requires its nuclear translocation and direct binding to its various target genes (de Groot et al., 1999; Lim & Cao, 2006). We wondered therefore, whether Hsp90 might also facilitate the transcriptional activation of STAT5 genes, and thus participate in promoter-associated STAT5 transcription complexes. Using an ELISA-based assay, we found that STAT5 (
[0194] Collectively, these data show that STAT5 activity is positively regulated by Hsp90 in CML cells (
[0195] More broadly, the data suggest that it is the PU-H71-Hsp90 fraction of cellular Hsp90 that is most closely involved in supporting oncogenic protein functions in tumor cells, and PU-H71-Hsp90 proteomics can be used to identify a broad cross-section of the protein pathways required to maintain the malignant phenotype in specific tumor cells (
Discussion
[0196] It is now appreciated that many proteins that are required to maintain tumor cell survival may not present mutations in their coding sequence, and yet identifying these proteins is of extreme importance to understand how individual tumors work. Genome wide mutational studies may not identify these oncoproteins since mutations are not required for many genes to support tumor cell survival (e.g. IRF4 in multiple myeloma and BCL6 in B-cell lymphomas) (Cerchietti et al., 2009). Highly complex, expensive and large-scale methods such as RNAi screens have been the major means for identifying the complement of oncogenic proteins in various tumors (Horn et al., 2010). We present herein a rapid and simple chemical-proteomics method for surveying tumor oncoproteins regardless of whether they are mutated (
[0197] While this method presents a unique approach to identify the oncoproteins that maintain the malignant phenotype of tumor cells, one needs to be aware that, similarly to other chemical or antibody-based proteomics techniques, it also has potential limitations (Rix & Superti-Furga, 2009). For example, “sticky” or abundant proteins may also bind in a nondiscriminatory fashion to proteins isolated by the PU-H71 beads. Such proteins were catalogued by several investigators (Trinkle-Mulcahy et al., 2008), and we have used these lists to eliminate them from the pull-downs with the clear understanding that some of these proteins may actually be genuine Hsp90 clients. Second, while we have presented several lines of evidence that PU-H71 is specific for Hsp90 (
[0198] In spite of the potential limitations described in the preceeding paragraph, we have, using this method, performed the first global evaluation of Hsp90-facilitated aberrant signaling pathways in CML. The Hsp90 interactome identified by PU-H71 affinity purification significantly overlaps with the well-characterized CML signalosome (
[0199] Since single agent therapy is not likely to be curative in cancer, it is necessary to design rational combinatorial therapy approaches. Proteomic identification of oncogenic Hsp90-scaffolded signaling networks may identify additional oncoproteins that could be further targeted using specific small molecule inhibitors. Indeed, inhibitors of mTOR and CAMKII, which are identified by our method to contribute to the transformation of K562 CML cells and be key nodal proteins on individual networks (
[0200] When applied to less well-characterized tumor types, PU-H71 chemical proteomics might provide less obvious and more impactful candidate targets for combinatorial therapy. We exemplify this concept in the MDA-MB-468 triple-negative breast cancer cells, the MiaPaCa2 pancreatic cancer cells and the OCI-LY1 diffuse large B-cell lymphoma cells.
[0201] In the triple negative breast cancer cell line MDA-MB-468 major signaling networks identified by the method were the PI3K/AKT, IGF-IR, NRF2-mediated oxidative stress response, MYC, PKA and the IL-6 signaling pathways (
TABLE-US-00002 TABLE 3 ©2000-2012 Ingenuity Systems, Inc. All rights reserved. ID Notes Symbol Entrez Gene Name Location Type(s) Drug(s) AAGAB AAGAB alpha- and Cytoplasm other gamma-adaptin binding protein ABHD10 ABHD10 abhydrolase Cytoplasm other domain containing 10 ACAP2 ACAP2 ArfGAP with Nucleus other coiled-coil, ankyrin repeat and PH domains 2 AHSA1 AHSA1 AHA1, activator Cytoplasm other of heat shock 90 kDa protein ATPase homolog 1 (yeast) AKAP8 AKAP8 A kinase Nucleus other (PRKA) anchor protein 8 AKAP8L AKAP8L A kinase Nucleus other (PRKA) anchor protein 8-like ALYREF ALYREF Aly/REF export Nucleus transcription factor regulator ANKRD17 ANKRD17 ankyrin repeat unknown other domain 17 ANKRD50 ANKRD50 ankyrin repeat unknown other domain 50 ANP32A ANP32A acidic (leucine- Nucleus other rich) nuclear phosphoprotein 32 family, member A ANXA11 ANXA11 annexin A11 Nucleus other ANXA2 ANXA2 annexin A2 Plasma other Membrane ANXA7 ANXA7 annexin A7 Plasma ion channel Membrane ARFGAP1 ARFGAP1 ADP-ribosylation Cytoplasm transporter factor GTPase activating protein 1 ARFGEF2 ARFGEF2 ADP-ribosylation Cytoplasm other factor guanine nucleotide- exchange factor 2 (brefeldin A- inhibited) ARFIP2 ARFIP2 ADP-ribosylation Cytoplasm other factor interacting protein 2 ARHGAP29 ARHGAP29 Rho GTPase Cytoplasm other activating protein 29 ARHGEF40 ARHGEF40 Rho guanine unknown other nucleotide exchange factor (GEF) 40 ASAH1 ASAH1 N- Cytoplasm enzyme acylsphingosine amidohydrolase (acid ceramidase) 1 ATL3 ATL3 atlastin GTPase 3 Cytoplasm other BAG4 BAG4 BCL2- Cytoplasm other associated athanogene 4 BAG6 BAG6 BCL2- Nucleus enzyme associated athanogene 6 BECN1 BECN1 beclin 1, Cytoplasm other autophagy related BIRC6 BIRC6 baculoviral IAP Cytoplasm enzyme repeat containing 6 BLMH BLMH bleomycin Cytoplasm peptidase hydrolase BRAT1 BRAT1 BRCA1- Cytoplasm other associated ATM activator 1 BRCC3 BRCC3 BRCA1/BRCA2- Nucleus enzyme containing complex, subunit 3 BRD4 BRD4 bromodomain Nucleus kinase containing 4 BTAF1 BTAF1 BTAF1 RNA Nucleus transcription polymerase II, regulator B-TFIID transcription factor- associated, 170 kDa (Mot1 homolog, S. cerevisiae) BUB1B BUB1B budding Nucleus kinase uninhibited by benzimidazoles 1 homolog beta (yeast) BUB3 BUB3 budding Nucleus other (includes uninhibited by EG: 12237) benzimidazoles 3 homolog (yeast) BYSL BYSL bystin-like Cytoplasm other BZW1 BZW1 basic leucine Cytoplasm translation zipper and W2 regulator domains 1 CACYBP CACYBP calcyclin binding Nucleus other protein CALU CALU calumenin Cytoplasm other CAMK2G CAMK2G calcium/calmodulin- Cytoplasm kinase dependent protein kinase II gamma CAND1 CAND1 cullin-associated Cytoplasm transcription and neddylation- regulator dissociated 1 CANX CANX calnexin Cytoplasm other CAP1 CAP1 CAP, adenylate Plasma other cyclase- Membrane associated protein 1 (yeast) CAPRIN1 CAPRIN1 cell cycle Plasma other associated Membrane protein 1 CAPZA1 CAPZA1 capping protein Cytoplasm other (actin filament) muscle Z-line, alpha 1 CAPZB CAPZB capping protein Cytoplasm other (actin filament) muscle Z-line, beta CARM1 CARM1 coactivator- Nucleus transcription associated regulator arginine methyltransferase 1 CASKIN1 CASKIN1 CASK Nucleus transcription interacting regulator protein 1 CAT CAT catalase Cytoplasm enzyme CBR1 CBR1 carbonyl Cytoplasm enzyme reductase 1 CCDC124 CCDC124 coiled-coil unknown other domain containing 124 CCDC99 CCDC99 coiled-coil Nucleus other domain containing 99 CDC37 CDC37 cell division Cytoplasm other cycle 37 homolog (S. cerevisiae) CDC37L1 CDC37L1 cell division Cytoplasm other cycle 37 homolog (S. cerevisiae)- like 1 CDC42BPG CDC42BPG CDC42 binding Cytoplasm kinase protein kinase gamma (DMPK- like) CDH1 CDH1 cadherin 1, type Plasma other 1, E-cadherin Membrane (epithelial) CDK1 CDK1 cyclin- Nucleus kinase flavopiridol dependent kinase 1 CDK13 CDK13 cyclin- Nucleus kinase dependent kinase 13 CDK4 CDK4 cyclin- Nucleus kinase PD-0332991, dependent flavopiridol kinase 4 CDK7 CDK7 cyclin- Nucleus kinase BMS-387032, dependent flavopiridol kinase 7 CHTF18 CHTF18 CTF18, unknown other chromosome transmission fidelity factor 18 homolog (S. cerevisiae) CNDP2 CNDP2 CNDP Cytoplasm peptidase dipeptidase 2 (metallopeptidase M20 family) CNN3 CNN3 calponin 3, Cytoplasm other acidic CNOT1 CNOT1 CCR4-NOT Cytoplasm other transcription complex, subunit 1 CNOT2 CNOT2 CCR4-NOT Nucleus transcription transcription regulator complex, subunit 2 CNOT7 CNOT7 CCR4-NOT Nucleus transcription transcription complex, subunit 7 CPOX CPOX coproporphyrinogen Cytoplasm enzyme oxidase CSDA CSDA cold shock Nucleus transcription domain protein A regulator CSNK1A1 CSNK1A1 casein kinase 1, Cytoplasm kinase alpha 1 CSNK2A1 CSNK2A1 casein kinase 2, Cytoplasm kinase alpha 1 polypeptide CSNK2A2 CSNK2A2 casein kinase 2, Cytoplasm kinase alpha prime polypeptide CTNNB1 CTNNB1 catenin Nucleus transcription (cadherin- regulator associated protein), beta 1, 88 kDa CTNND1 CTNND1 catenin Nucleus other (cadherin- associated protein), delta 1 CTSB CTSB cathepsin B Cytoplasm peptidase CTTN CTTN cortactin Plasma other Membrane CTU1 CTU1 cytosolic Cytoplasm other thiouridylase subunit 1 homolog (S. pombe) CYFIP1 CYFIP1 cytoplasmic Cytoplasm other FMR1 interacting protein 1 DCP1A DCP1A DCP1 Nucleus other decapping enzyme homolog A (S. cerevisiae) DICER1 DICER1 dicer 1, Cytoplasm enzyme ribonuclease type III DNAJA1 DNAJA1 DnaJ (Hsp40) Nucleus other homolog, subfamily A, member 1 DNAJA2 DNAJA2 DnaJ (Hsp40) Nucleus enzyme homolog, subfamily A, member 2 DNAJB1 DNAJB1 DnaJ (Hsp40) Nucleus other homolog, subfamily B, member 1 DNAJB11 DNAJB11 DnaJ (Hsp40) Cytoplasm other homolog, subfamily B, member 11 DNAJB6 DNAJB6 DnaJ (Hsp40) Nucleus transcription homolog, regulator subfamily B, member 6 DNAJC7 DNAJC7 DnaJ (Hsp40) Cytoplasm other homolog, subfamily C, member 7 DSP DSP desmoplakin Plasma other Membrane DTX3L DTX3L deltex 3-like Cytoplasm enzyme (Drosophila) EBNA1BP2 EBNA1BP2 EBNA1 binding Nucleus other protein 2 EDC3 EDC3 enhancer of mRNA Cytoplasm other (includes decapping 3 EG: 315708) homolog (S. cerevisiae) EDC4 EDC4 enhancer of Cytoplasm other mRNA decapping 4 EEF1B2 EEF1B2 eukaryotic Cytoplasm translation translation regulator elongation factor 1 beta 2 EEF2 EEF2 eukaryotic Cytoplasm translation translation regulator elongation factor 2 EFTUD2 EFTUD2 elongation factor Nucleus enzyme Tu GTP binding domain containing 2 EIF2B2 EIF2B2 eukaryotic Cytoplasm translation translation regulator initiation factor 2B, subunit 2 beta, 39 kDa EIF3A EIF3A eukaryotic Cytoplasm translation translation regulator initiation factor 3, subunit A EIF4A1 EIF4A1 eukaryotic Cytoplasm translation translation regulator initiation factor 4A1 EIF6 EIF6 eukaryotic Cytoplasm translation translation regulator initiation factor 6 ELAVL1 ELAVL1 ELAV Cytoplasm other (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) ELP3 ELP3 elongation Nucleus enzyme protein 3 homolog (S. cerevisiae) EMD EMD emerin Nucleus other EPCAM EPCAM epithelial cell Plasma other tucotuzumab adhesion Membrane celmoleukin, molecule catumaxomab, adecatumumab EPPK1 EPPK1 epiplakin 1 Cytoplasm other EPS15 EPS15 epidermal Plasma other growth factor Membrane receptor pathway substrate 15 EPS15L1 EPS15L1 epidermal Plasma other growth factor Membrane receptor pathway substrate 15-like 1 ESRP1 ESRP1 epithelial Nucleus other splicing regulatory protein 1 ESYT1 ESYT1 extended unknown other synaptotagmin- like protein 1 ETF1 ETF1 eukaryotic Cytoplasm translation translation regulator termination factor 1 ETFA ETFA electron- Cytoplasm transporter transfer- flavoprotein, alpha polypeptide ETV3 ETV3 ets variant 3 Nucleus transcription regulator FANCD2 FANCD2 Fanconi anemia, Nucleus other complementation group D2 FASN FASN fatty acid Cytoplasm enzyme synthase FDFT1 FDFT1 farnesyl- Cytoplasm enzyme TAK-475, diphosphate zoledronic farnesyltransferase 1 acid FHL3 FHL3 four and a half Plasma other LIM domains 3 Membrane FKBP4 FKBP4 FK506 binding Nucleus enzyme protein 4, 59 kDa FKBP9 FKBP9 FK506 binding Cytoplasm enzyme protein 9, 63 kDa FLAD1 FLAD1 FAD1 flavin Cytoplasm enzyme adenine dinucleotide synthetase homolog (S. cerevisiae) FLNA FLNA filamin A, alpha Cytoplasm other FLNB FLNB filamin B, beta Cytoplasm other FUBP1 FUBP1 far upstream Nucleus transcription element (FUSE) regulator binding protein 1 FUBP3 FUBP3 far upstream Nucleus transcription element (FUSE) regulator binding protein 3 GAN GAN gigaxonin Cytoplasm other GANAB GANAB glucosidase, Cytoplasm enzyme alpha; neutral AB GAPDH GAPDH glyceraldehyde- Cytoplasm enzyme 3-phosphate dehydrogenase GART GART phosphoribosyl- Cytoplasm enzyme LY231514 glycinamide formyltransferase, phosphoribosyl- glycinamide synthetase, phosphoribosyl- aminoimidazole synthetase GBA GBA glucosidase, Cytoplasm enzyme beta, acid GCA GCA grancalcin, EF- Cytoplasm other hand calcium binding protein GIGYF2 GIGYF2 GRB10 unknown other interacting GYF protein 2 GINS4 GINS4 GINS complex Nucleus other subunit 4 (Sld5 homolog) GLA GLA galactosidase, Cytoplasm enzyme alpha GLB1 GLB1 galactosidase, Cytoplasm enzyme beta 1 GLMN GLMN glomulin, FKBP Cytoplasm other associated protein GPHN GPHN gephyrin Plasma enzyme Membrane GPI GPI glucose-6- Extracellular enzyme phosphate Space isomerase GPS1 GPS1 G protein Nucleus other pathway suppressor 1 GRB2 GRB2 growth factor Cytoplasm other receptor-bound protein 2 GTF2F1 GTF2F1 general Nucleus transcription transcription regulator factor IIF, polypeptide 1, 74 kDa GTF2F2 GTF2F2 general Nucleus transcription transcription regulator factor IIF, polypeptide 2, 30 kDa GTF2I GTF2I general Nucleus transcription transcription regulator factor IIi H1F0 H1F0 H1 histone Nucleus other family, member 0 H1FX H1FX H1 histone Nucleus other family, member X HDAC2 HDAC2 histone Nucleus transcription tributyrin, deacetylase 2 regulator belinostat, pyroxamide, vorinostat, romidepsin HDAC3 HDAC3 histone Nucleus transcription tributyrin, deacetylase 3 regulator belinostat, pyroxamide, MGCD0103, vorinostat, romidepsin HDAC6 HDAC6 histone Nucleus transcription tributyrin, deacetylase 6 regulator belinostat, pyroxamide, vorinostat, romidepsin HIF1AN HIF1AN hypoxia Nucleus enzyme inducible factor 1, alpha subunit inhibitor HIST1H1B HIST1H1B histone cluster 1, Nucleus other H1b HIST1H1D HIST1H1D histone cluster 1, Nucleus other H1d HNRNPA0 HNRNPA0 heterogeneous Nucleus other nuclear ribonucleoprotein A0 HSP90AA1 HSP90AA1 heat shock Cytoplasm enzyme 17-dimethylamino- protein 90 kDa ethylamino- alpha 17-demethoxy- (cytosolic), class geldanamycin, A member 1 IPI-504, cisplatin HSP90AA4P HSP90AA4P heat shock unknown other protein 90 kDa alpha (cytosolic), class A member 4, pseudogene HSP90AB1 HSP90AB1 heat shock Cytoplasm enzyme 17-dimethylamino- protein 90 kDa ethylamino- alpha 17-demethoxy- (cytosolic), class geldanamycin, B member 1 IPI-504, cisplatin HSP90B1 HSP90B1 heat shock Cytoplasm other 17-dimethylamino- protein 90 kDa ethylamino- beta (Grp94), 17-demethoxy- member 1 geldanamycin, IPI-504, cisplatin HSPA4 HSPA4 heat shock Cytoplasm other 70 kDa protein 4 HSPA5 HSPA5 heat shock Cytoplasm enzyme 70 kDa protein 5 (glucose- regulated protein, 78 kDa) HSPA8 HSPA8 heat shock Cytoplasm enzyme 70 kDa protein 8 HSPB1 HSPB1 heat shock Cytoplasm other 27 kDa protein 1 HSPD1 HSPD1 heat shock Cytoplasm enzyme 60 kDa protein 1 (chaperonin) HSPH1 HSPH1 heat shock Cytoplasm other 105 kDa/110 kDa protein 1 IDH2 IDH2 isocitrate Cytoplasm enzyme dehydrogenase 2 (NADP+), mitochondrial IGBP1 IGBP1 immunoglobulin Cytoplasm phosphatase (CD79A) binding protein 1 IGF2BP3 IGF2BP3 insulin-like Cytoplasm translation growth factor 2 regulator mRNA binding protein 3 IKBKAP IKBKAP inhibitor of Cytoplasm other kappa light polypeptide gene enhancer in B-cells, kinase complex- associated protein ILF2 ILF2 interleukin Nucleus transcription enhancer regulator binding factor 2, 45 kDa ILF3 ILF3 interleukin Nucleus transcription enhancer binding factor 3, 90 kDa IMPDH1 IMPDH1 IMP (inosine 5′- Cytoplasm enzyme thioguanine, monophosphate) VX-944, dehydrogenase 1 interferon alfa- 2b/ribavirin, mycophenolic acid, ribavirin IMPDH2 IMPDH2 IMP (inosine 5′- Cytoplasm enzyme thioguanine, monophosphate) VX-944, dehydrogenase 2 interferon alfa- 2b/ribavirin, mycophenolic acid, ribavirin INF2 INF2 inverted formin, Cytoplasm other FH2 and WH2 domain containing INTS3 INTS3 integrator Nucleus other complex subunit 3 IRAK1 IRAK1 interleukin-1 Plasma kinase receptor- Membrane associated kinase 1 ISYNA1 ISYNA1 inositol-3- unknown enzyme phosphate synthase 1 ITCH ITCH itchy E3 Nucleus enzyme ubiquitin protein ligase homolog (mouse) KHDRBS1 KHDRBS1 KH domain Nucleus transcription containing, RNA regulator binding, signal transduction associated 1 KHSRP KHSRP KH-type splicing Nucleus enzyme regulatory protein LGALS3 LGALS3 lectin, Extracellular other galactoside- Space binding, soluble, 3 LGALS3BP LGALS3BP lectin, Plasma transmembrane galactoside- Membrane receptor binding, soluble, 3 binding protein LIPA LIPA lipase A, Cytoplasm enzyme lysosomal acid, cholesterol esterase LMAN2 LMAN2 lectin, mannose- Cytoplasm transporter binding 2 LMNA LMNA lamin A/C Nucleus other LRBA LRBA LPS-responsive Cytoplasm other vesicle trafficking, beach and anchor containing LRPPRC LRPPRC leucine-rich Cytoplasm other PPR-motif containing LSM14A LSM14A LSM14A, SCD6 Cytoplasm other homolog A (S. cerevisiae) MAGI3 MAGI3 membrane Cytoplasm kinase associated guanylate kinase, WW and PDZ domain containing 3 MAP3K7 MAP3K7 mitogen- Cytoplasm kinase (includes activated protein EG: 172842) kinase kinase kinase 7 MAPK1 MAPK1 mitogen- Cytoplasm kinase activated protein kinase 1 MAPK3 MAPK3 mitogen- Cytoplasm kinase activated protein kinase 3 MAPK9 MAPK9 mitogen- Cytoplasm kinase activated protein kinase 9 MCM2 MCM2 minichromosome Nucleus enzyme maintenance complex component 2 MEMO1 MEMO1 mediator of cell Cytoplasm other (includes motility 1 EG: 298787) MKI67 MKI67 antigen Nucleus other identified by monoclonal antibody Ki-67 MLF2 MLF2 myeloid Nucleus other leukemia factor 2 MSH6 MSH6 mutS homolog 6 Nucleus enzyme (E. coli) MSI1 MSI1 musashi Cytoplasm other (includes homolog 1 EG: 17690) (Drosophila) MSI2 MSI2 musashi Cytoplasm other homolog 2 (Drosophila) MTA2 MTA2 metastasis Nucleus transcription associated 1 regulator family, member 2 MTOR MTOR mechanistic Nucleus kinase deforolimus, target of OSI-027, rapamycin NVP-BEZ235, (serine/threonine temsirolimus, kinase) tacrolimus, everolimus MTX1 MTX1 metaxin 1 Cytoplasm transporter MYBBP1A MYBBP1A MYB binding Nucleus transcription protein (P160) 1a regulator MYCBP2 MYCBP2 MYC binding Nucleus enzyme protein 2 NACC1 NACC1 nucleus Nucleus transcription accumbens regulator associated 1, BEN and BTB (POZ) domain containing NAT10 NAT10 N- Nucleus enzyme acetyltransferase 10 (GCN5- related) NCBP1 NCBP1 nuclear cap Nucleus other binding protein subunit 1, 80 kDa NCKAP1 NCKAP1 NCK-associated Plasma other protein 1 Membrane NCKIPSD NCKIPSD NCK interacting Nucleus other protein with SH3 domain NCL NCL nucleolin Nucleus other NCOR1 NCOR1 nuclear receptor Nucleus transcription corepressor 1 regulator NCOR2 NCOR2 nuclear receptor Nucleus transcription corepressor 2 regulator NFKB2 NFKB2 nuclear factor of Nucleus transcription kappa light regulator polypeptide gene enhancer in B-cells 2 (p49/p100) NKRF NKRF NFKB Nucleus transcription repressing factor regulator NME7 NME7 non-metastatic Cytoplasm kinase cells 7, protein expressed in (nucleoside- diphosphate kinase) NNMT NNMT nicotinamide N- Cytoplasm enzyme methyltransferase NOL6 NOL6 nucleolar protein Nucleus other family 6 (RNA- associated) NPM1 NPM1 nucleophosmin Nucleus transcription (nucleolar regulator phosphoprotein B23, numatrin) NQO1 NQO1 NAD(P)H Cytoplasm enzyme dehydrogenase, quinone 1 NQO2 NQO2 NAD(P)H Cytoplasm enzyme dehydrogenase, quinone 2 NUCB1 NUCB1 nucleobindin 1 Cytoplasm other NUDCD1 NUDCD1 NudC domain unknown other containing 1 NUDCD3 NUDCD3 NudC domain unknown other containing 3 NUDT5 NUDT5 nudix Cytoplasm phosphatase (nucleoside diphosphate linked moiety X)- type motif 5 NUF2 NUF2 NUF2, NDC80 Nucleus other kinetochore complex component, homolog (S. cerevisiae) OTUB1 OTUB1 OTU domain, unknown enzyme ubiquitin aldehyde binding 1 OTUD4 OTUD4 OTU domain unknown other containing 4 PA2G4 PA2G4 proliferation- Nucleus transcription associated 2G4, regulator 38 kDa PCNA PCNA proliferating cell Nucleus enzyme nuclear antigen PDAP1 PDAP1 PDGFA Cytoplasm other associated protein 1 PDCD2L PDCD2L programmed cell unknown other death 2-like PDCD6IP PDCD6IP programmed cell Cytoplasm other death 6 interacting protein PDIA6 PDIA6 protein disulfide Cytoplasm enzyme isomerase family A, member 6 PDK3 PDK3 pyruvate Cytoplasm kinase dehydrogenase kinase, isozyme 3 PDLIM1 PDLIM1 PDZ and LIM Cytoplasm transcription domain 1 regulator PDLIM5 PDLIM5 PDZ and LIM Cytoplasm other domain 5 PIK3C2B PIK3C2B phosphoinositide- Cytoplasm kinase 3-kinase, class 2, beta polypeptide PIK3C3 PIK3C3 phosphoinositide- Cytoplasm kinase 3-kinase, class 3 PIK3R4 PIK3R4 phosphoinositide- Cytoplasm other 3-kinase, regulatory subunit 4 PLAA PLAA phospholipase Cytoplasm other A2-activating protein PLBD2 PLBD2 phospholipase B Extracellular other domain Space containing 2 POLD1 POLD1 polymerase Nucleus enzyme nelarabine, (DNA directed), MB07133, delta 1, catalytic clofarabine, subunit 125 kDa cytarabine, trifluridine, vidarabine, entecavir POLR2A POLR2A polymerase Nucleus enzyme (RNA) II (DNA directed) polypeptide A, 220 kDa PPIE PPIE peptidylprolyl Nucleus enzyme isomerase E (cyclophilin E) PPP1CB PPP1CB protein Cytoplasm phosphatase phosphatase 1, catalytic subunit, beta isozyme PPP2CA PPP2CA protein Cytoplasm phosphatase phosphatase 2, catalytic subunit, alpha isozyme PPP3CA PPP3CA protein Cytoplasm phosphatase ISAtx-247, phosphatase 3, tacrolimus, catalytic subunit, pimecrolimus, alpha isozyme cyclosporin A PPP4C PPP4C protein Cytoplasm phosphatase phosphatase 4, catalytic subunit PPP5C PPP5C protein Nucleus phosphatase phosphatase 5, catalytic subunit PPP6C PPP6C protein Nucleus phosphatase phosphatase 6, catalytic subunit PRIM2 PRIM2 primase, DNA, Nucleus enzyme fludarabine polypeptide 2 phosphate (58 kDa) PRKAA1 PRKAA1 protein kinase, Cytoplasm kinase AMP-activated, alpha 1 catalytic subunit PRKAB1 PRKAB1 protein kinase, Nucleus kinase AMP-activated, beta 1 non- catalytic subunit PRKAB2 PRKAB2 protein kinase, Cytoplasm kinase AMP-activated, beta 2 non- catalytic subunit PRKAG1 PRKAG1 protein kinase, Nucleus kinase AMP-activated, gamma 1 non- catalytic subunit PRKCSH PRKCSH protein kinase C Cytoplasm enzyme substrate 80K-H PRKDC PRKDC protein kinase, Nucleus kinase DNA-activated, catalytic polypeptide PRMT1 PRMT1 protein arginine Nucleus enzyme methyltransferase 1 PRMT5 PRMT5 protein arginine Cytoplasm enzyme methyltransferase 5 PSMA1 PSMA1 proteasome Cytoplasm peptidase (prosome, macropain) subunit, alpha type, 1 PSMC1 PSMC1 proteasome Nucleus peptidase (prosome, macropain) 26S subunit, ATPase, 1 PSMD1 PSMD1 proteasome Cytoplasm other (prosome, macropain) 26S subunit, non- ATPase, 1 PSME1 PSME1 proteasome Cytoplasm other (prosome, macropain) activator subunit 1 (PA28 alpha) PSPC1 PSPC1 paraspeckle Nucleus other component 1 PTCD3 PTCD3 Pentatricopeptide Cytoplasm other repeat domain 3 PTGES2 PTGES2 prostaglandin E Cytoplasm transcription synthase 2 regulator PTK2 PTK2 PTK2 protein Cytoplasm kinase (includes tyrosine kinase 2 EG: 14083) PUM1 PUM1 pumilio homolog Cytoplasm other 1 (Drosophila) RAB3D RAB3D RAB3D, Cytoplasm enzyme member RAS oncogene family RAB3GAP1 RAB3GAP1 RAB3 GTPase Cytoplasm other activating protein subunit 1 (catalytic) RAB3GAP2 RAB3GAP2 RAB3 GTPase Cytoplasm enzyme activating protein subunit 2 (non-catalytic) RAB5C RAB5C RAB5C, Cytoplasm enzyme member RAS oncogene family RABGGTB RABGGTB Rab Cytoplasm enzyme geranylgeranyl- transferase, beta subunit RAD23B RAD23B RAD23 homolog Nucleus other B (S. cerevisiae) RAE1 RAE1 RAE1 RNA Nucleus other export 1 homolog (S. pombe) RANBP2 RANBP2 RAN binding Nucleus enzyme protein 2 RANGAP1 RANGAP1 Ran GTPase Cytoplasm other activating protein 1 RBCK1 RBCK1 RanBP-type and Cytoplasm transcription C3HC4-type regulator zinc finger containing 1 RBM10 RBM10 RNA binding Nucleus other motif protein 10 RELA RELA v-rel Nucleus transcription NF-kappaB reticuloendotheliosis regulator decoy viral oncogene homolog A (avian) RFC2 RFC2 replication factor Nucleus other C (activator 1) 2, 40 kDa RPA2 RPA2 replication Nucleus other protein A2, 32 kDa RPS6 RPS6 ribosomal Cytoplasm other protein S6 RPS6KA3 RPS6KA3 ribosomal Cytoplasm kinase protein S6 kinase, 90 kDa, polypeptide 3 RPSA RPSA ribosomal Cytoplasm translation protein SA regulator RUVBL1 RUVBL1 RuvB-like 1 Nucleus transcription (E. coli) regulator RUVBL2 RUVBL2 RuvB-like 2 Nucleus transcription (E. coli) regulator S100A8 S100A8 S100 calcium Cytoplasm other binding protein A8 S100A9 S100A9 S100 calcium Cytoplasm other binding protein A9 SAMHD1 SAMHD1 SAM domain Nucleus enzyme and HD domain 1 SELO SELO selenoprotein O Extracellular enzyme Space SETD2 SETD2 SET domain Cytoplasm enzyme containing 2 SF1 SF1 splicing factor 1 Nucleus transcription regulator SHARPIN SHARPIN SHANK- Plasma other associated RH Membrane domain interactor SIRT1 SIRT1 sirtuin 1 Nucleus transcription regulator SIRT3 SIRT3 sirtuin 3 Cytoplasm enzyme SMARCA2 SMARCA2 SWI/SNF Nucleus transcription related, matrix regulator associated, actin dependent regulator of chromatin, subfamily a, member 2 SMARCA4 SMARCA4 SWI/SNF Nucleus transcription related, matrix regulator associated, actin dependent regulator of chromatin, subfamily a, member 4 SNRNP200 SNRNP200 small nuclear Nucleus enzyme ribonucleoprotein 200 kDa (U5) SNX9 SNX9 sorting nexin 9 Cytoplasm transporter SON SON SON DNA Nucleus other binding protein SPC24 SPC24 SPC24, NDC80 Cytoplasm other (includes kinetochore EG: 147841) complex component, homolog (S. cerevisiae) SQSTM1 SQSTM1 sequestosome 1 Cytoplasm transcription regulator SRPK2 SRPK2 SRSF protein Nucleus kinase kinase 2 ST13 ST13 suppression of Cytoplasm other tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) STAM STAM signal Cytoplasm other transducing adaptor molecule (SH3 domain and ITAM motif) 1 STAT3 STAT3 signal Nucleus transcription transducer and regulator activator of transcription 3 (acute-phase response factor) STAT5B STAT5B signal Nucleus transcription transducer and regulator activator of transcription 5B STIP1 STIP1 stress-induced- Cytoplasm other phosphoprotein 1 STK3 STK3 serine/threonine Cytoplasm kinase kinase 3 STRAP STRAP serine/threonine Plasma other kinase receptor Membrane associated protein STUB1 STUB1 STIP1 homology Cytoplasm enzyme and U-box containing protein 1, E3 ubiquitin protein ligase SULT1A1 SULT1A1 sulfotransferase Cytoplasm enzyme family, cytosolic, 1A, phenol- preferring, member 1 SULT2B1 SULT2B1 sulfotransferase Cytoplasm enzyme family, cytosolic, 2B, member 1 SURF4 SURF4 surfeit 4 Cytoplasm other TAB1 TAB1 TGF-beta Cytoplasm enzyme activated kinase 1/MAP3K7 binding protein 1 TBC1D15 TBC1D15 TBC1 domain Cytoplasm other family, member 15 TBC1D9B TBC1D9B TBC1 domain unknown other family, member 9B (with GRAM domain) TBK1 TBK1 TANK-binding Cytoplasm kinase kinase 1 TBRG4 TBRG4 transforming Cytoplasm other growth factor beta regulator 4 TCEAL4 TCEAL4 transcription unknown other elongation factor A (SII)-like 4 TFRC TFRC transferrin Plasma transporter receptor (p90, Membrane CD71) TIPRL TIPRL TIP41, TOR unknown other signaling pathway regulator-like (S. cerevisiae) TJP2 TJP2 tight junction Plasma kinase protein 2 (zona Membrane occludens 2) TLN1 TLN1 talin 1 Plasma other Membrane TMCO6 TMCO6 transmembrane unknown other and coiled-coil domains 6 TNRC6B TNRC6B trinucleotide unknown other repeat containing 6B TOMM34 TOMM34 translocase of Cytoplasm other outer mitochondrial membrane 34 TP53 TP53 tumor protein Nucleus transcription (includes p53 regulator EG: 22059) TP53I3 TP53I3 tumor protein unknown enzyme p53 inducible protein 3 TP53RK TP53RK TP53 regulating Nucleus kinase kinase TPD52L2 TPD52L2 tumor protein Cytoplasm other D52-like 2 TPM3 TPM3 tropomyosin 3 Cytoplasm other TPP1 TPP1 tripeptidyl Cytoplasm peptidase (includes peptidase I EG: 1200) TPP2 TPP2 tripeptidyl Cytoplasm peptidase peptidase II TRA2A TRA2A transformer 2 Nucleus other alpha homolog (Drosophila) TRA2B TRA2B transformer 2 Nucleus other beta homolog (Drosophila) TRAP1 TRAP1 TNF receptor- Cytoplasm enzyme associated protein 1 TRIM28 TRIM28 tripartite motif Nucleus transcription containing 28 regulator TRIO TRIO triple functional Plasma kinase domain (PTPRF Membrane interacting) TTC1 TTC1 tetratricopeptide unknown other repeat domain 1 TTC19 TTC19 tetratricopeptide Cytoplasm other repeat domain 19 TTC35 TTC35 tetratricopeptide Nucleus other repeat domain 35 TTC5 TTC5 tetratricopeptide unknown other repeat domain 5 TYMS TYMS thymidylate Nucleus enzyme flucytosine, synthetase 5-fluorouracil, plevitrexed, nolatrexed, capecitabine, trifluridine, floxuridine, LY231514 UBA1 UBA1 ubiquitin-like Cytoplasm enzyme modifier activating enzyme 1 UBA7 UBA7 ubiquitin-like Cytoplasm enzyme modifier activating enzyme 7 UBAC1 UBAC1 UBA domain Nucleus other containing 1 UBAP2 UBAP2 ubiquitin Cytoplasm other associated protein 2 UBAP2L UBAP2L ubiquitin unknown other associated protein 2-like UBASH3B UBASH3B ubiquitin unknown enzyme associated and SH3 domain containing B UBE3A UBE3A ubiquitin protein Nucleus enzyme ligase E3A UBE4B UBE4B ubiquitination Cytoplasm enzyme factor E4B UBQLN1 UBQLN1 ubiquilin 1 Cytoplasm other UBQLN2 UBQLN2 ubiquilin 2 Nucleus other UBQLN4 UBQLN4 ubiquilin 4 Cytoplasm other UBR1 UBR1 ubiquitin protein Cytoplasm enzyme (includes ligase E3 EG: 197131) component n- recognin 1 UBR4 UBR4 ubiquitin protein Nucleus other ligase E3 component n- recognin 4 UCHL5 UCHL5 ubiquitin Cytoplasm peptidase carboxyl- terminal hydrolase L5 UFD1L UFD1L ubiquitin fusion Cytoplasm peptidase degradation 1 like (yeast) UNC45A UNC45A unc-45 homolog Plasma other A (C. elegans) Membrane USP10 USP10 ubiquitin specific Cytoplasm peptidase peptidase 10 USP11 USP11 ubiquitin specific Nucleus peptidase peptidase 11 USP13 USP13 ubiquitin specific unknown peptidase peptidase 13 (isopeptidase T-3) USP14 USP14 ubiquitin specific Cytoplasm peptidase peptidase 14 (tRNA-guanine transglycosylase) USP15 USP15 ubiquitin specific Cytoplasm peptidase peptidase 15 USP24 USP24 ubiquitin specific unknown peptidase peptidase 24 USP28 USP28 ubiquitin specific Nucleus peptidase peptidase 28 USP32 USP32 ubiquitin specific Cytoplasm enzyme peptidase 32 USP34 USP34 ubiquitin specific unknown peptidase peptidase 34 USP47 USP47 ubiquitin specific Cytoplasm peptidase peptidase 47 USP5 USP5 ubiquitin specific Cytoplasm peptidase peptidase 5 (isopeptidase T) USP7 USP7 ubiquitin specific Nucleus peptidase peptidase 7 (herpes virus- associated) USP9X USP9X ubiquitin specific Plasma peptidase peptidase 9, X- Membrane linked VGLL1 VGLL1 vestigial like 1 Nucleus transcription (Drosophila) regulator VPS11 VPS11 vacuolar protein Cytoplasm transporter sorting 11 homolog (S. cerevisiae) WBP2 WBP2 WW domain Cytoplasm other binding protein 2 WBP4 WBP4 WW domain Cytoplasm other binding protein 4 (formin binding protein 21) WDR11 WDR11 WD repeat unknown other domain 11 WDR18 WDR18 WD repeat Nucleus other domain 18 WDR5 WDR5 WD repeat Nucleus other domain 5 WDR6 WDR6 WD repeat Cytoplasm other domain 6 WDR61 WDR61 WD repeat unknown other domain 61 WDR77 WDR77 WD repeat Nucleus transcription domain 77 regulator WDR82 WDR82 WD repeat Nucleus other domain 82 XAB2 XAB2 XPA binding Nucleus other protein 2 XIAP XIAP X-linked inhibitor Cytoplasm other of apoptosis YWHAB YWHAB tyrosine 3- Cytoplasm transcription monooxygenase/ regulator tryptophan 5- monooxygenase activation protein, beta polypeptide YWHAE YWHAE tyrosine 3- Cytoplasm other monooxygenase/ tryptophan 5- monooxygenase activation protein, epsilon polypeptide YWHAG YWHAG tyrosine 3- Cytoplasm other monooxygenase/ tryptophan 5- monooxygenase activation protein, gamma polypeptide YWHAH YWHAH tyrosine 3- Cytoplasm transcription monooxygenase/ regulator tryptophan 5- monooxygenase activation protein, eta polypeptide YWHAQ YWHAQ tyrosine 3- Cytoplasm other monooxygenase/ tryptophan 5- monooxygenase activation protein, theta polypeptide YWHAZ YWHAZ tyrosine 3- Cytoplasm enzyme monooxygenase/ tryptophan 5- monooxygenase activation protein, zeta polypeptide ZBED1 ZBED1 zinc finger, Nucleus enzyme BED-type containing 1 ZC3H13 ZC3H13 zinc finger unknown other CCCH-type containing 13 ZC3H4 ZC3H4 zinc finger unknown other CCCH-type containing 4 ZC3HAV1 ZC3HAV1 zinc finger Plasma other CCCH-type, Membrane antiviral 1 ZFR ZFR zinc finger RNA Nucleus other binding protein ZNF511 ZNF511 zinc finger Nucleus other protein 511 ZW10 ZW10 ZW10, Nucleus other kinetochore associated, homolog (Drosophila) ZWILCH ZWILCH Zwilch, Nucleus other kinetochore associated, homolog (Drosophila)
PI3K-AKT-mTOR Pathway
[0202] Phosphatidylinositol 3 kinases (PI3K) are a family of lipid kinases whose inositol lipid products play a central role in signal transduction pathways of cytokines, growth factors and other extracellular matrix proteins. PI3Ks are divided into three classes: Class 1, 11 and III with Class I being the best studied one. It is a heterodimer consisting of a catalytic and regulatory subunit. These are most commonly found to be p110 and p85. Phosphorylation of phosphoinositide(4,5)bisphosphate (PIP2) by Class I PI3K generates PtdIns(3,4,5)P3. The different PI3ks are involved in a variety of signaling pathways. This is mediated through their interaction with molecules like the receptor tyrosine kinases (RTKs), the adapter molecules GAB1-GRB2, and the kinase JAK. These converge to activate PDK1 which then phosphorylates AKT. AKT follows two distinct paths: 1) Inhibitory role—for example, AKT inhibits apoptosis by phosphorylating the Bad component of the Bad/Bcl-XL complex, allowing for cell survival. 2) Activating role—AKT activates IKK leading to NF-κB activation and cell survival. By its inhibitory as well as activating role, AKT is involved in numerous cellular processes like energy storage, cell cycle progression, protein synthesis and angiogenesis.
[0203] This pathway is composed of, but not restricted to 1-phosphatidyl-D-myo-inositol 4,5-bisphosphate, 14-3-3, 14-3-3-Cdkn1b, Akt, BAD, BCL2, BCL2L1, CCND1, CDC37, CDKN1A, CDKN1B, citrulline, CTNNB1, EIF4E, EIF4EBP1, ERK1/2, FKHR, GAB1/2, GDF15, Glycogen synthase, GRB2, Gsk3, Ikb, IkB-NfkB, IKK (complex), ILK, Integrin, JAK, L-arginine, LIMS1, MAP2K1/2, MAP3K5, MAP3K8, MAPK81P1, MCL1, MDM2, MTOR, NANOG, NFkB (complex), nitric oxide, NOS3, P110, p70 S6k, PDPK1, phosphatidylinositol-3,4,5-triphosphate, PI3K p85, PP2A, PTEN, PTGS2, RAF1, Ras, RHEB, SFN, SHC1 (includes EG:20416), SHIP, Sos, THEM4, TP53 (includes EG:22059), TSC1, Tsc1-Tsc2, TSC2, YWHAE
IGF-IR Signaling Network
[0204] Insulin-like growth factor-1 (IGF-1) is a peptide hormone under control of the growth hormone. IGF-1 promotes cell proliferation, growth and survival. Six specific binding proteins, IGFBP 1-6, allow for a more nuanced control of IGF activity. The IGF-1 receptor (IGF-1R) is a transmembrane tyrosine kinase protein. IGF-1-induced receptor activation results in autophosphorylation followed by an enhanced capability to activate downstream pathways. Activated IGF-1R phosphorylates SHC and IRS-1. SHC along with adapter molecules GRB2 and SOS forms a signaling complex that activates the Ras/Raf/MEK/ERK pathway. ERK translocation to the nucleus results in the activation of transcriptional regulators ELK-1, c-Jun and c-Fos which induce genes that promote cell growth and differentiation. IRS-1 activates pathways for cell survival via the PI3K/PDK1/AKT/BAD pathway. IRS-1 also activates pathways for cell growth via the PI3K/PDK1/p70RSK pathway. IGF-1 also signals via the JAK/STAT pathway by inducing tyrosine phosphorylation of JAK-1, JAK-2 and STAT-3. SOCS proteins are able to inhibit the JAKs thereby inhibiting this pathway. The adapter protein GRB10 interacts with IGF-IR. GRB10 also binds the E3 ubiquitin ligase NEDD4 and promotes ligand stimulated ubiquitination, internalization, and degradation of the IGF-IR as a means of long-term attenuation of signaling.
[0205] This pathway is composed of, but not restricted to 1-phosphatidyl-D-myo-inositol 4,5-bisphosphatc, 14-3-3, 14-3-3-Bad, Akt, atypical protein kinase C, BAD, CASP9 (includes EG:100140945), Ck2, ELK1, ERK1/2, FKHR, FOS, GRB10, GRB2, IGF1, Igfl-Igfbp, IGF1R, Igfbp, IRS1/2, JAK1/2, JUN, MAP2K1/2, MAPK8, NEDD4, p70 S6k, PDPK1, phosphatidylinositol-3,4,5-triphosphate, PI3K (complex), Pka, PTK2 (includes EG:14083), PTPN11, PXN, RAF1, Ras, RASA1, SHC1 (includes EG:20416), SOCS, SOCS3, Sos, SRF, STAT3, Stat3-Stat3
NRF2-Mediated Oxidative Stress Response
[0206] Oxidative stress is caused by an imbalance between the production of reactive oxygen and the detoxification of reactive intermediates. Reactive intermediates such as peroxides and free radicals can be very damaging to many parts of cells such as proteins, lipids and DNA. Severe oxidative stress can trigger apoptosis and necrosis. Oxidative stress is involved in many diseases such as atherosclerosis, Parkinson's disease and Alzheimer's disease. Oxidative stress has also been linked to aging. The cellular defense response to oxidative stress includes induction of detoxifying enzymes and antioxidant enzymes. Nuclear factor-erythroid 2-related factor 2 (Nrf2) binds to the antioxidant response elements (ARE) within the promoter of these enzymes and activates their transcription. Inactive Nrf2 is retained in the cytoplasm by association with an actin-binding protein Keap1. Upon exposure of cells to oxidative stress, Nrf2 is phosphorylated in response to the protein kinase C, phosphatidylinositol 3-kinase and MAP kinase pathways. After phosphorylation, Nrf2 translocates to the nucleus, binds AREs and transactivates detoxifying enzymes and antioxidant enzymes, such as glutathione S-transferase, cytochrome P450, NAD(P)H quinone oxidoreductase, heme oxygenase and superoxide dismutase.
[0207] This pathway is composed of, but not restricted to ABCC1, ABCC2, ABCC4 (includes EG:10257), Actin, Actin-Nrf2, Afar, AKRIA1, AKT1, AOX1, ATF4, BACH1, CAT, Cbp/p300, CBR1, CCT7, CDC34, CLPP, CUL3 (includes EG:26554), Cul3-Rocl, Cypla/2a/3a/4a/2c, EIF2AK3, ENC1, EPHX1, ERK1/2, ERP29, FKBP5, FM01 (includes EG:14261), FOS, FOSL1, FTH1 (includes EG:14319), FTL, GCLC, GCLM, GPX2, GSK3B, GSR, GST, HERPUD1, HMOX1, Hsp22/Hsp40/Hsp90, JINK1/2, Jnkk, JUN/JUNB/JUND, KEAP1, Keap1-Nrf2, MAF, MAP2K1/2, MAP2K5, MAP3K1, MAP3K5, MAP3K7 (includes EG:172842), MAPK14, MAPK7, MKK3/6, musculoaponeurotic fibrosarcoma oncogene, NFE2L2, NQO, PI3K (complex), Pkc(s), PMF1, PPIB, PRDX1, Psm, PTPLAD1, RAF1, Ras, RBX1, reactive oxygen species, SCARB1, SLC35A2, Sod, SQSTM1, STIP1, TXN (includes EG:116484), TXNRD1, UBB, UBE2E3, UBE2K, USP14, VCP
Protein Kinase A Signaling Pathway
[0208] Protein kinase A (PKA) regulates processes as diverse as growth, development, memory, and metabolism. It exists as a tetrameric complex of two catalytic subunits (PKA-C) and a regulatory (PKA-R) subunit dimer. Type-II PKA is anchored to specific locations within the cell by AKAPs. Extracellular stimuli such as neurotransmitters, hormones, inflammatory stimuli, stress, epinephrine and norepinephrine activate G-proteins through receptors such as GPCRs and ADR-α/β. These receptors along with others such as CRHR, GcgR and DCC are responsible for cAMP accumulation which leads to activation of PKA. The conversion of ATP to cAMP is mediated by the 9 transmembrane AC enzymes and one soluble AC. The transmembrane AC are regulated by heterotrimeric G-proteins, Gαs, Gαq and Gαi. Gαs and Gαq activate while Gαi inhibits AC. Gβ and Gγ subunits act synergistically with Gαs and Gαq to activate ACII, IV and VII. However the β and γ subunits along with Gαi inhibit the activity of ACI, V and VI.
[0209] G-proteins indirectly influence cAMP signaling by activating PLC, which generates DAG and IP3. DAG in turn activates PKC. IP3 modulates proteins upstream to cAMP signaling with the release of Ca2+ from the ER through IP3R. Ca2+ is also released by CaCn and CNG. Ca2+ release activates Calmodulin, CamKKs and CamKs, which take part in cAMP modulation by activating ACI. Gal3 activates MEKK1 and RhoA via two independent pathways which induce phosphorylation and degradation of IκBα and activation of PKA. High levels of cAMP under stress conditions like hypoxia, ischemia and heat shock also directly activate PKA. TGF-β activates PKA independent of cAMP through phosphorylation of SMAD proteins. PKA phosphorylates Phospholamban which regulates the activity of SERCA2 leading to myocardial contraction, whereas phosphorylation of TnnI mediates relaxation. PKA also activates KDELR to promote protein retrieval thereby maintaining steady state of the cell. Increase in concentration of Ca2+ followed by PKA activation enhances eNOS activity which is essential for cardiovascular homeostasis. Activated PKA represses ERK activation by inhibition of Raf1. PKA inhibits the interaction of 14-3-3 proteins with BAD and NFAT to promote cell survival. PKA phosphorylates endothelial MLCK leading to decreased basal MLC phosphorylation. It also phosphorylates filamin, adducin, paxillin and FAK and is involved in the disappearance of stress fibers and F-actin accumulation in membrane ruffles. PKA also controls phosphatase activity by phosphorylation of a specific PPtase1 inhibitor, DARPP32. Other substrates of PKA include histone H1, histone H2B and CREB.
[0210] This pathway is composed of, but not restricted to 1-phosphatidyl-D-myo-inositol 4,5-bisphosphate, 14-3-3, ADCY, ADCY1/5/6, ADCY2/4/7, ADCY9, Adducin, AKAP, APC, ATFL (includes EG:100040260), ATP, BAD, BRAF, Ca2+, Calcineurin protein(s), Calmodulin, CaMK_II, CHUK, Cng Channel, Creb, CREBBP, CREM, CTNNB1, cyclic AMP, DCC, diacylglycerol, ELK1, ERK1/2, Filamin, Focal adhesion kinase, G protein alphai, G protein beta gamma, G-protein beta, G-protein gamma, GLI3, glycogen, glycogen phosphorylase, Glycogen synthase, GNA13, GNAQ, GNAS, GRK1/7, Gsk3, Hedgehog, Histone H1, Histone h3, Ikb, IkB-NfkB, inositol triphosphate, ITPR, KDELR, LIPE, MAP2K1/2, MAP3K1, Mlc, myosin-light-chain kinase, Myosin2, Nfat (family), NFkB (complex), NGFR, NOS3, NTN1, Patched, Pde, Phk, Pka, Pka catalytic subunit, PKAr, Pkc(s), PLC, PLN, PP1 protein complex group, PPP1R1B, PTPase, PXN, RAF1, Rap1, RHO, RHOA, Rock, Ryr, SMAD3, Smad3-Smad4, SMAD4, SMO, TCF/LEF, Tgf beta, Tgf beta receptor, TGFBR1, TGFBR2, TH, Tni, VASP
IL-6 Signaling Pathway
[0211] The central role of IL-6 in inflammation makes it an important target for the management of inflammation associated with cancer. IL-6 responses are transmitted through Glycoprotein 130 (GP130), which serves as the universal signal-transducing receptor subunit for all IL-6-related cytokines. IL-6-type cytokines utilize tyrosine kinases of the Janus Kinase (JAK) family and signal transducers and activators of transcription (STAT) family as major mediators of signal transduction. Upon receptor stimulation by IL-6, the JAK family of kinases associated with GP130 are activated, resulting in the phosphorylation of GP130. Several phosphotyrosine residues of GP130 serve as docking sites for STAT factors mainly STAT3 and STAT1. Subsequently, STATs are phosphorylated, form dimers and translocate to the nucleus, where they regulate transcription of target genes. In addition to the JAK/STAT pathway of signal transduction, IL-6 also activates the extracellular signal-regulated kinases (ERK1/2) of the mitogen activated protein kinase (MAPK) pathway. The upstream activators of ERK1/2 include RAS and the src homology-2 containing proteins GRB2 and SHC. The SHC protein is activated by JAK2 and thus serves as a link between the IL-6 activated JAK/STAT and RAS-MAPK pathways. The phosphorylation of MAPKs in response to IL-6 activated RAS results in the activation of nuclear factor IL-6 (NF-IL6), which in turn stimulates the transcription of the IL-6 gene. The transcription of the IL-6 gene is also stimulated by tumor necrosis factor (TNF) and Interleukin-1 (IL-1) via the activation of nuclear factor kappa B (NFκB).
[0212] Based on the findings by the method described here in MDA-MB-468 cells, combination of an inhibitor of components of these identified pathways, such as those targeting but not limited to AKT, mTOR, PI3K, 1GF1R, IKK, Bcl2, PKA complex, phosphodiesterases are proposed to be efficacious when used in combination with an Hsp90 inhibitor.
[0213] Example of AKT inhibitors are PF-04691502, Triciribine phosphate (NSC-280594), A-674563, CCT128930, AT7867, PHT-427, GSK690693, MK-2206
[0214] Example of PI3K inhibitors are 2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine, BKM120, NVP-BEZ235, PX-866, SF 1126, XL147.
[0215] Example of mTOR inhibitors are deforolimus, everolimus, NVP-BEZ235, OSI-027, tacrolimus, temsirolimus, Ku-0063794, WYE-354, PP242, OSI-027, GSK2126458, WAY-600, WYE-125132
[0216] Examples of Bcl2 inhibitors are ABT-737, Obatoclax (GX15-070), ABT-263, TW-37
[0217] Examples of IGF1R inhibitors are NVP-ADW742, BMS-754807, AVE1642, BIIB022, cixutumumab, ganitumab, IGF1, OSI-906
[0218] Examples of JAK inhibitors are Tofacitinib citrate (CP-690550), AT9283, AG-490, INCB018424 (Ruxolitinib), AZD1480, LY2784544, NVP-BSK805, TG101209, TG-101348
[0219] Examples of IkK inhibitors are SC-514, PF 184
[0220] Examples of inhibitors of phosphodiesterases are aminophylline, anagrelide, arofylline, caffeine, cilomilast, dipyridamole, dyphylline, L 869298, L-826,141, milrinone, nitroglycerin, pentoxifylline, roflumilast, rolipram, tetomilast, theophylline, tolbutamide, amrinone, anagrelide, arofylline, caffeine, cilomilast, L 869298, L-826,141, milrinone, pentoxifylline, roflumilast, rolipram, tetomilast
[0221] In the Diffuse large B-cell lymphoma (DLBCL) cell line OCI-LY1, major signaling networks identified by the method were the B cell receptor, PKCteta, PI3K/AKT, CD40, CD28 and the ERK/MAPK signaling, pathways (
TABLE-US-00003 TABLE 4 ©2000-2012 Ingenuity Systems, Inc. All rights reserved. ID Notes Symbol Entrez Gene Name Location Type(s) Drug(s) AAGAB AAGAB alpha- and Cytoplasm other gamma-adaptin binding protein ABI1 ABI1 abl-interactor 1 Cytoplasm other ABR ABR active BCR-related Cytoplasm other gene AHSA1 AHSA1 AHA1, activator of Cytoplasm other heat shock 90 kDa protein ATPase homolog 1 (yeast) AIFM1 AIFM1 apoptosis-inducing Cytoplasm enzyme factor, mitochondrion- associated, 1 AKAP8 AKAP8 A kinase (PRKA) Nucleus other anchor protein 8 AKAP8L AKAP8L A kinase (PRKA) Nucleus other anchor protein 8- like ALKBH8 ALKBH8 alkB, alkylation Cytoplasm enzyme repair homolog 8 (E. coli) ALOX5 ALOX5 arachidonate 5- Cytoplasm enzyme TA 270, lipoxygenase benoxaprofen, meclofenamic acid, zileuton, sulfasalazine, balsalazide, 5- aminosalicylic acid, masoprocol ANAPC7 ANAPC7 anaphase Nucleus other promoting complex subunit 7 ANKFY1 ANKFY1 ankyrin repeat and Nucleus transcription FYVE domain regulator containing 1 ANKRD17 ANKRD17 ankyrin repeat unknown other domain 17 ANP32B ANP32B acidic (leucine- Nucleus other rich) nuclear phosphoprotein 32 family, member B AP1B1 AP1B1 adaptor-related Cytoplasm transporter protein complex 1, beta 1 subunit AP2A1 AP2A1 adaptor-related Cytoplasm transporter protein complex 2, alpha 1 subunit APIP APIP APAF1 interacting Cytoplasm enzyme protein APOBEC3G APOBEC3G apolipoprotein B Nucleus enzyme mRNA editing enzyme, catalytic polypeptide-like 3G ARFGAP1 ARFGAP1 ADP-ribosylation Cytoplasm transporter factor GTPase activating protein 1 ARFGEF2 ARFGEF2 ADP-ribosylation Cytoplasm other factor guanine nucleotide- exchange factor 2 (brefeldin A- inhibited) ARFIP2 ARFIP2 ADP-ribosylation Cytoplasm other factor interacting protein 2 ARHGEF1 ARHGEF1 Rho guanine Cytoplasm other nucleotide exchange factor (GEF) 1 ARID1A ARID1A AT rich interactive Nucleus transcription domain 1A (SWI- regulator like) ASAH1 ASAH1 N-acylsphingosine Cytoplasm enzyme amidohydrolase (acid ceramidase) 1 ASMTL ASMTL acetylserotonin O- Cytoplasm enzyme methyltransferase- like ASNA1 ASNA1 arsA arsenite Nucleus transporter transporter, ATP- binding, homolog 1 (bacterial) ASPSCR1 ASPSCR1 alveolar soft part Cytoplasm other sarcoma chromosome region, candidate 1 ATM ATM ataxia Nucleus kinase telangiectasia mutated ATR ATR ataxia Nucleus kinase telangiectasia and Rad3 related ATXN10 ATXN10 ataxin 10 Cytoplasm other ATXN2L ATXN2L ataxin 2-like unknown other BABAM1 BABAM1 BRISC and Nucleus other BRCA1 A complex member 1 BAG6 BAG6 BCL2-associated Nucleus enzyme athanogene 6 BIRC6 BIRC6 baculoviral IAP Cytoplasm enzyme repeat containing 6 BRAT1 BRAT1 BRCA1-associated Cytoplasm other ATM activator 1 BRCC3 BRCC3 BRCA1/BRCA2- Nucleus enzyme containing complex, subunit 3 BTAF1 BTAF1 BTAF1 RNA Nucleus transcription polymerase II, B- regulator TFIID transcription factor-associated, 170 kDa (Mot1 homolog, S. cerevisiae) BTK BTK Bruton Cytoplasm kinase agammaglobulinemia tyrosine kinase BUB1B BUB1B budding Nucleus kinase uninhibited by benzimidazoles 1 homolog beta (yeast) BUB3 BUB3 budding Nucleus other (includes uninhibited by EG: 12237) benzimidazoles 3 homolog (yeast) BZW1 BZW1 basic leucine Cytoplasm translation zipper and W2 regulator domains 1 CACYBP CACYBP calcyclin binding Nucleus other protein CALU CALU calumenin Cytoplasm other CAMK1D CAMK1D calcium/calmodulin- Cytoplasm kinase dependent protein kinase ID CAMK2D CAMK2D calcium/calmodulin- Cytoplasm kinase dependent protein kinase II delta CAMK2G CAMK2G calcium/calmodulin- Cytoplasm kinase dependent protein kinase II gamma CAMK4 CAMK4 calcium/calmodulin- Nucleus kinase dependent protein kinase IV CAND1 CAND1 cullin-associated Cytoplasm transcription and neddylation- regulator dissociated 1 CANX CANX calnexin Cytoplasm other CAP1 CAP1 CAP, adenylate Plasma other cyclase-associated Membrane protein 1 (yeast) CAPN1 CAPN1 calpain 1, (mu/l) Cytoplasm peptidase large subunit CAPRIN1 CAPRIN1 cell cycle Plasma other associated protein 1 Membrane CARM1 CARM1 coactivator- Nucleus transcription associated regulator arginine methyltransferase 1 CCNY CCNY cyclin Y Nucleus other CD38 CD38 CD38 molecule Plasma enzyme Membrane CD74 CD74 CD74 molecule, Plasma transmembrane major Membrane receptor histocompatibility complex, class II invariant chain CDC37 CDC37 cell division cycle Cytoplasm other 37 homolog (S. cerevisiae) CDC37L1 CDC37L1 cell division cycle Cytoplasm other 37 homolog (S. cerevisiae)-like 1 CDK1 CDK1 cyclin-dependent Nucleus kinase flavopiridol kinase 1 CDK4 CDK4 cyclin-dependent Nucleus kinase PD-0332991, kinase 4 flavopiridol CDK7 CDK7 cyclin-dependent Nucleus kinase BMS-387032, kinase 7 flavopiridol CDK9 CDK9 cyclin-dependent Nucleus kinase BMS-387032, kinase 9 flavopiridol CHAF1B CHAF1B chromatin Nucleus other assembly factor 1, subunit B (p60) CHD8 CHD8 chromodomain Nucleus enzyme helicase DNA binding protein 8 CHTF18 CHTF18 CTF18, unknown other chromosome transmission fidelity factor 18 homolog (S. cerevisiae) CNN2 CNN2 calponin 2 Cytoplasm other CNOT1 CNOT1 CCR4-NOT Cytoplasm other transcription complex, subunit 1 CNP CNP 2′,3′-cyclic Cytoplasm enzyme nucleotide 3′ phosphodiesterase CNTLN CNTLN centlein, unknown other centrosomal protein COBRA1 COBRA1 cofactor of BRCA1 Nucleus other CORO7 CORO7 coronin 7 Cytoplasm other CRKL CRKL v-crk sarcoma Cytoplasm kinase virus CT10 oncogene homolog (avian)-like CSDE1 CSDE1 cold shock domain Cytoplasm enzyme containing E1, RNA-binding CSNK1A1 CSNK1A1 casein kinase 1, Cytoplasm kinase alpha 1 CSNK2A1 CSNK2A1 casein kinase 2, Cytoplasm kinase alpha 1 polypeptide CSNK2A2 CSNK2A2 casein kinase 2, Cytoplasm kinase alpha prime polypeptide CTBP2 CTBP2 C-terminal binding Nucleus transcription protein 2 regulator CTSZ CTSZ cathepsin Z Cytoplasm peptidase CUTC CUTC cutC copper Cytoplasm other transporter homolog (E. coli) CYB5R3 CYB5R3 cytochrome b5 Cytoplasm enzyme reductase 3 CYFIP1 CYFIP1 cytoplasmic FMR1 Cytoplasm other interacting protein 1 CYFIP2 CYFIP2 cytoplasmic FMR1 Cytoplasm other interacting protein 2 DBNL DBNL drebrin-like Cytoplasm other DCAF7 DCAF7 DDB1 and CUL4 Cytoplasm other associated factor 7 DICER1 DICER1 dicer 1, Cytoplasm enzyme ribonuclease type III DIMT1 DIMT1 DIM1 Cytoplasm enzyme dimethyladenosine transferase 1 homolog (S. cerevisiae) DIS3L DIS3L DIS3 mitotic Cytoplasm enzyme control homolog (S. cerevisiae)-like DNAJA1 DNAJA1 DnaJ (Hsp40) Nucleus other homolog, subfamily A, member 1 DNAJA2 DNAJA2 DnaJ (Hsp40) Nucleus enzyme homolog, subfamily A, member 2 DNAJB1 DNAJB1 DnaJ (Hsp40) Nucleus other homolog, subfamily B, member 1 DNAJB11 DNAJB11 DnaJ (Hsp40) Cytoplasm other homolog, subfamily B, member 11 DNAJB2 DNAJB2 DnaJ (Hsp40) Nucleus other homolog, subfamily B, member 2 DNAJC10 DNAJC10 DnaJ (Hsp40) Cytoplasm enzyme homolog, subfamily C, member 10 DNAJC21 DNAJC21 DnaJ (Hsp40) unknown other homolog, subfamily C, member 21 DNAJC7 DNAJC7 DnaJ (Hsp40) Cytoplasm other homolog, subfamily C, member 7 DNMT1 DNMT1 DNA (cytosine-5-)- Nucleus enzyme methyltransferase 1 DOCK2 DOCK2 dedicator of Cytoplasm other cytokinesis 2 DPH5 DPH5 DPH5 homolog unknown enzyme (S. cerevisiae) DPYSL2 DPYSL2 dihydropyrimidinase- Cytoplasm enzyme like 2 DRG1 DRG1 developmentally Cytoplasm other regulated GTP binding protein 1 DTX3L DTX3L deltex 3-like Cytoplasm enzyme (Drosophila) EBNA1BP2 EBNA1BP2 EBNA1 binding Nucleus other protein 2 EEF1A1 EEF1A1 eukaryotic Cytoplasm translation translation regulator elongation factor 1 alpha 1 EHD1 EHD1 EH-domain Cytoplasm other containing 1 EIF2B2 EIF2B2 eukaryotic Cytoplasm translation translation initiation regulator factor 2B, subunit 2 beta, 39 kDa ELMO1 ELMO1 engulfment and Cytoplasm other cell motility 1 EPG5 EPG5 ectopic P-granules unknown other autophagy protein 5 homolog (C. elegans) EPS15 EPS15 epidermal growth Plasma other factor receptor Membrane pathway substrate 15 EPS15L1 EPS15L1 epidermal growth Plasma other factor receptor Membrane pathway substrate 15-like 1 ETF1 ETF1 eukaryotic Cytoplasm translation translation regulator termination factor 1 EXOSC2 EXOSC2 exosome Nucleus enzyme component 2 EXOSC5 EXOSC5 exosome Nucleus enzyme component 5 EXOSC6 EXOSC6 exosome Nucleus other component 6 EXOSC7 EXOSC7 exosome Nucleus enzyme component 7 FANCD2 FANCD2 Fanconi anemia, Nucleus other complementation group D2 FANCI FANCI Fanconi anemia, Nucleus other complementation group I FBXL12 FBXL12 F-box and leucine- Cytoplasm other rich repeat protein 12 FBXO22 FBXO22 F-box protein 22 unknown enzyme FBXO3 FBXO3 F-box protein 3 unknown enzyme FCHSD2 FCHSD2 FCH and double unknown other SH3 domains 2 FCRLA FCRLA Fc receptor-like A Plasma other Membrane FDFT1 FDFT1 farnesyl- Cytoplasm enzyme TAK-475, diphosphate zoledronic farnesyltransferase 1 acid FKBP4 FKBP4 FK506 binding Nucleus enzyme protein 4, 59 kDa FKBP5 FKBP5 FK506 binding Nucleus enzyme protein 5 FLI1 FLI1 Friend leukemia Nucleus transcription virus integration 1 regulator FLII FLII flightless I homolog Nucleus other (Drosophila) FLNA FLNA filamin A, alpha Cytoplasm other FN3KRP FN3KRP fructosamine 3 unknown kinase kinase related protein FNBP1 FNBP1 formin binding Nucleus enzyme protein 1 G3BP1 G3BP1 GTPase activating Nucleus enzyme protein (SH3 domain) binding protein 1 G3BP2 G3BP2 GTPase activating Nucleus enzyme protein (SH3 domain) binding protein 2 GAPVD1 GAPVD1 GTPase activating Cytoplasm other protein and VPS9 domains 1 GARS GARS glycyl-tRNA Cytoplasm enzyme synthetase GART GART phosphoribosyl- Cytoplasm enzyme LY231514 glycinamide formyltransferase, phosphoribosyl- glycinamide synthetase, phosphoribosylamino- imidazole synthetase GIGYF2 GIGYF2 GRB10 interacting unknown other GYF protein 2 GLMN GLMN glomulin, FKBP Cytoplasm other associated protein GLRX3 GLRX3 glutaredoxin 3 Cytoplasm enzyme GOLPH3L GOLPH3L golgi Cytoplasm other phosphoprotein 3- like GPATCH8 GPATCH8 G patch domain unknown other containing 8 GTF2B GTF2B general Nucleus transcription transcription factor regulator IIB GTF2F1 GTF2F1 general Nucleus transcription transcription factor regulator IIF, polypeptide 1, 74 kDa GTF2F2 GTF2F2 general Nucleus transcription transcription factor regulator IIF, polypeptide 2, 30 kDa GTF2I GTF2I general Nucleus transcription transcription factor regulator IIi GTF3C1 GTF3C1 general Nucleus transcription transcription factor regulator IIIC, polypeptide 1, alpha 220 kDa GTPBP4 GTPBP4 GTP binding Nucleus enzyme protein 4 HAT1 HAT1 histone Nucleus enzyme acetyltransferase 1 HCLS1 HCLS1 hematopoietic cell- Nucleus transcription specific Lyn regulator substrate 1 HDAC1 HDAC1 histone Nucleus transcription tributyrin, deacetylase 1 regulator belinostat, pyroxamide, MGCD0103, vorinostat, romidepsin HDAC2 HDAC2 histone Nucleus transcription tributyrin, deacetylase 2 regulator belinostat, pyroxamide, vorinostat, romidepsin HDAC3 HDAC3 histone Nucleus transcription tributyrin, deacetylase 3 regulator belinostat, pyroxamide, MGCD0103, vorinostat, romidepsin HDAC6 HDAC6 histone Nucleus transcription tributyrin, deacetylase 6 regulator belinostat, pyroxamide, vorinostat, romidepsin HDLBP HDLBP high density Nucleus transporter lipoprotein binding protein HECTD1 HECTD1 HECT domain unknown enzyme containing 1 HERC1 HERC1 hect (homologous Cytoplasm other to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 HIF1AN HIF1AN hypoxia inducible Nucleus enzyme factor 1, alpha subunit inhibitor HIRIP3 HIRIP3 HIRA interacting Nucleus other protein 3 HIST1H1B HIST1H1B histone cluster 1, Nucleus other H1b HIST1H1D HIST1H1D histone cluster 1, Nucleus other H1d HK2 HK2 hexokinase 2 Cytoplasm kinase HLA-DQB1 HLA-DQB1 major Plasma other histocompatibility Membrane complex, class II, DQ beta 1 HLA-DRA HLA-DRA major Plasma transmembrane histocompatibility Membrane receptor complex, class II, DR alpha HLA-DRB1 HLA-DRB1 major Plasma transmembrane apolizumab histocompatibility Membrane receptor complex, class II, DR beta 1 HNRNPAB HNRNPAB heterogeneous Nucleus enzyme nuclear ribonucleoprotein A/B HNRNPD HNRNPD heterogeneous Nucleus transcription nuclear regulator ribonucleoprotein D (AU-rich element RNA binding protein 1, 37 kDa) HNRNPU HNRNPU heterogeneous Nucleus transporter nuclear ribonucleoprotein U (scaffold attachment factor A) HSP90AA1 HSP90AA1 heat shock protein Cytoplasm enzyme 17- 90 kDa alpha dimethylamino- (cytosolic), class A ethylamino-17- member 1 demethoxy- geldanamycin, IPI-504, cisplatin HSP90AB1 HSP90AB1 heat shock protein Cytoplasm enzyme 17- 90 kDa alpha dimethylamino- (cytosolic), class B ethylamino-17- member 1 demethoxy- geldanamycin, IPI-504, cisplatin HSP90B1 HSP90B1 heat shock protein Cytoplasm other 17- 90 kDa beta dimethylamino- (Grp94), member 1 ethylamino-17- demethoxy- geldanamycin, IPI-504, cisplatin HSPA4 HSPA4 heat shock 70 kDa Cytoplasm other protein 4 HSPA5 HSPA5 heat shock 70 kDa Cytoplasm enzyme protein 5 (glucose- regulated protein, 78 kDa) HSPA8 HSPA8 heat shock 70 kDa Cytoplasm enzyme protein 8 HSPA9 HSPA9 heat shock 70 kDa Cytoplasm other protein 9 (mortalin) HSPD1 HSPD1 heat shock 60 kDa Cytoplasm enzyme protein 1 (chaperonin) HSPH1 HSPH1 heat shock Cytoplasm other 105 kDa/110 kDa protein 1 HTRA2 HTRA2 HtrA serine Cytoplasm peptidase peptidase 2 IFIH1 IFIH1 interferon induced Nucleus enzyme with helicase C domain 1 IFIT1 IFIT1 interferon-induced Cytoplasm other protein with tetratricopeptide repeats 1 IFIT3 IFIT3 interferon-induced Cytoplasm other protein with tetratricopeptide repeats 3 IGBP1 IGBP1 immunoglobulin Cytoplasm phosphatase (CD79A) binding protein 1 IGF2BP3 IGF2BP3 insulin-like growth Cytoplasm translation factor 2 mRNA regulator binding protein 3 IKBKAP IKBKAP inhibitor of kappa Cytoplasm other light polypeptide gene enhancer in B-cells, kinase complex- associated protein ILF2 ILF2 interleukin Nucleus transcription enhancer binding regulator factor 2, 45 kDa INPP5B INPP5B inositol Plasma phosphatase polyphosphate-5- Membrane phosphatase, 75 kDa INPP5D INPP5D inositol Cytoplasm phosphatase polyphosphate-5- phosphatase, 145 kDa ISY1 ISY1 ISY1 splicing factor Nucleus other (includes homolog EG: 362394) (S. cerevisiae) ITCH ITCH itchy E3 ubiquitin Nucleus enzyme protein ligase homolog (mouse) ITFG2 ITFG2 integrin alpha FG- unknown other GAP repeat containing 2 ITIH3 ITIH3 inter-alpha-trypsin Extracellular other inhibitor heavy Space chain 3 ITSN2 ITSN2 intersectin 2 Cytoplasm other KARS KARS lysyl-tRNA Cytoplasm enzyme synthetase KCNAB2 KCNAB2 potassium voltage- Plasma ion channel gated channel, Membrane shaker-related subfamily, beta member 2 KIAA0368 KIAA0368 KIAA0368 Cytoplasm other KIAA0564 KIAA0564 KIAA0564 Cytoplasm other KIAA0664 KIAA0664 KIAA0664 Cytoplasm translation regulator KIAA1524 KIAA1524 KIAA1524 Cytoplasm other KIAA1797 KIAA1797 KIAA1797 unknown other KIAA1967 KIAA1967 KIAA1967 Cytoplasm peptidase LARS LARS leucyl-tRNA Cytoplasm enzyme synthetase LPXN LPXN leupaxin Cytoplasm other LTN1 LTN1 listerin E3 ubiquitin Nucleus enzyme protein ligase 1 LYAR LYAR Ly1 antibody Plasma other reactive homolog Membrane (mouse) MAGI1 MAGI1 membrane Plasma kinase (includes associated Membrane EG: 14924) guanylate kinase, WW and PDZ domain containing 1 MAP3K1 MAP3K1 mitogen-activated Cytoplasm kinase protein kinase kinase kinase 1 MAPK1 MAPK1 mitogen-activated Cytoplasm kinase protein kinase 1 MAPK14 MAPK14 mitogen-activated Cytoplasm kinase SCIO-469, protein kinase 14 RO-3201195 MAPK3 MAPK3 mitogen-activated Cytoplasm kinase protein kinase 3 MAPK9 MAPK9 mitogen-activated Cytoplasm kinase protein kinase 9 MCM2 MCM2 minichromosome Nucleus enzyme maintenance complex component 2 MCMBP MCMBP minichromosome Nucleus other maintenance complex binding protein MED1 MED1 mediator complex Nucleus transcription (includes subunit 1 regulator EG: 19014) MEMO1 MEMO1 mediator of cell Cytoplasm other (includes motility 1 EG: 298787) MEPCE MEPCE methylphosphate unknown enzyme capping enzyme METTL15 METTL15 methyltransferase unknown other like 15 MLH1 MLH1 mutL homolog 1, Nucleus enzyme colon cancer, nonpolyposis type 2 (E. coli) MLST8 MLST8 MTOR associated Cytoplasm other protein, LST8 homolog (S. cerevisiae) MMS19 MMS19 MMS19 nucleotide Nucleus transcription excision repair regulator homolog (S. cerevisiae) MS4A1 MS4A1 membrane- Plasma other tositumomab, spanning 4- Membrane rituximab, domains, subfamily ofatumumab, A, member 1 veltuzumab, afutuzumab, ibritumomab tiuxetan MSH2 MSH2 mutS homolog 2, Nucleus enzyme colon cancer, nonpolyposis type 1 (E. coli) MSH6 MSH6 mutS homolog 6 Nucleus enzyme (E. coli) MSI2 MSI2 musashi homolog Cytoplasm other 2 (Drosophila) MSTO1 MSTO1 misato homolog 1 Cytoplasm other (Drosophila) MTHFD1 MTHFD1 methylenetetra- Cytoplasm enzyme hydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetra- hydrofolate cyclohydrolase, formyltetra- hydrofolate synthetase MTOR MTOR mechanistic target Nucleus kinase deforolimus, of rapamycin OSI-027, (serine/threonine NVP-BEZ235, kinase) temsirolimus, tacrolimus, everolimus MX1 MX1 myxovirus Nucleus enzyme (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) MYBBP1A MYBBP1A MYB binding Nucleus transcription protein (P160) 1a regulator MYCBP2 MYCBP2 MYC binding Nucleus enzyme protein 2 MYH9 MYH9 myosin, heavy Cytoplasm enzyme chain 9, non- muscle MYO9A MYO9A myosin IXA Cytoplasm enzyme NADKD1 NADKD1 NAD kinase Cytoplasm other domain containing 1 NASP NASP nuclear Nucleus other autoantigenic sperm protein (histone-binding) NAT10 NAT10 N- Nucleus enzyme acetyltransferase 10 (GCN5-related) NCAPD2 NCAPD2 non-SMC Nucleus other condensin I complex, subunit D2 NCAPG2 NCAPG2 non-SMC Nucleus other condensin II complex, subunit G2 NCBP1 NCBP1 nuclear cap Nucleus other binding protein subunit 1, 80 kDa NCKAP1L NCKAP1L NCK-associated Plasma other protein 1-like Membrane NCKIPSD NCKIPSD NCK interacting Nucleus other protein with SH3 domain NCL NCL nucleolin Nucleus other NCOR1 NCOR1 nuclear receptor Nucleus transcription corepressor 1 regulator NCOR2 NCOR2 nuclear receptor Nucleus transcription corepressor 2 regulator NDE1 NDE1 nudE nuclear Nucleus other (includes distribution gene E EG: 54820) homolog 1 (A. nidulans) NEDD4L NEDD4L neural precursor Cytoplasm enzyme cell expressed, developmentally down-regulated 4- like NEK9 NEK9 NIMA (never in Nucleus kinase mitosis gene a)- related kinase 9 NFKB1 NFKB1 nuclear factor of Nucleus transcription kappa light regulator polypeptide gene enhancer in B-cells 1 NFKB2 NFKB2 nuclear factor of Nucleus transcription kappa light regulator polypeptide gene enhancer in B-cells 2 (p49/p100) NFKBIB NFKBIB nuclear factor of Nucleus transcription kappa light regulator polypeptide gene enhancer in B-cells inhibitor, beta NFKBIE NFKBIE nuclear factor of Nucleus transcription kappa light regulator polypeptide gene enhancer in B-cells inhibitor, epsilon NISCH NISCH nischarin Plasma transmembrane Membrane receptor NOSIP NOSIP nitric oxide Cytoplasm other synthase interacting protein NPM1 NPM1 nucleophosmin Nucleus transcription (nucleolar regulator phosphoprotein B23, numatrin) NSDHL NSDHL NAD(P) dependent Cytoplasm enzyme steroid dehydrogenase- like NSFL1C NSFL1C NSFL1 (p97) Cytoplasm other cofactor (p47) NSUN2 NSUN2 NOP2/Sun domain Nucleus enzyme family, member 2 NUDT5 NUDT5 nudix (nucleoside Cytoplasm phosphatase diphosphate linked moiety X)-type motif 5 OAS2 OAS2 2′-5′- Cytoplasm enzyme oligoadenylate synthetase 2, 69/71 kDa OGDH OGDH oxoglutarate Cytoplasm enzyme (alpha- ketoglutarate) dehydrogenase (lipoamide) OPA1 OPA1 optic atrophy 1 Cytoplasm enzyme (autosomal dominant) OTUB1 OTUB1 OTU domain, unknown enzyme ubiquitin aldehyde binding 1 PA2G4 PA2G4 proliferation- Nucleus transcription associated 2G4, regulator 38 kDa PABPC1 PABPC1 poly(A) binding Cytoplasm translation protein, regulator cytoplasmic 1 PARN PARN poly(A)-specific Nucleus enzyme ribonuclease PARP9 PARP9 poly (ADP-ribose) Nucleus other polymerase family, member 9 PARVG PARVG parvin, gamma Cytoplasm other PCBP1 PCBP1 poly(rC) binding Nucleus translation protein 1 regulator PCBP2 PCBP2 poly(rC) binding Nucleus other protein 2 PCDHGB6 PCDHGB6 protocadherin unknown other gamma subfamily B, 6 PCID2 PCID2 PCI domain Nucleus transcription containing 2 regulator PCNA PCNA proliferating cell Nucleus enzyme nuclear antigen PDCD2L PDCD2L programmed cell unknown other death 2-like PDCD6IP PDCD6IP programmed cell Cytoplasm other death 6 interacting protein PDE4DIP PDE4DIP phosphodiesterase Cytoplasm enzyme 4D interacting protein PDHB PDHB pyruvate Cytoplasm enzyme dehydrogenase (lipoamide) beta PDIA6 PDIA6 protein disulfide Cytoplasm enzyme isomerase family A, member 6 PDK1 PDK1 pyruvate Cytoplasm kinase dehydrogenase kinase, isozyme 1 PDP1 PDP1 pyruvate Cytoplasm phosphatase dehyrogenase phosphatase catalytic subunit 1 PDPR PDPR pyruvate Cytoplasm enzyme dehydrogenase phosphatase regulatory subunit PHKB PHKB phosphorylase Cytoplasm kinase kinase, beta PI4KA PI4KA phosphatidylinositol Cytoplasm kinase 4-kinase, catalytic, alpha PIK3AP1 PIK3AP1 phosphoinositide- Cytoplasm other 3-kinase adaptor protein 1 PIK3C2B PIK3C2B phosphoinositide- Cytoplasm kinase 3-kinase, class 2, beta polypeptide PIK3C3 PIK3C3 phosphoinositide- Cytoplasm kinase 3-kinase, class 3 PIK3R4 PIK3R4 phosphoinositide- Cytoplasm other 3-kinase, regulatory subunit 4 PLAA PLAA phospholipase A2- Cytoplasm other activating protein PLBD2 PLBD2 phospholipase B Extracellular other domain containing 2 Space PLCG2 PLCG2 phospholipase C, Cytoplasm enzyme gamma 2 (phosphatidyl- inositol-specific) PM20D2 PM20D2 peptidase M20 unknown other domain containing 2 PMS1 PMS1 PMS1 postmeiotic Nucleus enzyme segregation increased 1 (S. cerevisiae) PMS2 PMS2 PMS2 postmeiotic Nucleus other segregation increased 2 (S. cerevisiae) PNP PNP purine nucleoside Nucleus enzyme forodesine, phosphorylase 9-deaza-9- (3-thienyl- methyl)guanine POLD1 POLD1 polymerase (DNA Nucleus enzyme nelarabine, directed), delta 1, MB07133, catalytic subunit clofarabine, 125 kDa cytarabine, trifluridine, vidarabine, entecavir POLR1C POLR1C polymerase (RNA) Nucleus enzyme I polypeptide C, 30 kDa POLR2A POLR2A polymerase (RNA) Nucleus enzyme II (DNA directed) polypeptide A, 220 kDa PPAT PPAT phosphoribosyl Cytoplasm enzyme 6-mercaptopurine, pyrophosphate thioguanine, amidotransferase azathioprine PPM1A PPM1A protein Cytoplasm phosphatase phosphatase, Mg2+/Mn2+ dependent, 1A PPP1CC PPP1CC protein Cytoplasm phosphatase phosphatase 1, catalytic subunit, gamma isozyme PPP2R1A PPP2R1A protein Cytoplasm phosphatase phosphatase 2, regulatory subunit A, alpha PPP3CA PPP3CA phosphatase 3, Cytoplasm phosphatase ISAtx-247, catalytic subunit, tacrolimus, alpha isozyme pimecrolimus, cyclosporin A PPP4C PPP4C protein Cytoplasm phosphatase phosphatase 4, catalytic subunit PPP5C PPP5C protein Nucleus phosphatase phosphatase 5, catalytic subunit PPP6C PPP6C protein Nucleus phosphatase phosphatase 6, catalytic subunit PRKAA1 PRKAA1 protein kinase, Cytoplasm kinase AMP-activated, alpha 1 catalytic subunit PRKAB1 PRKAB1 protein kinase, Nucleus kinase AMP-activated, beta 1 non- catalytic subunit PRKAB2 PRKAB2 protein kinase, Cytoplasm kinase AMP-activated, beta 2 non- catalytic subunit PRKAG1 PRKAG1 protein kinase, Nucleus kinase AMP-activated, gamma 1 non- catalytic subunit PRKCSH PRKCSH protein kinase C Cytoplasm enzyme substrate 80K-H PRKD2 PRKD2 protein kinase D2 Cytoplasm kinase PRKDC PRKDC protein kinase, Nucleus kinase DNA-activated, catalytic polypeptide PRMT1 PRMT1 protein arginine Nucleus enzyme methyltransferase 1 PRMT10 PRMT10 protein arginine unknown other methyltransferase 10 (putative) PRMT3 PRMT3 protein arginine Nucleus enzyme methyltransferase 3 PRMT5 PRMT5 protein arginine Cytoplasm enzyme methyltransferase 5 PSD4 PSD4 pleckstrin and Cytoplasm other Sec7 domain containing 4 PSMA1 PSMA1 proteasome Cytoplasm peptidase (prosome, macropain) subunit, alpha type, 1 PSMC1 PSMC1 proteasome Nucleus peptidase (prosome, macropain) 26S subunit, ATPase, 1 PSME1 PSME1 proteasome Cytoplasm other (prosome, macropain) activator subunit 1 (PA28 alpha) PTCD3 PTCD3 Pentatricopeptide Cytoplasm other repeat domain 3 PTGES2 PTGES2 prostaglandin E Cytoplasm transcription synthase 2 regulator PTK2 PTK2 PTK2 protein Cytoplasm kinase (includes tyrosine kinase 2 EG: 14083) PTK2B PTK2B PTK2B protein Cytoplasm kinase (includes tyrosine kinase 2 EG: 19229) beta PTPN1 PTPN1 protein tyrosine Cytoplasm phosphatase phosphatase, non- receptor type 1 PTPN6 PTPN6 protein tyrosine Cytoplasm phosphatase phosphatase, non- receptor type 6 PTPRJ PTPRJ protein tyrosine Plasma phosphatase phosphatase, Membrane receptor type, J PUF60 PUF60 poly-U binding Nucleus other splicing factor 60 KDa RAB3GAP1 RAB3GAP1 RAB3 GTPase Cytoplasm other activating protein subunit 1 (catalytic) RAB3GAP2 RAB3GAP2 RAB3 GTPase Cytoplasm enzyme activating protein subunit 2 (non- catalytic) RABGGTB RABGGTB Rab Cytoplasm enzyme geranylgeranyl- transferase, beta subunit RAD23B RAD23B RAD23 homolog B Nucleus other (S. cerevisiae) RAD51 RAD51 RAD51 homolog Nucleus enzyme (S. cerevisiae) RAE1 RAE1 RAE1 RNA export Nucleus other 1 homolog (S. pombe) RANBP2 RANBP2 RAN binding Nucleus enzyme protein 2 RAPGEF6 RAPGEF6 Rap guanine Plasma other nucleotide Membrane exchange factor (GEF) 6 RARS RARS arginyl-tRNA Cytoplasm enzyme synthetase RASSF2 RASSF2 Ras association Nucleus other (RalGDS/AF-6) domain family member 2 RBCK1 RBCK1 RanBP-type and Cytoplasm transcription C3HC4-type zinc regulator finger containing 1 RCOR1 RCOR1 REST corepressor 1 Nucleus transcription regulator REL REL v-rel Nucleus transcription reticuloendotheliosis regulator viral oncogene homolog (avian) RELA RELA v-rel Nucleus transcription NF-kappaB reticuloendotheliosis regulator decoy viral oncogene homolog A (avian) REM1 REM1 RAS (RAD and unknown enzyme GEM)-like GTP- binding 1 RG9MTD1 RG9MTD1 RNA (guanine-9-) Cytoplasm other methyltransferase domain containing 1 RNF138 RNF138 ring finger protein 138 unknown other RNF20 RNF20 ring finger protein 20 Nucleus enzyme RNF213 RNF213 ring finger protein 213 Plasma other Membrane RNF31 RNF31 ring finger protein 31 Cytoplasm enzyme RNMT RNMT RNA (guanine-7-) Nucleus enzyme methyltransferase RPA1 RPA1 replication protein Nucleus other A1, 70 kDa RPA2 RPA2 replication protein Nucleus other A2, 32 kDa RPS6 RPS6 ribosomal protein Cytoplasm other S6 RPS6KA3 RPS6KA3 ribosomal protein Cytoplasm kinase S6 kinase, 90 kDa, polypeptide 3 RTN4IP1 RTN4IP1 reticulon 4 Cytoplasm enzyme interacting protein 1 RUVBL1 RUVBL1 RuvB-like 1 Nucleus transcription (E. coli) regulator RUVBL2 RUVBL2 RuvB-like 2 Nucleus transcription (E. coli) regulator SAMHD1 SAMHD1 SAM domain and Nucleus enzyme HD domain 1 SCAF8 SCAF8 SR-related CTD- Nucleus other associated factor 8 SCFD1 SCFD1 sec1 family domain Cytoplasm transporter containing 1 SCPEP1 SCPEP1 serine Cytoplasm peptidase carboxypeptidase 1 SCYL1 SCYL1 SCY1-like 1 Cytoplasm kinase (S. cerevisiae) SEC23B SEC23B Sec23 homolog B Cytoplasm transporter (S. cerevisiae) SEC23IP SEC23IP SEC23 interacting Cytoplasm other protein SEPHS1 SEPHS1 selenophosphate unknown enzyme synthetase 1 SEPSECS SEPSECS Sep (O- Cytoplasm other phosphoserine) tRNA: Sec (selenocysteine) tRNA synthase SEPT2 SEPT2 septin 2 Cytoplasm enzyme SEPT9 SEPT9 septin 9 Cytoplasm enzyme SERBP1 SERBP1 SERPINE1 mRNA Nucleus other binding protein 1 SERPINB9 SERPINB9 serpin peptidase Cytoplasm other inhibitor, clade B (ovalbumin), member 9 SET SET SET nuclear Nucleus phosphatase oncogene SETD2 SETD2 SET domain Cytoplasm enzyme containing 2 SF3A1 SF3A1 splicing factor 3a, Nucleus other subunit 1, 120 kDa SFPQ SFPQ splicing factor Nucleus other proline/glutamine- rich SHARPIN SHARPIN SHANK-associated Plasma other RH domain Membrane interactor SIRT3 SIRT3 sirtuin 3 Cytoplasm enzyme SIRT5 SIRT5 sirtuin 5 Cytoplasm enzyme SLBP SLBP stem-loop binding Nucleus other protein SLC1A5 SLC1A5 solute carrier Plasma transporter family 1 (neutral Membrane amino acid transporter), member 5 SLC25A3 SLC25A3 solute carrier Cytoplasm transporter family 25 (mitochondrial carrier; phosphate carrier), member 3 SLC25A5 SLC25A5 solute carrier Cytoplasm transporter family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 SLC3A2 SLC3A2 solute carrier Plasma transporter family 3 (activators Membrane of dibasic and neutral amino acid transport), member 2 SMAD2 SMAD2 SMAD family Nucleus transcription member 2 regulator SMARCA4 SMARCA4 SWI/SNF related, Nucleus transcription matrix associated, regulator actin dependent regulator of chromatin, subfamily a, member 4 SMARCC2 SMARCC2 SWI/SNF related, Nucleus transcription matrix associated, regulator actin dependent regulator of chromatin, subfamily c, member 2 SMARCD2 SMARCD2 SWI/SNF related, Nucleus transcription matrix associated, regulator actin dependent regulator of chromatin, subfamily d, member 2 SMC1A SMC1A structural Nucleus transporter maintenance of chromosomes 1A SMC2 SMC2 structural Nucleus transporter maintenance of chromosomes 2 SMC3 SMC3 structural Nucleus other maintenance of chromosomes 3 SMC4 SMC4 structural Nucleus transporter maintenance of chromosomes 4 SMG1 SMG1 smg-1 homolog, Cytoplasm kinase phosphatidylinositol 3-kinase-related kinase (C. elegans) SMNDC1 SMNDC1 survival motor Nucleus other neuron domain containing 1 SNRNP200 SNRNP200 small nuclear Nucleus enzyme ribonucleoprotein 200 kDa (U5) SPG21 SPG21 spastic paraplegia Plasma enzyme 21 (autosomal Membrane recessive, Mast syndrome) SRPK1 SRPK1 SRSF protein Nucleus kinase kinase 1 SRR SRR serine racemase Cytoplasm enzyme SRSF7 SRSF7 serine/arginine-rich Nucleus other splicing factor 7 SSBP2 SSBP2 single-stranded Nucleus transcription DNA binding regulator protein 2 ST13 ST13 suppression of Cytoplasm other tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) STAT1 STAT1 signal transducer Nucleus transcription and activator of regulator transcription 1, 91 kDa STAT3 STAT3 signal transducer Nucleus transcription and activator of regulator transcription 3 (acute-phase response factor) STAT5B STAT5B signal transducer Nucleus transcription and activator of regulator transcription 5B STIP1 STIP1 stress-induced- Cytoplasm other phosphoprotein 1 STK4 STK4 serine/threonine Cytoplasm kinase kinase 4 STRAP STRAP serine/threonine Plasma other kinase receptor Membrane associated protein STUB1 STUB1 STIP1 homology Cytoplasm enzyme and U-box containing protein 1, E3 ubiquitin protein ligase STX12 STX12 syntaxin 12 Plasma other Membrane SYK SYK spleen tyrosine Cytoplasm kinase kinase SYMPK SYMPK symplekin Cytoplasm other SYNE1 SYNE1 spectrin repeat Nucleus other containing, nuclear envelope 1 SYNE2 SYNE2 spectrin repeat Nucleus other containing, nuclear envelope 2 TAB1 TAB1 TGF-beta activated Cytoplasm enzyme kinase 1/MAP3K7 binding protein 1 TACC3 TACC3 transforming, Nucleus other acidic coiled-coil containing protein 3 TARBP1 TARBP1 TAR (HIV-1) RNA Nucleus transcription binding protein 1 regulator TARDBP TARDBP TAR DNA binding Nucleus transcription protein regulator TBCD TBCD tubulin folding Cytoplasm other cofactor D TBK1 TBK1 TANK-binding Cytoplasm kinase kinase 1 TBL1XR1 TBL1XR1 transducin (beta)- Nucleus transcription like 1 X-linked regulator receptor 1 TBL3 TBL3 transducin (beta)- Cytoplasm peptidase like 3 TBRG4 TBRG4 transforming Cytoplasm other growth factor beta regulator 4 TFIP11 TFIP11 tuftelin interacting Extracellular other protein 11 Space TH1L TH1L TH1-like Nucleus other (Drosophila) THG1L THG1L tRNA-histidine Cytoplasm enzyme guanylyltransferase 1-like (S. cerevisiae) THOC2 THOC2 THO complex 2 Nucleus other THUMPD1 THUMPD1 THUMP domain unknown other containing 1 THUMPD3 THUMPD3 THUMP domain unknown other containing 3 TIMM50 TIMM50 translocase of Cytoplasm phosphatase inner mitochondrial membrane 50 homolog (S. cerevisiae) TIPRL TIPRL TIP41, TOR unknown other signaling pathway regulator-like (S. cerevisiae) TKT TKT transketolase Cytoplasm enzyme TLE3 TLE3 transducin-like Nucleus other enhancer of split 3 (E(sp1) homolog, Drosophila) TLN1 TLN1 talin 1 Plasma other Membrane TOE1 TOE1 target of EGR1, Nucleus other member 1 (nuclear) TOMM34 TOMM34 translocase of Cytoplasm other outer mitochondrial membrane 34 TP53RK TP53RK TP53 regulating Nucleus kinase kinase TPP1 TPP1 tripeptidyl Cytoplasm peptidase (includes peptidase I EG: 1200) TPP2 TPP2 tripeptidyl Cytoplasm peptidase peptidase II TRAP1 TRAP1 TNF receptor- Cytoplasm enzyme associated protein 1 TRIM25 TRIM25 tripartite motif Cytoplasm transcription containing 25 regulator TRIM28 TRIM28 tripartite motif Nucleus transcription containing 28 regulator TRIO TRIO triple functional Plasma kinase domain (PTPRF Membrane interacting) TROVE2 TROVE2 TROVE domain Nucleus other family, member 2 TTC1 TTC1 tetratricopeptide unknown other repeat domain 1 TTC19 TTC19 tetratricopeptide Cytoplasm other repeat domain 19 TTC37 TTC37 tetratricopeptide unknown other repeat domain 37 TTC5 TTC5 tetratricopeptide unknown other repeat domain 5 TTN TTN titin Cytoplasm kinase (includes EG: 22138) TUT1 TUT1 terminal uridylyl Nucleus enzyme transferase 1, U6 snRNA-specific UBA1 UBA1 ubiquitin-like Cytoplasm enzyme modifier activating enzyme 1 UBAC1 UBAC1 UBA domain Nucleus other containing 1 UBAP2 UBAP2 ubiquitin Cytoplasm other associated protein 2 UBAP2L UBAP2L ubiquitin unknown other associated protein 2-like UBE2O UBE2O ubiquitin- unknown enzyme conjugating enzyme E2O UBE3A UBE3A ubiquitin protein Nucleus enzyme ligase E3A UBQLN1 UBQLN1 ubiquilin 1 Cytoplasm other UBR1 UBR1 ubiquitin protein Cytoplasm enzyme (includes ligase E3 EG: 197131) component n- recognin 1 UBR4 UBR4 ubiquitin protein Nucleus other ligase E3 component n- recognin 4 UBR5 UBR5 ubiquitin protein Nucleus enzyme ligase E3 component n- recognin 5 UBXN1 UBXN1 UBX domain Cytoplasm other protein 1 UCHL5 UCHL5 ubiquitin carboxyl- Cytoplasm peptidase terminal hydrolase L5 UCK2 UCK2 uridine-cytidine Cytoplasm kinase kinase 2 UFD1L UFD1L ubiquitin fusion Cytoplasm peptidase degradation 1 like (yeast) UHRF1BP1 UHRF1BP1 UHRF1 binding unknown other protein 1 UPF1 UPF1 UPF1 regulator of Nucleus enzyme nonsense transcripts homolog (yeast) USO1 USO1 USO1 vesicle Cytoplasm transporter docking protein homolog (yeast) USP11 USP11 ubiquitin specific Nucleus peptidase peptidase 11 USP13 USP13 ubiquitin specific unknown peptidase peptidase 13 (isopeptidase T-3) USP15 USP15 ubiquitin specific Cytoplasm peptidase peptidase 15 USP24 USP24 ubiquitin specific unknown peptidase peptidase 24 USP25 USP25 ubiquitin specific unknown peptidase peptidase 25 USP28 USP28 ubiquitin specific Nucleus peptidase peptidase 28 USP34 USP34 ubiquitin specific unknown peptidase peptidase 34 USP47 USP47 ubiquitin specific Cytoplasm peptidase peptidase 47 USP5 USP5 ubiquitin specific Cytoplasm peptidase peptidase 5 (isopeptidase T) USP7 USP7 ubiquitin specific Nucleus peptidase peptidase 7 (herpes virus- associated) USP9X USP9X ubiquitin specific Plasma peptidase peptidase 9, X- Membrane linked VAV1 VAV1 vav 1 guanine Nucleus transcription nucleotide regulator exchange factor VCP VCP valosin containing Cytoplasm enzyme protein VDAC1 VDAC1 voltage-dependent Cytoplasm ion channel anion channel 1 VPRBP VPRBP Vpr (HIV-1) binding Nucleus other protein WBP2 WBP2 WW domain Cytoplasm other binding protein 2 WDFY4 WDFY4 WDFY family unknown other member 4 WDR11 WDR11 WD repeat domain 11 unknown other WDR5 WDR5 WD repeat domain 5 Nucleus other WDR6 WDR6 WD repeat domain 6 Cytoplasm other WDR61 WDR61 WD repeat domain 61 unknown other WDR82 WDR82 WD repeat domain 82 Nucleus other WDR92 WDR92 WD repeat domain 92 unknown other YWHAB YWHAB tyrosine 3- Cytoplasm transcription monooxygenase/ regulator tryptophan 5- monooxygenase activation protein, beta polypeptide YWHAE YWHAE tyrosine 3- Cytoplasm other monooxygenase/ tryptophan 5- monooxygenase activation protein, epsilon polypeptide YWHAG YWHAG tyrosine 3- Cytoplasm other monooxygenase/ tryptophan 5- monooxygenase activation protein, gamma polypeptide YWHAH YWHAH tyrosine 3- Cytoplasm transcription monooxygenase/ regulator tryptophan 5- monooxygenase activation protein, eta polypeptide YWHAQ YWHAQ tyrosine 3- Cytoplasm other monooxygenase/ tryptophan 5- monooxygenase activation protein, theta polypeptide YWHAZ YWHAZ tyrosine 3- Cytoplasm enzyme monooxygenase/ tryptophan 5- monooxygenase activation protein, zeta polypeptide ZC3H11A ZC3H11A zinc finger CCCH- unknown other type containing 11A ZC3H18 ZC3H18 zinc finger CCCH- Nucleus other type containing 18 ZC3H4 ZC3H4 zinc finger CCCH- unknown other type containing 4 ZFR ZFR zinc finger RNA Nucleus other binding protein ZFYVE26 ZFYVE26 zinc finger, FYVE Cytoplasm other domain containing 26 ZNF259 ZNF259 zinc finger protein Nucleus other 259
B Cell Receptor Signaling
[0222] Signals propagated through the B cell antigen receptor (BCR) are crucial to the development, survival and activation of B lymphocytes. These signals also play a central role in the removal of potentially self-reactive B lymphocytes. The BCR is composed of surface-bound antigen recognizing membrane antibody and associated Ig-α and Ig-β heterodimers which are capable of signal transduction via cytosolic motifs called immunoreceptor tyrosine based activation motifs (ITAM). The recognition of polyvalent antigens by the B cell antigen receptor (BCR) initiates a series of interlinked signaling events that culminate in cellular responses. The engagement of the BCR induces the phosphorylation of tyrosine residues in the ITAM. The phosphorylation of ITAM is mediated by SYK kinase and the SRC family of kinases which include LYN, FYN and BLK. These kinases which are reciprocally activated by phosphorylated ITAMs in turn trigger a cascade of interlinked signaling pathways. Activation of the BCR leads to the stimulation of nuclear factor kappa B (NFκB). Central to BCR signaling via NF-kB is the complex formed by the Bruton's tyrosine kinase (BTK), the adaptor B-cell linker (BLNK) and phospholipase C gamma 2 (PLCγ2). Tyrosine phosphorylated adaptor proteins act as bridges between BCR associated tyrosine kinases and downstream effector molecules. BLNK is phosphorylated on BCR activation and serves to couple the tyrosine kinase SYK to the activation of PLCγ2. The complete stimulation of PLCγ2 is facilitated by BTK. Stimulated PLCγ2 triggers the DAG and Ca2+ mediated activation of Protein kinase (PKC) which in turn activates IkB kinase (IKK) and thereafter NFκB. In addition to the activation of NFκB, BLNK also interacts with other proteins like VAV and GRB2 resulting in the activation of the mitogen activated protein kinase (MAPK) pathway. This results in the transactivation of several factors like c-JUN, activation of transcription factor (ATF) and ELK6. Another adaptor protein, B cell adaptor for phosphoinositide 3-kinase (PI3K), termed BCAP once activated by SYK, goes on to trigger a PI3K/AKT signaling pathway. This pathway inhibits Glycogen synthase kinase 3 (GSK3), resulting in the nuclear accumulation of transcription factors like nuclear factor of activated T cells (NFAT) and enhancement of protein synthesis. Activation of PI3K/AKT pathway also leads to the inhibition of apoptosis in B cells. This pathway highlights the important components of B cell receptor antigen signaling.
[0223] This pathway is composed of, but not restricted to 1-phosphatidyl-D-myo-inositol 4,5-bisphosphate, ABL1, Akt, ATF2, BAD, BCL10, Bcl10-Card10-Malt1, BCL2A1, BCL2L1, BCL6, BLNK, BTK, Calmodulin, CaMKII, CARD10, CD19, CD22, CD79A, CD79B, Creb, CSK, DAPP1, EGR1, ELK1, ERK1/2, ETS1, Fcgr2, GAB1/2, GRB2, Gsk3, Ikb, IkB-NfkB, IKK (complex), JINK1/2, Jnkk, JUN, LYN, MALT1, MAP2K1/2, MAP3K, MKK3/4/6, MTOR, NFAT (complex), NFkB (complex), P38 MAPK, p70 S6k, PAG1, phosphatidylinositol-3,4,5-triphosphate, PI3K (complex), PIK3AP1, PKC(β,θ), PLCG2, POU2F2, Pp2b, PTEN, PTPN11, PTPN6, PTPRC, Rac/Cdc42, RAFT, Ras, SHC1 (includes EG:20416), SHIP, Sos, SYK, VAV
PKCteta Pathway
[0224] An effective immune response depends on the ability of specialized leukocytes to identify foreign molecules and respond by differentiation into mature effector cells. A cell surface antigen recognition apparatus and a complex intracellular receptor-coupled signal transducing machinery mediate this tightly regulated process which operates at high fidelity to discriminate self antigens from non-self antigens. Activation of T cells requires sustained physical interaction of the TCR with an MHC-presented peptide antigen that results in a temporal and spatial reorganization of multiple cellular elements at the T-Cell-APC contact region, a specialized region referred to as the immunological synapse or supramolecular activation cluster. Recent studies have identified PKCθ, a member of the Ca-independent PKC family, as an essential component of the T-Cell supramolecular activation cluster that mediates several crucial functions in TCR signaling leading to cell activation, differentiation, and survival through IL-2 gene induction. High levels of PKCθ are expressed in skeletal muscle and lymphoid tissues, predominantly in the thymus and lymph nodes, with lower levels in spleen. T cells constitute the primary location for PKCθ expression. Among T cells, CD4+/CD8+ single positive peripheral blood T cells and CD4+/CD8+ double positive thymocytes are found to express high levels of PKCθ. On the surface of T cells, TCR/CD3 engagement induces activation of Src, Syk, ZAP70 and Tec-family PTKs leading to stimulation and membrane recruitment of PLCγ1, PI3K and Vav. A Vav mediated pathway, which depends on Rac and actin cytoskeleton reorganization as well as on PI3K, is responsible for the selective recruitment of PKCθ to the supramolecular activation cluster. PLCγ1-generated DAG also plays a role in the initial recruitment of PKCθ. The transcription factors NF-κB and AP-1 are the primary physiological targets of PKCθ. Efficient activation of these transcription factors by PKCθ requires integration of TCR and CD28 co-stimulatory signals. CD28 with its CD80/CD86 (B7-1/B7-2) ligands on APCs is required for the recruitment of PKCθ specifically to the supramolecular activation cluster. The transcriptional element which serves as a target for TCR/CD28 costimulation is CD28RE in the IL-2 promoter. CD28RE is a combinatorial binding site for NF-κB and AP-1. Recent studies suggest that regulation of TCR coupling to NF-κB by PKCθ is affected through a variety of distinct mechanisms. PKCθ may directly associate with and regulate the IKK complex; PKCθ may regulate the IKK complex indirectly though CaMKII; It may act upstream of a newly described pathway involving BCL10 and MALT1, which together regulate NF-κB and IκB via the IKK complex. PKCθ has been found to promote Activation-induced T cell death (AICD), an important process that limits the expansion of activated antigen-specific T cells and ensures termination of an immune response once the specific pathogen has been cleared. Enzymatically active PKCθ selectively synergizes with calcineurin to activate a caspase 8-mediated Fas/FasL-dependent AICD. CD28 co-stimulation plays an essential role in TCR-mediated IL-2 production, and in its absence the T cell enters a stable state of unresponsiveness termed anergy. PKCθ-mediated CREB phosphorylation and its subsequent binding to a cAMP-response element in the IL-2 promoter negatively regulates IL-2 transcription thereby driving the responding T cells into an anergic state. The selective expression of PKCθ in T-Cells and its essential role in mature T cell activation establish it as an attractive drug target for immunosuppression in transplantation and autoimmune diseases.
[0225] This pathway is composed of, but not restricted to Ap1, BCL10, Bcl10-Card11-Malt1, Calcineurin protein(s), CaMKII, CARD11, CD28, CD3, CD3-TCR, CD4, CD80 (includes EG:12519), CD86, diacylglycerol, ERK1/2, FOS, FYN, GRAP2, GRB2, Ikb, IkB-NfkB, Ikk (family), IL2, inositol triphosphate, JUN, LAT, LCK, LCP2, MALT1, MAP2K4, MAP3K, MAPK8, MHC Class II (complex), Nfat (family), NFkB (complex), phorbol myristate acetate, PI3K (complex), PLC gamma, POU2F1, PRKCQ, Rac, Ras, Sos, TCR, VAV, voltage-gated calcium channel, ZAP70
CD40 Signaling
[0226] CD40 is a member of the tumor necrosis factor superfamily of cell surface receptors that transmits survival signals to B cells. Upon ligand binding, canonical signaling evoked by cell-surface CD40 follows a multistep cascade requiring cytoplasmic adaptors (called TNF-receptor-associated factors [TRAFs], which are recruited by CD40 in the lipid rafts) and the IKK complex. Through NF-κB activation, the CD40 signalosome activates transcription of multiple genes involved in B-cell growth and survival. Because the CD40 signalosome is active in aggressive lymphoma and contributes to tumor growth, immunotherapeutic strategies directed against CD40 are being designed and currently tested in clinical trials [Bayes 2007 and Fanale 2007).
[0227] CD40-mediated signal transduction induces the transcription of a large number of genes implicated in host defense against pathogens. This is accomplished by the activation of multiple pathways including NF-κB, MAPK and STAT3 which regulate gene expression through activation of c-Jun, ATF2 and Rel transcription factors. Receptor clustering of CD40L is mediated by an association of the ligand with p53, a translocation of ASM to the plasma membrane, activation of ASM, and formation of ceramide. Ceramide serves to cluster CD40L and several TRAF proteins (including TRAF1, TRAF2, TRAF3, TRAF5, and TRAF6) with CD40. TRAF2, TRAF3 and TRAF6 bind to CD40 directly. TRAF1 does not directly bind CD40 but is recruited to membrane micro domains through heterodimerization with TRAF2. Analogous to the recruitment of TRAF1, TRAF5 is also indirectly recruited to CD40 in a TRAF3-dependent manner. Act1 links TRAF proteins to TAK1/IKK to activate NF-κB/I-κB, and MKK complex to activate JNK, p38 MAPK and ERK1/2. NIK also plays a leading role in activating IKK. Act1-dependent CD40-mediated NF-κB activation protects cells from CD40L-induced apoptosis. On stimulation with CD40L or other inflammatory mediators, I-κB proteins are phosphorylated by IKK and NF-κB is activated through the Act1-TAK1 pathway. Phosphorylated I-κB is then rapidly ubiquitinated and degraded. The liberated NF-κB translocates to the nucleus and activates transcription. A20, which is induced by TNF inhibits NF-κB activation as well as TNF-mediated apoptosis. TRAF3 initiates signaling pathways that lead to the activation of p38 and JNK but inhibits Act1-dependent CD40-mediated NF-κB activation and initiates CD40L-induced apoptosis. TRAF2 is required for activation of SAPK pathways and also plays a role in CD40-mediated surface upregulation, IgM secretion in B-Cells and up-regulation of ICAM1. CD40 ligation by CD40L stimulates MCP1 and IL-8 production in primary cultures of human proximal tubule cells, and this occurs primarily via recruitment of TRAF6 and activation of the ERK1/2, SAPK/JNK and p38 MAPK pathways. Activation of SAPK/JNK and p38 MAPK pathways is mediated via TRAF6 whereas ERK1/2 activity is potentially mediated via other TRAF members. However, stimulation of all three MAPK pathways is required for MCP1 and IL-8 production. Other pathways activated by CD40 stimulation include the JAK3-STAT3 and PI3K-Akt pathways, which contribute to the anti-apoptotic properties conferred by CD40L to B-Cells. CD40 directly binds to JAK3 and mediates STAT3 activation followed by up-regulation of ICAM1, CD23, and LT-α.
[0228] This pathway is composed of, but not restricted to Act1, Ap1, ATF1 (includes EG:100040260), CD40, CD40LG, ERK1/2, FCER2, I kappa b kinase, ICAM1, Ikb, IkB-NfkB, JAK3, Jnk, LTA, MAP3K14, MAP3K7 (includes EG:172842), MAPKAPK2, Mek, NFkB (complex), P38 MAPK, PI3K (complex), STAT3, Stat3-Stat3, TANK, TNFAIP3, TRAF1, TRAF2, TRAF3, TRAF5, TRAF6
CD28 Signaling Pathway
[0229] CD28 is a co-receptor for the TCR/CD3 and is a major positive co-stimulatory molecule. Upon ligation with CD80 and CD86, CTLA4 provides a negative co-stimulatory signal for the termination of activation. Further binding of CD28 to Class-I regulatory PI3K recruits PI3K to the membrane, resulting in generation of PIP3 and recruitment of proteins that contain a pleckstrin-homology domain to the plasma membrane, such as PIK3C3. PI3K is required for activation of Akt, which in turn regulates many downstream targets that to promote cell survival. In addition to NFAT, NF-κB has a crucial role in the regulation of transcription of the IL-2 promoter and anti-apoptotic factors. For this, PLC-γ utilizes PIP2 as a substrate to generate IP3 and DAG. IP3 elicits release of Ca2+ via IP3R, and DAG activates PKC-θ. Under the influence of RLK, PLC-γ, and Ca2+; PKC-θ regulates the phosphorylation state of IKK complex through direct as well as indirect interactions. Moreover, activation of CARMA1 phosphorylates BCL10 and dimerizes MALT1, an event that is sufficient for the activation of IKKs. The two CD28-responsive elements in the IL-2 promoter have NF-κB binding sites. NF-κB dimers are normally retained in cytoplasm by binding to inhibitory I-κBs. Phosphorylation of I-κBs initiates its ubiquitination and degradation, thereby freeing NF-κB to translocate to the nucleus. Likewise, translocation of NFAT to the nucleus as a result of calmodulin-calcineurin interaction effectively promotes IL-2 expression. Activation of Vav1 by TCR-CD28-PI3K signaling connects CD28 with the activation of Rac and CDC42, and this enhances TCR-CD3-CD28 mediated cytoskeletal re-organization. Rac regulates actin polymerization to drive lamellipodial protrusion and membrane ruffling, whereas CDC42 generates polarity and induces formation of filopodia and microspikes. CDC42 and Rac GTPases function sequentially to activate downstream effectors like WASP and PAK1 to induce activation of ARPs resulting in cytoskeletal rearrangements. CD28 impinges on the Rac/PAK1-mediated IL-2 transcription through subsequent activation of MEKK1, MKKs and JNKs. JNKs phosphorylate and activate c-Jun and c-Fos, which is essential for transcription of IL-2. Signaling through CD28 promotes cytokine IL-2 mRNA production and entry into the cell cycle, T-cell survival, T-Helper cell differentiation and Immunoglobulin isotype switching.
[0230] This pathway is composed of, but not restricted to 1,4,5-IP3, 1-phosphatidyl-D-myo-inositol 4,5-bisphosphate, Akt, Ap1, Arp2/3, BCL10, Ca2+, Calcineurin protein(s), Calmodulin, CARD11, CD28, CD3, CD3-TCR, CD4, CD80 (includes EG:12519), CD86, CDC42, CSK, CTLA4, diacylglycerol, FOS, FYN, GRAP2, GRB2, Ikb, IkB-NfkB, IKK (complex), IL2, ITK, ITPR, Jnk, JUN, LAT, LCK, LCP2, MALT1, MAP2K1/2, MAP3K1, MHC Class II (complex), Nfat (family), NFkB (complex), PAK1, PDPK1, phosphatidylinositol-3,4,5-triphosphate, PI3K (complex), PLCG1, PRKCQ, PTPRC, RAC1, SHP, SYK, TCR, VAV1, WAS, ZAP70
ERK-MAPK Pathway
[0231] The ERK (extracellular-regulated kinase)/MAPK (mitogen activated protein kinase) pathway is a key pathway that transduces cellular information on meiosis/mitosis, growth, differentiation and carcinogenesis within a cell. Membrane bound receptor tyrosine kinases (RTK), which are often growth factor receptors, are the starting point for this pathway. Binding of ligand to RTK activates the intrinsic tyrosine kinase activity of RTK. Adaptor molecules like growth factor receptor bound protein 2 (GRB2), son of sevenless (SOS) and Shc form a signaling complex on tyrosine phosphorylated RTK and activate Ras. Activated Ras initiates a kinase cascade, beginning with Raf (a MAPK kinase kinase) which activates and phosphorylates MEK (a MAPK kinase); MEK activates and phosphorylates ERK (a MAPK). ERK in the cytoplasm can phosphorylate a variety of targets which include cytoskeleton proteins, ion channels/receptors and translation regulators. ERK is also translocated across into the nucleus where it induces gene transcription by interacting with transcriptional regulators like ELK-1, STAT-1 and -3, ETS and MYC. ERK activation of p90RSK in the cytoplasm leads to its nuclear translocation where it indirectly induces gene transcription through interaction with transcriptional regulators, CREB, c-Fos and SRF. RTK activation of Ras and Raf sometimes takes alternate pathways. For example, integrins activate ERK via a FAK mediated pathway. ERK can also be activated by a CAS-CRK-Rap1 mediated activation of B-Raf and a PLCγ-PKC-Ras-Raf activation of ERK.
[0232] This pathway is be composed of, but not restricted to 1,4,5-IP3, 1-phosphatidyl-D-myo-inositol 4,5-bisphosphate, 14-3-3(β,γ,θ,η,ζ), 14-3-3(η,θ,ζ), ARAF, ATF1 (includes EG:100040260), BAD, BCAR1, BRAF, c-Myc/N-Myc, cAMP-Gef, CAS-Crk-DOCK 180, Cpla2, Creb, CRK/CRKL, cyclic AMP, diacylglycerol, DOCK1, DUSP2, EIF4E, EIF4EBP1, ELK1, ERK1/2, Erk1/2 dimer, ESR1, ETS, FOS, FYN, GRB2, Histone h3, Hsp27, Integrin, KSR1, LAMTOR3, MAP2K1/2, MAPKAPK5, MKP1/2/3/4, MNK1/2, MOS, MSK1/2, NFATC1, Pak, PI3K (complex), Pka, PKC (α,β,γ,δ,ε,.Math.), PLC gamma, PP1/PP2A, PPARG, PTK2 (includes EG:14083), PTK2B (includes EG:19229), PXN, Rac, RAFT, Rap1, RAPGEF1, Ras, RPS6KA1 (includes EG:20111), SHC1 (includes EG:20416), Sos, SRC, SRF, Stat1/3, Talin, VRK2
[0233] Based on the findings by the method described here in the DLBCL OCI-LY1, combination of an inhibitor of components of these pathways, such as those targeting but not limited to SYK, BTK, mTOR, PI3K, Ikk, CD40, MEK, Raf, JAK, the MHC complex components, CD80, CD3 are proposed to be efficacious when used in combination with an Hsp90 inhibitor.
[0234] Examples of BTK inhibitors are PCI-32765
[0235] Examples of SYK inhibitors are R-406, 8406, R935788 (Fostamatinib disodium)
[0236] Examples of CD40 inhibitors are SGN-40 (anti-huCD40 mAb)
[0237] Examples of inhibitors of the CD28 pathway are abatacept, belatacept, blinatumomab, muromonab-CD3, visilizumab.
[0238] Example of inhibitors of major histocompatibility complex, class II are apolizumab
[0239] Example of PI3K inhibitors are 2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine, BKM120, NVP-BEZ235, PX-866, SF 1126, XL147.
[0240] Example of mTOR inhibitors are deforolimus, everolimus, NVP-BEZ235, OSI-027, tacrolimus, temsirolimus, Ku-0063794, WYE-354, PP242, OSI-027, GSK2126458, WAY-600, WYE-125132
[0241] Examples of JAK inhibitors are Tofacitinib citrate (CP-690550), AT9283, AG-490, INCB018424 (Ruxolitinib), AZD1480, LY2784544, NVP-BSK805, TG101209, TG-101348
[0242] Examples of 1kK inhibitors are SC-514, PF 184
[0243] Example of inhibitors of Raf are sorafenib, vemurafenib, GDC-0879, PLX-4720, PLX4032 (Vemurafenib), NVP-BHG712, SB590885, AZ628, ZM 336372
[0244] Example of inhibitors of SRC are AZM-475271, dasatinib, saracatinib
[0245] In the MiaPaCa2 pancreatic cancer cell line major signaling networks identified by the method were the PI3K/AKT, KIEL cell cycle-G2/M DNA damage checkpoint regulation, ERK/MAPK and the PKA signaling pathways (
[0246] Interactions between the several network component proteins are exemplified in
[0247] Pancreatic adenocarcinoma continues to be one of the most lethal cancers, representing the fourth leading cause of cancer deaths in the United States. More than 80% of patients present with advanced disease at diagnosis and therefore, are not candidates for potentially curative surgical resection. Gemcitabine-based chemotherapy remains the main treatment of locally advanced or metastatic pancreatic adenocarcinoma since a pivotal Phase III trial in 1997. Although treatment with gemcitabine does achieve significant symptom control in patients with advanced pancreatic cancer, its response rates still remain low and is associated with a median survival of approximately 6 months. These results reflect the inadequacy of existing treatment strategies for this tumor type, and a concerted effort is required to develop new and more effective therapies for patients with a pancreatic cancer.
[0248] A current review of Pub Med. literature, clinical trial database (clinicaltrials.gov), American Society of Clinical Oncology (ASCO) and American Association of Cancer Research (AACR) websites, concluded that the molecular pathogenesis of a pancreatic cancer involves multiple pathways and defined mutations, suggesting this complexity as a major reason for failure of targeted therapy in this disease. Faced with a complex mechanism of activating oncogenic pathways that regulate cellular proliferation, survival and metastasis, therapies that target a single activating molecule cannot thus, overpower the multitude of aberrant cellular processes, and may be of limited therapeutic benefit in advanced disease.
[0249] Based on the findings by the method described here in MiaPaCa2 cells, combination of an inhibitor of components of these identified pathways, such as those targeting but not limited to AKT, mTOR, PI3K, JAK, STAT3, IKK, Bcl2, PKA complex, phosphodiesterases, ERK, Raf, JNK are proposed to be efficacious when used in combination with an Hsp90 inhibitor.
[0250] Example of AKT inhibitors are PF-04691502, Triciribine phosphate (NSC-280594), A-674563, CCT128930, AT7867, PHT-427, GSK690693, MK-2206 dihydrochloride
[0251] Example of PI3K inhibitors are 2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine, BKM120, NVP-BEZ235, PX-866, SF 1126, XL147.
[0252] Example of mTOR inhibitors are deforolimus, everolimus, NVP-BEZ235, OSI-027, tacrolimus, temsirolimus, Ku-0063794, WYE-354, PP242, OSI-027, GSK2126458, WAY-600, WYE-125132
[0253] Examples of Bcl2 inhibitors are ABT-737, Obatoclax (GX15-070), ABT-263, TW-37
[0254] Examples of JAK inhibitors are Tofacitinib citrate (CP-690550), AT9283, AG-490, INCB018424 (Ruxolitinib), AZD1480, LY2784544, NVP-BSK805, TG101209, TG-101348
[0255] Examples of IkK inhibitors are SC-514, PF 184
[0256] Examples of inhibitors of phosphodiesterases are aminophylline, anagrelide, arofylline, caffeine, cilomilast, dipyridamole, dyphylline, L 869298, L-826,141, milrinonc, nitroglycerin, pentoxifylline, roflumilast, rolipram, tetomilast, theophylline, tolbutamide, amrinone, anagrelide, arofylline, caffeine, cilomilast, L 869298, L-826,141, milrinone, pentoxifylline, roflumilast, rolipram, tetomilast
[0257] Indeed, inhibitors of mTOR, which is identified by our method to potentially contribute to the transformation of MiaPaCa2 cells (
[0258] Quantitative analysis of synergy between mTOR and Hsp90 inhibitors: To determine the drug interaction between pp242 (mTOR inhibitor) and PU-H71 (Hsp90 inhibitor), the combination index (CI) isobologram method of Chou-Talalay was used as previously described. This method, based on the median-effect principle of the law of mass action, quantifies synergism or antagonism for two or more drug combinations, regardless of the mechanisms of each drug, by computerized simulation. Based on algorithms, the computer software displays median-effect plots, combination index plots and normalized isobolograms (where non constant ratio combinations of 2 drugs are used). PU-H71 (0.5, 0.25, 0.125, 0.0625, 0.03125, 0.0125 μM) and pp242 (0.5, 0.125, 0.03125, 0.0008, 0.002, 0.001 μM) were used as single agents in the concentrations mentioned or combined in a non constant ratio (PU-H71:pp242; 1:1, 1:2, 1:4, 1:7.8, 1:15.6, 1:12.5). The Fa (fraction killed cells) was calculated using the formulae Fa=1-Fu; Fu is the fraction of unaffected cells and was used for a dose effect analysis using the computer software (CompuSyn, Paramus, N.J., USA).
[0259] In a similar fashion, inhibitors of the PI3K-AKT-mTOR pathway which is identified by our method to contribute to the transformation of MDA-MB-468 cells, are more efficacious in the MDA-MB-468 breast cancer cells when combined with the Hsp90 inhibitor.
Cell Cycle: G2/M DNA Damage Checkpoint Regulation
[0260] G2/M checkpoint is the second checkpoint within the cell cycle. This checkpoint prevents cells with damaged DNA from entering the M phase, while also pausing so that DNA repair can occur. This regulation is important to maintain genomic stability and prevent cells from undergoing malignant transformation. Ataxia telangiectasia mutated (ATM) and ataxia telangiectasia mutated and rad3 related (ATR) are key kinases that respond to DNA damage. ATR responds to UV damage, while ATM responds to DNA double-strand breaks (DSB). ATM and ATR activate kinases Chk1 and Chk2 which in turn inhibit Cdc25, the phosphatase that normally activates Cdc2. Cdc2, a cyclin-dependent kinase, is a key molecule that is required for entry into M phase. It requires binding to cyclin B1 for its activity. The tumor suppressor gene p53 is an important molecule in G2/M checkpoint regulation. ATM, ATR and Chk2 contribute to the activation of p53. Further, p19Arf functions mechanistically to prevent MDM2's neutralization of p53. Mdm4 is a transcriptional inhibitor of p53. DNA damage-induced phosphorylation of Mdm4 activates p53 by targeting Mdm4 for degradation. Well known p53 target genes like Gadd45 and p21 are involved in inhibiting Cdc2. Another p53 target gene, 14-3-3σ, binds to the Cdc2-cyclin B complex rendering it inactive. Repression of the cyclin B1 gene by p53 also contributes to blocking entry into mitosis. In this way, numerous checks are enforced before a cell is allowed to enter the M phase.
[0261] This pathway is composed of, but not limited to 14-3-3, 14-3-3 (β,ε,ζ), 14-3-3-Cdc25, ATM, ATM/ATR, BRCA1, Cdc2-CyclinB, Cdc2-CyclinB-Sfn, Cdc25B/C, CDK1, CDK7, CDKN1A, CDKN2A, Cdkn2a-Mdm2, CHEK1, CHEK2, CKS1B, CKS2, Cyclin B, EP300, Ep300/Pcaf, GADD45A, KAT2B, MDM2, Mdm2-Tp53-Mdm4, MDM4, PKMYT1, PLK1, PRKDC, RPRM, RPS6KA1 (includes EG:20111), Scf, SFN, Top2, TP53 (includes EG:22059), WEE1
[0262] Based on the findings by the method described here, combination of an inhibitor of components of this pathway, such as those targeting CDK1, CDK7, CHEK1, PLK1 and TOP2A(B) are proposed to be efficacious when used in combination with an Hsp90 inhibitor.
[0263] Examples of inhibitors are AQ4N, becatecarin, BN 80927, CPI-0004Na, daunorubicin, dexrazoxane, doxorubicin, elsamitrucin, epirubicin, etoposide, gatifloxacin, gemifloxacin, mitoxantrone, nalidixic acid, nemorubicin, norfloxacin, novobiocin, pixantrone, tafluposide, TAS-103, tirapazamine, valrubicin, XK469, BI2536
[0264] PU-beads also identify proteins of the DNA damage, replication and repair, homologous recombination and cellular response to ionizing radiation as Hsp90-regulated pathways in select CML, pancreatic cancer and breast cancer cells. PU-H71 synergized with agents that act on these pathways.
[0265] Specifically, among the Hsp90-regulated pathways identified in the K562 CML cells, MDA-MB-468 breast cancer cells and the Mia-PaCa-2 pancreatic cancer cells are several involved in DNA damage, replication and repair response and/or homologous recombination (Tables 3, 5a-5f). Hsp90 inhibition may synergize or be additive with agents that act on DNA damage and/or homologous recombination (i.e. potentiate DNA damage sustained post treatment with IR/chemotherapy or other agents, such as PARP inhibitors that act on the proteins that are important for the repair of double-strand DNA breaks by the error-free homologous recombinational repair pathway). Indeed, we found that PU-H71 radiosensitized the Mia-PaCa-2 human pancreatic cancer cells. We also found PU-H71 to synergize with the PARP inhibitor olaparib in the MDA-MB-468 and HCC1937 breast cancer cells (
[0266] Identification of Hsp90 clients required for tumor cell survival may also serve as tumor-specific biomarkers for selection of patients likely to benefit from Hsp90 therapy and for pharmacodynamic monitoring of Hsp90 inhibitor efficacy during clinical trials (i.e. clients in
[0267] This work substantiates and significantly extends the work of Kamal et al, providing a more sophisticated understanding of the original model in which Hsp90 in tumors is described as present entirely in multi-chaperone complexes, whereas Hsp90 from normal tissues exists in a latent, uncomplexed state (Kamal et al., 2003). We propose that Hsp90 forms biochemically distinct complexes in cancer cells (
[0268] In sum, our work uses chemical tools to provide new insights into the heterogeneity of tumor associated Hsp90 and harnesses the biochemical features of a particular Hsp90 inhibitor to identify tumor-specific biological pathways and proteins (
Materials and METHODS
Cell Lines and Primary Cells
[0269] The CML cell lines K562, Kasumi-4, MEG-01 and KU182, triple-negative breast cancer cell line MDA-MB-468, HER2+ breast cancer cell line SKBr3, melanoma cell line SK-Mel-28, prostate cancer cell lines LNCaP and DU145, pancreatic cancer cell line Mia-PaCa-2, colon fibroblast, CCCD18Co cell lines were obtained from the American Type Culture Collection. The CML cell line KCL-22 was obtained from the Japanese Collection of Research Bioresources. The NIH-3T3 fibroblast cells were transfected as previously described (An et al., 2000). Cells were cultured in DMEM/F12 (MDA-MB-468, SKBr3 and Mia-PaCa-2), RPMI (K562, SK-Mel-28, LNCaP, DU145 and NIH-3T3) or MEM (CCD18Co) supplemented with 10% FBS, 1% L-glutamine, 1% penicillin and streptomycin. Kasumi-4 cells were maintained in IMDM supplemented with 20% FBS, 10 ng/ml Granulocyte macrophage colony-stimulating factor (GM-CSF) and 1×Pen/Strep. PBL (human peripheral blood leukocytes) and cord blood were obtained from patient blood purchased from the New York Blood Center. Thirty five ml of the cell suspension was layered over 15 ml of Ficoll-Paque plus (GE Healthcare). Samples were centrifuged at 2,000 rpm for 40 min at 4° C., and the leukocyte interface was collected. Cells were plated in RPMI medium with 10% FBS and used as indicated. Primary human blast crisis CML and AML cells were obtained with informed consent. The manipulation and analysis of specimens was approved by the University of Rochester, Weill Cornell Medical College and University of Pennsylvania Institutional Review Boards. Mononuclear cells were isolated using Ficoll-Plaque (Pharmacia Biotech, Piscataway, N.Y.) density gradient separation. Cells were cryopreserved in freezing medium consisting of Iscove's modified Dulbecco medium (IMDM), 40% fetal bovine serum (FBS), and 10% dimethylsulfoxide (DMSO) or in CryoStor™ CS-10 (Biolife). When cultured, cells were kept in a humidified atmosphere of 5% CO.sub.2 at 37° C.
Cell Lysis for Chemical and Immuno Precipitation
[0270] Cells were lysed by collecting them in Felts Buffer (HEPES 20 mM, KCl 50 mM, MgCl.sub.2 5 mM, NP40 0.01%, freshly prepared Na.sub.2MoO.sub.4 20 mM, pH 7.2-7.3) with added 1 μg/μL of protease inhibitors (leupeptin and aprotinin), followed by three successive freeze (in dry ice) and thaw steps. Total protein concentration was determined using the BCA kit (Pierce) according to the manufacturer's instructions.
Immunoprecipitation
[0271] The Hsp90 antibody (H9010) or normal IgG (Santa Cruz Biotechnology) was added at a volume of 10 μL to the indicated amount of cell lysate together with 40 μL of protein G agarose beads (Upstate), and the mixture incubated at 4° C. overnight. The beads were washed five times with Felts lysis buffer and separated by SDS-PAGE, followed by a standard western blotting procedure.
Chemical Precipitation
[0272] Hsp90 inhibitors beads or Control beads, containing an Hsp90 inactive chemical (ethanolamine) conjugated to agarose beads, were washed three times in lysis buffer. Unless otherwise indicated, the bead conjugates (80 μL) were then incubated at 4° C. with the indicated amounts of cell lysates (120-500 μg), and the volume was adjusted to 200 μL with lysis buffer. Following incubation, bead conjugates were washed 5 times with the lysis buffer and proteins in the pull-down analyzed by Western blot. For depletion studies, 2-4 successive chemical precipitations were performed, followed by immunoprecipitation steps, where indicated.
[0273] Additional methods are also described herein at pages 173-183.
Supplementary Materials
Table 5 Legend
[0274] Table 5. (a-d) List of proteins isolated in the PU-beads pull-downs and identified as indicated in Supplementary Materials and Methods. (e) Dataset of mapped proteins used for analysis in the Ingenuity Pathway. (f) Protein regulatory networks generated by bioinformatic pathways analysis through the use of the Ingenuity Pathways Analysis (IPA) software. Proteins listed in Table 5e were analyzed by IPA.
TABLE-US-00004 TABLE 5a Putative Hsp90 interacting proteins identified using the QSTAR-Elite hybrid quadrupole time-of-flight mass spectrometer (QT of MS) (AB/MDS Sciex) #GChiosis_K562 and MiPaca2_All, Samples Report created on Aug. 05, 2010 GChiosis_K562 and MiPaca2_All Displaying: Number of Assigned Spectra Entrez- UniProt- Accession Molecular K562 K562 Mia- Gene KB Number Weight Prep 1 Prep 2 Paca 2 HSP90AA1 P07900 heat shock 90 kDa protein IPI00382470 98 kDa 563 2018 1514 1, alpha isoform 1 (+1) HSP90AB1 P08238 Heat shock protein HSP 90- IPI00414676 83 kDa 300 1208 578 beta ABL1 P00519 Isoform IA of Proto- IPI00216969 123 kDa 3 4 0 oncogene tyrosine-protein (+1) kinase ABL1 BCR P11274 Isoform 1 of Breakpoint IPI00004497 143 kDa 1 4 0 cluster region protein (+1) RPS6KA3 P51812 Ribosomal protein S6 IPI00020898 84 kDa 13 10 3 kinase alpha-3 RPS6KA1 Q15418 Ribosomal protein S6 IPI00017305 83 kDa 6 1 0 kinase alpha-1 (+1) MTOR; P42345 FKBP12-rapamycin IPI00031410 289 kDa 43 14 13 FRAP complex-associated protein RPTOR Q8N122 Isoform 1 of Regulatory- IPI00166044 149 kDa 7 3 2 associated protein of mTOR PIK3R4; Q99570 Phosphoinositide 3-kinase IPI00024006 153 kDa 8 9 4 VPS15 regulatory subunit 4 hVps34; Q8NEB9 Phosphatidylinositol 3- IPI00299755 102 kDa 5 1 1 PIK3C3 kinase catalytic subunit (+1) type 3 Sin1; Q9BPZ7 Isoform 1 of Target of IPI00028195 59 kDa 2 0 0 MAPKAP1 rapamycin complex 2 (+4) subunit MAPKAP1 STAT5A P42229 Signal transducer and IPI00030783 91 kDa 48 25 0 activator of transcription 5A STAT5B P51692 Signal transducer and IPI00103415 90 kDa 10 5 0 activator of transcription 5B RAF1 P04049 Isoform 1 of RAF proto- IPI00021786 73 kDa 5 1 1 oncogene serine/threonine- protein kinase ARAF P10398 A-Raf proto-oncogene IPI00020578 68 kDa 2 0 1 serine/threonine-protein (+1) kinase VAV1 P15498 Proto-oncogene vav IPI00011696 98 kDa 3 1 0 BTK Q06187 Tyrosine-protein kinase IPI00029132 76 kDa 11 8 0 BTK PTK2; Q05397 Isoform 1 of Focal adhesion IPI00012885 119 kDa 4 5 4 FAK1 kinase 1 (+1) PTPN23 Q9H3S7 Tyrosine-protein IPI00034006 179 kDa 8 8 2 phosphatase non-receptor type 23 STAT3 P40763 Isoform Del-701 of Signal IPI00306436 88 kDa 15 4 6 transducer and activator of (+2) transcription 3 IRAK1 P51617 interleukin-1 receptor- IPI00060149 68 kDa 7 2 1 associated kinase 1 isoform 3 (+3) MAPK1; P28482 Mitogen-activated protein IPI00003479 41 kDa 23 5 14 ERK2 kinase 1, ERK2 MAP3K4; Q9Y6R4 Isoform A of Mitogen- IPI00186536 182 kDa 3 7 0 MEKK4 activated protein kinase (+2) kinase kinase 4 TAB1 Q15750 Mitogen-activated protein IPI00019459 55 kDa 1 3 2 kinase kinase kinase 7- (+1) interacting protein 1 MAPK14; Q16539 Isoform CSBP2 of Mitogen- IPI00002857 41 kDa 1 0 0 p38 activated protein kinase 14 (+1) MAP2K3; P46734 Isoform 3 of Dual specificity IPI00220438 39 kDa 0 0 2 MEK3 mitogen-activated protein kinase kinase 3 CAPN1 P07384 Calpain-1 catalytic subunit IPI00011285 82 kDa 10 11 0 IGF2BP2 O00425 Isoform 1 of Insulin-like IPI00658000 64 kDa 18 14 20 growth factor 2 mRNA- binding protein 3 IGF2BP1 O88477 Insulin-like growth factor 2 IPI00008557 63 kDa 11 19 0 mRNA-binding protein 1 CAPNS1 P04632 Calpain small subunit 1 IPI00025084 28 kDa 0 0 3 RUVBL1 Q9Y265 Isoform 1 of RuvB-like 1 IPI00021187 50 kDa 10 17 30 RUVBL2 Q9Y230 RuvB-like 2 IPI00009104 51 kDa 20 30 26 MYCBP Q99417 MYCBP protein IPI00871174 14 kDa 2 0 3 AKAP8 O43823 A-kinase anchor protein 8 IPI00014474 76 kDa 4 0 0 AKAP8L Q9ULX6 A-kinase anchor protein 8- IPI00297455 72 kDa 3 3 2 like NPM1 P06748 Isoform 2 of IPI00220740 29 kDa 8 4 49 Nucleophosmin (+1) CARM1 Q86X55 Isoform 1 of Histone- IPI00412880 63 kDa 12 16 9 arginine methyltransferase (+1) CARM1 CALM P62158 Calmodulin IPI00075248 17 kDa 0 0 34 CAMK1 Q14012 Calcium/calmodulin- IPI00028296 41 kDa 0 0 3 dependent protein kinase type 1 CAMK2G Q13555 Isoform 4 of IPI00172450 60 kDa 2 3 0 Calcium/calmodulin- (+11) dependent protein kinase type II gamma chain TYK2 P29597 Non-receptor tyrosine- IPI00022353 134 kDa 2 0 0 protein kinase TYK2 TBK1 Q9UHD2 Serine/threonine-protein IPI00293613 84 kDa 10 0 0 kinase TBK1 PI4KA P42356 Isoform 1 of IPI00070943 231 kDa 15 4 0 Phosphatidylinositol 4- kinase alpha SMG1 Q96Q15 Isoform 3 of IPI00183368 341 kDa 1 9 0 Serine/threonine-protein (+5) kinase SMG1 PHKB Q93100 Isoform 4 of Phosphorylase IPI00181893 124 kDa 10 3 9 b kinase regulatory subunit (+1) beta PANK4 Q9NVE7 cDNA FLJ56439, highly IPI00018946 87 kDa 7 7 0 similar to Pantothenate kinase 4 PRKACA P17612 Isoform 2 of cAMP- IPI00217960 40 kDa 0 0 4 dependent protein kinase (+1) catalytic subunit alpha, PKA PRKAA1 Q13131 protein kinase, AMP- IPI00410287 66 kDa 11 6 1 activated, alpha 1 catalytic (+3) subunit isoform 2 PRKAG1 Q8N7V9 cDNA FLJ40287 fis, clone IPI00473047 39 kDa 10 0 1 TESTI2027909, highly (+1) similar to 5′-AMP- ACTIVATED PROTEIN KINASE, GAMMA-1 SUBUNIT SCYL1 Q96KG9 Isoform 4 of N-terminal IPI00062264 86 kDa 8 2 0 kinase-like protein (+5) ATM Q13315 Serine-protein kinase ATM IPI00298306 351 kDa 2 4 1 ATR Q13535 Isoform 1 of IPI00412298 301 kDa 5 0 3 Serine/threonine-protein (+1) kinase ATR STRAP Q9Y3F4 cDNA FLJ51909, highly IPI00294536 40 kDa 13 0 4 similar to Serine-threonine kinase receptor-associated protein RIOK2 Q9BVS4 Serine/threonine-protein IPI00306406 63 kDa 7 6 1 kinase RIO2 PRKD2 Q9BZL6 cDNA FLJ60070, highly IPI00009334 98 kDa 4 0 0 similar to Serine/threonine- (+1) protein kinase D2 CSNK1A1 P48729 Isoform 2 of Casein kinase I IPI00448798 42 kDa 5 0 1 isoform alpha CSNK2B P67870 Casein kinase II subunit IPI00010865 25 kDa 1 0 1 beta (+1) KSR1 Q8IVT5 Isoform 2 of Kinase IPI00013384 97 kDa 3 0 0 suppressor of Ras 1 (+1) BMP2K Q9NSY1 Isoform 1 of BMP-2- IPI00337426 129 kDa 4 3 0 inducible protein kinase SRPK1 Q96SB4 Isoform 2 of IPI00290439 74 kDa 11 2 7 Serine/threonine-protein (+1) kinase SRPK1 SRPK2 P78362 Serine/threonine-protein IPI00333420 78 kDa 1 1 0 kinase SRPK2 (+3) PLK1 P53350 Serine/threonine-protein IPI00021248 68 kDa 3 0 0 kinase PLK1 (+1) CDK7 P50613 Cell division protein kinase 7 IPI00000685 39 kDa 2 0 1 CDK12 Q9NYV4 Isoform 1 of Cell division IPI00021175 164 kDa 0 0 3 cycle 2-related protein (+1) kinase 7 CCAR1 Q8IX12 Cell division cycle and IPI00217357 133 kDa 3 0 0 apoptosis regulator protein 1 CDC27 P30260 Cell division cycle protein IPI00294575 92 kDa 7 2 1 27 homolog (+1) CDC23 Q9UJX2 cell division cycle protein 23 IPI00005822 69 kDa 1 4 4 CDK9 P50750 Isoform 1 of Cell division IPI00301923 43 kDa 3 0 1 protein kinase 9 (+1) BUB1B O60566 Isoform 1 of Mitotic IPI00141933 120 kDa 3 1 0 checkpoint serine/threonine-protein kinase BUB1 beta BUB1 O43683 Mitotic checkpoint IPI00783305 122 kDa 1 0 0 serine/threonine-protein kinase BUB1 ANAPC1 Q9H1A4 Anaphase-promoting IPI00033907 217 kDa 12 6 7 complex subunit 1 ANAPC7 Q9UJX3 anaphase-promoting IPI00008248 67 kDa 3 8 0 complex subunit 7 isoform a (+1) ANAPC5 Q9UJX4 Isoform 1 of Anaphase- IPI00008247 85 kDa 9 3 0 promoting complex subunit 5 ANAPC4 Q9UJX5 Isoform 1 of Anaphase- IPI00002551 92 kDa 3 0 0 promoting complex subunit 4 NEK9 Q8TD19 Serine/threonine-protein IPI00301609 107 kDa 3 3 5 kinase Nek9 CDC45 O75419 CDC45-related protein IPI00025695 66 kDa 7 7 0 (+2) CRKL P46109 Crk-like protein IPI00004839 34 kDa 5 0 0 DOCK2 Q92608 Isoform 1 of Dedicator of IPI00022449 212 kDa 2 3 1 cytokinesis protein 2 DOCK7 Q96N67 Isoform 2 of Dedicator of IPI00183572 241 kDa 2 0 0 cytokinesis protein 7 (+5) DOCK11 Q5JSL3 Putative uncharacterized IPI00411452 238 kDa 0 0 1 protein DOCK11 (+1) EPS15 P42566 Isoform 1 of Epidermal IPI00292134 99 kDa 23 26 3 growth factor receptor substrate 15 GRB2 P62993 Isoform 1 of Growth factor IPI00021327 25 kDa 5 1 2 receptor-bound protein 2 (+1) BTF3 P20290 Isoform 1 of Transcription IPI00221035 22 kDa 0 0 3 factor BTF3 (+1) LGALS3 P17931 Galectin-3 IPI00465431 26 kDa 0 0 9 NONO Q15233 Non-POU domain- IPI00304596 54 kDa 0 0 4 containing octamer-binding protein ITPA Q9BY32 Inosine triphosphate IPI00018783 21 kDa 0 0 5 pyrophosphatase RBX1 P62877 RING-box protein 1 IPI00003386 12 kDa 0 0 5 RIPK1 Q13546 Receptor-interacting IPI00013773 76 kDa 2 0 0 serine/threonine-protein kinase 1 HINT1 P49773 Histidine triad nucleotide- IPI00239077 14 kDa 0 0 9 binding protein 1 GSE1 Q14687 Isoform 1 of Genetic IPI00215963 136 kDa 11 2 0 KIAA0182 suppressor element 1 (+1) PDAP1 Q13442 28 kDa heat- and acid- IPI00013297 21 kDa 0 0 5 stable phosphoprotein SQSTM1 Q13501 Isoform 1 of IPI00179473 48 kDa 3 5 1 Sequestosome-1 (+1) TBL1XR1 Q9BZK7 F-box-like/WD repeat- IPI00002922 56 kDa 3 12 3 containing protein TBL1XR1 PRMT5 O14744 Protein arginine N- IPI00441473 73 kDa 12 11 3 methyltransferase 5 PRMT6 Q96LA8 Protein arginine N- IPI00102128 42 kDa 2 0 0 methyltransferase 6 (+1) PRMT3 Q8WUV3 PRMT3 protein (Fragment) IPI00103026 62 kDa 6 1 1 (+2) ATG2A Q2TAZ0 Isoform 1 of Autophagy- IPI00304926 213 kDa 2 3 0 related protein 2 homolog A (+1) AMBRA1 Q9C0C7 Isoform 2 of Activating IPI00106552 136 kDa 2 2 1 molecule in BECN1- (+3) regulated autophagy protein 1 ATG5 Q9H1Y0 Isoform Long of Autophagy IPI00006800 32 kDa 2 1 0 protein 5 YWHAE P62258 14-3-3 protein epsilon IPI00000816 29 kDa 13 1 13 MYBBP1A Q9BQG0 Isoform 1 of Myb-binding IPI00005024 149 kDa 4 4 29 protein 1A (+1) RQCD1 Q92600 Cell differentiation protein IPI00023101 34 kDa 5 1 8 RCD1 homolog YWHAQ P27348 14-3-3 protein theta IPI00018146 28 kDa 0 0 4 DDB1 Q16531 DNA damage-binding IPI00293464 127 kDa 25 15 2 protein 1 YBX1 P67809 Nuclease-sensitive IPI00031812 36 kDa 6 13 40 element-binding protein 1 RCOR1 Q9UKL0 REST corepressor 1 IPI00008531 53 kDa 9 5 0 HDAC1 Q13547 Histone deacetylase 1 IPI00013774 55 kDa 10 11 1 KDM1A O60341 Isoform 2 of Lysine-specific IPI00217540 95 kDa 13 4 0 histone demethylase 1 (+1) HDAC6 Q9UBN7 cDNA FLJ56474, highly IPI00005711 133 kDa 4 6 2 similar to Histone deacetylase 6 RBBP7 Q16576 Histone-binding protein IPI00395865 48 kDa 5 4 3 RBBP7 (+2) HIST1H1C P16403 Histone H1.2 IPI00217465 21 kDa 1 0 7 HDAC2 Q92769 histone deacetylase 2 IPI00289601 66 kDa 2 3 1 HIST1H1B P16401 Histone H1.5 IPI00217468 23 kDa 0 0 5 H1FX Q92522 Histone H1x IPI00021924 22 kDa 0 0 3 SMARCC1 Q92922 SWI/SNF complex subunit IPI00234252 123 kDa 15 17 0 SMARCC1 SMARCC2 Q8TAQ2 Isoform 2 of SWI/SNF IPI00150057 125 kDa 6 7 0 complex subunit SMARCC2 (+1) TNFAIP2 Q03169 Tumor necrosis factor, IPI00304866 73 kDa 2 1 0 alpha-induced protein 2 PICALM Q13492 Isoform 2 of IPI00216184 69 kDa 1 7 0 Phosphatidylinositol-binding (+5) clathrin assembly protein KIAA1967 Q8N163 Isoform 1 of Protein IPI00182757 103 kDa 17 23 3 KIAA1967 MCM5 P33992 DNA replication licensing IPI00018350 82 kDa 24 18 2 factor MCM5 (+2) TFRC P02786 Transferrin receptor protein 1 IPI00022462 85 kDa 25 7 0 TRIM28 Q13263 Isoform 1 of Transcription IPI00438229 89 kDa 16 14 4 intermediary factor 1-beta TLN1 Q9Y490 Talin-1 IPI00298994 270 kDa 12 12 0 NDC80 O14777 Kinetochore protein NDC80 IPI00005791 74 kDa 13 4 0 homolog IQGAP2 Q13576 Isoform 1 of Ras GTPase- IPI00299048 181 kDa 18 21 1 activating-like protein IQGAP2 MIF P14174 Macrophage migration IPI00293276 12 kDa 3 0 25 inhibitory factor PA2G4 Q9UQ80 Proliferation-associated IPI00299000 44 kDa 3 8 14 protein 2G4 CYFIP1 Q7L576 Isoform 1 of Cytoplasmic IPI00644231 145 kDa 8 4 4 FMR1-interacting protein 1 (+1) PCNA P12004 Proliferating cell nuclear IPI00021700 29 kDa 9 3 10 antigen NSUN2 Q08J23 tRNA (cytosine-5-)- IPI00306369 86 kDa 11 8 5 methyltransferase NSUN2 NCOR1 O75376 Isoform 1 of Nuclear IPI00289344 270 kDa 11 13 1 receptor corepressor 1 (+1) NCOR2 Q9Y618 Isoform 1 of Nuclear IPI00001735 275 kDa 8 5 2 receptor corepressor 2 ILF3 Q12906 Isoform 1 of Interleukin IPI00298788 95 kDa 25 16 20 enhancer-binding factor 3 ILF2 Q12905 Interleukin enhancer- IPI00005198 43 kDa 8 11 18 binding factor 2 KHDRBS1 Q07666 Isoform 1 of KH domain- IPI00008575 48 kDa 8 15 2 containing, RNA-binding, signal transduction- associated protein 1 RNF213 Q9HCF4 Isoform 1 of Protein ALO17 IPI00642126 576 kDa 12 49 16 MTA2 O94776 Metastasis-associated IPI00171798 75 kDa 14 12 3 protein MTA2 TRMT112 Q9UI30 TRM112-like protein IPI00009010 14 kDa 0 0 3 ERH P84090 Enhancer of rudimentary IPI00029631 12 kDa 0 0 3 homolog FBXO22 Q8NEZ5 Isoform 1 of F-box only IPI00183208 45 kDa 0 0 3 protein 22 TP63 Q9H3D4 Isoform 1 of Tumor protein IPI00301360 77 kDa 0 0 3 63 (+5) PPP5C P53041 Serine/threonine-protein IPI00019812 57 kDa 3 1 0 phosphatase 5 DIAPH1 O60610 Isoform 1 of Protein IPI00852685 141 kDa 6 7 0 diaphanous homolog 1 (+1) RPA1 P27694 Replication protein A 70 kDa IPI00020127 68 kDa 22 8 0 DNA-binding subunit SERBP1 Q8NC51 Isoform 3 of Plasminogen IPI00470498 43 kDa 0 6 16 activator inhibitor 1 RNA- binding protein PPP2R5E Q16537 Serine/threonine-protein IPI00002853 55 kDa 0 0 2 phosphatase 2A 56 kDa (+1) regulatory subunit epsilon isoform PPP2R1B P30154 Isoform 1 of IPI00294178 66 kDa 3 2 0 Serine/threonine-protein (+3) phosphatase 2A 65 kDa regulatory subunit A beta isoform PPP2R2A P63151 Serine/threonine-protein IPI00332511 52 kDa 9 1 5 phosphatase 2A 55 kDa regulatory subunit B alpha isoform PPP6R1 Q9UPN7 Isoform 1 of IPI00402008 103 kDa 5 2 5 Serine/threonine-protein (+1) phosphatase 6 regulatory subunit 1 TGFBRAP1 Q8WUH2 Transforming growth factor- IPI00550891 97 kDa 1 0 0 beta receptor-associated protein 1 OLA1 Q9NTK5 Isoform 1 of Obg-like IPI00290416 45 kDa 8 4 3 ATPase 1 CTSB P07858 Cathepsin B IPI00295741 38 kDa 0 0 2 (+2) CTSZ Q9UBR2 Cathepsin Z IPI00002745 34 kDa 1 0 0 (+1) ACAP2 Q15057 ARFGAP with coiled-coil, IPI00014264 88 kDa 3 2 1 ANK repeat and PH domain-containing protein 2 GIT1 Q9Y2X7 Isoform 1 of ARF GTPase- IPI00384861 84 kDa 2 0 0 activating protein GIT1 (+2) ARHGEF1 Q92888 Isoform 2 of Rho guanine IPI00339379 99 kDa 4 3 0 nucleotide exchange factor 1 (+2) ARHGEF2 Q92974 Isoform 1 of Rho guanine IPI00291316 112 kDa 14 7 2 nucleotide exchange factor 2 RANGAP1 P46060 Ran GTPase-activating IPI00294879 64 kDa 13 4 1 protein 1 GAPVD1 Q14C86 Isoform 6 of GTPase- IPI00292753 166 kDa 4 6 6 activating protein and VPS9 (+4) domain-containing protein 1 RAB3GAP1 Q15042 Isoform 1 of Rab3 GTPase- IPI00014235 111 kDa 9 6 3 activating protein catalytic subunit RAN P62826 GTP-binding nuclear IPI00643041 24 kDa 7 2 6 protein Ran (+1) SAR1A Q9NR31 GTP-binding protein SAR1a IPI00015954 22 kDa 3 1 1 RAB11B Q15907 Ras-related protein Rab- IPI00020436 24 kDa 6 1 0 11B (+1) TBC1D15 Q8TC07 TBC1 domain family, IPI00794613 80 kDa 6 4 4 member 15 isoform 3 TELO2 Q9Y4R8 Telomere length regulation IPI00016868 92 kDa 11 1 1 protein TEL2 homolog RIF1 Q5UIP0 Isoform 1 of Telomere- IPI00293845 274 kDa 2 0 2 associated protein RIF1 (+1) WRAP53 Q9BUR4 Telomerase Cajal body IPI00306087 59 kDa 3 0 0 protein 1 TNKS1BP1 Q9C0C2 Isoform 1 of 182 kDa IPI00304589 182 kDa 23 79 12 tankyrase-1-binding protein (+1) PDCD4 Q53EL6 programmed cell death 4 IPI00240675 51 kDa 2 5 3 isoform 2 (+1) FERMT3 Q86UX7 Isoform 2 of Fermitin family IPI00216699 75 kDa 8 0 0 homolog 3 (+1) PTK2B Q14289 Isoform 1 of Protein IPI00029702 116 kDa 2 0 0 tyrosine kinase 2 beta; (+1) PYK2; FAK2 MLLT4 P55196 Isoform 4 of Afadin IPI00023461 207 kDa 1 2 0 (+1) TRIM56 Q9BRZ2 Isoform 1 of Tripartite motif- IPI00514832 81 kDa 0 0 3 containing protein 56 (+1) HYOU1 Q9Y4L1 Hypoxia up-regulated IPI00000877 111 kDa 0 3 0 protein 1 (+1) ZG16B Q96DA0 Zymogen granule protein IPI00060800 23 kDa 0 3 0 16 homolog B INPP4A Q96PE3 Isoform 3 of Type I inositol- IPI00044388 109 kDa 3 0 0 3,4-bisphosphate 4- (+3) phosphatase INF2 Q27J81 Putative uncharacterized IPI00872508 55 kDa 0 0 3 protein INF2 (+3) GNL1 P36915 HSR1 protein IPI00384745 62 kDa 2 1 0 (+1) SAMHD1 Q9Y3Z3 SAM domain and HD IPI00294739 72 kDa 11 2 6 domain-containing protein 1 TJP1 Q07157 Isoform Long of Tight IPI00216219 195 kDa 6 3 0 junction protein ZO-1 (+2) BAT3 P46379 Isoform 1 of Large proline- IPI00465128 119 kDa 4 5 3 rich protein BAT3 (+4) SPTA1 D3DVD8 spectrin, alpha, erythrocytic 1 IPI00220741 280 kDa 43 62 0 FLNA P21333 Isoform 2 of Filamin-A IPI00302592 280 kDa 26 91 0 (+2) FLNC Q14315 Isoform 1 of Filamin-C IPI00178352 291 kDa 55 183 0 (+1) KIAA1468 Q9P260 Isoform 2 of LisH domain IPI00023330 139 kDa 0 0 3 and HEAT repeat- containing protein KIAA1468 HEATR2 Q86Y56 Isoform 1 of HEAT repeat- IPI00242630 94 kDa 5 2 11 containing protein 2 HEATR6 Q6AI08 HEAT repeat-containing IPI00464999 129 kDa 2 1 0 protein 6 HSPG2 P98160 Basement membrane- IPI00024284 469 kDa 4 9 0 specific heparan sulfate proteoglycan core protein CTTN Q14247 Src substrate cortactin IPI00029601 62 kDa 6 6 2 (+1) AIP O00170 AH receptor-interacting IPI00010460 38 kDa 10 0 0 protein NAT10 Q9H0A0 N-acetyltransferase 10 IPI00300127 116 kDa 8 3 1 DICER1 Q9UPY3 dicer1 IPI00219036 219 kDa 8 3 1 FAM120A Q9NZB2 Isoform A of Constitutive IPI00472054 122 kDa 1 1 12 coactivator of PPAR- (+1) gamma-like protein 1 NUMA1 Q14980 Isoform 2 of Nuclear mitotic IPI00006196 237 kDa 4 4 4 apparatus protein 1 (+2) TRIPI3 Q15645 Isoform 1 of Thyroid IPI00003505 49 kDa 3 3 8 receptor-interacting protein 13 FAM115A Q9Y4C2 Isoform 1 of Protein IPI00006050 102 kDa 9 1 0 FAM115A (+3) SUPV3L1 Q8IYB8 ATP-dependent RNA IPI00412404 88 kDa 8 3 0 helicase SUPV3L1, mitochondrial LTV1 Q96GA3 Protein LTV1 homolog IPI00153032 55 kDa 5 6 0 LYAR Q9NX58 Cell growth-regulating IPI00015838 44 kDa 1 2 6 nucleolar protein ASAH1 Q13510 Acid ceramidase IPI00013698 45 kDa 8 1 0 FIP1L1 Q6UN15 Isoform 3 of Pre-mRNA 3′- IPI00008449 58 kDa 6 3 0 end-processing factor FIP1 (+3) TP53BP1 Q12888 Isoform 1 of Tumor IPI00029778 214 kDa 0 6 3 suppressor p53-binding (+3) protein 1 BAX Q07812 Isoform Epsilon of IPI00071059 18 kDa 3 0 6 Apoptosis regulator BAX (+3) APRT P07741 Adenine IPI00218693 20 kDa 0 0 6 phosphoribosyltransferase FHOD1 Q9Y613 FH1/FH2 domain- IPI00001730 127 kDa 5 2 0 containing protein 1 CPNE3 O75131 Copine-3 IPI00024403 60 kDa 4 5 0 TLE1 Q04724 Isoform 2 of Transducin-like IPI00177938 82 kDa 5 2 1 enhancer protein 3 (+4) TPP1 O14773 Putative uncharacterized IPI00554538 60 kDa 4 1 1 protein TPP1 (+2) SDCCAG1 O60524 Isoform 1 of Serologically IPI00301618 123 kDa 2 2 3 defined colon cancer antigen 1 NCKAP1 Q9Y2A7 Isoform 1 of Nck-associated IPI00031982 129 kDa 5 1 2 protein 1 (+1) NUP54 Q7Z3B4 Nucleoporin 54 kDa variant IPI00172580 56 kDa 1 7 0 (Fragment) NUP85 Q9BW27 Nucleoporin NUP85 IPI00790530 75 kDa 14 2 0 NUP160 Q12769 nucleoporin 160 kDa IPI00221235 162 kDa 13 1 0 NOP14 P78316 Isoform 1 of Nucleolar IPI00022613 98 kDa 9 2 0 protein 14 PRPF31 Q8WWY3 Isoform 1 of U4/U6 small IPI00292000 55 kDa 3 2 0 nuclear ribonucleoprotein (+1) Prp31 PRPF3 O43395 Isoform 1 of U4/U6 small IPI00005861 78 kDa 3 0 0 nuclear ribonucleoprotein (+1) Prp3 CNOT1 A5YKK6 Isoform 1 of CCR4-NOT IPI00166010 267 kDa 53 73 23 transcription complex subunit 1 LRRC40 Q9H9A6 Leucine-rich repeat- IPI00152998 68 kDa 4 3 0 containing protein 40 PHB2 Q99623 Prohibitin-2 IPI00027252 33 kDa 8 0 0 VAC14 Q08AM6 Protein VAC14 homolog IPI00025160 88 kDa 5 2 0 NOP2 P46087 Putative uncharacterized IPI00294891 94 kDa 0 0 7 protein NOP2 (+2) NOB1 Q9ULX3 RNA-binding protein NOB1 IPI00022373 48 kDa 5 0 0 SARM1 Q6SZW1 Isoform 1 of Sterile alpha IPI00448630 79 kDa 0 0 5 and TIR motif-containing protein 1 FTSJD2 Q8N1G2 FtsJ methyltransferase IPI00166153 95 kDa 3 1 0 domain-containing protein 2 NFKB1 P19838 Isoform 2 of Nuclear factor IPI00292537 105 kDa 1 0 2 NF-kappa-B p105 subunit (+1) SLC3A2 P08195 4F2 cell-surface antigen IPI00027493 58 kDa 3 0 0 heavy chain (+5) WIGB Q9BRP8 Putative uncharacterized IPI00914992 23 kDa 0 0 4 protein WIBG (Fragment) (+2) DIABLO Q9NR28 Diablo homolog, IPI00008418 36 kDa 1 0 2 mitochondrial precursor (+4) AIFM1 O95831 Isoform 1 of Apoptosis- IPI00000690 67 kDa 2 0 0 inducing factor 1, (+1) mitochondrial ZC3HAV1 Q7Z2W4 Isoform 1 of Zinc finger IPI00410067 101 kDa 7 0 0 CCCH-type antiviral protein 1 PSPC1 Q8WXF1 Isoform 1 of Paraspeckle IPI00103525 59 kDa 5 2 0 component 1 (+1) STRN O43815 Isoform 1 of Striatin IPI00014456 86 kDa 5 1 0 PHB P35232 Prohibitin IPI00017334 30 kDa 5 0 0 (+1) SDPR O95810 Serum deprivation- IPI00005809 47 kDa 0 0 4 response protein GPS2 Q13227 G protein pathway IPI00012301 37 kDa 5 0 0 suppressor 2 (+1) CSDE1 O75534 Isoform Long of Cold shock IPI00470891 89 kDa 4 0 0 domain-containing protein (+2) E1 CHD4 Q14839 Isoform 1 of IPI00000846 218 kDa 12 45 2 Chromodomain-helicase- (+1) DNA-binding protein 4 RID1A O14497 Isoform 1 of AT-rich IPI00643722 242 kDa 20 37 0 interactive domain- containing protein 1A PTPLAD1 Q9P035 Protein tyrosine IPI00008998 43 kDa 2 0 0 phosphatase-like protein (+1) PTPLAD1 PLBD1 Q6P4A8 hypothetical protein IPI00016255 63 kDa 0 0 2 LOC79887 MALT1 Q9UDY8 Isoform 1 of Mucosa- IPI00009540 92 kDa 0 0 2 associated lymphoid tissue (+2) lymphoma translocation protein 1 BCL7C Q8WUZ0 Isoform 1 of B-cell IPI00006266 23 kDa 2 0 0 CLL/lymphoma 7 protein (+2) family member C PRCC Q92733 Proline-rich protein PRCC IPI00294618 52 kDa 2 0 0 (+2) WASF2 Q9Y6W5 Wiskott-Aldrich syndrome IPI00472164 54 kDa 2 0 0 protein family member 2 PSD4 Q8NDX1 Isoform 1 of PH and SEC7 IPI00304670 116 kDa 2 0 0 domain-containing protein 4 (+2) ZBED1 O96006 Zinc finger BED domain- IPI00006203 78 kDa 2 0 0 containing protein 1 NCSTN Q92542 Isoform 1 of Nicastrin IPI00021983 78 kDa 2 0 0 (+3) CT45A5 Q6NSH3 Cancer/testis antigen 45-5 IPI00431697 21 kDa 2 0 0 (+4) MOBKL3 Q9Y3A3 Isoform 1 of Mps one IPI00386122 26 kDa 0 0 1 binder kinase activator-like 3 (+2) SKP1 P63208 Isoform 2 of S-phase IPI00172421 18 kDa 0 0 4 kinase-associated protein 1 (+1) KIF14 Q15058 Kinesin-like protein KIF14 IPI00299554 186 kDa 1 1 0 ASCC2 Q9H1I8 Isoform 1 of Activating IPI00549736 86 kDa 0 0 1 signal cointegrator 1 complex subunit 2 ZZEF1 O43149 Isoform 1 of Zinc finger ZZ- IPI00385631 331 kDa 0 0 1 type and EF-hand domain- (+1) containing protein 1 MLF2 Q15773 Myeloid leukemia factor 2 IPI00023095 28 kDa 2 0 1 PRAME P78395 preferentially expressed IPI00893980 21 kDa 4 0 0 antigen in melanoma (+3) O60613 15 kDa selenoprotein IPI00030877 18 kDa 0 0 2 isoform 1 precursor
TABLE-US-00005 TABLE 5b Putative Hsp90 interacting co-chaperones identified using the QSTAR-Elite hybrid quadrupole time-of-flight mass spectrometer (QT of MS) (AB/MDS Sciex) UniProt- Identified Proteins Accession Molecular K562 K562 Mia- EntrezGene KB (1559) Number Weight Prep1 Prep2 Paca2 HSP90AA1 P07900 heat shock 90 kDa IPI00382470 98 kDa 563 2018 1514 Hsp90 protein 1, alpha (+1) alpha isoform 1 HSP90AB1 P08238 Heat shock protein IPI00414676 83 kDa 300 1208 578 Hsp90 HSP 90-beta beta Putative heat shock IPI00555565 58 kDa 2 12 4 protein HSP 90-beta 4 Putative heat shock IPI00555957 48 kDa 6 1 1 protein HSP 90- alpha A4 TRAP1 Q12931 Heat shock protein IPI00030275 80 kDa 65 411 21 Trap- 75 kDa, 1* mitochondrial HSP90B1 P14625 Endoplasmin; IPI00027230 92 kDa 55 194 1 Grp94* GRP94 HSPA8 P11142 Isoform 1 of Heat IPI00003865 71 kDa 78 217 25 Hsc70 shock cognate 71 kDa protein, Hsc70 HSPA1B; P08107 Heat shock 70 kDa IPI00304925 70 kDa 47 61 3 Hsp70 HSPA1A protein 1 (+1) Heat shock 70 kDa IPI00002966 94 kDa 6 1 0 protein 4 STIP1 P31948 Stress-induced- IPI00013894 63 kDa 40 45 5 HOP phosphoprotein 1; HOP ST13 P50502 Hsc70-interacting IPI00032826 41 kDa 8 5 4 HIP protein CDC37 Q16543 Hsp90 co- IPI00013122 44 kDa 1 1 3 Cdc37 chaperone Cdc37 AHSA1 O95433 Activator of 90 kDa IPI00030706 38 kDa 1 0 3 AHA-1 heat shock protein ATPase homolog 1 HSPH1 Q92598 Isoform Beta of Heat IPI00218993 92 kDa 2 0 0 Hsp110 shock protein 105 kDa (+2) DNAJC7 Q99615 DnaJ homolog IPI00329629 56 kDa 4 4 2 Hsp40s subfamily C member 7 DNAJA2 O60884 DnaJ homolog IPI00032406 46 kDa 5 0 3 subfamily A member 2 DNAJB6 O75190 Isoform A of DnaJ IPI00024523 36 kDa 5 0 2 homolog subfamily (+1) B member 6 DNAJB1 P25685 DnaJ homolog IPI00012535 45 kDa 6 0 2 subfamily A member 1 DNAJB4 Q9UDY4 DnaJ homolog IPI00008454 41 kDa 4 2 1 subfamily B member 11 DNAJB1 P25685 DnaJ homolog IPI00015947 38 kDa 3 0 1 subfamily B member 1 DNAJC13 O75165 DnaJ homolog IPI00307259 254 kDa 0 0 3 subfamily C member 13 DNAJC8 O75937 DnaJ homolog IPI00003438 30 kDa 1 0 0 subfamily C member 8 DNAJC9 Q8WXX5 DnaJ homolog IPI00154975 30 kDa 3 0 1 subfamily C member 9 SACS Q9NZJ4 Isoform 2 of Sacsin IPI00784002 505 kDa 2 1 0 (+1) PPIB P23284 Peptidyl-prolyl cis- IPI00646304 24 kDa 4 0 0 PPlase trans isomerase B PPIL1 Q9Y3C6 Isoform 1 of IPI00003824 59 kDa 13 1 0 (peptidylprolylisomerase) Peptidyl-prolyl cis- trans isomerase-like 2 PPIA P62937 Peptidyl-prolyl cis- IPI00419585 18 kDa 0 0 6 trans isomerase A PPID Q08752 40 kDa peptidyl- IPI00003927 41 kDa 3 1 0 prolyl cis-trans isomerase PPIE Q9UNP9 Isoform A of IPI00009316 33 kDa 0 0 3 Peptidyl-prolyl cis- (+2) trans isomerase E P4HB P07237 Protein disulfide- IPI00010796 57 kDa 11 36 1 isomerase FKBP4 Q02790 FK506-binding IPI00219005 52 kDa 21 12 8 protein 4 FKBP10 Q96AY3 FK506-binding IPI00303300 64 kDa 0 0 7 protein 10 FKBP9 O95302 FK506-binding IPI00182126 63 kDa 1 0 0 protein 9 (+1) BAG4 O95429 BAG family IPI00030695 50 kDa 4 0 0 BAG molecular (+1) chaperone regulator 4 BAG2 O95816 BAG family IPI00000643 24 kDa 1 1 3 molecular chaperone regulator 2 TTC27 Q6P3X3 Tetratricopeptide IPI00183938 97 kDa 13 3 2 repeat protein 27 TTC4 O95801 Tetratricopeptide IPI00000606 45 kDa 1 0 0 repeat protein 4 (+1) TTC19 Q6DKK2 Tetratricopeptide IPI00170855 56 kDa 2 0 0 repeat protein 19 (+1) PTCD1 O75127 Pentatricopeptide IPI00171925 79 kDa 2 0 0 repeat-containing protein 1 B3KU92 Isoform 1 of TPR IPI00395476 95 kDa 3 0 0 repeat-containing protein LOC90826 TOMM40 O96008 Isoform 1 of IPI00014053 38 kDa 3 0 0 TOM40 Mitochondrial import receptor subunit TOM40 homolog UNC45B Q8IWX7 Isoform 2 of Protein IPI00735181 102 kDa 33 6 2 UNC45 unc-45 homolog A HSPA9 P38646 Stress-70 protein, IPI00007765 74 kDa 19 25 4 GRP75 mitochondrial; GRP75 HSPD1 P10809 60 kDa heat shock IPI00784154 61 kDa 19 29 1 HSP60 protein, mitochondrial; HSP60 *Grp94 and Trap-1 are Hsp90 isoforms to which PU-H71 binds directly
TABLE-US-00006 TABLE 5c Putative Hsp90 interacting proteins acting in the proteasome pathway identified using the QSTAR-Elite hybrid quadrupole time-of-flight mass spectrometer (GT of MS) (AB/MDS Sciex) Accession Molecular K562 K562 Mia- EntrezGene UniProtKB Number Weight Prep1 Prep2 Paca2 TRIM33 Q9UPN9 Isoform Alpha of E3 IPI00010252 123 kDa 1 1 0 ubiquitin-protein ligase (+1) TRIM33 ITCH Q96J02 Isoform 1 of E3 ubiquitin- IPI00061780 103 kDa 2 0 0 protein ligase Itchy (+1) homolog UBR3 Q6ZT12 Isoform 1 of E3 ubiquitin- IPI00335581 212 kDa 0 2 1 protein ligase UBR3 (+1) UBR1 Q8IWV7 Isoform 1 of E3 ubiquitin- IPI00217405 200 kDa 3 1 1 protein ligase UBR1 UBR2 Q8IWV8 Isoform 4 of E3 ubiquitin- IPI00217407 201 kDa 1 5 0 protein ligase UBR2 (+1) UBR4 Q5T4S7 Isoform 3 of E3 ubiquitin- IPI00646605 572 kDa 40 61 8 protein ligase UBR4 (+2) UBR5 O95071 E3 ubiquitin-protein ligase IPI00026320 309 kDa 15 34 0 UBR5 UBE3C Q15386 Isoform 1 of Ubiquitin- IPI00604464 124 kDa 12 0 5 protein ligase E3C UBE3A Q05086 Isoform II of Ubiquitin- IPI00011609 101 kDa 13 0 0 protein ligase E3A (+2) UBE4B O95155 Isoform 1 of Ubiquitin IPI00005715 146 kDa 6 2 0 conjugation factor E4 B (+1) HECTD3 A1A4G1 Isoform 1 of Probable E3 IPI00456642 97 kDa 4 1 2 ubiquitin-protein ligase (+1) HECTD3 NEDD4 P46934 E3 ubiquitin-protein ligase IPI00009322 115 kDa 5 0 1 NEDD4 RNF123 Q5XPI4 Isoform 1 of E3 ubiquitin- IPI00335085 149 kDa 2 0 0 protein ligase RNF123 (+2) HERC4 Q5GLZ8 Isoform 1 of Probable E3 IPI00333067 119 kDa 3 0 0 ubiquitin-protein ligase (+3) HERC4 HERC1 Q15751 Probable E3 ubiquitin- IPI00022479 532 kDa 1 2 0 protein ligase HERC1 KCMF1 Q9P0J7 E3 ubiquitin-protein ligase IPI00306661 42 kDa 1 0 0 KCMF1 TRIP12 Q14669 TRIP12 protein; Probable IPI00032342 226 kDa 0 0 6 E3 ubiquitin-protein ligase (+1) TRIP12 USP47 Q96K76 Isoform 1 of Ubiquitin IPI00607554 157 kDa 11 8 2 carboxyl-terminal hydrolase 47 USP34 Q70CQ2 Isoform 1 of Ubiquitin IPI00297593 404 kDa 15 6 3 carboxyl-terminal (+2) hydrolase 34 USP15 Q9Y4E8 Isoform 1 of Ubiquitin IPI00000728 112 kDa 12 10 2 carboxyl-terminal hydrolase 15 USP9X Q93008 ubiquitin specific protease IPI00003964 290 kDa 24 52 9 9, X-linked isoform 4 (+1) UBAP2L Q14157 Isoform 1 of Ubiquitin- IPI00514856 115 kDa 9 12 17 associated protein 2-like UBA1 P22314 Ubiquitin-like modifier- IPI00645078 118 kDa 6 6 26 activating enzyme 1 UCHL5 Q9Y5K5 Isoform 2 of Ubiquitin IPI00219512 36 kDa 12 0 5 carboxyl-terminal (+6) hydrolase isozyme L5 USP7 Q93009 Ubiquitin carboxyl-terminal IPI00003965 128 kDa 8 3 0 hydrolase 7 (+1) USP10 Q14694 Ubiquitin carboxyl-terminal IPI00291946 87 kDa 5 2 2 hydrolase 10 USP32 Q8NFA0 Ubiquitin carboxyl-terminal IPI00185661 182 kDa 5 1 2 hydrolase 32 (+1) USP28 Q96RU2 Isoform 1 of Ubiquitin IPI00045496 122 kDa 1 1 2 carboxyl-terminal (+1) hydrolase 28 USP14 P54578 Ubiquitin carboxyl-terminal IPI00219913 56 kDa 2 2 0 hydrolase 14 (+2) CDC16 Q13042 Isoform 1 of Cell division IPI00022091 72 kDa 1 3 0 cycle protein 16 homolog (+3) USP11 P51784 ubiquitin specific protease IPI00184533 110 kDa 9 2 5 11 UFD1L Q92890 Isoform Short of Ubiquitin IPI00218292 35 kDa 10 0 7 fusion degradation protein (+2) 1 homolog UBAP2 Q5T6F2 Ubiquitin-associated IPI00171127 117 kDa 6 2 1 protein 2 UBAC1 Q9BSL1 Ubiquitin-associated IPI00305442 45 kDa 6 0 0 domain-containing protein 1 FAU P62861 ubiquitin-like protein fubi IPI00019770 14 kDa 0 0 2 and ribosomal protein S30 (+1) precursor NUB1 Q9Y5A7 NEDD8 ultimate buster 1 IPI00157365 72 kDa 4 1 0 (Negative regulator of (+1) ubiquitin-like proteins 1) (Renal carcinoma antigen NY-REN-18). Isoform 2 VCPIP1 Q96JH7 Deubiquitinating protein IPI00064162 134 kDa 1 0 0 VCIP135 GAN Q9H2C0 Gigaxonin IPI00022758 68 kDa 2 2 1 UBQLN2 Q9UHD9 Ubiquilin-2 IPI00409659 66 kDa 0 0 3 (+1) KEAP1 Q14145 Kelch-like ECH-associated IPI00106502 70 kDa 5 2 0 protein 1 (+1) CUL2 B7Z6K8 cDNA FLJ56037, highly IPI00014311 90 kDa 10 6 3 similar to Cullin-2 CUL1 Q13616 Cullin-1 IPI00014310 90 kDa 11 2 1 CAND2 O75155 Isoform 2 of Cullin- IPI00374208 123 kDa 5 2 0 associated NEDD8- dissociated protein 2 CUL3 Q13618 Isoform 1 of Cullin-3 IPI00014312 89 kDa 7 0 1 (+1) CUL4A Q13619 Isoform 1 of Cullin-4A IPI00419273 88 kDa 4 0 0 CUL4B Q13620 Isoform 1 of Cullin-4B IPI00179057 102 kDa 2 0 0 (+2) CUL5 Q93034 Cullin-5 IPI00216003 97 kDa 1 0 0 (+1)
TABLE-US-00007 TABLE 5d Putative Hsp90 interacting proteins identified using the Waters Xevo QTof MS Run1 gel size cut >200 150-200 110-150 80-110 Matched Peptides by Fraction UniProt- Total Protein.Name.Abbrev KB Reference MW fmol JA01 JA02 JA03 JA04 Heat shock P08238 83264.4 2708.8638 14 5 11 260 protein HSP 90-beta Heat shock P07900 84659.9 1351.4965 6 7 209 protein HSP 90-alpha Signal P42229 90647.2 33.6765 78 transducer and activator of transcription 5A Signal P51692 89866.1 21.2998 64 transducer and activator of transcription 5B Mitogen- P28482 41389.8 79.3199 activated protein kinase 1; MAPK1; ERK-2 Serine/threonine- P42345 288892.5 16.4969 22 18 protein kinase mTOR Serine/threonine- Q9UHD2 83642.4 5.3258 9 protein kinase TBK1 Phosphoinositide Q99570 153103.9 6.7192 13 3-kinase regulatory subunit 4 Cell division P06493 34095.5 33.2760 protein kinase 1; CDK1 Calpain-1 P07384 81890.2 18.7642 catalytic subunit; CAPN1 Mitogen- P27361 43135.7 6.6438 activated protein kinase 3; ERK-1 Ribosomal P51812 83736.2 11.9267 20 protein S6 kinase alpha-3; RSK2 Inosine-5′- P12268 PubMed 55805.1 174.2461 monophosphate dehydrogenase 2 Signal P40763 88068.1 15.8176 22 transducer and activator of transcription 3 Tyrosine- Q06187 76281.5 10.8031 protein kinase BTK Regulatory- Q8N122 149038.0 4.8217 13 associated protein of mTOR; RAPTOR Rapamycin- Q6R327 192218.0 1.0407 7 insensitive companion of mTOR; RICTOR Mitogen- Q9Y6R4 181552.1 4.3965 6 activated protein kinase kinase kinase 4; MEKK4 Dedicator of Q92608 211949.0 4.2624 5 cytokinesis protein 2; DOCK2 Growth factor P62993 25206.4 20.7753 receptor- bound protein 2; Grb2 Epidermal P42566 PubMed 98655.9 20.4881 24 growth factor receptor substrate 15 Phosphatidylinositol P42356 231319.9 5.5247 12 4-kinase alpha Serine/threonine- Q9UBE8 http://www.ncbi.nim.nih.gov/pubmed/15764709 57048.5 7.0941 protein kinase NLK Histone- Q86X55 63460.1 50.3460 5 arginine methyltransferase CARM1 Protein Q14744 72684.1 17.3556 arginine N- methyltransferase 5 Crk-like P46109 33777.1 4.4171 protein; CRKL Proliferation- Q9UQ80 43787.0 28.0444 associated protein 2G4 Serine/threonine- P30153 65308.8 125.6820 protein phosphatase 2A 65 kDa regulatory subunit A alpha isoform Serine/threonine- P30154 66213.7 5.3180 protein phosphatase 2A 65 kDa regulatory subunit A beta isoform Mitogen- Q16539 41293.4 2.1763 activated protein kinase 14; p38 Protein ALO17 Q9HCF4 174897.6 9.9440 22 Vascular P17948 PubMed 150769.1 2.0434 endothelial growth factor receptor 1; VEGFR-1 Beta-type P09619 122828.1 2.0664 platelet- derived growth factor receptor; PDGFRB Protein- Q14289 115875.0 1.3365 4 tyrosine kinase 2-beta; FAK-2 Talin-1; TLN-1 Q9Y490 269767.8 3.1856 19 Vinculin P18206 123799.6 17.7700 35 Filamin-A P21333 280739.6 8.4872 42 Transforming Q8WUH2 97158.1 1.7989 15 growth factor- beta receptor- associated protein 1 DNA- P78527 469090.2 71.4210 236 30 dependent protein kinase catalytic subunit Plasminogen Q8NC51 44965.4 19.2385 activator inhibitor 1 RNA-binding protein; SERBP1 Metastasis- Q94776 PubMed 75023.3 17.8585 associated protein MTA2 Serine/threonine- Q98ZL6 96722.5 3.5358 6 protein kinase D2; PRKD2 RuvB-like 2; Q9Y230 51156.7 96.1562 TIP48 RuvB-like 1; Q9Y265 50228.1 111.9313 TIP49 Casein kinase P19784 41213.3 1.6994 II subunit alpha′ Casein kinase P67870 24942.5 9.0324 II subunit beta Casein kinase I P48729 38915.0 7.8446 isoform alpha N-terminal Q96KG9 89631.5 14.6654 11 kinase-like protein; SCYL1, telomerase i Telomere Q9Y4R8 PubMed: 91747.2 7.6607 25 length 12670948 regulation protein TEL2 homolog 182 kDa Q9C0C2 181781.8 7.9788 12 tankyrase-1- binding protein Serine/threonine- Q5H9R7 97669.4 10.1079 16 protein phosphatase 6 regulatory subunit 3; SAPS3 CDC27; P30260 91867.6 4.4289 17 Anaphase- promoting complex subunit 3 Inhibitor of Q15111 84729.2 2.1707 16 nuclear factor kappa-B kinase subunit alpha Serine/threonine- P67775 35594.3 63.3310 protein phosphatase 2A catalytic subunit alpha isoform Arf-GAP with Q15057 88028.9 4.8244 18 coiled-coil, ANK repeat and PH domain- containing protein 2 Interleukin Q12905 43062.2 48.8644 enhancer- binding factor 2; ILF2 Interleukin Q12906 95338.6 16.2442 9 20 enhancer- binding factor 3; ILF3 14-3-3 protein P62258 29174.0 20.1372 epsilon; YWHAE 14-3-3 protein P61981 28302.7 25.6664 gamma; YWHAG Serine/threonine- Q8TD19 107168.8 5.5558 5 protein kinase Nek9 Serine- Q9Y3F4 38438.4 9.5433 threonine kinase receptor- associated protein; STRAP Transforming Q969Z0 70738.2 7.4653 growth factor beta regulator 4 Insulin-like Q00425 63720.1 14.2841 growth factor 2 mRNA-binding protein 3 Insulin-like Q9NZI8 63456.6 26.2110 growth factor 2 mRNA-binding protein 1; IGF2BP1 Cell Q92600 33631.3 16.2644 differentiation protein RCD1 homolog 5′-AMP- Q13131 62807.9 11.2910 activated protein kinase catalytic subunit alpha- 1; PRKAA1 5′-AMP- P54619 37579.5 25.9468 activated protein kinase subunit gamma-1; PRKAG1 Calpain small P04632 28315.8 10.0635 subunit 1; CAPNS1 Cell growth- Q9NX58 43614.9 4.7794 regulating nucleolar protein; LYAR Serine Q43464 48840.9 8.0093 protease HTRA2 Kelch-like Q14145 69666.5 12.8272 ECH- associated protein 1 THUMP Q9BV44 57002.9 15.3092 domain- containing protein 3 Histone Q14929 49512.7 10.9424 acetyltransferase type B catalytic subunit; HAT1 Proliferating P12004 28768.9 38.3707 cell nuclear antigen Mitotic Q43684 37154.9 12.0013 checkpoint protein BUB3 Histone Q13547 55103.1 19.2088 deacetylase 1; HDAC1 Histone Q13547 48847.9 9.1175 deacetylase 3; HDAC3 Histone Q92769 55364.4 15.8525 deacetylase 2; HDAC2 Histone Q9UBN7 131419.6 8.6654 11 deacetylase 6; HDAC6 N- Q9H0A0 115704.1 3.0039 4 acetyltransferase 10; NAT10 Histone H1.2 P16403 21364.8 7.5569 BRCA1-A Q9NXR7 46974.6 11.1230 complex subunit BRE S-adenosyl-L- Q8N1G2 95321.1 3.4876 9 methionine- dependent methyltransferase FTSJD2 Cell division Q75419 65568.8 13.0274 control protein 45 homolog Probable Q76071 37840.1 15.5890 cytosolic iron- sulfur protein assembly protein CIAO1 Serine/threonine- Q96SB34 74325.0 7.2125 6 protein kinase SRPK1 Regulator of Q95758 59689.7 0.5622 differentiation 1′ ROD1 Mitogen- P45983 48295.7 6.6247 activated protein kinase 8; JNK1; SAPK1 Transducin- Q04726 83416.9 3.7256 like enhancer protein 3; TLE3 Mitogen- P45984 48139.2 3.5130 activated protein kinase 9; JNK2 Serine/threonine- Q66LE6 52042.6 5.9742 protein phosphatase 2A 55 kDa regulatory subunit B delta isoform Serine/threonine- Q8TF05 107004.4 9.6747 13 protein phosphatase 4 regulatory subunit 1 Mitogen- P31152 65921.9 1.9160 activated protein kinase 4; ERK4 Mitogen- Q16659 82681.0 3.0471 activated protein kinase 6; ERK3 Cell division P50613 39038.5 3.8042 protein kinase 7 Cell division P24941 33929.6 3.8552 protein kinase 2 Tyrosine- Q9H3S7 178974.0 5.6692 10 protein phosphatase non-receptor type 23; PTPN23 Tyrosine- P18031 49967.0 3.5169 protein phosphatase non-receptor type 1; PTPN1 Probable E3 Q9H000 46940.5 7.3243 ubiquitin- protein ligase makorin-2 E3 ubiquitin- Q9UNE7 34856.3 30.9572 protein ligase CHIP Protein SET Q01105 33488.9 21.0046 E3 ubiquitin- Q5T4S7 573842.7 20.1396 112 protein ligase UBR4 ELAV-like Q15717 36092.0 55.2953 protein 1 28 kDa heat- Q13442 20630.0 3.7688 and acid-stable phosphoprotein Autophagy Q9H1Y0 32447.3 2.0138 protein 5 Serine/threonine- Q13535 301367.6 1.0124 10 protein kinase ATR Protein Q8N163 102901.7 22.1394 19 KIAA1967 p30 DBC Transcriptional Q8WXI9 65260.9 1.5826 repressor p66- beta Transcription Q00267 120999.8 6.9075 18 elongation factor SPT5 Phosducin-like Q9H2J4 27614.4 4.3938 protein 3 Nuclease- P67809 35924.2 45.8457 sensitive element- binding protein 1 Protein CREG1 Q75629 24074.6 8.0371 Ras Q15404 31540.3 3.2914 suppressor protein 1 Large proline- P46379 119409.0 5.9599 5 rich protein BAT3 Serine/threonine- Q9BVS4 63283.2 3.6676 6 protein kinase RIO2 Serine/threonine- P36873 36983.9 4.9265 protein phosphatase PP1-gamma catalytic subunit Integrin-linked Q13418 51419.4 1.6140 protein kinase; ILK Proto- P11309 45412.5 0.6796 oncogene serine/threonine- protein kinase pim-1 Endoplasmin; P14625 92469.0 127.8154 21 79 GRP94 Heat shock Q12931 80110.2 209.2569 protein 75 kDa, mitochondrial, TRAP1 Hsc70- P50502 41331.8 96.9194 interacting protein; HIP Stress- P31948 62639.5 129.2074 induced- phosphoprotein 1; HOP Heat shock P11142 70898.2 211.9690 cognate 71 kDa protein Heat shock 70 kDa P08107 70052.3 115.7597 protein 1A/1B Heat shock- P54652 70021.1 7.7656 related 70 kDa protein 2 Heat shock 70 kDa P34932 94331.2 5.9277 9 protein 4 Heat shock 70 kDa P17066 71028.3 1.6158 protein 6 Hsp90 co- Q16543 44468.5 45.9047 chaperone Cdc37 Activator of 90 kDa Q95433 38274.4 19.5699 heat shock protein ATPase homolog 1; AHSA1 DnaJ homolog Q75165 29841.7 6.8808 subfamily C member 8 DnaJ homolog Q9UBS4 40514.0 14.4606 subfamily B member 11 DnaJ homolog Q99615 56441.0 19.0068 subfamily C member 7 DnaJ homolog Q60884 45745.8 31.2111 subfamily A member 2 DnaJ homolog Q8WXX5 29909.8 4.9413 subfamily C member 9 DnaJ homolog P31689 44868.4 49.8849 subfamily A member 1 DnaJ homolog Q96EY1 52537.9 7.9449 subfamily A member 3 Peptidyl-prolyl Q02790 51804.7 58.4334 cis-trans isomerase FKBP4 Peptidyl-prolyl Q14318 44561.8 1.5935 cis-trans isomerase FKBP8 Peptidyl-prolyl Q13356 58823.6 6.0454 cis-trans isomerase-like 2 AH receptor- Q00170 37664.2 32.7606 interacting protein; Immunophilin homolog ARA9 Heat shock Q92598 96865.2 0.8860 protein 105 kDa; Hsp110 BAG family Q95816 23772.0 4.0787 molecular chaperone regulator 2 Protein unc-45 Q9H3U1 103077.2 16.4590 28 homolog A Mitochondrial Q94826 67455.0 3.4547 import receptor subunit TOM70 Stress-70 P38646 73680.7 31.2908 protein; GRP75 78 kDa P11021 72333.1 12.7943 glucose- regulated protein; GRP78 60 kDa heat P10809 61054.8 27.0126 shock protein; Hsp60 Heat shock P04792 22782.6 162.0092 protein beta-1; Hsp27 Run2 60-80 40-60 <40 >200 150-200 110-150 80-110 60-80 40-60 <40 MAXIMUM Matched Peptides by Fraction matched Protein.Name.Abbrev JA05 JA06 JA07 JA08 JA09 JA10 JA11 JA12 JA13 JA14 peptides Heat shock 54 55 20 25 5 24 242 57 51 19 260 protein HSP 90-beta Heat shock 47 38 14 14 20 234 11 234 protein HSP 90-alpha Signal 73 78 transducer and activator of transcription 5A Signal 62 64 transducer and activator of transcription 5B Mitogen- 79 65 79 activated protein kinase 1; MAPK1; ERK-2 Serine/threonine- 48 16 48 protein kinase mTOR Serine/threonine- 16 16 protein kinase TBK1 Phosphoinositide 14 14 3-kinase regulatory subunit 4 Cell division 27 24 27 protein kinase 1; CDK1 Calpain-1 22 27 27 catalytic subunit; CAPN1 Mitogen- 27 27 27 activated protein kinase 3; ERK-1 Ribosomal 15 20 protein S6 kinase alpha-3; RSK2 Inosine-5′- 66 7 70 14 70 monophosphate dehydrogenase 2 Signal 24 24 transducer and activator of transcription 3 Tyrosine- 11 14 14 protein kinase BTK Regulatory- 14 14 associated protein of mTOR; RAPTOR Rapamycin- 7 insensitive companion of mTOR; RICTOR Mitogen- 11 11 activated protein kinase kinase kinase 4; MEKK4 Dedicator of 16 16 cytokinesis protein 2; DOCK2 Growth factor 15 16 16 receptor- bound protein 2; Grb2 Epidermal 33 33 growth factor receptor substrate 15 Phosphatidylinositol 18 18 4-kinase alpha Serine/threonine- 7 14 14 protein kinase NLK Histone- 22 7 25 25 arginine methyltransferase CARM1 Protein 27 31 31 arginine N- methyltransferase 5 Crk-like 11 11 protein; CRKL Proliferation- 18 27 27 associated protein 2G4 Serine/threonine- 78 76 11 78 protein phosphatase 2A 65 kDa regulatory subunit A alpha isoform Serine/threonine- 34 37 37 protein phosphatase 2A 65 kDa regulatory subunit A beta isoform Mitogen- 9 11 11 activated protein kinase 14; p38 Protein ALO17 34 34 Vascular 23 14 23 endothelial growth factor receptor 1; VEGFR-1 Beta-type 13 16 16 platelet- derived growth factor receptor; PDGFRB Protein- 4 tyrosine kinase 2-beta; FAK-2 Talin-1; TLN-1 25 25 Vinculin 46 46 Filamin-A 46 46 Transforming 15 growth factor- beta receptor- associated protein 1 DNA- 251 41 251 dependent protein kinase catalytic subunit Plasminogen 17 20 20 activator inhibitor 1 RNA-binding protein; SERBP1 Metastasis- 26 24 26 associated protein MTA2 Serine/threonine- 9 9 protein kinase D2; PRKD2 RuvB-like 2; 51 59 59 TIP48 RuvB-like 1; 10 53 56 56 TIP49 Casein kinase 9 11 11 II subunit alpha′ Casein kinase 3 5 5 II subunit beta Casein kinase I 5 7 7 isoform alpha N-terminal 21 21 kinase-like protein; SCYL1, telomerase i Telomere 20 25 length regulation protein TEL2 homolog 182 kDa 22 22 tankyrase-1- binding protein Serine/threonine- 24 24 protein phosphatase 6 regulatory subunit 3; SAPS3 CDC27; 20 20 Anaphase- promoting complex subunit 3 Inhibitor of 16 nuclear factor kappa-B kinase subunit alpha Serine/threonine- 20 16 20 protein phosphatase 2A catalytic subunit alpha isoform Arf-GAP with 22 22 coiled-coil, ANK repeat and PH domain- containing protein 2 Interleukin 25 20 25 enhancer- binding factor 2; ILF2 Interleukin 9 21 21 enhancer- binding factor 3; ILF3 14-3-3 protein 15 17 17 epsilon; YWHAE 14-3-3 protein 12 12 12 gamma; YWHAG Serine/threonine- 11 11 protein kinase Nek9 Serine- 16 10 16 threonine kinase receptor- associated protein; STRAP Transforming 14 14 14 growth factor beta regulator 4 Insulin-like 18 16 18 growth factor 2 mRNA-binding protein 3 Insulin-like 32 22 32 growth factor 2 mRNA-binding protein 1; IGF2BP1 Cell 9 10 10 differentiation protein RCD1 homolog 5′-AMP- 12 9 12 activated protein kinase catalytic subunit alpha- 1; PRKAA1 5′-AMP- 19 19 19 activated protein kinase subunit gamma-1; PRKAG1 Calpain small 9 6 9 subunit 1; CAPNS1 Cell growth- 4 7 7 regulating nucleolar protein; LYAR Serine 6 6 6 protease HTRA2 Kelch-like 21 20 21 ECH- associated protein 1 THUMP 18 19 19 domain- containing protein 3 Histone 4 18 18 acetyltransferase type B catalytic subunit; HAT1 Proliferating 18 16 18 cell nuclear antigen Mitotic 8 10 10 checkpoint protein BUB3 Histone 11 16 16 deacetylase 1; HDAC1 Histone 9 13 13 deacetylase 3; HDAC3 Histone 7 11 11 deacetylase 2; HDAC2 Histone 9 11 deacetylase 6; HDAC6 N- 14 14 acetyltransferase 10; NAT10 Histone H1.2 7 6 7 BRCA1-A 8 12 12 complex subunit BRE S-adenosyl-L- 10 10 methionine- dependent methyltransferase FTSJD2 Cell division 14 14 14 control protein 45 homolog Probable 8 13 13 cytosolic iron- sulfur protein assembly protein CIAO1 Serine/threonine- 10 10 protein kinase SRPK1 Regulator of 13 13 differentiation 1′ ROD1 Mitogen- 13 6 13 activated protein kinase 8; JNK1; SAPK1 Transducin- 13 13 like enhancer protein 3; TLE3 Mitogen- 7 12 12 activated protein kinase 9; JNK2 Serine/threonine- 13 10 13 protein phosphatase 2A 55 kDa regulatory subunit B delta isoform Serine/threonine- 15 15 protein phosphatase 4 regulatory subunit 1 Mitogen- 7 6 7 activated protein kinase 4; ERK4 Mitogen- 9 11 11 activated protein kinase 6; ERK3 Cell division 6 9 9 protein kinase 7 Cell division 9 8 9 protein kinase 2 Tyrosine- 13 13 protein phosphatase non-receptor type 23; PTPN23 Tyrosine- 9 9 protein phosphatase non-receptor type 1; PTPN1 Probable E3 11 12 12 ubiquitin- protein ligase makorin-2 E3 ubiquitin- 14 12 14 protein ligase CHIP Protein SET 7 9 9 E3 ubiquitin- 128 128 protein ligase UBR4 ELAV-like 20 21 21 protein 1 28 kDa heat- 2 2 and acid-stable phosphoprotein Autophagy 9 9 protein 5 Serine/threonine- 10 protein kinase ATR Protein 26 26 KIAA1967 p30 DBC Transcriptional 13 13 repressor p66- beta Transcription 16 18 elongation factor SPT5 Phosducin-like 4 5 5 protein 3 Nuclease- 26 24 26 sensitive element- binding protein 1 Protein CREG1 2 3 3 Ras 5 4 5 suppressor protein 1 Large proline- 6 6 rich protein BAT3 Serine/threonine- 6 protein kinase RIO2 Serine/threonine- 8 7 8 protein phosphatase PP1-gamma catalytic subunit Integrin-linked 4 4 protein kinase; ILK Proto- 4 4 oncogene serine/threonine- protein kinase pim-1 Endoplasmin; 22 14 4 48 71 20 7 79 GRP94 Heat shock 80 90 90 protein 75 kDa, mitochondrial, TRAP1 Hsc70- 23 19 23 interacting protein; HIP Stress- 68 72 72 induced- phosphoprotein 1; HOP Heat shock 73 105 105 cognate 71 kDa protein Heat shock 70 kDa 65 82 82 protein 1A/1B Heat shock- 37 45 45 related 70 kDa protein 2 Heat shock 70 kDa 17 17 protein 4 Heat shock 70 kDa 39 44 44 protein 6 Hsp90 co- 17 16 17 chaperone Cdc37 Activator of 90 kDa 12 12 12 heat shock protein ATPase homolog 1; AHSA1 DnaJ homolog 5 6 6 subfamily C member 8 DnaJ homolog 5 6 6 subfamily B member 11 DnaJ homolog 14 24 24 subfamily C member 7 DnaJ homolog 23 22 23 subfamily A member 2 DnaJ homolog 3 4 4 subfamily C member 9 DnaJ homolog 26 26 26 subfamily A member 1 DnaJ homolog 12 11 12 subfamily A member 3 Peptidyl-prolyl 37 50 50 cis-trans isomerase FKBP4 Peptidyl-prolyl 5 5 cis-trans isomerase FKBP8 Peptidyl-prolyl 11 21 21 cis-trans isomerase-like 2 AH receptor- 20 20 20 interacting protein; Immunophilin homolog ARA9 Heat shock 9 9 protein 105 kDa; Hsp110 BAG family 4 2 4 molecular chaperone regulator 2 Protein unc-45 45 45 homolog A Mitochondrial 14 10 14 import receptor subunit TOM70 Stress-70 41 38 41 protein; GRP75 78 kDa 32 36 36 glucose- regulated protein; GRP78 60 kDa heat 32 28 32 shock protein; Hsp60 Heat shock 24 21 24 protein beta-1; Hsp27 *in gray are proteins for which the excized gel size fails to mach the reported MW
TABLE-US-00008 TABLE 5e Function, pathway and network analysis eligible proteins selected for processing by Ingenuity Pathway from the input list ©2000-2010 Ingenuity Systems, Inc. All rights reserved. ID Gene Description Location Family Drugs P07900 HSP90AA1 heat shock protein 90 kDa Cytoplasm other 17-dimethylaminoethylamino- alpha (cytosolic), class A 17-demethoxygeldanamycin, member 1 IPI-504 P08238 HSP90AB1 heat shock protein 90 kDa Cytoplasm other 17-dimethylaminoethylamino- alpha (cytosolic), class B 17-demethoxygeldanamycin, member 1 IPI-504 P00519 ABL1 c-abl oncogene 1, receptor Nucleus kinase saracatinib, imatinib, tyrosine kinase temozolomide P11274 BCR breakpoint cluster region Cytoplasm kinase imatinib P51812 RPS6KA3 ribosomal protein S6 Cytoplasm kinase kinase, 90 kDa, polypeptide 3 Q15418 RPS6KA1 ribosomal protein S6 Cytoplasm kinase kinase, 90 kDa, polypeptide 1 P42345 MTOR mechanistic target of Nucleus kinase deforolimus, OSI-027, rapamycin temsirolimus, tacrolimus, (serine/threonine kinase) everolimus Q8N122 RPTOR regulatory associated Cytoplasm other protein of MTOR, complex 1 Q99570 PIK3R4 phosphoinositide-3-kinase, Cytoplasm kinase regulatory subunit 4 Q8NEB9 PIK3C3 phosphoinositide-3-kinase, Cytoplasm kinase class 3 Q9BPZ7 MAPKAP1 mitogen-activated protein unknown other kinase associated protein 1 P42229 STAT5A signal transducer and Nucleus transcription activator of transcription 5A regulator P51692 STAT5B signal transducer and Nucleus transcription activator of transcription 5B regulator P04049 RAF1 v-raf-1 murine leukemia Cytoplasm kinase sorafenib viral oncogene homolog 1 P10398 ARAF v-raf murine sarcoma 3611 Cytoplasm kinase viral oncogene homolog P15498 VAV1 vav 1 guanine nucleotide Nucleus transcription exchange factor regulator Q06187 BTK Bruton Cytoplasm kinase agammaglobulinemia tyrosine kinase Q05397 PTK2 PTK2 protein tyrosine Cytoplasm kinase kinase 2 Q9H3S7 PTPN23 protein tyrosine Cytoplasm phosphatase phosphatase, non-receptor type 23 P40763 STAT3 signal transducer and Nucleus transcription activator of transcription 3 regulator (acute-phase response factor) P51617 IRAK1 interleukin-1 receptor- Plasma kinase associated kinase 1 Membrane P28482 MAPK1 mitogen-activated protein Cytoplasm kinase kinase 1 Q9Y6R4 MAP3K4 mitogen-activated protein Cytoplasm kinase kinase kinase kinase 4 Q15750 TAB1 TGF-beta activated kinase 1/ Cytoplasm enzyme MAP3K7 binding protein 1 Q16539 MAPK14 mitogen-activated protein Cytoplasm kinase SCIO-469, RO-3201195 kinase 14 P07384 CAPN1 calpain 1, (mu/l) large Cytoplasm peptidase subunit O00425 IGF2BP3 insulin-like growth factor 2 Cytoplasm translation mRNA binding protein 3 regulator O88477 IGF2BP1 insulin-like growth factor 2 Cytoplasm translation mRNA binding protein 1 regulator Q9Y6M1 IGF2BP2 insulin-like growth factor 2 Cytoplasm translation mRNA binding protein 2 regulator Q9Y265 RUVBL1 RuvB-like 1 (E. coli) Nucleus transcription regulator Q9Y230 RUVBL2 RuvB-like 2 (E. coli) Nucleus transcription regulator Q99417 MYCBP c-myc binding protein Nucleus transcription regulator O43823 AKAP8 A kinase (PRKA) anchor Nucleus other protein 8 Q9ULX6 AKAP8L A kinase (PRKA) anchor Nucleus other protein 8-like P06748 NPM1 nucleophosmin (nucleolar Nucleus transcription (includes phosphoprotein B23, regulator EG: 4869) numatrin) Q86X55 CARM1 coactivator-associated Nucleus transcription arginine methyltransferase 1 regulator Q13555 CAMK2G calcium/calmodulin- Cytoplasm kinase dependent protein kinase II gamma P29597 TYK2 tyrosine kinase 2 Plasma kinase Membrane Q9UHD2 TBK1 TANK-binding kinase 1 Cytoplasm kinase P42356 PI4KA phosphatidylinositol 4- Cytoplasm kinase kinase, catalytic, alpha Q96Q15 SMG1 SMG1 homolog, Cytoplasm kinase phosphatidylinositol 3- kinase-related kinase (C. elegans) Q93100 PHKB phosphorylase kinase, beta Cytoplasm kinase Q9NVE7 PANK4 pantothenate kinase 4 Cytoplasm kinase Q13131 PRKAA1 protein kinase, AMP- Cytoplasm kinase activated, alpha 1 catalytic subunit Q8N7V9 PRKAG1 protein kinase, AMP- Nucleus kinase activated, gamma 1 non- catalytic subunit Q96KG9 SCYL1 SCY1-like 1 (S. cerevisiae) Cytoplasm kinase Q13315 ATM ataxia telangiectasia Nucleus kinase mutated Q13535 ATR ataxia telangiectasia Nucleus kinase (includes and Rad3 related EG: 545) Q9Y3F4 STRAP serine/threonine kinase Plasma other receptor associated protein Membrane Q9BVS4 RIOK2 RIO kinase 2 (yeast) unknown kinase Q9BZL6 PRKD2 protein kinase D2 Cytoplasm kinase P48729 CSNK1A1 casein kinase 1, alpha 1 Cytoplasm kinase P67870 CSNK2B casein kinase 2, beta Cytoplasm kinase polypeptide Q8IVT5 KSR1 kinase suppressor of ras 1 Cytoplasm kinase Q9NSY1 BMP2K BMP2 inducible kinase Nucleus kinase (includes EG: 55589) Q96SB4 SRPK1 SFRS protein kinase 1 Nucleus kinase P78362 SRPK2 SFRS protein kinase 2 Nucleus kinase P53350 PLK1 polo-like kinase 1 Nucleus kinase BI 2536 (Drosophila) P06493 CDK1 cyclin-dependent kinase 1 Nucleus kinase flavopiridol P50613 CDK7 cyclin-dependent kinase 7 Nucleus kinase BMS-387032, flavopiridol Q8IX12 CCAR1 cell division cycle and Nucleus other apoptosis regulator 1 P30260 CDC27 cell division cycle 27 Nucleus other homolog (S. cerevisiae) Q9UJX2 CDC23 cell division cycle 23 Nucleus enzyme (includes homolog (S. cerevisiae) EG: 8697) Q13042 CDC16 cell division cycle 16 Nucleus other homolog (S. cerevisiae) P50750 CDK9 cyclin-dependent kinase 9 Nucleus kinase BMS-387032, flavopiridol O60566 BUB1B budding uninhibited by Nucleus kinase benzimidazoles 1 homolog beta (yeast) O43683 BUB1 budding uninhibited by Nucleus kinase benzimidazoles 1 homolog (yeast) Q9H1A4 ANAPC1 anaphase promoting Nucleus other complex subunit 1 Q9UJX3 ANAPC7 anaphase promoting unknown other complex subunit 7 Q9UJX4 ANAPC5 anaphase promoting Nucleus enzyme complex subunit 5 Q9UJX5 ANAPC4 anaphase promoting unknown enzyme complex subunit 4 Q8TD19 NEK9 NIMA (never in mitosis Nucleus kinase (includes gene a)- related kinase 9 EG: 91754) O75419 CDC45L CDC45 cell division cycle Nucleus other 45-like (S. cerevisiae) P46109 CRKL v-crk sarcoma virus CT10 Cytoplasm kinase oncogene homolog (avian)-like Q92608 DOCK2 dedicator of cytokinesis 2 Cytoplasm other Q96N67 DOCK7 dedicator of cytokinesis 7 unknown other (includes EG: 85440) Q5JSL3 DOCK11 dedicator of cytokinesis 11 unknown other P42566 EPS15 epidermal growth factor Plasma other receptor pathway substrate 15 Membrane P62993 GRB2 growth factor receptor- Cytoplasm other bound protein 2 Q13546 RIPK1 receptor (TNFRSF)- Plasma kinase interacting serine-threonine Membrane kinase 1 Q14687 KIAA0182 KIAA0182 unknown other Q13501 SQSTM1 sequestosome 1 Cytoplasm transcription regulator Q9BZK7 TBL1XR1 transducin (beta)-like 1 X- Nucleus transcription linked receptor 1 regulator O14744 PRMT5 protein arginine Cytoplasm enzyme methyltransferase 5 Q96LA8 PRMT6 protein arginine Nucleus enzyme methyltransferase 6 Q8WUV3 PRMT3 protein arginine Nucleus enzyme methyltransferase 3 Q2TAZ0 ATG2A ATG2 autophagy related 2 unknown other homolog A (S. cerevisiae) Q9C0C7 AMBRA1 autophagy/beclin-1 unknown other regulator 1 Q9H1Y0 ATG5 ATG5 autophagy related 5 Cytoplasm other (includes homolog (S. cerevisiae) EG: 9474) P62258 YWHAE tyrosine 3- Cytoplasm other monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide Q9BQG0 MYBBP1A MYB binding protein (P160) 1a Nucleus transcription regulator Q92600 RQCD1 RCD1 required for cell unknown other differentiation1 homolog (S. pombe) Q16531 DDB1 damage-specific DNA Nucleus other binding protein 1, 127 kDa P67809 YBX1 Y box binding protein 1 Nucleus transcription regulator Q9UKL0 RCOR1 REST corepressor 1 Nucleus transcription regulator Q13547 HDAC1 histone deacetylase 1 Nucleus transcription tributyrin, belinostat, regulator pyroxamide, MGCD0103, vorinostat, romidepsin O60341 KDM1A lysine (K)-specific Nucleus enzyme demethylase 1A Q9UBN7 HDAC6 histone deacetylase 6 Nucleus transcription tributyrin, belinostat, regulator pyroxamide, vorinostat, romidepsin Q16576 RBBP7 retinoblastoma binding Nucleus transcription protein 7 regulator Q92769 HDAC2 histone deacetylase 2 Nucleus transcription tributyrin, belinostat, regulator pyroxamide, vorinostat, romidepsin Q92922 SMARCC1 SWI/SNF related, matrix Nucleus transcription associated, actin regulator dependent regulator of chromatin, subfamily c, member 1 Q8TAQ2 SMARCC2 SWI/SNF related, matrix Nucleus transcription (includes associated, actin regulator EG: 6601) dependent regulator of chromatin, subfamily c, member 2 Q03169 TNFAIP2 tumor necrosis factor, Extracellular other alpha-induced protein 2 Space Q13492 PICALM phosphatidylinositol binding Cytoplasm other clathrin assembly protein Q8N163 KIAA1967 KIAA1967 Cytoplasm peptidase P33992 MCM5 minichromosome Nucleus enzyme maintenance complex component 5 P02786 TFRC transferrin receptor (p90, Plasma transporter CD71) Membrane Q13263 TRIM28 tripartite motif-containing 28 Nucleus transcription regulator Q9Y490 TLN1 talin 1 Plasma other Membrane O14777 NDC80 NDC80 homolog, Nucleus other kinetochore complex component (S. cerevisiae) Q13576 IQGAP2 IQ motif containing GTPase Cytoplasm other activating protein 2 P14174 MIF macrophage migration Extracellular cytokine inhibitory factor Space (glycosylation-inhibiting factor) Q9UQ80 PA2G4 proliferation-associated Nucleus transcription 2G4, 38 kDa regulator Q7L576 CYFIP1 cytoplasmic FMR1 Cytoplasm other interacting protein 1 P12004 PCNA proliferating cell nuclear Nucleus other antigen Q08J23 NSUN2 NOP2/Sun domain family, unknown enzyme member 2 O75376 NCOR1 nuclear receptor co- Nucleus transcription repressor 1 regulator Q9Y618 NCOR2 nuclear receptor co- Nucleus transcription repressor 2 regulator Q12906 ILF3 interleukin enhancer Nucleus transcription binding factor 3, 90 kDa regulator Q12905 ILF2 interleukin enhancer Nucleus transcription (includes binding factor 2, 45 kDa regulator EG: 3608) Q07666 KHDRBS1 KH domain containing, Nucleus transcription RNA binding, signal regulator transduction associated 1 Q9HCF4 RNF213 ring finger protein 213 Plasma other Membrane O94776 MTA2 metastasis associated 1 Nucleus transcription family, member 2 regulator P53041 PPP5C protein phosphatase 5, Nucleus phosphatase catalytic subunit O60610 DIAPH1 diaphanous homolog 1 Cytoplasm other (Drosophila) P27694 RPA1 replication protein A1, Nucleus other 70 kDa Q8NC51 SERBP1 SERPINE1 mRNA binding Nucleus other protein 1 P30154 PPP2R1B protein phosphatase 2 unknown phosphatase (formerly 2A), regulatory subunit A, beta isoform P63151 PPP2R2A protein phosphatase 2 Cytoplasm phosphatase (formerly 2A), regulatory subunit B, alpha isoform Q9UPN7 SAPS1 SAPS domain family, unknown other member 1 Q8WUH2 TGFBRAP1 transforming growth factor, Cytoplasm other beta receptor associated protein 1 Q9NTK5 OLA1 Obg-like ATPase 1 Cytoplasm other Q9UBR2 CTSZ cathepsin Z Cytoplasm peptidase (includes EG: 1522) Q15057 ACAP2 ArfGAP with coiled-coil, Nucleus other ankyrin repeat and PH domains 2 Q9Y2X7 GIT1 G protein-coupled receptor Nucleus other kinase interacting ArfGAP 1 Q92888 ARHGEF1 Rho guanine nucleotide Cytoplasm other exchange factor (GEF) 1 Q92974 ARHGEF2 Rho/Rac guanine Cytoplasm other nucleotide exchange factor (GEF) 2 P46060 RANGAP1 Ran GTPase activating Cytoplasm other protein 1 Q14C86 GAPVD1 GTPase activating protein unknown other and VPS9 domains 1 Q15042 RAB3GAP1 RAB3 GTPase activating Cytoplasm other protein subunit 1 (catalytic) P62826 RAN RAN, member RAS Nucleus enzyme oncogene family Q9NR31 SAR1A SAR1 homolog A Cytoplasm enzyme (S. cerevisiae) Q15907 RAB11B RAB11B, member RAS Cytoplasm enzyme oncogene family Q8TC07 TBC1D15 TBC1 domain family, Cytoplasm other member 15 Q9Y4R8 TELO2 TEL2, telomere unknown other maintenance 2, homolog (S. cerevisiae) Q5UIP0 RIF1 RAP1 interacting factor Nucleus other homolog (yeast) Q9BUR4 WRAP53 WD repeat containing, unknown other antisense to TP53 Q9C0C2 TNKS1BP1 tankyrase 1 binding protein 1, Nucleus other 182 kDa Q53EL6 PDCD4 programmed cell death 4 Nucleus other (neoplastic transformation inhibitor) Q86UX7 FERMT3 fermitin family homolog 3 Cytoplasm enzyme (Drosophila) Q14289 PTK2B PTK2B protein tyrosine Cytoplasm kinase kinase 2 beta P55196 MLLT4 myeloid/lymphoid or mixed- Nucleus other lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 Q9Y4L1 HYOU1 hypoxia up-regulated 1 Cytoplasm other Q96DA0 ZG16B zymogen granule protein unknown other 16 homolog B (rat) Q96PE3 INPP4A inositol polyphosphate-4- Cytoplasm phosphatase phosphatase, type I, 107 kDa P36915 GNL1 guanine nucleotide binding unknown other protein-like 1 Q9Y3Z3 SAMHD1 SAM domain and HD Nucleus enzyme domain 1 Q07157 TJP1 tight junction protein 1 Plasma other (zona occludens 1) Membrane P46379 BAT3 HLA-B associated Nucleus enzyme transcript 3 P21333 FLNA filamin A, alpha Cytoplasm other Q14315 FLNC filamin C, gamma Cytoplasm other Q86Y56 HEATR2 HEAT repeat containing 2 unknown other Q6AI08 HEATR6 HEAT repeat containing 6 unknown other P98160 HSPG2 heparan sulfate Plasma other (includes proteoglycan 2 Membrane EG: 3339) Q14247 CTTN cortactin Plasma other Membrane O00170 AIP aryl hydrocarbon receptor Nucleus transcription interacting protein regulator Q9H0A0 NAT10 N-acetyltransferase 10 Nucleus enzyme (GCN5-related) Q9UPY3 DICER1 dicer 1, ribonuclease type Cytoplasm enzyme III Q9NZB2 FAM120A family with sequence Cytoplasm other similarity 120A Q14980 NUMA1 nuclear mitotic apparatus Nucleus other protein 1 Q15645 TRIP13 thyroid hormone receptor Cytoplasm transcription interactor 13 regulator Q9Y4C2 FAM115A family with sequence unknown other similarity 115, member A Q8IYB8 SUPV3L1 suppressor of var1, 3-like 1 Cytoplasm enzyme (S. cerevisiae) Q96GA3 LTV1 LTV1 homolog (S. cerevisiae) unknown other Q9NX58 LYAR Ly1 antibody reactive Plasma other homolog (mouse) Membrane Q13510 ASAH1 N-acylsphingosine Cytoplasm enzyme amidohydrolase (acid ceramidase) 1 Q6UN15 FIP1L1 FIP1 like 1 (S. cerevisiae) Nucleus other Q14145 KEAP1 kelch-like ECH-associated Cytoplasm transcription protein 1 regulator Q12888 TP53BP1 tumor protein p53 binding Nucleus transcription protein 1 regulator Q07812 BAX BCL2-associated X protein Cytoplasm other Q9Y613 FHOD1 formin homology 2 domain Nucleus other containing 1 O75131 CPNE3 copine III Cytoplasm kinase Q04724 TLE1 transducin-like enhancer of Nucleus transcription split 1 (E(sp1) homolog, regulator Drosophila) O14773 TPP1 tripeptidyl peptidase I Cytoplasm peptidase O60524 SDCCAG1 serologically defined colon Nucleus other cancer antigen 1 Q9Y2A7 NCKAP1 NCK-associated protein 1 Plasma other Membrane Q7Z3B4 NUP54 nucleoporin 54 kDa Nucleus transporter Q9BW27 NUP85 nucleoporin 85 kDa Cytoplasm other Q12769 NUP160 nucleoporin 160 kDa Nucleus transporter A5YKK6 CNOT1 CCR4-NOT transcription unknown other complex, subunit 1 Q9H9A6 LRRC40 leucine rich repeat Nucleus other containing 40 Q99623 PHB2 prohibitin 2 Cytoplasm transcription regulator Q08AM6 VAC14 Vac14 homolog (S. cerevisiae) unknown other Q9ULX3 NOB1 NIN1/RPN12 binding Nucleus other protein 1 homolog (S. cerevisiae) P78395 PRAME preferentially expressed Nucleus other (includes antigen in melanoma EG: 23532) Q8N1G2 FTSJD2 FtsJ methyltransferase unknown other domain containing 2 P19838 NFKB1 nuclear factor of kappa light Nucleus transcription polypeptide gene enhancer regulator in B-cells 1 P08195 SLC3A2 solute carrier family 3 Plasma transporter (activators of dibasic and Membrane neutral amino acid transport), member 2 Q15773 MLF2 myeloid leukemia factor 2 Nucleus other Q9NR28 DIABLO diablo homolog Cytoplasm other (Drosophila) O95831 AIFM1 apoptosis-inducing factor, Cytoplasm enzyme mitochondrion-associated, 1 Q7Z2W4 ZC3HAV1 zinc finger CCCH-type, Plasma other antiviral 1 Membrane Q8WXF1 PSPC1 paraspeckle component 1 Nucleus other O43815 STRN striatin, calmodulin binding Cytoplasm other protein P35232 PHB prohibitin Nucleus transcription (includes regulator EG: 5245) Q15058 KIF14 kinesin family member 14 Cytoplasm other Q13227 GPS2 G protein pathway Nucleus other suppressor 2 O75534 CSDE1 cold shock domain Cytoplasm enzyme containing E1, RNA-binding Q14839 CHD4 chromodomain helicase Nucleus enzyme DNA binding protein 4 O14497 ARID1A AT rich interactive domain Nucleus transcription 1A (SWI-like) regulator Q9P035 PTPLAD1 protein tyrosine Cytoplasm other phosphatase-like A domain containing 1 Q8WUZ0 BCL7C B-cell CLL/lymphoma 7C unknown other Q92733 PRCC papillary renal cell Nucleus other carcinoma (translocation- associated) Q9Y6W5 WASF2 WAS protein family, Cytoplasm other member 2 Q8NDX1 PSD4 pleckstrin and Sec7 domain unknown other containing 4 O96006 ZBED1 zinc finger, BED-type Nucleus enzyme containing 1 Q92542 NCSTN nicastrin Plasma peptidase Membrane Q6NSH3 CT45A5 cancer/testis antigen family unknown other 45, member A5
TABLE-US-00009 TABLE 5f Significant networks and associated biofunctions assigned by Ingenuity Pathways Core Analysis to proteins isolated by PU-H71 in the K562 cell line ©2000-2010 Ingenuity Systems, Inc. All rights reserved. Focus ID Score* Molecules Top Functions Molecules in Network 1 38 22 Cell Cycle, 14-3-3, Akt, AMPK, ATM, ATR (includes EG: 545), Fgf, Carbohydrate HYOU1, INPP4A, Insulin, KHDRBS1, MAP2K1/2, Metabolism, Lipid MAPKAP1, MTOR, NGF, p70 S6k, p85 (pik3r), PA2G4, Metabolism Pi3-kinase, PIK3C3, PIK3R4, PRKAC, PRKAG1, Raf, RAF1, RPA1, RPS6KA1, RPTOR, SMG1, SRPK2, Stat1/3, STRAP, TELO2, TP53BP1, YWHAE, YWHAQ (includes EG: 10971) 2 36 22 Cell Signaling, alcohol group acceptor phosphotransferase, ARAF, BCR, Protein Synthesis, CAMK2G, Casein, CDK7, CK1, CSNK1A1, CSNK2B, Gm- Infection Mechanism csf, HINT1, Ifn, IFN TYPE 1, Ikb, IKK (complex), Ikk (family), IRAK, IRAK1, KEAP1, MALT1, MAP2K3, NFkB (complex), NFkB (family), PRKAA1, PRKD2, PTPLAD1, RIPK1, RPS6KA3, SARM1, SQSTM1, TAB1, TBK1, TFRC, Tnf receptor, TNFAIP2 3 33 20 Cell Death, Cell ABL1, ANAPC1, ANAPC4, ANAPC5, ANAPC7, APC, Cycle, Cell ARHGEF1, BUB1B, Caspase, Cdc2, CSDE1, CTSB, Morphology Cyclin A, Cyclin E, Cytochrome c, DIABLO, E2f, E3 RING, FBXO22, Hsp27, KIAA1967, Laminin, LGALS3, MAP3K4, MCM5, Mek, NPM1 (includes EG: 4869), NUMA1, P38 MAPK, PRAME (includes EG: 23532), Ras, Rb, RBX1 (includes EG: 9978), Sapk, SKP1 4 33 20 Cell Cycle 26s Proteasome, AKAP8L, Alp, ASAH1, ASCC2, BAT3, BAX, BMP2K (includes EG: 55589), DDB1, DICER1, ERH, Fibrinogen, hCG, Hsp70, IFN Beta, IgG, IL1, IL12 (complex), IL12 (family), Interferon alpha, LDL, NFKB1, OLA1 , PCNA, Pka, PRKACA, PRMT5, RNA polymerase II, RUVBL1, RUVBL2, STAT3, TLE1, TP63, Ubiquitin, ZC3HAV1 5 32 20 Cellular Assembly Adaptor protein 2, AIP, Ap1, ARHGEF2, BTF3, and Organization, Calcineurin protein(s), Calmodulin, CaMKII, Ck2, Collagen Cellular Function type IV, Creb, EPS15, Estrogen Receptor, G protein and Maintenance alphai, Hsp90, IGF2BP1, LYAR, Mapk, MAPK14, MIF, MOBKL3, NAT10, NMDA Receptor, NONO, NOP2, PDAP1, PDCD4, PI4KA, PICALM, PikSr, PP2A, PSPC1, RIF1, SRPK1, STRN 6 30 19 Gene Expression, ARID1A, atypical protein kinase C, CARM1, Cbp/p300, Cellular Assembly CHD4, ERK1/2, Esr1-Esr1-estrogen-estrogen, GIT1, and Organization, GPS2, Hdac1/2, HISTONE, Histone h3, Histone h4, Cellular KDM1A, Mi2, MTA2, MYBBP1A, N-cor, NCOR1, NCOR2, Compromise NCoR/SMRT corepressor, NuRD, PHB2, PHB (includes EG: 5245), Rar, RBBP7, RCOR1 , Rxr, SLC3A2, SMARCC1, SMARCC2 (includes EG: 6601), Sos, TBL1XR1, TIP60, TRIM28 7 22 15 Cell Cycle, AKAP8, AKAP14, ALDH1B1, CDCA7, CEPT1, CIT, Development CNBP, CPNE3, DISC1, DOCK11, FTSJD2, HIT, IFNA2, IGF2BP3, IQGAP3, KIF14, LGMN, MIR124, MIR129-2 (includes EG: 406918), MIRN339, MYC, MYCBP, NEK9 (includes EG: 91754), NFkB (complex), NUP160, PANK4, PEA15, PRPF40B, RNF213, SAMHD1, SCAMP5, TPP1, TRIM56, WRAP53, YME1L1 8 20 14 Cellular BCR, BTK, Calpain, CAPN1, CAPNS1, Collagen type I, Compromise, CRKL, DOCK2, Fcer1, GNRH, Ige, JAK, KSR1, MAPK1, Hypersensitivity NCK, NFAT (complex), Pdgf, PHKB, Pkg, PLC gamma, Response, Ptk, PTK2B, STAT, STAT1/3/5, STAT1/3/5/6, STAT3/5, Inflammatory STAT5A, STAT5a/b, STAT5B, SYK/ZAP, Talin, TLN1, Response TYK2, VAV, VAV1 9 20 14 Cell Morphology, ABLIM, ACAP2, AKR1C14, ARF6, ARPC1A, ATP9A, Cellular BUB1, CREBL2, DHRS3, DYRK3, FHOD1, FLNC, FSH, Development and GK7P, GNL1, GRB2, HEATR2, Lh, LOC81691, NCSTN, Function NDC80, PDGF BB, PI4K2A, PRMT6, PTP4A1, QRFP, RAB11B, RQCD1, SCARB2, SLC2A4, THBS1, TP53I11, TRIP13, Vegf, ZBED1 10 18 13 Cell Morphology AGT, AGTRAP, ATG5 (includes EG: 9474), Cathepsin, COL4A6, CORIN, ENPP1, FAM120A, GATM, H1FX, HSPG2 (includes EG: 3339), IGF2BP2, ITPA, KIAA0182, LPCAT3, MCPT1, MIR17 (includes EG: 406952), MYL3, NOS1, NSUN2, PFK, PLA1A, RPS6, SCYL1, SDPR, SERBP1, SMOC2, SRF, SRFBP1, STOML2, TGFB1, TGFBRAP1, TMOD3, VAC14, WIBG 11 17 12 Gene Expression, AMBRA1, AR, CDC45L, CDCA7L, CLDND1, CTDSP2, Developmental FAM115A, HEATR6, HNF4A, HYAL3, KIAA1468, Disorder LRRC40, MIR124-1 (includes EG: 406907), NUP54, PECI, PERP, POLR3G, PRCC, PTPN4, PTPN11, RIOK2, RNF6, RNPEPL1, SF3B4, SLC17A5, SLC25A20, SLC30A7, SLC39A7, SSFA2, STK19, SUPV3L1, TBC1D15, TCF19, ZBED3, ZZEF1 12 16 13 Cell Morphology, Actin, AIFM1, Arp2/3, CDS, CTTN, CYFIP1, DIAPH1, Cellular Assembly Dynamin, ERK, F Actin, FERMT3, Focal adhesion kinase, and Organization, Gpcr, Growth hormone, Integrin, IQGAP2, Jnk, Lfa-1, Cellular MLF2, MLLT4, NCKAP1, Nfat (family), Pak, PI3K, PI3K Development p85, Pkc(s), PPP5C, PTK2, Rac, Rap1, Ras homolog, Rsk, TCR, TJP1, WASF2 13 12 10 Cancer, Cell Cycle, ANKRD2, APRT, ARL6IP1, BANP, C11ORF82, CAMK1, Gene Expression CKMT1B, CNOT1, CTSZ (includes EG: 1522), DOCK7 (includes EG: 85440), FIP1L1, GART, GH1, GIP2, GSK3B, HDAC5, Hla-abc, IFNG, MAN2B1, NAPSA, NTHL1, NUP85, ORM2, PTPN23, SLC5A8, SLC6A6, TBX3, TNKS1BP1, TOB1, TP53, TRIM22, UNC5B, VPS33A, YBX1, YWHAZ *IPA computes a score for each possible network according to the fit of that network to the inputted proteins. The score is calculated as the negative base-10 logarithm of the p-value that indicates the likelihood of the inputted proteins in a given network being found together due to random chance. Therefore, scores of 2 or higher have at least a 99% confidence of not being generated by random chance alone.
Supplementary Materials and Methods
Reagents
[0275] The Hsp90 inhibitors, the solid-support immobilized and the fluorescein-labeled derivatives were synthesized as previously reported (Taldone et al., 2011, Synthesis and Evaluation of Small . . . ; Taldone et al., 2011, Synthesis and Evaluation of Fluorescent . . . ; He et al., 2006). We purchased Gleevec from LC Laboratories, AS703026 from Selleck, KN-93 from Tocris, and PP242, BMS-345541 and sodium vanadate from Sigma. All compounds were used as DMSO stocks.
Western Blotting
[0276] Cells were either treated with PU-H71 or DMSO (vehicle) for 24 h and lysed in 50 mM Tris, pH 7.4, 150 mM NaCl and 1% NP40 lysis buffer supplemented with leupeptin (Sigma Aldrich) and aprotinin (Sigma Aldrich). Protein concentrations were determined using BCA kit (Pierce) according to the manufacturer's instructions. Protein lysates (15-200 μg) were electrophoretically resolved by SDS/PAGE, transferred to nitrocellulose membrane and probed with the following primary antibodies against: Hsp90 (1:2000, SMC-107A/B; StressMarq), Bcr-Abl (1:75, 554148; BD Pharmingen), PI3K (1:1000, 06-195; Upstate), mTOR (1:200, Sc-1549; Santa Cruz), p-mTOR (1:1000, 2971; Cell Signaling), STAT3 (1:1000, 9132; Cell Signaling), p-STAT3 (1:2000, 9145; Cell Signaling), STAT5 (1:500, Sc-835; Santa Cruz), p-STAT5 (1:1000, 9351; Cell Signaling), RICTOR (1:2000, NB100-611; Novus Biologicals), RAPTOR (1:1000, 2280; Cell Signaling), P90RSK (1:1000, 9347; Cell Signaling), Raf-1 (1:300, Sc-133; Santa Cruz), CARM1 (1:1000, 09-818; Millipore), CRKL (1:200, Sc-319; Santa Cruz), GRB2 (1:1000, 3972; Cell Signaling), FAK (1:1000, Sc-1688; Santa Cruz), BTK (1:1000, 3533; Cell Signaling), A-Raf (1:1000, 4432; Cell Signaling), PRKD2 (1:200, sc-100415, Santa Cruz), HCK (1:500, 06-833; Milipore), p-HCK (1:500, ab52203; Abeam) and β-actin (1:2000, A1978; Sigma). The membranes were then incubated with a 1:3000 dilution of a corresponding horseradish peroxidase conjugated secondary antibody. Detection was performed using the ECL-Enhanced Chemiluminescence Detection System (Amersham Biosciences) according to manufacturer's instructions.
Densitometry
[0277] Gels were scanned in Adobe Photoshop 7.0.1 and quantitative densitometric analysis was performed using Un-Scan-It 5.1 software (Silk Scientific).
Nano-LC-MS/MS
[0278] Lysates prepared as mentioned above were first pre-cleaned by incubation with control beads overnight at 4° C. Pre-cleaned K562 cell extract (1,000 pig) in 200 μl Felts lysis buffer was incubated with PU-H71 or control-beads (80 μl) for 24 h at 4° C. Beads were washed with lysis buffer, proteins eluted by boiling in 2% SDS, separated on a denaturing gel and Coomassie stained according to manufacturer's procedure (Biorad). Gel-resolved proteins from pull-downs were digested with trypsin, as described (Winkler et al., 2002). In-gel tryptic digests were subjected to a micro-clean-up procedure (Erdjument-Bromage et al., 1998) on 2 μL bed-volume of Poros 50 R2 (Applied Biosystems—‘AB’) reversed-phase beads, packed in an Eppendorf gel-loading tip, and the eluant diluted with 0.1% formic acid (FA). Analyses of the batch purified pools were done using a QSTAR-Elite hybrid quadrupole time-of-flight mass spectrometer (QTof MS) (AB/MDS Sciex), equipped with a nano spray ion source. Peptide mixtures (in 20 μL) are loaded onto a trapping guard column (0.3×5-mm PepMap C18 100 cartridge from LC Packings) using an Eksigent nano MDLC system (Eksigent Technologies, Inc) at a flow rate of 20 μL/min. After washing, the flow was reversed through the guard column and the peptides eluted with a 5-45% MeCN gradient (in 0.1% FA) over 85 min at a flow rate of 200 nL/min, onto and over a 75-micron×15-cm fused silica capillary PepMap C18 column (LC Packings); the eluant is directed to a 75-micron (with 10-micron orifice) fused silica nano-electrospray needle (New Objective). Electrospray ionization (ESI) needle voltage was set at about 1800 V. The mass analyzer is operated in automatic, data-dependent MS/MS acquisition mode, with the threshold set to 10 counts per second of doubly or triply charged precursor ions selected for fragmentation scans. Survey scans of 0.25 sec are recorded from 400 to 1800 amu; up to 3 MS/MS scans are then collected sequentially for the selected precursor ions, recording from 100 to 1800 amu. The collision energy is automatically adjusted in accordance with the m/z value of the precursor ions selected for MS/MS. Selected precursor ions are excluded from repeated selection for 60 sec after the end of the corresponding fragmentation duty cycle. Initial protein identifications from LC-MS/MS data was done using the Mascot search engine (Matrix Science, version 2.2.04; www.matrixscience.com) and the NCBI (National Library of Medicine, NIH—human taxonomy containing, 223,695 protein sequences) and IPI (International Protein Index, EBI, Hinxton, UK—human taxonomy, containing 83,947 protein sequences) databases. One missed tryptic cleavage site was allowed, precursor ion mass tolerance=0.4 Da fragment ion mass tolerance=0.4 Da, protein modifications were allowed for Met-oxide, Cys-acrylamide and N-terminal acetylation. MudPit scoring was typically applied with ‘require bold red’ activated, and using significance threshold score p<0.05. Unique peptide counts (or ‘spectral counts’) and percent sequence coverages for all identified proteins were exported to Scaffold Proteome Software (version 2_06_01, www.proteomesoftware.com) for further bioinformatic analysis (Table 5a). Using output from Mascot, Scaffold validates, organizes, and interprets mass spectrometry data, allowing more easily to manage large amounts of data, to compare samples, and to search for protein modifications. Findings were validated in a second MS system, the Waters Xevo QTof MS instrument (Table 5d). Potential unspecific interactors were identified and removed from further analyses as indicated (Trinkle-Mulcahy et al., 2008).
Bioinformatic Pathways Analysis
[0279] Proteins were analyzed further by bioinformatic pathways analysis (Ingenuity Pathway Analysis 8.7 [IPA]; Ingenuity Systems, Mountain View, Calif., www.ingenuity.com) (Munday et al., 2010; Andersen et al., 2010). IPA constructs hypothetical protein interaction clusters based on a regularly updated “Ingenuity Pathways Knowledge Base”. The Ingenuity Pathways Knowledge Base is a very large curated database consisting of millions of individual relationships between proteins, culled from the biological literature. These relationships involve direct protein interactions including physical binding interactions, enzyme substrate relationships, and cis-trans relationships in translational control. The networks are displayed graphically as nodes (individual proteins) and edges (the biological relationships between the nodes). Lines that connect two molecules represent relationships. Thus any two molecules that bind, act upon one another, or that are involved with each other in any other manner would be considered to possess a relationship between them. Each relationship between molecules is created using scientific information contained in the Ingenuity Knowledge Base. Relationships are shown as lines or arrows between molecules. Arrows indicate the directionality of the relationship, such that an arrow from molecule A to B would indicate that molecule A acts upon B. Direct interactions appear in the network diagram as a solid line, whereas indirect interactions as a dashed line. In some cases a relationship may exist as a circular arrow or line originating from one molecule and pointing back at that same molecule. Such relationships are termed “self-referential” and arise from the ability of a molecule to act upon itself. In practice, the dataset containing the UniProtKB identifiers of differentially expressed proteins is uploaded into IPA. IPA then builds hypothetical networks from these proteins and other proteins from the database that are needed fill out a protein cluster. Network generation is optimized for inclusion of as many proteins from the inputted expression profile as possible, and aims for highly connected networks. Proteins are depicted in networks as two circles when the entity is part of a complex; as a single circle when only one unit is present; a triangle pointing up or down to describe a phosphatase or a kinase, respectively; by a horizontal oval to describe a transcription factor; and by circle to depict “other” functions. IPA computes a score for each possible network according to the fit of that network to the inputted proteins. The score is calculated as the negative base-10 logarithm of the p-value that indicates the likelihood of the inputted proteins in a given network being found together due to random chance. Therefore, scores of 2 or higher have at least a 99% confidence of not being generated by random chance alone. All the networks presented here were assigned a score of 10 or higher (Table 51).
Radioisotope Binding Studies and Hsp90 Quantification Studies
[0280] Saturation studies were performed with .sup.131I-PU-H71 and cells (K562, MDA-MB-468, SKBr3, LNCaP, DU-145, MRC-5 and PBL). Briefly, triplicate samples of cells were mixed with increasing amount of .sup.131I-PU-H71 either with or without 1 μM unlabeled PU-H71. The solutions were shaken in an orbital shaker and after 1 hr the cells were isolated and washed with ice cold Tris-buffered saline using a Brandel cell harvester. All the isolated cell samples were counted and the specific uptake of .sup.131I-PU-H71 determined. These data were plotted against the concentration of .sup.131I-PU-H71 to give a saturation binding curve. For the quantification of PU-bound Hsp90, 9.2×10.sup.7 K562 cells, 6.55×10.sup.7 KCL-22 cells, 2.55×10.sup.7 KU182 cells and 7.8×10.sup.7 MEG-01 cells were lysed to result in 6382, 3225, 1349 and 3414 μg of total protein, respectively. To calculate the percentage of Hsp90, cellular Hsp90 expression was quantified by using standard curves created of recombinant Hsp90 purified from HeLa cells (Stressgen #ADI-SPP-770).
Pulse-Chase
[0281] K562 cells were treated with Na.sub.3VO.sub.4 (1 mM) with or without PU-H71 (5 μM), as indicated. Cells were collected at indicated times and lysed in 50 mM Tris pH 7.4, 150 mM NaCl and 1% NP-40 lysis buffer, and were then subjected to western blotting procedure.
Tryptic Digestion
[0282] K562 cells were treated for 30 min with vehicle or PU-H71 (50 μM). Cells were collected and lysed in 50 mM Tris pH 7.4, 150 mM NaCl, 1% NP-40 lysis buffer. STAT5 protein was immunoprecipitated from 500 μg of total protein lysate with an anti-STAT5 antibody (Santa Cruz, sc-835). Protein precipitates bound to protein G agarose beads were washed with trypsin buffer (50 mM Tris pH 8.0, 20 mM CaCl.sub.2) and 33 ng of trypsin has been added to each sample. The samples were incubated at 37° C. and aliquots were collected at the indicated time points. Protein aliquots were subjected to SDS-PAGE and blotted for STAT5.
Activated STAT5 DNA Binding Assay
[0283] The DNA-binding capacity of STAT5a and STAT5b was assayed by an ELISA-based assay (TransAM, Active Motif, Carlsbad, Calif.) following the manufacturer instructions. Briefly, 5×10.sup.6 K562 cells were treated with PU-H71 1 and 10 μM or control for 24 h. Ten micrograms of cell lysates were added to wells containing pre-adsorbed STAT consensus oligonucleotides (5′-TTCCCGGAA-3′). For control treated cells the assay was performed in the absence or presence of 20 μmol of competitor oligonucleotides that contains either a wild-type or mutated STAT consensus binding site. Interferon-treated HeLa cells (5 μg per well) were used as positive controls for the assay. After incubation and washing, rabbit polyclonal anti-STAT5a or anti-STAT5b antibodies (1:1000, Active Motif) was added to each well, followed by HPR-anti-rabbit secondary antibody (1:1000, Active Motif). After HRP substrate addition, absorbance was read at 450 nm with a reference wavelength of 655 nm (Synergy4, Biotek, Winooski, Vt.). In this assay the absorbance is directly proportional to the quantity of DNA-bound transcription factor present in the sample. Experiments were carried out in four replicates. Results were expressed as arbitrary units (AU) from the mean absorbance values with SEM.
Quantitative Chromatin Immunoprecipitation (Q-ChIP)
[0284] Q-ChIP was made as previously described with modifications (Cerchietti et al., 2009). Briefly, 10.sup.8 K562 cells were fixed with 1% formaldehyde, lysed and sonicated (Branson sonicator, Branson). STAT5 N20 (Santa Cruz) and Hsp90 (Zymed) antibodies were added to the pre-cleared sample and incubated overnight at 4° C. Then, protein-A or G beads were added, and the sample was eluted from the beads followed by de-crosslinking. The DNA was purified using PCR purification columns (Qiagen). Quantification of the ChIP products was performed by quantitative PCR (Applied Biosystems 7900HT) using Fast SYBR Green (Applied Biosystems). Target genes containing STAT binding site were detected with the following primers: CCND2 (5-GTTGTTCTGGTCCCTTTAATCG (SEQ ID NO:1) and 5-ACCTCGCATACCCAGAGA(SEQ ID NO:2)), MYC (5-ATGCGTTGCTGGGTTATTTT(SEQ ID NO:3) and 5-CAGAGCGTGGGATGTTAGTG(SEQ ID NO:4)) and for the intergenic control region (5-CCACCTGAGTCTGCAATGAG (SEQ ID NO:5) and 5-CAGTCTCCAGCCTTTGTTCC(SEQ ID NO:6)).
Real Time QPCR
[0285] RNA was extracted from PU-H71-treated and control K562 cells using RNeasy Plus kit (Qiagen) following the manufacturer instructions. cDNA was synthesized using High Capacity RNA-to-cDNA kit (Applied Biosystems). We amplified specific genes with the following primers: MYC (5-AGAAGAGCATCTTCCGCATC (SEQ ID NO:7) and 5-CCTTTAAACAGTGCCCAAGC(SEQ ID NO:8)), CCND2 (5-TGAGCTGCTGGCTAAGATCA (SEQ ID NO:9) and 5-ACGGTACTGCTGCAGGCTAT (SEQ ID NO:10)), BCL-XL (5-CTTTTGTGGAACTCTATGGGAACA (SEQ ID NO:11) and 5-CAGCGGTTGAAGCGTTCCT (SEQ ID NO:12)), MCLI (5-AGACCTTACGACGGGTTGG (SEQ ID NO:13) and 5-ACATTCCTGATGCCACCTTC (SEQ ID NO:14)), CCND1 (5-CCTGTCCTACTACCGCCTCA (SEQ ID NO:15) and 5-GGCTTCGATCTGCTCCTG (SEQ ID NO:16)), HPRT (5-CGTCTTGCTCGAGATGTGATG (SEQ ID NO:17) and 5-GCACACAGAGGGCTACAATGTG (SEQ ID NO:18)), GAPDH (5-CGACCACTTTGTCAAGCTCA (SEQ ID NO:19) and 5-CCCTGTTGCTGTAGCCAAAT(SEQ ID NO:20)), RPLI3A (5-TGAGTGAAAGGGAGCCAGAAG (SEQ ID NO:21) and 5-CAGATGCCCCACTCACAAGA(SEQ ID NO:22)). Transcript abundance was detected using the Fast SYBR Green conditions (initial step of 20 sec at 95° C. followed by 40 cycles of 1 sec at 95° C. and 20 sec at 60° C.). The CT value of the housekeeping gene (RPLI3A) was subtracted from the correspondent genes of interest (CT). The standard deviation of the difference was calculated from the standard deviation of the CT values (replicates). Then, the CT values of the PU-H71-treated cells were expressed relative to their respective control-treated cells using the CT method. The fold expression for each gene in cells treated with the drug relative to control treated cells is determined by the expression: 2-MCT. Results were represented as fold expression with the standard error of the mean for replicates.
Hsp70 Knock-Down
[0286] Transfections were carried out by electroporation (Amaxa) and the Nucleofector Solution V (Amaxa), according to manufacturer's instructions. Hsp70 knockdown studies were performed using siRNAs designed as previously reported (Powers et al., 2008) against the open reading frame of Hsp70 (HSPAIA; accession number NM_005345). Negative control cells were transfected with inverted control siRNA sequence (Hsp70C; Dharmacon RNA technologies). The active sequences against Hsp70 used for the study are Hsp70A (5′-GGACGAGUUUGAGCACAAG-3′ (SEQ ID NO:23)) and Hsp70B (5′-CCAAGCAGACGCAGAUCUU-3′ (SEQ ID NO:24)).
[0287] Sequence for the control is Hsp70C (5′-GGACGAGUUGUAGCACAAG-3 (SEQ ID NO:25)). Three million 5 cells in 2 mL media (RPMI supplemented with 1% L-glutamine, 1% penicillin and streptomycin) were transfected with 0.5 μM siRNA according to the manufacturer's instructions. Transfected cells were maintained in 6-well plates and at 84 h, lysed followed by standard Western blot procedures.
Kinase Screen (Fabian et al., 2005)
[0288] For most assays, kinase-tagged T7 phage strains were grown in parallel in 24-well blocks in an E. coli host derived from the BL21 strain. E. coli were grown to log-phase and infected with T7 phage from a frozen stock (multiplicity of infection=0.4) and incubated with shaking at 32° C. until lysis (90-150 min). The lysates were centrifuged (6,000×g) and filtered (0.2 tm) to remove cell debris. The remaining kinases were produced in HEK-293 cells and subsequently tagged with DNA for qPCR detection. Streptavidin-coated magnetic beads were treated with biotinylated small molecule ligands for 30 minutes at room temperature to generate affinity resins for kinase assays. The liganded beads were blocked with excess biotin and washed with blocking buffer (SeaBlock (Pierce), 1% BSA, 0.05% Tween 20, 1 mM DTT) to remove unbound ligand and to reduce non-specific phage binding.
[0289] Binding reactions were assembled by combining kinases, liganded affinity beads, and test compounds in Ix binding buffer (20% SeaBlock, 0.17×PBS, 0.05% Tween 20, 6 mM DTT). Test compounds were prepared as 40× stocks in 100% DMSO and directly diluted into the assay. All reactions were performed in polypropylene 384-well plates in a final volume of 0.04 ml. The assay plates were incubated at room temperature with shaking for 1 hour and the affinity beads were washed with wash buffer (Ix PBS, 0.05 Tween 20). The beads were then re-suspended in elution buffer (Ix PBS, 0.05% Tween 20, 0.5 μm non-biotinylated affinity ligand) and incubated at room temperature with shaking for 30 minutes. The kinase concentration in the eluates was measured by qPCR. KINOMEscan's selectivity score (S) is a quantitative measure of compound selectivity. It is calculated by dividing the number of kinases that bind to the compound by the total number of distinct kinases tested, excluding mutant variants. TREEspot™ is a proprietary data visualization software tool developed by KINOMEscan (Fabian et al., 2005). Kinases found to bind are marked with red circles, where larger circles indicate higher-affinity binding. The kinase dendrogram was adapted and is reproduced with permission from Science and Cell Signaling Technology, Inc.
Lentiviral Vectors, Lentiviral Production and K562 Cells Transduction
[0290] Lentiviral constructs of shRNA knock-down of CARMI were purchased from the TRC lentiviral shRNA libraries of Openbiosystem: pLK0.1-shCARMl-KD1 (catalog No: RHS3979-9576107) and pLK0.1-shCARM1-KD2 (catalog No: RHS3979-9576108). The control shRNA (shRNA scramble) was Addgene plasmid 1864. GFP was cloned in to replace puromycin as the selection marker. Lentiviruses were produced by transient transfection of 293T as in the previously described protocol (Moffat et al., 2006). Viral supernatant was collected, filtered through a 0.45-μm filter and concentrated. K562 cells were infected with high-titer lentiviral concentrated suspensions, in the presence of 8 μg/ml polybrene (Aldrich). Transduced K562 cells were sorted for green fluorescence (GFP) after 72 hours transfection.
RNA Extraction and Quantitative Real-Time PCR (qRT-PCR)
[0291] For qRT-PCR, total RNA was isolated from 10.sup.6 cells using the RNeasy mini kit (QIAGEN, Germany), and then subjected to reverse-transcription with random hexamers (SuperScript III kit, Invitrogen). Real-time PCR reactions were performed using an ABI 7500 sequence detection system. The PCR products were detected using either Sybr green I chemistry or TaqMan methodology (PE Applied Biosystems, Norwalk, Conn.). Details for real-time PCR assays were described elsewhere (Zhao et al., 2009). The primer sequences for CARMI qPCR
TABLE-US-00010 are (SEQ ID NO: 26) TGATGGCCAAGTCTGTCAAG (forward) and (SEQ ID NO: 27) TGAAAGCAACGTCAAACCAG (reverse).
Cell Viability, Apoptosis, and Proliferation Assay
[0292] Viability assessment in K562 cells untransfected or transfected with CARMI shRNA or scramble was performed using Trypan Blue. This chromophore is negatively charged and does not interact with the cell unless the membrane is damaged. Therefore, all the cells that exclude the dye are viable. Apoptosis analysis was assessed using fluorescence microscopy by mixing 2 μL of acridine orange (100 μg/mL), 2 μL of ethidium bromide (100 μg/mL), and 20 μL of the cell suspension. A minimum of 200 cells was counted in at least five random fields. Live apoptotic cells were differentiated from dead apoptotic, necrotic, and normal cells by examining the changes in cellular morphology on the basis of distinctive nuclear and cytoplasmic fluorescence. Viable cells display intact plasma membrane (green color), whereas dead cells display damaged plasma membrane (orange color). An appearance of ultrastructural changes, including shrinkage, heterochromatin condensation, and nuclear degranulation, are more consistent with apoptosis and disrupted cytoplasmic membrane with necrosis. The percentage of apoptotic cells (apoptotic index) was calculated as: % Apoptotic cells=(total number of cells with apoptotic nuclei/total number of cells counted)×100. For the proliferation assay, 5×10.sup.3 K562 cells were plated on a 96-well solid black plate (Corning). The assay was performed according to the manufacturer's indications (CellTiter-Glo Luminescent Cell Viability Assay, Promega). All experiments were repeated three times. Where indicated, growth inhibition studies were performed using the Alamar blue assay. This reagent offers a rapid objective measure of cell viability in cell culture, and it uses the indicator dye resazurin to measure the metabolic capacity of cells, an indicator of cell viability. Briefly, exponentially growing cells were plated in microtiter plates (Corning #3603) and incubated for the indicated times at 37° C. Drugs were added in triplicates at the indicated concentrations, and the plate was incubated for 72 h. Resazurin (55 μM) was added, and the plate read 6 h later using the Analyst GT (Fluorescence intensity mode, excitation 530 nm, emission 580 nm, with 560 nm dichroic mirror). Results were analyzed using the Softmax Pro and the GraphPad Prism softwares. The percentage cell growth inhibition was calculated by comparing fluorescence readings obtained from treated versus control cells. The IC.sub.50 was calculated as the drug concentration that inhibits cell growth by 50%.
Quantitative Analysis of Synergy Between mTOR and Hsp90 Inhibitors
[0293] To determine the drug interaction between pp242 (mTOR inhibitor) and PU-H71 (Hsp90 inhibitor), the combination index (CI) isobologram method of Chou-Talalay was used as previously described (Chou, 2006; Chou & Talalay, 1984). This method, based on the median-effect principle of the law of mass action, quantifies synergism or antagonism for two or more drug combinations, regardless of the mechanisms of each drug, by computerized simulation. Based on algorithms, the computer software displays median-effect plots, combination index plots and normalized isobolograms (where non constant ratio combinations of 2 drugs are used). PU-H71 (0.5, 0.25, 0.125, 0.0625, 0.03125, 0.0125 μM) and pp242 (0.5, 0.125, 0.03125, 0.0008, 0.002, 0.001 μM) were used as single agents in the concentrations mentioned or combined in a non constant ratio (PU-H71:pp242; 1:1, 1:2, 1:4, 1:7.8, 1:15.6, 1:12.5). The Fa (fraction killed cells) was calculated using the formulae Fa=1-Fu; Fu is the fraction of unaffected cells and was used for a dose effect analysis using the computer software (CompuSyn, Paramus, N.J., USA).
Flow Cytometry
[0294] CD34 isolation—CD34+ cell isolation was performed using CD34 MicroBead Kit and the automated magnetic cell sorter autoMACS according to the manufacturer's instructions (Miltenyi Biotech, Auburn, Calif.). Viability assay—CML cells lines were plated in 48-well plates at the density of 5×10.sup.5 cells/ml, and treated with indicated doses of PU-H71. Cells were collected every 24 h, stained with Annexin V-V450 (BD Biosciences) and 7-AAD (Invitrogen) in Annexin V buffer (10 mM HEPES/NaOH, 0.14 M NaCl, 2.5 mM CaCl.sub.2). Cell viability was analyzed by flow cytometry (BD Biosciences). For patient samples, primary CML cells were plated in 48-well plates at 2×10.sup.6 cells/ml, and treated with indicated doses of PU-H71 for up to 96 h. Cells were stained with CD34-APC, CD38-PE-CY7 and CD45-APC-H7 antibodies (BD Biosciences) in FACS buffer (PBS, 0.05% FBS) at 4° C. for 30 min prior to Annexin V/7-AAD staining. PU-H71 binding assay—CML cells lines were plated in 48-well plates at the density of 5×10.sup.5 cells/ml, and treated with 1 μM PU-H71-FITC. At 4 h post treatment, cells were washed twice with FACS buffer. To measure PU-H71-FITC binding in live cells, cells were stained with 7-AAD in FACS buffer at room temperature for 10 min, and analyzed by flow cytometry (BD Biosciences). Alternatively, cells were fixed with fixation buffer (BD Biosciences) at 4° C. for 30 min, permeabilized in Perm Buffer III (BD Biosciences) on ice for 30 min, and then analyzed by flow cytometry. At 96 h post PU-H71-FITC treatment, cells were stained with Annexin V-V450 (BD Biosciences) and 7-AAD in Annexin V buffer, and subjected to flow cytometry to measure viability. To evaluate the binding of PU-H71-FITC to leukemia patient samples, primary CML cells were plated in 48-well plates at 2×10.sup.6 cells/ml, and treated with 1 μM PU-H71-FITC. At 24 h post treatment, cells were washed twice, and stained with CD34-APC, CD38-PE-CY7 and CD45-APC-H7 antibodies in FACS buffer at 4° C. for 30 min prior to 7-AAD staining. At 96 h post treatment, cells were stained with CD34-APC, CD38-PE-CY7 and CD45-APC-H7 antibodies followed by Annexin V-V450 and 7-AAD staining to measure cell viability. For competition test, CML cell lines at the density of 5×10.sup.5 cells/ml or primary CML samples at the density of 2×10.sup.6 cells/ml were treated with 1 μM unconjugated PU-H71 for 4 h followed by treatment of 1 μM PU-H71-FITC for 1 h. Cells were collected, washed twice, stained for 7-AAD in FACS buffer, and analyzed by flow cytometry. Hsp90 staining—Cells were fixed with fixation buffer (BD Biosciences) at 4° C. for 30 min, and permeabilized in Perm Buffer III (BD Biosciences) on ice for 30 min. Cells were stained with anti-Hsp90 phycoerythrin conjugate (PE) (F-8 clone, Santa Cruz Biotechnologies; CA) for 60 minutes. Cells were washed and then analyzed by flow cytometry. Normal mouse IgG2a-PE was used as isotype control.
Statistical Analysis
[0295] Unless otherwise indicated, data were analyzed by unpaired 2-tailed t tests as implemented in GraphPad Prism (version 4; GraphPad Software). A P value of less than 0.05 was considered significant. Unless otherwise noted, data are presented as the mean±SD or mean±SEM of duplicate or triplicate replicates. Error bars represent the SD or SEM of the mean. If a single panel is presented, data are representative of 2 or 3 individual experiments.
Maintenance of the B Cell Receptor Pathway and COP9 Signalosome by Hsp90 Reveals Novel Therapeutic Targets in Diffuse Large B Cell Lymphoma
Experimental Outline
[0296] Heat shock protein 90 (Hsp90) is an abundant molecular chaperone, the substrate proteins of which are involved in cell survival, proliferation and angiogenesis. Hsp90 is expressed constitutively and can also be induced by cellular stress, such as heat shock. Because it can chaperone substrate proteins necessary to maintain a malignant phenotype, Hsp90 is an attractive therapeutic target in cancer. In fact, inhibition of Hsp90 results in degradation of many of its substrate proteins. PUH71, an inhibitor of Hsp90, selectively inhibits the oncogenic Hsp90 complex involved in chaperoning onco-proteins and has potent anti-tumor activity diffuse large B cell lymphomas (DLBCLs). By immobilizing PUH71 on a solid support, Hsp90 complexes can be precipitated and analyzed to identify substrate onco-proteins of Hsp90, revealing known and novel therapeutic targets. Preliminary data using this method identified many components of the B cell receptor (BCR) pathway as substrate proteins of Hsp90 in DLBCL. BCR pathway activation has been implicated in lymphomagenesis and survival of DLBCLs. In addition to this, many components of the COP9 signalosome (CSN) were identified as substrates of Hsp90 in DLBCL. The CSN has been implicated in oncogenesis and activation of NF-κB, a survival mechanism of DLBCL. Based on these findings, we hypothesize that combined inhibition of Hsp90 and BCR pathway components and/or the CSN will synergize in killing DLBCL. Therefore, our specific aims are:
Specific Aim 1: To Determine Whether Concomitant Modulation of Hsp90 and BCR Pathways Cooperate in Killing DLBCL Cells In Vitro and In Vivo
[0297] Immobilized PU-H71 will be used to pull down Hsp90 complexes in DLBCL cell lines to detect interactions between Hsp90 and BCR pathway components. DLBCL cell lines treated with increasing doses of PU-H71 will be analyzed for degradation of BCR pathway components DLBCL cell lines will be treated with inhibitors of BCR pathway components alone and in combination with PU-H71 and assessed for viability. Effective combination treatments will be investigated in DLBCL xenograft mouse models.
Specific Aim 2: To Evaluate the Role of the CSN in DLBCL
Subaim 1: To Determine Whether the CSN can be a Therapeutic Target in DLBCL
[0298] CPs and treatment with PU-H71 will validate the CSN as a substrate of Hsp90 in DLBCL cell lines. The CSN will be genetically ablated alone and in combination with PU-H71 in DLBCL cell lines to demonstrate DLBCL dependence on the CSN for survival. Mouse xenograft models will be treated with CSN inhibition, alone and in combination with PU-H71, to show effect on tumor growth and animal survival.
Subaim 2: To Determine the Mechanism of CSN in the Survival of DLBCL
[0299] Immunoprecipitations (IPs) of the CSN will be used to demonstrate CSN-CBM interaction. Genetic ablation of the CSN will be used to demonstrate degradation of Bcl10 and ablation of NF-κB activity in DLBCL cell lines.
Background and Significance
1. DLBCL Classification
[0300] DLBCL is the most common form of non-Hodgkin's lymphoma. In order to improve diagnosis and treatment of DLBCL, many studies have attempted to classify this molecularly heterogeneous disease. One gene expression profiling study divided DLBCL into two major subtypes (Alizadeh et al., 2000). Germinal center (GC) B cell like (GCB) DLBCL can be characterized by the expression of genes important for germinal center differentiation including BCL6 and CD10, whereas activated B cell like (ABC) DLBCL can be distinguished by a gene expression profile resembling that of activated peripheral blood B cells. The NF-κB pathway is more active and often mutated in ABC DLBCL. Another classification effort using gene expression profiling identified three major classes of DLBCL. OxPhos DLBCL shows significant enrichment of genes involved in oxidative phosphorylation, mitochondrial function, and the electron transport chain. BCR/proliferation DLBCL can be characterized by an increased expression of genes involved in cell-cycle regulation. Host response (HR) DLBCL is identified based on increased expression of multiple components of the T-cell receptor (TCR) and other genes involved in T cell activation (Monti et al., 2005).
[0301] These prospective classifications were made using patient samples and have not been the final answer for diagnosis or treatment of patients. Because patient samples are comprised of heterogeneous populations of cells and tumor microenvironment plays a role in the disease, (de Jong and Enblad, 2008), DLBCL cell lines do not classify as well as patient samples. However, well-characterized cell lines can be used as models of the different subtypes of DLBCL in which to investigate the molecular mechanisms behind the disease.
2. DLBCL: Need for Novel Therapies
[0302] Standard chemotherapy regimens such as the combination of cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP) cure about 40% of DLBCL patients, with 5-year overall survival rates for GCB and ABC patients of 60% and 30%, respectively (Wright et al., 2003). The addition of rituximab immunotherapy to this treatment schedule (R-CHOP) increases survival of DLBCL patients by 10 to 15% (Coiffier et al., 2002). However, 40% of DLBCL patients do not respond to R-CHOP, and the side effects of this combination chemoimmunotherapy are not well tolerated, emphasizing the need for identifying novel targets and treatments for this disease.
[0303] Classification of patient tumors has advanced the understanding of the molecular mechanisms underlying DLBCL to a degree. Until these details are better understood, treatments cannot be individually tailored. Preclinical studies of treatments with new drugs alone and in combination treatments and the investigation of new targets in DLBCL will provide new insight on the molecular mechanisms behind the disease.
3. Hsp90: A Promising Target
[0304] Hsp90 is an emerging therapeutic target for cancer. The chaperone protein is expressed constitutively, but can also be induced upon cellular stress, such as heat shock. Hsp90 maintains the stability of a wide variety of substrate proteins involved in cellular processes such as survival, proliferation and angiogenesis (Neckers, 2007). Substrate proteins of Hsp90 include oncoproteins such as NPM-ALK in anaplastic large cell lymphoma, and BCR-ACL in chronic myelogenous leukemia (Bonvini et al., 2002; Gone et al., 2002). Because Hsp90 maintains the stability of oncogenic substrate proteins necessary for disease maintenance, it is an attractive therapeutic target. In fact, inhibition of Hsp90 results in degradation of many of its substrate proteins (Bonvini et al., 2002; Caldas-Lopes et al., 2009; Chiosis et al., 2001; Neckers, 2007; Nimmanapalli et al., 2001). As a result, many inhibitors of Hsp90 have been developed for the clinic (Taldone et al., 2008).
4. PU-H71: A Novel Hsp90 Inhibitor
[0305] A novel purine scaffold Hsp90 inhibitor, PU-H71, has been shown to have potent anti-tumor effects with an improved pharmacodynamic profile and less toxicity than other Hsp90 inhibitors (Caldas-Lopes et al., 2009; Cerchietti et al., 2010a; Chiosis and Neckers, 2006). Studies from our laboratory have shown that PU-H71 potently kills DLBCL cell lines, xenografts and ex vivo patient samples, in part, through degradation of BCL-6, a transcriptional repressor involved in DLCBL proliferation and survival (Cerchietti et al., 2010a).
[0306] A unique property of PU-H71 is its high affinity for tumor related-Hsp90, which explains why the drug been shown to accumulate preferentially in tumors (Caldas-Lopes et al., 2009; Cerchietti et al., 2010a). This property of PU-H71 makes it a useful tool in identifying novel targets for cancer therapy. By immobilizing PU-H71 on a solid support, a chemical precipitation (CP) of tumor-specific Hsp90 complexes can be obtained, and the substrate proteins of Hsp90 can be identified using a proteomics approach. Preliminary experiments using this method in DLBCL cell lines have revealed at least two potential targets that are stabilized by Hsp90 in DLBCL cells: the BCR pathway and the COP9 signalosome (CSN).
5. Combination Therapies in Cancer
[0307] Identifying rational combination treatments for cancer is essential because single agent therapy is not curative (Table 6). Monotherapy is not effective in cancer because of tumor cell heterogeneity. Although tumors grow from a single cell, their genetic instability produces a heterogeneous population of daughter cells that are often selected for enhanced survival capacity in the form of resistance to apoptosis, reduced dependence on normal growth factors, and higher proliferative capacity (Hanahan and Weinberg, 2000). Because tumors are comprised of heterogeneous populations of cells, a single drug will kill not all cells in a given tumor, and surviving cells cause tumor relapse. Tumor heterogeneity provides an increased number of potential drug targets and therefore, the need for combining treatments.
TABLE-US-00011 TABLE 6 Multiple therapeutic agents are required for tumor cure. (Kufe D W, 2003) Number of Agents Adjuvant or Number of Agents Tumor Required for Cure Neoadjuvant Required for Cure Acute lymphoblastic 4-7 Wilms 2-3 leukemia (children) Gestational Embryonic 2-3 Choriocarcinoma.sup.a early 1-3 OGS 3 advanced 2-4 Soft tissue sarcoma 3 AML 3+ Ovary 3-4 Testis 3 Breast cancer 2-4 Burkitt.sup.b 1-4 Colorectal 2 Hodgkin's disease 4-5 Lung non-small-cell carcinoma stage IIIA 2 DHL 4-5 Lung small-cell carcinoma, limited 2-4 .sup.aOne agent is curative, but a higher cure rate results with two or more. .sup.bOne agent cures state 1 African Burkitt, but two or more are better.
indicates data missing or illegible when filed
[0308] Exposure to chemotherapeutics can give rise to resistant populations of tumor cells that can survive in the presence of drug. Avoiding this therapeutic resistance is another important rationale for combination treatments.
[0309] Combinations of drugs with non-overlapping side effects can result in additive or synergistic anti-tumor effect at lower doses of each drug, thus lowering side effects. Therefore, the possible favorable outcomes for synergism or potentiation include i) increasing the efficacy of the therapeutic effect, ii) decreasing the dosage but increasing or maintaining the same efficacy to avoid toxicity, iii) minimizing the development of drug resistance, iv) providing selective synergism against a target (or efficacy synergism) versus host. Drug combinations have been widely used to treat complex diseases such as cancer and infectious diseases for these therapeutic benefits.
[0310] Because inhibition of Hsp90 kills malignant cells and results in degradation of many of its substrate proteins, identification of tumor-Hsp90 substrate proteins may reveal additional therapeutic targets. In this study, we aim to investigate the BCR pathway and the CSN, substrates of Hsp90, in DLBCL survival as potential targets for combination therapy with Hsp90 inhibition. We predict that combined inhibition of Hsp90 and its substrate proteins will synergize in killing DLBCL, providing increased patient response with decreased toxicity.
6. Synergy Between Inhibition of Hsp90 and its Substrate BCL6: Proof of Principle
[0311] The transcriptional repressor BCL6, a signature of GCB DLBCL gene expression, is the most commonly involved oncogene in DLBCL. BCL6 forms a transcriptional repressive complex to negatively regulate expression of genes involved in DNA damage response and plasma cell differentiation of GC B cells. BCL6 is required for B cells to undergo immunoglobulin affinity maturation (Ye et al., 1997), and somatic hypermutation in germinal centers. Aberrant constitutive expression of BCL6 (Ye et al., 1993), may lead to DLBCL as shown in animal models. A peptidomimetic inhibitor of BCL6, RIBPI, selectively kills BCL-6-dependent DLBCL cells (Cerchietti et al., 2010a; Cerchietti et al., 2009b) and is under development for the clinic.
[0312] CPs using PU-H71 beads reveal that BCL6 is a substrate protein of Hsp90 in DLBCL cell lines, and treatment with PU-H71 induces degradation of BCL6 (Cerchietti et al., 2009a) (
7. BCR Signaling
[0313] The BCR is a large transmembrane receptor whose ligand-mediated activation leads to an extensive downstream signaling cascade in B cells (outlined in
[0314] Signals from the BCR signalosome are transduced to extracellular signal-related kinase (ERK) family proteins through Ras and to the mitogen activated protein kinase (MAPK) family through Rac/cdc43. Activation of PLCγ causes increases in cellular calcium (Ca.sup.2+), resulting in activation of Ca.sup.2+-calmodulin kinase (CamK) and NFAT. Significantly, increased cellular Ca.sup.2+ activates PKC-β, which phosphorylates Carma1 (CARD11), an adaptor protein that forms a complex with BCL10 and MALT1. This CBM complex activates IκB kinase (IKK), resulting in phosphorylation of IκB, which sequesters NF-κB subunits in the cytosol. Phosphorylated IκB is ubiquitinylated, causing its degradation and localization of NF-κB subunits to the nucleus. Many other downstream effectors in this complex pathway (p38 MAPK, ERK1/2, CaMK) translocate to the nucleus to affect changes in transcription of genes involved in cell survival, proliferation, growth, and differentiation (NF-κB, NFAT). Syk also activates phosphatidylinositol 3-kinase (PI3K), resulting in increased cellular PIP.sub.3. This second messenger activates the acutely transforming retrovirus (Akt)/mammalian target of rapamycin (mTOR) pathway which promotes cell growth and survival (Dal Porto et al., 2004).
8. Aberrant BCR Signaling in DLBCL
[0315] BCR signaling is necessary for survival and maturation of B cells (Lam et al., 1997), particularly survival signaling through NF-κB. In fact, constitutive NF-κB signaling is a hallmark of ABC DLBCL (Davis et al., 2001). Moreover, mutations in the BCR and its effectors contribute to the enhanced activity of NF-κB in DLBCL, specifically ABC DLBCL.
[0316] It has been shown that mutations in the ITAMs of the CD79a/CD79b heterodimer associated with hyperresponsive BCR activation and decreased receptor internalization in DLBCL (Davis et al., 2010). CD79 ITAM mutations also block negative regulation by Lyn kinase. Lyn phosphorylates immunoreceptor tyrosine-based inactivation motifs (ITIMs) on CD22 and the Fc γ-receptor, membrane receptors that communicate with the BCR. After docking on these phosphorylated ITIMs, SHP1 dephosphorylates CD79 ITAMs causing downmodulation of BCR signaling. Lyn also phosphorylates Syk at a negative regulatory site, decreasing its activity (Chan et al., 1997). Taken together, mutations in CD79 ITAMs, found in both ABC and GCB DLBCL, result in decreased Lyn kinase activity and increased signaling through the BCR.
[0317] Certain mutations in the BCR pathway components directly enhance NF-κB activity. Somatic mutations in the CARD11 adaptor protein result in constitutive activation of IKK causing enhanced NF-κB activity even in the absence of BCR engagement (Lenz et al., 2008). A20, a ubiquitin-editing enzyme, terminates NF-κB signaling by removing ubiquitin chains from IKK. Inactivating mutations in A20 remove this brake from NF-κB signaling in ABC DLBCL (Compagno et al., 2009).
[0318] This constitutive BCR activity in ABC DLBCL has been referred to as “chronic active BCR signaling” to distinguish it from “tonic BCR signaling.” Tonic BCR signaling maintains mature B cells and does not require CARD11 because mice deficient in CBM components have normal numbers of B cells (Thome, 2004). Chronic active BCR signaling, however, requires the CBM complex and is distinguished by prominent BCR clustering, a characteristic of antigen-stimulated B cells and not resting B cells. In fact, knockdown of CARD11, MALT1, and BCL10 is preferentially toxic for ABC as compared to GCB DLBCL cell lines (Ngo et al., 2006). Chronic active BCR signaling is associated mostly with ABC DLBCL, however CARD11 and CD79 ITAM mutations do occur in GCB DLBCL (Davis et al., 2010; Lenz et al., 2008), suggesting that BCR signaling is a potential target across subtypes of DLBCL.
9. Targeting the BCR Pathway in DLBCL
[0319] Because it promotes cell growth, proliferation and survival, BCR signaling is an obvious target in cancer. Mutations in the BCR pathway in DLBCL (described above) highlight its relevance as a target in the disease. In fact, many components of the BCR have been targeted in DLBCL, and some of these treatments have already translated to patients.
[0320] Overexpression of protein tyrosine phosphatase (PTP) receptor-type 0 truncated (PTPROt), a negative regulator of Syk, inhibits proliferation and induces apoptosis in DLBCL, identifying Syk as a target in DLBCL (Chen et al., 2006). Inhibition of Syk by small molecule fostamatinib disodium (R406) blocks proliferation and induces apoptosis in DLBCL cell lines (Chen et al., 2008). This orally available compound has also shown significant clinical activity with good tolerance in DLBCL patients (Friedberg et al., 2010).
[0321] An RNA interference screen revealed Btk as a potential target in DLBCL. Short hairpin RNAs (shRNAs) targeting Btk are highly toxic for DLBCL cell lines, specifically ABC DLBCL. A small molecule irreversible inhibitor of Btk, PCI-32765 (Honigberg et al., 2010), potently kills DLBCL cell lines, specifically ABC DLBCL (Davis et al., 2010). The compound is in clinical trials and has shown efficacy in B cell malignancies with good tolerability (Fowler et al., 2010).
[0322] Constitutive activity of NF-κB makes it a rational target in DLBCL. NF-κB can be targeted through different approaches Inhibition of IKK blocks phosphorylation of IκB, preventing release and nuclear translocation of NF-κB subunits. MLX105, a selective IKK inhibitor, potently kills ABC DLBCL cell lines (Lam et al., 2005). NEDD8-activating enzyme (NAE) regulates the CRL1.sup.βTRCP ubiquitination of phosphorylated IκB, resulting in its degradation and the release of NF-κB subunits. Inhibition of NAE by small molecules such as MLN4924 induces apoptosis in ABC DLBCL and shows strong tumor burden regression in DLBCL and patient xenograft models. MLN4924 shows more potency in ABC DLBCL, which is expected because of the higher dependence on constitutive NF-κB activity for survival in this subtype (Milhollen et al., 2010). Because it activates IKK, inhibiting PKC-β is another approach to block NF-κB activity. Specific PKC-β inhibitors, such as Ly379196, kill both ABC and GCB DLBCL cell lines, albeit at high doses (Su et al., 2002).
[0323] These approaches to targeting NF-κB activity are promising therapies for DLBCL. Inhibition of IKK and NAE is most potent in ABC DLBCL, but less potent effect was also seen in GCB DLBCL. These studies suggest that combining NF-κB activity with other targeted therapies may produce a more robust effect across DLBCL subtypes.
[0324] The PI3K/Akt/mTOR pathway is deregulated in many human diseases and is constitutively activated in DLBCL (Gupta et al., 2009). Because malignant cells exploit this pathway to promote cell growth and survival, small molecule inhibitors of the pathway have been heavily researched. Rapamycin (sirolimus), a macrolide antibiotic that targets mTOR, is an FDA approved oral immunosuppressant (Yap et al., 2008). Everolimus, an orally available rapamycin analog, has also been approved as a transplant immunosuppressant (Hudes et al., 2007). These compounds have antitumor activity in DLBCL cell lines and patient samples (Gupta 2009), but their effect is mostly antiproliferative and only narrowly cytotoxic. To achieve cytotoxicity, rapamycin and everolimus have been evaluated in combination with many other therapeutic agents (Ackler et al., 2008; Yap et al., 2008). Phase II clinical studies of everolimus in DLBCL have been moderately successful with an ORR of 35% (Reeder C, 2007). Everolimus has also been shown to sensitize DLBCL cell lines to other cytotoxic agents (Wanner et al., 2006). These findings clearly demonstrate the therapeutic potential of mTOR inhibition in DLBCL, especially in combination therapies.
[0325] Inhibition of Aid is also a promising cancer therapy and can be targeted in many ways. Lipid based inhibitors block the PIP3-binding PH domain of Akt to prevent its translocation to the membrane. One such drug, perifosine, has shown antitumor activity both in vitro and in vivo.
[0326] Overall, the compound has shown only partial responses, prompting combination with other targeted therapies (Yap et al., 2008). Small molecule inhibitors of Akt, such as GSK690693, cause growth inhibition and apoptosis in lymphomas and leukemias, specifically ALL (Levy et al., 2009), and may be effective in killing DLBCL as a monotherapy or in combination with other targeted therapies.
[0327] The MAPK pathway is another interesting target in cancer therapeutics. The oncogene MCT-1 is highly expressed in DLBCL patient samples and is regulated by ERK Inhibition of ERK causes apoptosis in DLBCL xenograft models (Dai et al., 2009). Small molecule inhibitors of ERK and MEK have been developed and demonstrate excellent safety profiles and tumor suppressive activity in the clinic. The response to these drugs, however, has not been robust with four partial patient responses observed and stable disease reported in 22% of patients (Friday and Adjei, 2008) Inhibition of MEK alone may be insufficient to cause cytotoxicity because the upstream regulators of the MAPK pathway, namely Ras and Raf, are most frequently mutated in cancer and may regulate other kinases that maintain cell survival despite MEK inhibition. In the face of these pitfalls, MEK inhibitors such as AZD6244 have entered the clinic. The partial response to MEK inhibition suggests that combinations of these inhibitors with other targeted therapies may reveal a more robust patient response (Friday and Adjei, 2008).
10. The CSN: Structure and Function
[0328] The CSN was first discovered in Aradopsis in 1996 as a negative regulator of photomorphogenesis (Chamovitz et al., 1996). The complex is highly conserved from yeast to human and is comprised of eight subunits, CSN1-CSN8, numbered in size from largest to smallest (Deng et al., 2000). Most of the CSN subunits are more stable as part of the eight subunit holocomplex, but some smaller complexes, such as the mini-CSN, containing CSN4-7, have been reported (Oron et al., 2002; Tomoda et al., 2002). CSN5, first identified as Junactivation-domain-binding protein (Jab1), functions independently of the holo-CSN, and has been shown to interact with many cellular signaling mediators (Kato and Yoneda-Kato, 2009). The molecular constitution and functionality of these complexes are not yet clearly understood.
[0329] CSN5 and CSN6 each contain an MPR1-PAD1-N-terminal (MPN) domain, but only CSN5 contains a JAB1 MPN domain metalloenzyme motif (JAMM/MPN+ motif). The other six subunits contain a proteasome-COP9 signalosome-initiation factor 3 domain (PCI (or PINT)) (Hofmann and Bucher, 1998). Though the exact function of these domains is not yet fully understood, they bear an extremely similar homology to the lid complex of the proteasome and the eIF3 complex (Hofmann and Bucher, 1998), suggesting that the function of the CSN relates to protein synthesis and degradation.
[0330] The best characterized function of the CSN is the regulation of protein stability. The CSN regulates protein degradation by deneddylation of cullins. Cullins are protein scaffolds at the center of the ubiquitin E3 ligase. They also serve as docking sites for ubiquitin E2 conjugating enzymes and protein substrates targeted for degradation. The cullin-RING-E3 ligases (CRLs) are the largest family of ubiquitin ligases. Post-translational modification of the cullin subunit of a CRL by conjugation of Nedd8 is required for CRL activity (Chiba and Tanaka, 2004; Ohh et al., 2002). The CSN5 JAMM motif catalyzes removal of Nedd8 from CRLs; this deneddylation reaction requires an intact CSN holocomplex (Cope et al., 2002; Sharon et al., 2009). Although cullin deneddylation inactivates CRLs, the CSN is required for CRL activation (Schwechheimer and Deng, 2001), and may prevent CRL components from self-destruction by autoubiquitinylation (Peth et al., 2007).
[0331] The CSN has many other biological functions, including apoptosis and cell proliferation. Knockout of CSN components 2, 3, 5, and 8 in mice causes early embryonic death due to massive apoptosis with CSN5 knockout exhibiting the most severe phenotype (Lykke-Andersen et al., 2003; Menon et al., 2007; Tomoda et al., 2004; Yan et al., 2003). These functions may be related to the complex's role in protein stability and degradation because the phenotypes in these knockout animals parallel the phenotype of NAE knockout mice (Tateishi et al., 2001) and knockout mice of various cullins (Dealy et al., 1999; Li et al., 2002; Wang et al., 1999).
[0332] Ablation of CSN5 in thymocytes results in apoptosis as a result of increased expression of proapoptotic BCL2-associated X protein (Bax) and decreased expression of anti-apoptotic Bcl-xL protein (Panattoni et al., 2008). The interaction of CSN5 with the cyclin-dependent kinase (CDK) inhibitor p27 suggests its role in cell proliferation (Tomoda et al., 1999). CSN5 knockout thymocytes display G2 arrest (Panattoni et al., 2008), while CSN8 plays a role in T cell entry to the cell cycle from quiescence (Menon et al., 2007).
11. The CSN and Cancer
[0333] The involvement of the CSN in such cellular functions as apoptosis, proliferation and cell cycle regulation suggest that it may play a role in cancer. In fact, overexpression of CSN5 is observed in a variety of tumors (Table 7), and knockdown of CSN5 inhibits the proliferation of tumor cells (Fukumoto et al., 2006). CSN5 is also involved in myc-mediated transcriptional activation of genes involved in cell proliferation, invasion and angiogenesis (Adler et al., 2006). CSN2 and CSN3 are identified as putative tumor suppressors due to their ability to overcome senescence (Leal et al., 2008), and inhibit the proliferation of mouse fibroblasts (Yoneda-Kato et al., 2005), respectively.
TABLE-US-00012 TABLE 7 CSN5 Overexpression Correlating Tumor Progression or Clinical Outcome (Richardson and Zundel, 2005) indicator Cancer (reference) Increased expression
with poor clinical outcome CSN5 Pancreatic
(101) Not evaluated CSN5
carcinoma (53) Gene amplification
CSN5
carcinoma (102) Not evaluated CSN5
squamous cell carcinoma (87) Indicator of disease-free and overall survival CSN5
squamous cell carcinoma (
) Indicator of lymph node
and poor prognosis CSN6 Lung adenocarcinoma (104) Indicator of disease state but not clinical outcome CSN6 Breast ductal carcinoma
(105) Expression is higher in
with
CSN6 Node-negative breast cancer (89) Associated with
but not disease-free survival CSN5 Invasive breast carcinoma (89) Indicator of disease progression and relapse CSN5 Melanoma (
) Not evaluated CSN5
(91) Not evaluated CSN5 Pituitary carcinomas (110) Not evaluated CSN6
(131) Localization associated with tumor differentiation CSN6 B-cell non-Hodgkin’s lymphoma (
) Not evaluated CSN6 Malignant lymphoma (thyroid, ref. 113) Predictor of tumor grade and proliferating index
indicates data missing or illegible when filed
[0334] Knockdown of CSN5 in xenograft models significantly decreases tumor growth (Supriatno et al., 2005). Derivatives of the natural product curcumin inhibit the growth of pancreatic cancer cells by inhibition of CSN5 (Li et al., 2009). Taken together, these findings indicate that the CSN is a good therapeutic target in cancer.
12. The CSN and NF-κB Activation: A Role in DLBCL?
[0335] The CSN regulates NF-κB activity differently in different cellular contexts. In TNFα-stimulated synviocytes of rheumatoid arthritis patients, knockdown of CSN5 abrogates TNFR1-ligation dependent IκBα degradation and NF-κB activation (Wang et al., 2006). Ablation of CSN subunits in TNFα-stimulated endothelial cells, however, results in stabilization of IκBα and sustained nuclear translocation of NF-κB (Schweitzer and Naumann, 2010).
[0336] Studies of the CSN in T cells demonstrate its critical role in T cell development and survival. Thymocytes from CSN5 null mice display cell cycle arrest and increased apoptosis. Importantly, these cells show accumulation of IκBα, reduced nuclear NF-κB accumulation, and decreased expression of anti-apoptotic NF-κB target genes (Panattoni et al., 2008), suggesting that CSN5 regulates T-cell activation. In fact, the CSN interacts with the CBM complex in activated T cells. T-cell activation stimulates interaction of the CSN with MALT1 and CARD11 and with BCL10 through MALT1. CSN2 and CSN5 stabilize the CBM by deubiquitinylating BCL10. Knockdown of either subunit causes rapid degradation of Bcl10 and also blocks IKK activation in TCR-stimulated T cells, suggesting that CSN may regulate NF-κB activity through this mechanism (Welteke et al., 2009).
[0337] The exact function of the CSN in NF-κB regulation is not well defined, and may differ depending on cell type. The involvement of the CSN in NF-κB regulation, particularly in T cells and through the stabilization of the CBM, suggests that it may play a role in DLBCL pathology.
Preliminary Results
[0338] CPs were performed in OCI-Ly1 and OCI-Ly7 DLBCL cell lines. Cells were lysed, and cytosolic and nuclear lysates were extracted. Lysates were incubated with either control or agarose beads coated with PUH71 overnight, then washed to remove non-specifically bound proteins. Tightly binding proteins were eluted by boiling in SDS/PAGE loading buffer, separated by SDS/PAGE and visualized by colloidal blue staining Gel lanes were cut into segments and analyzed by mass spectroscopy by our collaborators. Proteins that were highly represented (determined by number of peptides) in PUH71 pulldowns but not control pulldowns are candidate DLBCL-related Hsp90 substrate proteins. After excluding common protein contaminants and the agarose proteome, we obtained 80% overlapping putative client proteins (N=˜200) in both cell lines represented by multiple peptides. One of the pathways highly represented among PU-H71 Hsp90 clients in these experiments is the BCR pathway (23 proteins out of 200, shown in grey in
Experimental Approach
AIM1: To Determine Whether Concomitant Modulation of Hsp90 and BCR Pathways Cooperate in Killing DLBCL Cells In Vitro and In Vivo
[0339] Our preliminary data identified many components of the BCR pathway as substrate proteins of Hsp90 in DLBCL. The BCR pathway has been implicated in oncogenesis and DLBCL survival. We hypothesize that combined inhibition of Hsp90 and components of the BCR pathway will synergize in killing DLBCL.
Experimental Design and Expected Outcomes
[0340] DLBCL cell lines will be maintained in culture. GCB DLBCL cell lines will include OCI-Ly1, OCI-Ly7, and Toledo. ABC DLBCL cell lines will include OCI-Ly3, OCI-Ly10, HBL-1, TMD8. Cell lines OCI-Ly1, OCT-Ly7, and OCT-Ly10 will be maintained in 90% Iscove's modified medium containing 10% FBS and supplemented with penicillin and streptomycin. Cell lines Toledo, OCI-Ly3, and HBL-1 will be grown in 90% RPMI and 10% FBS supplemented with penicillin and streptomycin, L-glutamine, and HEPES. The TMD8 cell line will be grown in medium containing 90% mem-alpha and 10% FBS supplemented with penicillin and streptomycin.
[0341] Components of the BCR pathway were identified as substrate proteins of Hsp90 in a preliminary experiment of a proteomics analysis of PU-H71 CPs in two DLBCL cell lines. To verify that the components of the BCR pathway are stabilized by Hsp90, CPs will be performed using DLBCL cell lines and analyzed by western blot using commercially available antibodies to BCR pathway components, including CD79a, CD79b, Syk, Btk, PLCγ2, AKT, mTOR, CAMKII, p38 MAPK, p40 ERK1/2, p65, Bcl-XL, Bcl6. CPs will be performed with increasing salt concentrations to show the affinity of Hsp90 for these substrate proteins. Because some proteins are expressed at low levels, nuclear/cytosolic separation of cell lysates will be performed to enrich for Hsp90 substrate proteins that are not readily detected using whole cell lysate.
[0342] Hsp90 stabilization of BCR pathway components will also be demonstrated by treatment of DLBCL cell lines with increasing doses of PU-H71. Levels of the substrate proteins listed above will be determined by western blot. Substrate proteins are expected to be degraded by exposure to PU-H71 in a dose-dependent and time-dependent manner.
[0343] Viability of DLBCL cell lines will be assessed following treatment with PU-H71 or inhibitors of BCR pathway components (Syk, Btk, PLCγ2, AKT, mTOR, p38 MAPK, p40 ERK1/2, NF-κB). Inhibitors of BCR pathway components will be selected and prioritized based on reported data in DLBCL and use in clinical trials. For example, the Melnick lab has MTAs in place to use PCI-32765 and MLN4924 (described above). Cells will be plated in 96-well plates at concentrations sufficient to keep untreated cells in exponential growth for the duration of drug treatment. Drugs will be administered in 6 different concentrations in triplicate wells for 48 hours. Cell viability will be measured with a fluorometric resazurin reduction method (CellTiter-Blue, Promega).
[0344] Fluorescence (560.sub.excitation/590.sub.emission) will be measured using the Synergy4 microplate reader in the Melnick lab (BioTek). Viability of treated cells will be normalized to appropriate vehicle controls, for example, water, in the case of PU-H71. Dose-effect curves and calculation of the drug concentration that inhibits the growth of the cell line by 50% compared to control (GI50) will be performed using CompuSyn software (Biosoft). Although many of these findings may be confirmatory of published data, instituting effective methods with these inhibitors and determining their dose-responses in our cell lines will be necessary for later combination treatment experiments demonstrating the effect of combined inhibition of Hsp90 and the BCR pathway.
[0345] Once individual dose-response curves and G150s for BCR pathway inhibitors have been established, DLBCL cells will be treated with both PU-H71 and single inhibitors of the BCR pathway to demonstrate the effect of the combination on cell killing. Experiments will be performed in 96-well plates using the conditions described above. Cells will be treated with 6 different concentrations of combination of drugs in constant ratio in triplicate with the highest dose being twice the GI50 of each drug as measured in individual dose-response experiments. Drugs will be administered in different sequences in order to determine the most effective treatment schedule: PU-H71 followed by drug X after 24 hours, drug X followed by PU-H71 after 24 hours, and PU-H71 with drug X. Viability will be determined after 48 hours using the assays mentioned above. Isobologram analysis of cell viability will be performed using Compusyn software.
[0346] Combination treatments in DLBCL cell lines proposed above will guide experiments in xenograft models in terms of dose and schedule. The drug schedules that exhibit the best cell killing effect will be translated to xenograft models. DLBCL cell lines will be injected subcutaneously into SCID mice, using two cell lines expected to respond to drug and one cell line expected not to respond as a negative control. Tumor growth will be monitored every other day until palpable (about 75-100 mm.sup.3). Animals (n=20) will be randomly divided into the following groups: control, PU-H71, BCR pathway inhibitor (drug X), and PU-H71+drug X with five animals per group. To measure drug effect on tumor growth, tumor volume will be measured with Xenogen IVIS system every other day after drug administration. After ten days, all animals will be sacrificed, and tumors will be assayed for apoptosis by TUNEL. To assess drug effect on survival, a second cohort of animals as specified above will be treated and sacrificed when tumors reach 1000 mm.sup.3 in size. Tumors will be analyzed biochemically to demonstrate that the drugs hit their targets, by ELISA for NF-κB activity or phosphorlyation of downstream targets, for example. We will perform toxicity studies established in the Melnick lab (Cerchietti et al., 2009a) in treated mice including physical examination, macro and microscopic tissue examination, serum chemistries and CBCs.
Alternatives and Pitfalls
[0347] If the fluorescence assay used to detect cell viability is incompatible with some cell lines (due to acidity of media, for example) an ATP-based luminescent method (CellTiter-Glo, Promega) will be used. Also, because some drugs may not kill cells in 48 hours, higher drug doses and longer drug incubations will be performed if necessary to determine optimal drug treatments. It is possible inhibition of some BCR pathway components will not demonstrate an improved effect in killing DLBCL when combined with inhibition of Hsp90, but based on preliminary data shown above, we believe that some combinations will be more effective than either drug alone.
AIM 2: To Evaluate the Role of the CSN in DLBCL
Subaim 1: To Determine Whether the CSN can be a Therapeutic Target in DLBCL
[0348] Our preliminary data has identified subunits of the CSN as substrate proteins of Hsp90 in DLBCL. The CSN has been implicated in cancer and may play a role in DLBCL survival. We hypothesize that DLBCL requires the CSN for survival and that combined inhibition of Hsp90 and the CSN will synergize in killing DLBCL.
Experimental Design and Expected Outcomes
[0349] Expression of CSN subunits in DLBCL cell lines (described above) will be verified. DLBCL cell lines will be lysed for protein harvest and analyzed by SDS-PAGE and western blotting using commercially available antibodies to the CSN subunits and actin as a loading control.
[0350] The CSN was identified as a substrate protein of Hsp90 in a preliminary proteomics analysis of PU-H71 CPs in two DLBCL cell lines. To verify that Hsp90 stabilizes the CSN, CPs will be performed as described above using DLBCL cell lines and analyzed by western blot. Hsp90 stabilization of the CSN will also be demonstrated by treatment of DLBCL cell lines with increasing PU-H71 concentration. Protein levels of CSN subunits will be determined by western blot. CSN subunits are expected to be degraded upon exposure to PU-H71 in a dose-dependent and time-dependent manner.
[0351] DLBCL cells lines will be infected with lentiviral pLKO.1 vectors containing short hairpin (sh)RNAs targeting CSN2 or CSN5 and selected by puromycin resistance. These vectors are commercially available through the RNAi Consortium. These subunits will be used because knockdown of one CSN subunit can affect expression of other CSN subunits (Menon et al., 2007; Schweitzer et al., 2007; Schweitzer and Naumann, 2010), and knockdown of CSN2 ablates formation of the CSN holocomplex. CSN5 knockdown will be used because this subunit contains the enzymatic domain of the CSN. A pool of 3 to 5 shRNAs will be tested against each target to obtain the sequence with optimal knockdown of the target protein. Empty vector and scrambled shRNAs will be used as controls. Because we predict that knockdown of CSN subunits will kill DLBCL cells, and we aim to measure cell viability, tetracycline (tet) inducible constructs will be used. This method may also allow us to establish conditions for dose-dependent knockdown of CSN subunits using a titration of shRNA induction. Knockdown efficiency will be assessed by western blot following infection and tet induction. Cells will be assessed for viability using the methods described in Aim 1 following infection. We predict that knockdown the CSN will kill DLBCLs, and ABC DLBCLs are expected to depend on the CSN for survival more than GCB DLBCLs because of the CSN's role in stabilizing the CBM complex.
[0352] Following CSN monotherapy experiments in DLBCL, induction of CSN knockdown will be combined with PU-H71 treatment in DLBCL cell lines. shRNA constructs that demonstrate effective dose dependent CSN knock down in 48 hours (as evaluated in earlier experiments) will be used in order to perform 48 hour cell viability experiments. Control shRNAs as described above will be used. Control cells and cells infected with tet-inducible shRNA constructs targeting CSN subunits will be treated with different doses of tet and PU-H71 in constant ratio in triplicate. Drugs will be administered in different sequences in order to determine the most effective treatment schedule: PU-H71 followed by tet, tet followed by PU-H71, and PU-H71 with tet. Cell viability will be measured as described in Aim 1. Combined inhibition of the CSN and Hsp90 is expected to synergize in killing DLBCL, specifically ABC DLBCL.
[0353] Combined inhibition of the CSN and Hsp90 in DLBCL cell lines proposed above will guide experiments in xenograft models. The most effective combination of PU-H71 and CSN knockdown from in vitro experiments will be used in xenograft experiments. Control and inducible-knockout-CSN DLBCL cells will be used for xenograft, using two cell lines expected to respond to treatment and one cell line expected not to respond to treatment as a negative control. Animals will be treated with vehicle, PU-H71, or tet, using the dose and schedule of the most effective combination of PU-H71 and tet as determined by in vitro experiments. Tumor growth, animal survival and toxicity will be assayed as described in Aim 1.
Alternatives and Pitfalls
[0354] Accomplishing dose-dependent knockdown of the CSN by titration of tetracycline induction may prove difficult. If this occurs, in order to demonstrate proof of principle, shRNAs with different knockdown efficiencies will be used to simulate increasing inhibition of the CSN as a monotherapy and in combination with different doses of PU-H71.
Subaim 2: To Determine the Mechanism of DLBCL Dependence on the CSN
[0355] Since the CSN has been shown to interact with the CBM complex and activate IKK in stimulated T-cells, we hypothesize that the CSN interacts with the CBM, stabilizes Bcl10, and activates NF-κB in DLBCL.
Experimental Design and Expected Outcomes
[0356] DLBCL cell lysates will be incubated with an antibody to CSN1 that effectively precipitates the whole CSN complex (da Silva Correia et al., 2007; Wei and Deng, 1998). Precipitated CSN1 complexes will be separated by SDS-PAGE and analyzed for interaction with CBM components by western blot using commercially available antibodies to the different components of the CBM: CARD11, BCL10, and MALT1. Based on reported experiments in T cells, we expect the CSN to interact preferentially with CARD11 and MALT1 in ABC DLBCL cell lines as opposed to GCB DLBCL cell lines because of the chronic active BCR signaling in ABC DLBCL.
[0357] Because the CSN, specifically CSN5, has been shown to regulate Bcl10 stability and degradation in activated T-cells, we hypothesize that the CSN stabilizes Bcl10 in DLBCL. DLBCL cells lines will be infected with short hairpin (sh)RNAs targeting CSN subunits as described above. Cells will be treated with tet to induce CSN subunit knockdown and Bcl10 protein levels in infected and induced cells will be quantified by western blot. We expect Bcl10 levels to be degraded with CSN subunit knockdown in a dose-dependent and time-dependent manner. To demonstrate that reduction in Bcl10 protein is not a result of cell death, cell viability will be measured by counting viable cells with Trypan blue before cell lysis. CSN subunit knockdown will be combined with proteasome inhibition to demonstrate that Bcl10 degradation is a specific effect of CSN ablation.
[0358] Knockdown of CSN2 or CSN5 is expected to abrogate NF-κB activity in DLBCL cell lines. Using DLBCL cell lines infected with control shRNAs or shRNAs to CSN2 or CSN5, control and infected cells will be assayed for NF-κB activity in several ways. First, lysates will be analyzed by western blot to determine levels of IκBα protein. Second, nuclear translocation of the NF-κB subunits p65 and c-Rel will be measured by western blot of nuclear and cytosolic fractions of lysed cells or by plate-based EMSA of nuclei from control and infected cells. Finally, NF-κB target gene expression of these cells will be evaluated at the transcript and protein level by quantitative PCR of cDNA prepared by reverse transcriptase PCR (RT-PCR) and western blot, respectively.
Alternatives and Pitfalls
[0359] Because the CSN was shown to interact with the CBM in TCR-stimulated T cells, we predict that the CSN interacts with the CBM in DLBCL, especially in ABC DLBCL because this subtype exhibits chronic active BCR signaling. If CSN-CBM interaction is not apparent in DLBCL, then cells will be stimulated with IgM in order to activate the BCR pathway and stimulate formation of the CBM. To determine the kinetics of the CSN interaction with the CBM, cellular IPs as described above will be performed over a time course from the point of IgM stimulation. To correlate CSN-CBM interaction with the kinetics of CBM formation, BCL10 IP will be performed to demonstrate BCL10-CARD11 interaction over the same time course.
Conclusions and Future Directions
[0360] The development of PU-H71 as a new therapy for DLBCL is promising, but combination treatments are likely to be more potent and less toxic. PU-H71 can also be used as a tool to identify substrate proteins of Hsp90. In experiments using this method, the BCR pathway and the CSN were identified as substrates of Hsp90 in DLBCL.
[0361] The BCR plays a role in DLBCL oncogenesis and survival, and efforts to target components of this pathway have been successful. We predict that combining PU-H71 and inhibition of BCR pathway components will be a more potent and less toxic treatment approach. Identified synergistic combinations in cells and xenograft models will be evaluated for translation to clinical trials, and ultimately advance patient treatment toward rationally designed targeted therapy and away from chemotherapy.
[0362] The CSN has been implicated in cancer and NF-κB activation, indicating that it may be a good target in DLBCL. We hypothesize that the CSN stabilizes the CBM complex, promoting NF-κB activation and DLBCL survival. Therefore, we predict that combined inhibition of Hsp90 and the CSN will synergize in killing DLBCL. These studies will act as proof of principle that new therapeutic targets can be identified using the proteomics approach described in this proposal.
[0363] Future studies will identify compounds that target the CSN, and ultimately bring CSN inhibitors to the clinic as an innovative therapy for DLBCL. Determining downstream effects of CSN inhibition, such as CBM stabilization and NF-κB activation may reveal new opportunities for additional combinatorial drug regimens of three drugs. Future studies will evaluate combinatorial regimens of three drugs inhibiting Hsp90, the CSN and its downstream targets together.
[0364] The most effective drug combinations with PU-H71 found in this study will be performed using other Hsp90 inhibitors in clinical development such as 17-DMAG to demonstrate the broad clinical applicability of identified effective drug combinations.
[0365] DLBCL, the most common form of non-Hodgkins lymphoma, is an aggressive disease that remains without cure. The studies proposed herein will advance the understanding of the molecular mechanisms behind DLBCL and improve patient therapy.
[0366] Here, we report on the design and synthesis of molecules based on purine, purine-like isoxazole and indazol-4-one chemical classes attached to Affi-Gel® 10 beads (
Methods of Synthesizing of Hsp90 Probes
6.1. General
[0367] .sup.1H and .sup.13C NMR spectra were recorded on a Bruker 500 MHz instrument. Chemical shifts were reported in δ values in ppm downfield from TMS as the internal standard. .sup.1H data were reported as follows: chemical shift, multiplicity (s=singlet, d=doublet, t=triplet, q=quartet, br=broad, m=multiplet), coupling constant (Hz), integration. .sup.13C chemical shifts were reported in δ values in ppm downfield from TMS as the internal standard. Low resolution mass spectra were obtained on a Waters Acquity Ultra Performance LC with electrospray ionization and SQ detector. High-performance liquid chromatography analyses were performed on a Waters Autopurification system with PDA, MicroMass ZQ and ELSD detector and a reversed phase column (Waters X-Bridge C18, 4.6×150 mm, 5 μm) using a gradient of (a) H.sub.2O+0.1% TFA and (b) CH.sub.3CN+0.1% TFA, 5 to 95% b over 10 minutes at 1.2 mL/min. Column chromatography was performed using 230-400 mesh silica gel (EMD). All reactions were performed under argon protection. Affi-Gel® 10 beads were purchased from Bio-Rad (Hercules, Calif.). EZ-Link® Amine-PEO.sub.3-Biotin was purchased from Pierce (Rockford, Ill.). PU-H71 (He et al., 2006) and NVP-AUY922 (Brough et al., 2008) were synthesized according to previously published methods. GM was purchased from Aldrich.
6.2. Synthesis
6.2.1. 9-(3-Bromopropyl)-8-(6-iodobenzo[d][1,3]dioxol-5-ylthio)-9H-purin-6-amine (2)
[0368] 1 (He et al., 2006) (0.500 g, 1.21 mmol) was dissolved in DMF (15 mL). Cs.sub.2CO.sub.3 (0.434 g, 1.33 mmol) and 1,3-dibromopropane (1.22 g, 0.617 mL, 6.05 mmol) were added and the mixture was stirred at rt for 45 minutes. Then additional Cs.sub.2CO.sub.3 (0.079 g, 0.242 mmol) was added and the mixture was stirred for 45 minutes. Solvent was removed under reduced pressure and the resulting residue was chromatographed (CH.sub.2Cl.sub.2:MeOH:AcOH, 120:1:0.5 to 80:1:0.5) to give 0.226 g (35%) of 2 as a white solid. .sup.1H NMR (CDCl.sub.3/MeOH-d.sub.4) δ 8.24 (s, 1H), 7.38 (s, 1H), 7.03 (s, 1H), 6.05 (s, 2H), 4.37 (t, J=7.1 Hz, 2H), 3.45 (t, J=6.6 Hz, 2H), 2.41 (m, 2H); MS (ESI): m/z 534.0/536.0 [M+H].sup.+.
6.2.2. tert-Butyl 6-aminohexylcarbamate (3) (Hansen et al., 1982)
[0369] 1,6-diaminohexane (10 g, 0.086 mol) and Et.sub.3N (13.05 g, 18.13 mL, 0.129 mol) were suspended in CH.sub.2Cl.sub.2 (300 mL). A solution of di-tert-butyl dicarbonate (9.39 g, 0.043 mol) in CH.sub.2Cl.sub.2 (100 mL) was added dropwise over 90 minutes at rt and stirring continued for 18 h. The reaction mixture was added to a separatory funnel and washed with water (100 mL), brine (100 mL), dried over Na.sub.2SO.sub.4 and concentrated under reduced pressure. The resulting residue was chromatographed [CH.sub.2Cl.sub.2:MeOH-NH.sub.3 (7N), 70:1 to 20:1] to give 7.1 g (76%) of 3. .sup.1H NMR (CDCl.sub.3) δ 4.50 (br s, 1H), 3.11 (br s, 2H), 2.68 (t, J=6.6 Hz, 2H), 1.44 (s, 13H), 1.33 (s, 4H); MS (ESI): m/z 217.2 [M+H].sup.+.
6.2.3. tert-Butyl 6-(3-(6-amino-8-(6-iodobenzo[d][1,3]dioxol-5-ylthio)-9H-purin-9-yl)propylamino)hexylcarbamate (4)
[0370] 2 (0.226 g, 0.423 mmol) and 3 (0.915 g, 4.23 mmol) in DMF (7 mL) was stirred at rt for 24 h. The reaction mixture was concentrated and the residue chromatographed [CHCl.sub.3:MeOH:MeOH-NH.sub.3 (7N), 100:7:3] to give 0.255 g (90%) of 4. .sup.1H NMR (CDCl.sub.3) δ 8.32 (s, 1H), 7.31 (s, 1H), 6.89 (s, 1H), 5.99 (s, 2H), 5.55 (br s, 2H), 4.57 (br s, 1H), 4.30 (t, J=7.0 Hz, 2H), 3.10 (m, 2H), 2.58 (t, J=6.7 Hz, 2H), 2.52 (t, J=7.2 Hz, 2H), 1.99 (m, 2H), 1.44 (s, 13H), 1.30 (s, 4H); .sup.13C NMR (125 MHz, CDCl.sub.3) δ 156.0, 154.7, 153.0, 151.6, 149.2, 149.0, 146.3, 127.9, 120.1, 119.2, 112.4, 102.3, 91.3, 79.0, 49.8, 46.5, 41.8, 40.5, 31.4, 29.98, 29.95, 28.4, 27.0, 26.7; HRMS (ESI) m/z [M+H].sup.+ calcd. for C.sub.26H.sub.37IN.sub.7O.sub.4S, 670.1673; found 670.1670; HPLC: t.sub.R=7.02 min.
6.2.4. N.SUP.1.-(3-(6-Amino-8-(6-iodobenzo[d][1,3]dioxol-5-ylthio)-9H-purin-9-yl)propyl)hexane-1,6-diamine (5)
[0371] 4 (0.310 g, 0.463 mmol) was dissolved in 15 mL of CH.sub.2Cl.sub.2:TFA (4:1) and the solution was stirred at rt for 45 min. Solvent was removed under reduced pressure and the residue chromatographed [CH.sub.2Cl.sub.2:MeOH-NH.sub.3 (7N), 20:1 to 10:1] to give 0.37 g of a white solid. This was dissolved in water (45 mL) and solid Na.sub.2CO.sub.3 added until pH-12. This was extracted with CH.sub.2Cl.sub.2 (4×50 mL) and the combined organic layers were washed with water (50 mL), dried over Na.sub.2SO.sub.4, filtered and concentrated under reduced pressure to give 0.200 g (76%) of 5. .sup.1H NMR (CDCl.sub.3) δ 8.33 (s, 1H), 7.31 (s, 1H), 6.89 (s, 1H), 5.99 (s, 2H), 5.52 (br s, 2H), 4.30 (t, J=6.3 Hz, 2H), 2.68 (t, J=7.0 Hz, 2H), 2.59 (t, J=6.3 Hz, 2H), 2.53 (t, J=7.1 Hz, 2H), 1.99 (m, 2H), 1.44 (s, 4H), 1.28 (s, 4H); .sup.13C NMR (125 MHz, CDCl.sub.3/MeOH-d.sub.4) δ 154.5, 152.6, 151.5, 150.0, 149.6, 147.7, 125.9, 119.7, 119.6, 113.9, 102.8, 94.2, 49.7, 46.2, 41.61, 41.59, 32.9, 29.7, 29.5, 27.3, 26.9; HRMS (ESI) m/z [M+H].sup.+ calcd. for C.sub.21H.sub.29IN.sub.7O.sub.2S, 570.1148; found 570.1124; HPLC: t.sub.R=5.68 min.
6.2.5. PU-H71-Affi-Gel 10 Beads (6)
[0372] 4 (0.301 g, 0.45 mmol) was dissolved in 15 mL of CH.sub.2Cl.sub.2:TFA (4:1) and the solution was stirred at rt for 45 min. Solvent was removed under reduced pressure and the residue dried under high vacuum overnight. This was dissolved in DMF (12 mL) and added to 25 mL of Affi-Gel 10 beads (prewashed, 3×50 mL DMF) in a solid phase peptide synthesis vessel. 225 μL of N,N-diisopropylethylamine and several crystals of DMAP were added and this was shaken at rt for 2.5 h. Then 2-methoxyethylamine (0.085 g, 97 μl, 1.13 mmol) was added and shaking was continued for 30 minutes. Then the solvent was removed and the beads washed for 10 minutes each time with CH.sub.2Cl.sub.2:Et.sub.3N (9:1, 4×50 mL), DMF (3×50 mL), Felts buffer (3×50 mL) and i-PrOH (3×50 mL). The beads 6 were stored in i-PrOH (beads: i-PrOH (1:2), v/v) at −80° C.
6.2.6. PU-H71-biotin (7)
[0373] 2 (4.2 mg, 0.0086 mmol) and EZ-Link® Amine-PEO.sub.3-Biotin (5.4 mg, 0.0129 mmol) in DMF (0.2 mL) was stirred at rt for 24 h. The reaction mixture was concentrated and the residue chromatographed [CHCl.sub.3:MeOH-NH.sub.3 (7N), 5:1] to give 1.1 mg (16%) of 7. .sup.1H NMR (CDCl.sub.3) δ 8.30 (s, 1H), 8.10 (s, 1H), 7.31 (s, 1H), 6.87 (s, 1H), 6.73 (br s, 1H), 6.36 (br s, 1H), 6.16 (br s, 2H), 6.00 (s, 2H), 4.52 (m, 1H), 4.28-4.37 (m, 3H), 3.58-3.77 (m, 10H), 3.55 (m, 2H), 3.43 (m, 2H), 3.16 (m, 1H), 2.92 (m, 1H), 2.80 (m, 2H), 2.72 (m, 1H), 2.66 (m, 2H), 2.17 (t, J=7.0 Hz, 2H), 2.04 (m, 2H), 1.35-1.80 (m, 6H); MS (ESI): m/z 872.2 [M+H].sup.+.
6.2.7. tert-Butyl 6-(4-(5-(2,4-bis(benzyloxy)-5-isopropylphenyl)-3-(ethylcarbamoyl)isoxazol-4-yl)benzylamino)hexylcarbamate (9)
[0374] AcOH (0.26 g, 0.25 mL, 4.35 mmol) was added to a mixture of 8 (Brough et al., 2008) (0.5 g, 0.87 mmol), 3 (0.56 g, 2.61 mmol), NaCNBH.sub.3 (0.11 g, 1.74 mmol), CH.sub.2Cl.sub.2 (21 mL) and 3 Å molecular sieves (3 g). The reaction mixture was stirred for 1 h at rt. It was then concentrated under reduced pressure and chromatographed [CH.sub.2Cl.sub.2:MeOH-NH.sub.3 (7N), 100:1 to 60:1] to give 0.50 g (75%) of 9. .sup.1H NMR (CDCl.sub.3) δ 7.19-7.40 (m, 12H), 7.12-7.15 (m, 2H), 7.08 (s, 1H), 6.45 (s, 1H), 4.97 (s, 2H), 4.81 (s, 2H), 3.75 (s, 2H), 3.22 (m, 2H), 3.10 (m, 3H), 2.60 (t, J=7.1 Hz, 2H), 1.41-1.52 (m, 13H), 1.28-1.35 (m, 4H), 1.21 (t, J=7.2 Hz, 3H), 1.04 (d, J=6.9 Hz, 6H); MS (ESI): m/z 775.3 [M+H].sup.+.
6.2.8. 4-(4-((6-Aminohexylamino)methyl)phenyl)-5-(2,4-dihydroxy-5-isopropylphenyl)-N-ethylisoxazole-3-carboxamide (10)
[0375] To a solution of 9 (0.5 g, 0.646 mmol) in CH.sub.2Cl.sub.2 (20 mL) was added a solution of BCl.sub.3 (1.8 mL, 1.87 mmol, 1.0 M in CH.sub.2Cl.sub.2) and this was stirred at rt for 10 h. Saturated NaHCO.sub.3 was added and CH.sub.2Cl.sub.2 was evaporated under reduced pressure. The water was carefully decanted and the remaining yellow precipitate was washed a few times with EtOAc and CH.sub.2Cl.sub.2 to give 0.248 g (78%) of 10. .sup.1H NMR (CDCl.sub.3/MeOH-d.sub.4) δ 7.32 (d, J=8.1 Hz, 2H), 7.24 (d, J=8.1 Hz, 2H), 6.94 (s, 1H), 6.25 (s, 1H), 3.74, (s, 2H), 3.41 (q, J=7.3 Hz, 2H), 3.08 (m, 1H), 2.65 (t, J=7.1 Hz, 2H), 2.60 (t, J=7.1 Hz, 2H), 1.40-1.56 (m, 4H), 1.28-1.35 (m, 4H), 1.21 (t, J=7.3 Hz, 3H), 1.01 (d, J=6.9 Hz, 6H); .sup.13C NMR (125 MHz, CDCl.sub.3/MeOH-d.sub.4) δ 168.4, 161.6, 158.4, 157.6, 155.2, 139.0, 130.5, 129.5, 128.71, 128.69, 127.6, 116.0, 105.9, 103.6, 53.7, 49.2, 41.8, 35.0, 32.7, 29.8, 27.6, 27.2, 26.4, 22.8, 14.5; HRMS (ESI) m/z [M+H]′ calcd. for C.sub.28H.sub.39N.sub.4O.sub.4, 495.2971; found 495.2986; HPLC: t.sub.R=6.57 min.
6.2.9. NVP-AUY922-Affi-Gel 10 Beads (11)
[0376] 10 (46.4 mg, 0.094 mmol) was dissolved in DMF (2 mL) and added to 5 mL of Affi-Gel 10 beads (prewashed, 3×8 mL DMF) in a solid phase peptide synthesis vessel. 45 μl of N,N-diisopropylethylamine and several crystals of DMAP were added and this was shaken at rt for 2.5 h. Then 2-methoxyethylamine (17.7 mg, 21 μl, 0.235 mmol) was added and shaking was continued for 30 minutes. Then the solvent was removed and the beads washed for 10 minutes each time with CH.sub.2Cl.sub.2 (3×8 mL), DMF (3×8 mL), Felts buffer (3×8 mL) and i-PrOH (3×8 mL). The beads 11 were stored in i-PrOH (beads: i-PrOH, (1:2), v/v) at −80° C.
6.2.10. N′-(3,3-Dimethyl-5-oxocyclohexylidene)-4-methylbenzenesulfonohydrazide (14) (Hiegel & Burk, 1973)
[0377] 10.00 g (71.4 mmol) of dimedone (13), 13.8 g (74.2 mmol) of tosyl hydrazide (12) and p-toluene sulfonic acid (0.140 g, 0.736 mmol) were suspended in toluene (600 mL) and this was refluxed with stirring for 1.5 h. While still hot, the reaction mixture was filtered and the solid was washed with toluene (4×100 mL), ice-cold ethyl acetate (2×200 mL) and hexane (2×200 mL) and dried to give 19.58 g (89%) of 14 as a solid. TLC (100% EtOAc) R.sub.f=0.23; .sup.1H NMR (DMSO-d.sub.6) δ 9.76 (s, 1H), 8.65 (br s, 1H), 7.69 (d, J=8.2 Hz, 2H), 7.41 (d, J=8.1 Hz, 2H), 5.05 (s, 1H), 2.39 (s, 3H), 2.07 (s, 2H), 1.92 (s, 2H), 0.90 (s, 6H); MS (ESI): m/z 309.0 [M+H].sup.+.
6.2.11. 6,6-Dimethyl-3-(trifluoromethyl)-6,7-dihydro-1H-indazol-4(5H)-one (15)
[0378] To 5.0 g (16.2 mmol) of 14 in THF (90 mL) and Et.sub.3N (30 mL) was added trifluoroacetic anhydride (3.4 g, 2.25 mL, 16.2 mmol) in one portion. The resulting red solution was heated at 55° C. for 3 h. After cooling to rt, methanol (8 mL) and 1M NaOH (8 mL) were added and the solution was stirred for 3 h at rt. The reaction mixture was diluted with 25 mL of saturated NH.sub.4Cl, poured into a separatory funnel and extracted with EtOAc (3×50 mL). The combined organic layers were washed with brine (3×50 mL), dried over Na.sub.2SO.sub.4 and concentrated under reduced pressure to give a red oily residue which was chromatographed (hexane:EtOAc, 80:20 to 60:40) to give 2.08 g (55%) of 15 as an orange solid. TLC (hexane:EtOAc, 6:4) R.sub.f=0.37; .sup.1H NMR (CDCl.sub.3) δ 2.80 (s, 2H), 2.46 (s, 2H), 1.16 (s, 6H); MS (ESI): m/z 231.0 [M−H].sup.−.
6.2.12. 2-Bromo-4-(6,6-dimethyl-4-oxo-3-(trifluoromethyl)-4,5,6,7-tetrahydro-1H-indazol-1-yl)benzonitrile (16)
[0379] To a mixture of 15 (0.100 g, 0.43 mmol) and NaH (15.5 mg, 0.65 mmol) in DMF (8 mL) was added 2-bromo-4-fluorobenzonitrile (86 mg, 0.43 mmol) and heated at 90° C. for 5 h. The reaction mixture was concentrated under reduced pressure and the residue chromatographed (hexane:EtOAc, 10:1 to 10:2) to give 0.162 g (91%) of 16 as a white solid. .sup.1H NMR (CDCl.sub.3) δ 7.97 (d, J=2.1 Hz, 1H), 7.85 (d, J=8.4 Hz, 1H), 7.63 (dd, J=8.4, 2.1 Hz, 1H), 2.89 (s, 2H), 2.51 (s, 2H), 1.16 (s, 6H); MS (ESI): m/z 410.0/412.0 [M−H].sup.−.
6.2.13. 2-(trans-4-Aminocyclohexylamino)-4-(6,6-dimethyl-4-oxo-3-(trifluoromethyl)-4,5,6,7-tetrahydro-1H-indazol-1-yl)benzonitrile (17)
[0380] A mixture of 16 (0.200 g, 0.485 mmol), NaOtBu (93.3 mg, 0.9704 mmol), Pd.sub.2(dba).sub.3 (88.8 mg, 0.097 mmol) and DavePhos (38 mg, 0.097 mmol) in 1,2-dimethoxyethane (15 mL) was degassed and flushed with argon several times. trans-1,4-Diaminocyclohexane (0.166 g, 1.456 mmol) was added and the flask was again degassed and flushed with argon before heating the reaction mixture at 50° C. overnight. The reaction mixture was concentrated under reduced pressure and the residue purified by preparatory TLC (CH.sub.2Cl.sub.2:MeOH-NH.sub.3 (7N), 10:1) to give 52.5 mg (24%) of 17. Additionally, 38.5 mg (17%) of amide 18 was isolated for a total yield of 41%. .sup.1H NMR (CDCl.sub.3) δ 7.51 (d, J=8.3 Hz, 1H), 6.81 (d, J=1.8 Hz, 1H), 6.70 (dd, J=8.3, 1.8 Hz, 1H), 4.64 (d, J=7.6 Hz, 1H), 3.38 (m, 1H), 2.84 (s, 2H), 2.81 (m, 1H), 2.49 (s, 2H), 2.15 (d, J=11.2 Hz, 2H), 1.99 (d, J=11.0 Hz, 2H), 1.25-1.37 (m, 4H), 1.14 (s, 6H); MS (ESI): m/z 446.3 [M+H].sup.+.
6.2.14. 2-(trans-4-Aminocyclohexylamino)-4-(6,6-dimethyl-4-oxo-3-(trifluoromethyl)-4,5,6,7-tetrahydro-1H-indazol-1-yl)benzamide (18)
[0381] A solution of 17 (80 mg, 0.18 mmol) in DMSO (147 μl), EtOH (590 μl), 5N NaOH (75 μl) and H.sub.2O.sub.2 (88 μl) was stirred at rt for 3 h. The reaction mixture was concentrated under reduced pressure and the residue purified by preparatory TLC [CH.sub.2Cl.sub.2:MeOH-NH.sub.3 (7N), 10:1] to give 64.3 mg (78%) of 18. .sup.1H NMR (CDCl.sub.3) δ 8.06 (d, J=7.5 Hz, 1H), 7.49 (d, J=8.4 Hz, 1H), 6.74 (d, J=1.9 Hz, 1H), 6.62 (dd, J=8.4, 2.0 Hz, 1H), 5.60 (br s, 2H), 3.29 (m, 1H), 2.85 (s, 2H), 2.77 (m, 1H), 2.49 (s, 2H), 2.13 (d, J=11.9 Hz, 2H), 1.95 (d, J=11.8 Hz, 2H), 1.20-1.42 (m, 4H), 1.14 (s, 6H); MS (ESI): m/z 464.4 [M+H].sup.+; HPLC: t.sub.R=7.05 min.
6.2.15. tert-Butyl 6-(trans-4-(2-carbamoyl-5-(6,6-dimethyl-4-oxo-3-(trifluoromethyl)-4,5,6,7-tetrahydro-1H-indazol-1-yl)phenylamino)cyclohexylamino)-6-oxohexylcarbamate (19)
[0382] To a mixture of 18 (30 mg, 0.0647 mmol) in CH.sub.2Cl.sub.2 (1 ml) was added 6-(Boc-amino)caproic acid (29.9 mg, 0.1294 mmol), EDCI (24.8 mg, 0.1294 mmol) and DMAP (0.8 mg, 0.00647 mmol). The reaction mixture was stirred at rt for 2 h then concentrated under reduced pressure and the residue purified by preparatory TLC [hexane:CH.sub.2Cl.sub.2:EtOAc:MeOH-NH.sub.3 (7N), 2:2:1:0.5] to give 40 mg (91%) of 19. .sup.1H NMR (CDCl.sub.3/MeOH-d.sub.4) δ 7.63 (d, J=8.4 Hz, 1H), 6.75 (d, J=1.7 Hz, 1H), 6.61 (dd, J=8.4, 2.0 Hz, 1H), 3.75 (m, 1H), 3.31 (m, 1H), 3.06 (t, J=7.0 Hz, 2H), 2.88 (s, 2H), 2.50 (s, 2H), 2.15 (m, 4H), 2.03 (d, J=11.5 Hz, 2H), 1.62 (m, 2H), 1.25-1.50 (m, 17H), 1.14 (s, 6H); .sup.13C NMR (125 MHz, CDCl.sub.3/MeOH-d.sub.4) δ 191.5, 174.1, 172.3, 157.2, 151.5, 150.3, 141.5, 140.6 (q, J=39.4 Hz), 130.8, 120.7 (q, J=268.0 Hz), 116.2, 114.2, 109.5, 107.3, 79.5, 52.5, 50.7, 48.0, 40.4, 37.3, 36.4, 36.0, 31.6, 31.3, 29.6, 28.5, 28.3, 25.7, 25.4; HRMS (ESI) m/z [M+Na].sup.+ calcd. for C.sub.34H.sub.47F.sub.3N.sub.6O.sub.5Na, 699.3458; found 699.3472; HPLC: t.sub.R=9.10 min.
6.2.16. 2-(trans-4-(6-Aminohexanamido)cyclohexylamino)-4-(6,6-dimethyl-4-oxo-3-(trifluoromethyl)-4,5,6,7-tetrahydro-1H-indazol-1-yl)benzamide (20)
[0383] 19 (33 mg, 0.049 mmol) was dissolved in 1 mL of CH.sub.2Cl.sub.2:TFA (4:1) and the solution was stirred at rt for 45 min. Solvent was removed under reduced pressure and the residue purified by preparatory TLC [CH.sub.2Cl.sub.2:MeOH-NH.sub.3 (7N), 6:1] to give 24 mg (86%) of 20. .sup.1H NMR (CDCl.sub.3/MeOH-d.sub.4) δ 7.69 (d, J=8.4 Hz, 1H), 6.78 (d, J=1.9 Hz, 1H), 6.64 (dd, J=8.4, 1.9 Hz, 1H), 3.74 (m, 1H), 3.36 (m, 1H), 2.92 (t, J=7.5 Hz, 2H), 2.91 (s, 2H), 2.51 (s, 2H), 2.23 (t, J=7.3 Hz, 2H), 2.18 (d, J=10.2 Hz, 2H), 2.00 (d, J=9.1 Hz, 2H), 1.61-1.75 (m, 4H), 1.34-1.50 (m, 6H), 1.15 (s, 6H); .sup.13C NMR (125 MHz, MeOH-d.sub.4) δ 191.2, 173.6, 172.2, 151.8, 149.7, 141.2, 139.6 (q, J=39.5 Hz), 130.3, 120.5 (q, J=267.5 Hz), 115.5, 114.1, 109.0, 106.8, 51.6, 50.0, 47.8, 39.0, 36.3, 35.2, 35.1, 31.0, 30.5, 26.8, 26.7, 25.4, 24.8; HRMS (ESI) m/z [M+H].sup.+ calcd. for C.sub.29H.sub.40F.sub.3N.sub.6O.sub.3, 577.3114; found 577.3126; HPLC: t.sub.R=7.23 min.
6.2.17. SNX-2112-Affi-Gel 10 Beads (21)
[0384] 19 (67 mg, 0.0992 mmol) was dissolved in 3.5 mL of CH.sub.2Cl.sub.2:TFA (4:1) and the solution was stirred at rt for 20 min. Solvent was removed under reduced pressure and the residue dried under high vacuum for two hours. This was dissolved in DMF (2 mL) and added to 5 mL of Affi-Gel 10 beads (prewashed, 3×8 mL DMF) in a solid phase peptide synthesis vessel. 45 μl of N,N-diisopropylethylamine and several crystals of DMAP were added and this was shaken at rt for 2.5 h. Then 2-methoxyethylamine (18.6 mg, 22 μl, 0.248 mmol) was added and shaking was continued for 30 minutes. Then the solvent was removed and the beads washed for 10 minutes each time with CH.sub.2Cl.sub.2 (3×8 mL), DMF (3×8 mL) and i-PrOH (3×8 mL). The beads 21 were stored in i-PrOH (beads: i-PrOH, (1:2), v/v) at −80° C.
6.2.18. N-Fmoc-trans-4-aminocyclohexanol (22) (Crestey et al., 2008)
[0385] To a solution of trans-4-aminocyclohexanol hydrochloride (2.0 g, 13.2 mmol) in dioxane:water (26:6.5 mL) was added Et.sub.3N (1.08 g, 1.49 mL, 10.7 mmol) and this was stirred for 10 min. Then Fmoc-OSu (3.00 g, 8.91 mmol) was added over five minutes and the resulting suspension was stirred at rt for 2 h. The reaction mixture was concentrated to −5 mL, then some CH.sub.2Cl.sub.2 was added. This was filtered and the solid was washed with H.sub.2O (4×40 mL) then dried to give 2.85 g (95%) of 22 as a white solid. Additional 0.100 g (3%) of 22 was obtained by extracting the filtrate with CH.sub.2Cl.sub.2 (2×100 mL), drying over Na.sub.2SO.sub.4, filtering and removing solvent for a combined yield of 98%. TLC (hexane:EtOAc, 20:80) R.sub.f=0.42; .sup.1H NMR (CDCl.sub.3) δ 7.77 (d, J=7.5 Hz, 2H), 7.58 (d, J=7.4 Hz, 2H), 7.40 (t, J=7.4 Hz, 2H), 7.31 (t, J=7.4 Hz, 2H), 4.54 (br s, 1H), 4.40 (d, J=5.6 Hz, 2H), 4.21 (t, J=5.6 Hz, 1H), 3.61 (m, 1H), 3.48 (m, 1H), 1.9-2.1 (m, 4H), 1.32-1.48 (m, 2H), 1.15-1.29 (m, 2H); MS (ESI): m/z 338.0 [M+H]′.
6.2.19. N-Fmoc-trans-4-aminocyclohexanol tetrahydropyranyl ether (23)
[0386] 1.03 g (3.05 mmol) of 22 and 0.998 g (1.08 mL, 11.86 mmol) of 3,4-dihydro-2H-pyran (DHP) was suspended in dioxane (10 mL). Pyridinium p-toluenesulfonate (0.153 g, 0.61 mmol) was added and the suspension stirred at rt. After 1 hr additional DHP (1.08 mL, 11.86 mmol) and dioxane (10 mL) were added and stirring continued. After 9 h additional DHP (1.08 mL, 11.86 mmol) was added and stirring continued overnight. The resulting solution was concentrated and the residue chromatographed (hexane:EtOAc, 75:25 to 65:35) to give 1.28 g (100%) of 23 as a white solid. TLC (hexane:EtOAc, 70:30) R.sub.f=0.26; .sup.1H NMR (CDCl.sub.3) δ 7.77 (d, J=7.5 Hz, 2H), 7.58 (d, J=7.5 Hz, 2H), 7.40 (t, J=7.4 Hz, 2H), 7.31 (dt, J=7.5, 1.1 Hz, 2H), 4.70 (m, 1H), 4.56 (m, 1H), 4.40 (d, J=6.0 Hz, 2H), 4.21 (t, J=6.1 Hz, 1H), 3.90 (m, 1H), 3.58 (m, 1H), 3.45-3.53 (m, 2H), 1.10-2.09 (m, 14H); MS (ESI): m/z 422.3 [M+H].sup.+.
6.2.20. trans-4-Aminocylohexanol tetrahydropyranyl ether (24)
[0387] 1.28 g (3.0 mmol) of 23 was dissolved in CH.sub.2Cl.sub.2 (20 mL) and piperidine (2 mL) was added and the solution stirred at rt for 5 h. Solvent was removed and the residue was purified by chromatography [CH.sub.2Cl.sub.2:MeOH-NH.sub.3 (7N), 80:1 to 30:1] to give 0.574 g (96%) of 24 as an oily residue which slowly crystallized. .sup.1H NMR (CDCl.sub.3) δ 4.70 (m, 1H), 3.91 (m, 1H), 3.58 (m, 1H), 3.49 (m, 1H), 2.69 (m, 1H), 1.07-2.05 (m, 14H); MS (ESI): m/z 200.2 [M+H].sup.+.
6.2.21. 4-(6,6-Dimethyl-4-oxo-3-(trifluoromethyl)-4,5,6,7-tetrahydro-1H-indazol-1-yl)-2-(trans-4-(tetrahydro-2H-pyran-2-yloxy)cyclohexylamino)benzonitrile (25)
[0388] A mixture of 16 (0.270 g, 0.655 mmol), NaOtBu (0.126 g, 1.31 mmol), Pd.sub.2(dba).sub.3 (0.120 g, 0.131 mmol) and DavePhos (0.051 g, 0.131 mmol) in 1,2-dimethoxyethane (20 mL) was degassed and flushed with argon several times. 24 (0.390 g, 1.97 mmol) was added and the flask was again degassed and flushed with argon before heating the reaction mixture at 60° C. for 3.5 h. The reaction mixture was concentrated under reduced pressure and the residue purified by preparatory TLC [hexane:CH.sub.2Cl.sub.2:EtOAc:MeOH-NH.sub.3 (7N), 7:6:3:1.5] to give 97.9 mg (28%) of 25. Additionally, 60.5 mg (17%) of amide 26 was isolated for a total yield of 45%. .sup.1H NMR (CDCl.sub.3) δ 7.52 (d, J=8.3 Hz, 1H), 6.80 (d, J=1.7 Hz, 1H), 6.72 (dd, J=8.3, 1.8 Hz, 1H), 4.72 (m, 1H), 4.67 (d, J=7.6 Hz, 1H), 3.91 (m, 1H), 3.68 (m, 1H), 3.50 (m, 1H), 3.40 (m, 1H), 2.84 (s, 2H), 2.49 (s, 2H), 2.06-2.21 (m, 4H), 1.30-1.90 (m, 10H), 1.14 (s, 6H); MS (ESI): m/z 529.4 [M−H].sup.−.
6.2.22. 4-(6,6-Dimethyl-4-oxo-3-(trifluoromethyl)-4,5,6,7-tetrahydro-1H-indazol-1-yl)-2-(trans-4-(tetrahydro-2H-pyran-2-yloxy)cyclohexylamino)benzamide (26)
[0389] A solution of 25 (120 mg, 0.2264 mmol) in DMSO (220 μl), EtOH (885 μl), 5N NaOH (112 μl) and H.sub.2O.sub.2 (132 μl) was stirred at rt for 4 h. Then 30 mL of brine was added and this was extracted with EtOAc (5×15 mL), dried over Na.sub.2SO.sub.4, filtered and concentrated under reduced pressure. The residue was purified by preparatory TLC [hexane:CH.sub.2Cl.sub.2:EtOAc:MeOH-NH.sub.3 (7N), 7:6:3:1.5] to give 102 mg (82%) of 26. .sup.1H NMR (CDCl.sub.3) δ 8.13 (d, J=7.4 Hz, 1H), 7.50 (d, J=8.4 Hz, 1H), 6.74 (d, J=1.9 Hz, 1H), 6.63 (dd, J=8.4, 2.0 Hz, 1H), 5.68 (br s, 2H), 4.72 (m, 1H), 3.91 (m, 1H), 3.70 (m, 1H), 3.50 (m, 1H), 3.34 (m, 1H), 2.85 (s, 2H), 2.49 (s, 2H), 2.05-2.19 (m, 4H), 1.33-1.88 (m, 10H), 1.14 (s, 6H); MS (ESI): m/z 547.4 [M−H].sup.−.
6.2.23. 4-(6,6-Dimethyl-4-oxo-3-(trifluoromethyl)-4,5,6,7-tetrahydro-1H-indazol-1-yl)-2-(trans-4-hydroxycyclohexylamino)benzamide (SNX-2112)
[0390] 26 (140 mg, 0.255 mmol) and pyridinium p-toluenesulfonate (6.4 mg, 0.0255 mmol) in EtOH (4.5 mL) was heated at 65° C. for 17 h. The reaction mixture was concentrated under reduced pressure and the residue purified by preparatory TLC [hexane:CH.sub.2Cl.sub.2:EtOAc:MeOH-NH.sub.3 (7N), 2:2:1:0.5] to give 101 mg (85%) of SNX-2112. .sup.1H NMR (CDCl.sub.3) δ 8.10 (d, J=7.4 Hz, 1H), 7.52 (d, J=8.4 Hz, 1H), 6.75 (d, J=1.3 Hz, 1H), 6.60 (dd, J=8.4, 1.6 Hz, 1H), 5.97 (br s, 2H), 3.73 (m, 1H), 3.35 (m, 1H), 2.85 (s, 2H), 2.48 (s, 2H), 2.14 (d, J=11.8 Hz, 2H), 2.04 (d, J=11.1 Hz, 2H), 1.33-1.52 (m, 4H), 1.13 (s, 6H); .sup.13C NMR (125 MHz, CDCl.sub.3/MeOH-d.sub.4) δ 191.0, 171.9, 151.0, 150.0, 141.3, 140.3 (q, J=39.6 Hz), 130.4, 120.3 (q, J=270.2 Hz), 115.9, 113.7, 109.2, 107.1, 69.1, 52.1, 50.2, 40.1, 37.0, 35.6, 33.1, 30.2, 28.0; MS (ESI): m/z 463.3 [M−H].sup.−, 465.3 [M+H].sup.+; HPLC: t.sub.R=7.97 min.
6.2.24. Preparation of Control Beads
[0391] DMF (8.5 mL) was added to 20 mL of Affi-Gel 10 beads (prewashed, 3×40 mL DMF) in a solid phase peptide synthesis vessel. 2-Methoxyethylamine (113 mg, 129 μL, 1.5 mmol) and several crystals of DMAP were added and this was shaken at rt for 2.5 h. Then the solvent was removed and the beads washed for 10 minutes each time with CH.sub.2Cl.sub.2 (4×35 mL), DMF (3×35 mL), Felts buffer (2×35 mL) and i-PrOH (4×35 mL). The beads were stored in i-PrOH (beads: i-PrOH (1:2), v/v) at −80° C.
6.3. Competition Assay
[0392] For the competition studies, fluorescence polarization (FP) assays were performed as previously reported (Du et al., 2007). Briefly, FP measurements were performed on an Analyst GT instrument (Molecular Devices, Sunnyvale, Calif.). Measurements were taken in black 96-well microtiter plates (Corning #3650) where both the excitation and the emission occurred from the top of the wells. A stock of 10 μM GM-cy3B was prepared in DMSO and diluted with Felts buffer (20 mM Hepes (K), pH 7.3, 50 mM KCl, 2 mM DTT, 5 mM MgCl.sub.2, 20 mM Na.sub.2MoO.sub.4, and 0.01% NP40 with 0.1 mg/mL BGG). To each 96-well were added 6 nM fluorescent GM (GM-cy3B), 3 ng SKBr3 lysate (total protein), and tested inhibitor (initial stock in DMSO) in a final volume of 100 μL HFB buffer. Drugs were added in triplicate wells. For each assay, background wells (buffer only), tracer controls (free, fluorescent GM only) and bound GM controls (fluorescent GM in the presence of SKBr3 lysate) were included on each assay plate. GM was used as positive control. The assay plate was incubated on a shaker at 4° C. for 24 h and the FP values in mP were measured. The fraction of tracer bound to Hsp90 was correlated to the mP value and plotted against values of competitor concentrations. The inhibitor concentration at which 50% of bound GM was displaced was obtained by fitting the data. All experimental data were analyzed using SOFTmax Pro 4.3.1 and plotted using Prism 4.0 (Graphpad Software Inc., San Diego, Calif.).
6.4. Chemical Precipitation, Western Blotting and Flow Cytometry
[0393] The leukemia cell lines K562 and MV4-11 and the breast cancer cell line MDA-MB-468 were obtained from the American Type Culture Collection. Cells were cultured in RPMI (K562), in Iscove's modified Dulbecco's media (MV4-11) or in DME/F12 (MDA-MB-468) supplemented with 10% FBS, 1% L-glutamine, 1% penicillin and streptomycin, and maintained in a humidified atmosphere of 5% CO.sub.2 at 37° C. Cells were lysed by collecting them in Felts buffer (HEPES 20 mM, KCl 50 mM, MgCl.sub.2 5 mM, NP40 0.01%, freshly prepared Na.sub.2MoO.sub.4 20 mM, pH 7.2-7.3) with added 10 μg/μL of protease inhibitors (leupeptin and aprotinin), followed by three successive freeze (in dry ice) and thaw steps. Total protein concentration was determined using the BCA kit (Pierce) according to the manufacturer's instructions.
[0394] Hsp90 inhibitor beads or control beads containing an Hsp90 inactive chemical (2-methoxyethylamine) conjugated to agarose beads were washed three times in lysis buffer. The bead conjugates (80 μL or as indicated) were then incubated overnight at 4° C. with cell lysates (250 μg), and the volume was adjusted to 200-300 μL with lysis buffer. Following incubation, bead conjugates were washed 5 times with the lysis buffer and analyzed by Western blot, as indicated below.
[0395] For treatment with PU-H71, cells were grown to 60-70% confluence and treated with inhibitor (5 μM) for 24 h. Protein lysates were prepared in 50 mM Tris pH 7.4, 150 mM NaCl and 1% NP-40 lysis buffer.
[0396] For Western blotting, protein lysates (10-50 μg) were electrophoretically resolved by SDS/PAGE, transferred to nitrocellulose membrane and probed with a primary antibody against Hsp90 (1:2000, SMC-107A/B, StressMarq), anti-IGF-IR (1:1000, 3027, Cell Signaling) and anti-c-Kit (1:200, 612318, BD Transduction Laboratories). The membranes were then incubated with a 1:3000 dilution of a corresponding horseradish peroxidase conjugated secondary antibody. Detection was performed using the ECL-Enhanced Chemiluminescence Detection System (Amersham Biosciences) according to manufacturer's instructions.
[0397] To detect the binding of PU-H71 to cell surface Hsp90, MV4-11 cells at 500,000 cells/ml were incubated with the indicated concentrations of PU-H71-biotin or D-biotin as control for 2 h at 37° C. followed by staining of phycoerythrin (PE) conjugated streptavidin (SA) (BD Biosciences) in FACS buffer (PBS+0.5% FBS) at 4° C. for 30 min. Cells were then analyzed using the BD-LSRII flow cytometer. Mean fluorescence intensity (MFI) was used to calculate the binding of PU-H71-biotin to cells and values were normalized to the MFI of untreated cells stained with SA-PE.
6.5. Docking
[0398] Molecular docking computations were carried out on a HP workstation xw8200 with the Ubuntu 8.10 operating system using Glide 5.0 (Schrodinger). The coordinates for the Hsp90a complexes with bound inhibitor PU-H71 (PDB ID: 2FWZ), NVP-AUY922 (PDB ID: 2VCI) and 27 (PDB ID: 3D0B) were downloaded from the RCSB Protein Data Bank. For docking experiments, compounds PU-H71, NVP-AUY922, 5, 10, 20 and 27 were constructed using the fragment dictionary of Maestro 8.5 and geometry-optimized using the Optimized Potentials for Liquid Simulations-All Atom (OPLS-AA) force field (Jorgensen et al., 1996) with the steepest descent followed by truncated Newton conjugate gradient protocol as implemented in Macromodel 9.6, and were further subjected to ligand preparation using default parameters of LigPrep 2.2 utility provided by Schrödinger LLC. Each protein was optimized for subsequent grid generation and docking using the Protein Preparation Wizard provided by Schrödinger LLC. Using this tool, hydrogen atoms were added to the proteins, bond orders were assigned, water molecules of crystallization not deemed to be important for ligand binding were removed, and the entire protein was minimized. Partial atomic charges for the protein were assigned according to the OPLS-2005 force field. Next, grids were prepared using the Receptor Grid Generation tool in Glide. With the respective bound inhibitor in place, the centroid of the workspace ligand was chosen to define the grid box. The option to dock ligands similar in size to the workspace ligand was selected for determining grid sizing.
[0399] Next, the extra precision (XP) Glide docking method was used to flexibly dock compounds PU-H71 and 5 (to 2FWZ), NVP-AUY922 and 10 (to 2VCI), and 20 and 27 (to 3D0B) into their respective binding site. Although details on the methodology used by Glide are described elsewhere (Patel et al., 2008; Friesner et al., 2004; Halgren et al., 2004), a short description about parameters used is provided below. The default setting of scale factor for van der Waals radii was applied to those atoms with absolute partial charges less than or equal to 0.15 (scale factor of 0.8) and 0.25 (scale factor of 1.0) electrons for ligand and protein, respectively. No constraints were defined for the docking runs. Upon completion of each docking calculation, at most 100 poses per ligand were allowed to generate. The top-scored docking pose based on the Glide scoring function (Eldridge et al., 1997) was used for our analysis. In order to validate the XP Glide docking procedure the crystallographic bound inhibitor (PU-H71 or NVP-AUY922 or 27) was extracted from the binding site and re-docked into its respective binding site. There was excellent agreement between the localization of the inhibitor upon docking and the crystal structure as evident from the 0.098 Å (2FWZ), 0.313 Å (2VC1) and 0.149 Å (3D0B) root mean square deviations. Thus, the present study suggests the high docking reliability of Glide in reproducing the experimentally observed binding mode for Hsp90 inhibitors and the parameter set for the Glide docking reasonably reproduces the X-ray structure.
TABLE-US-00013 TABLE 8 Binding affinity for Hsp90 from SKBr3 cellular extracts. Compound IC.sub.50 (nM) GM 15.4 PU-H71 22.4 5 19.8 7 67.1 NVP-AUY922 4.1 10 7.0 SNX-2112 15.1 18 210.1 20 24.7
REFERENCES
[0400] 1. Ackler, S., Xiao, Y., Mitten, M. J., Foster, K., Oleksijew, A., Refici, M., Schlessinger, S., Wang, B., Chemburkar, S. R., Bauch, J., et al. (2008). ABT-263 and rapamycin act cooperatively to kill lymphoma cells in vitro and in vivo. Mol Cancer Ther 7, 3265-3274. [0401] 2. Adler, A. S., Lin, M., Horlings, H., Nuyten, D. S., van de Vijver, M. J., and Chang, H. Y. (2006). Genetic regulators of large-scale transcriptional signatures in cancer. Nat Genet 38, 421-430. [0402] 3. Alizadeh, A. A., Eisen, M. B., Davis, R. E., Ma, C., Lossos, I. S., Rosenwald, A., Boldrick, J. C., Sabet, H., Tran, T., Yu, X., et al. (2000). Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature 403, 503-511. [0403] 4. An, W. G., Schulte, T. W. & Neckers, L. M. (2000). The heat shock protein 90 antagonist geldanamycin alters chaperone association with p210bcr-abl and v-src proteins before their degradation by the proteasome. Cell Growth Differ. 11, 355-360. [0404] 5. Andersen, J. N. et al. (2010). Pathway-Based Identification of Biomarkers for Targeted Therapeutics: Personalized Oncology with PI3K Pathway Inhibitors. Sci. Transl. Med. 2, 43ra55. [0405] 6. Apsel, B., et al. (2008). Targeted polypharmacology: discovery of dual inhibitors of tyrosine and phosphoinositide kinases. Nature Chem. Biol. 4, 691-699. [0406] 7. Ashman, K. & Villar, E. L. (2009). Phosphoproteomics and cancer research. Clin. Transl. Oncol. 11, 356-362. [0407] 8. Barril, X.; Beswick, M. C.; Collier, A.; Drysdale, M. J.; Dymock, B. W.; Fink, A.; Grant, K.; Howes, R.; Jordan, A. M.; Massey, A.; Surgenor, A.; Wayne, J.; Workman, P.; Wright, L., Bioorg. Med. Chem. Lett. 2006, 16, 2543-2548. [0408] 9. Barta, T. E.; Veal, J. M.; Rice, J. W.; Partridge, J. M.; Fadden, R. P.; Ma, W.; Jenks, M.; Geng, L.; Hanson, G. J.; Huang, K. H.; Barabasz, A. F.; Foley, B. E.; Otto, J.; Hall, S. E., Bioorg. Med. Chem. Lett. 2008, 18, 3517-3521. [0409] 10. Bedford, M. T. & Clarke, S. G. (2009). Protein arginine methylation in mammals: who, what, and why. Mol. Cell 33, 1-13. [0410] 11. Bonvini, P., Gastaldi, T., Falini, B., and Rosolen, A. (2002). Nucleophosmin-anaplastic lymphoma kinase (NPM-ALK), a novel Hsp90-client tyrosine kinase: down-regulation of NPMALK expression and tyrosine phosphorylation in ALK(+) CD30(+) lymphoma cells by the Hsp90 antagonist 17-allylamino,17-demethoxygeldanamycin. Cancer Res 62, 1559-1566. [0411] 12. Brehme, M. et al. (2009). Charting the molecular network of the drug target Bcr-Abl. Proc. Natl. Acad. Sci. USA 106, 7414-7419. [0412] 13. Brough, P. A., Aherne, W., Barril, X., Borgognoni, J., Boxall, K., Cansfield, J. E., Cheung, K.-M. J., Collins, I., Davies, N. G. M., Drysdale, M. J., Dymock, B., Eccles, S. A., Finch, H., Fink, A., Hayes, A., Howes, R., Hubbard, R. E., James, K., Jordan, A. M., Lockie, A., Martins, V., Massey, A., Matthews, T. P., McDonald, E., Northfield, C. J., Pearl, L. H., Prodromou, C., Ray, S., Raynaud, F. I., Roughlcy, S. D., Sharp, S. Y., Surgenor, A., Walmsley, D. L., Webb, P., Wood, M., Workman, P., and Wright, L. (2008). J. Med. Chem. 51, 196-218. [0413] 14. Burke, B. A. & Carroll, M. (2010). BCR-ABL: a multi-faceted promoter of DNA mutation in chronic myelogeneous leukemia. Leukemia 24, 1105-1112. [0414] 15. Caldas-Lopes, E., Cerchietti, L., Ahn, J. H., Clement, C. C., Robles, A. I., Rodina, A., Moulick, K., Taldone, T., Gozman, A., Guo, Y., et al. (2009). Hsp90 inhibitor PU-H71, a multimodal inhibitor of malignancy, induces complete responses in triple-negative breast cancer models. Proc Natl Acad Sci USA 106, 8368-8373. [0415] 16. Carayol, N. et al. (2010). Critical roles for mTORC2- and rapamycin-insensitive mTORC I-complexes in growth and survival of BCR-ABL-expressing leukemic cells. Proc. Natl. Acad. Sci. USA. 107, 12469-12474. [0416] 17. Carden, C. P., Sarker, D., Postel-Vinay, S., Yap, T. A., Attard, G., Banerji, U., Garrett, M. D., Thomas, G. V., Workman, P., Kaye, S. B., and de Bono, J. S. (2010). Drug Discov. Today 15, 88-97. [0417] 18. Cerchietti, L. C., Ghetu, A. F., Zhu, X., Da Silva, G. F., Zhong, S., Matthews, M., Bunting, K. L., Polo, J. M., Fares, C., Arrowsmith, C. H., et al. (2010a). A small-molecule inhibitor of BCL6 kills DLBCL cells in vitro and in vivo. Cancer Cell 17, 400-411. [0418] 19. Cerchietti, L. C., Hatzi, K., Caldas-Lopes, E., Yang, S. N., Figueroa, M. E., Morin, R. D., Hirst, M., Mendez, L., Shaknovich, R., Cole, P. A., et al. (2010b). BCL6 repression of EP300 in human diffuse large B cell lymphoma cells provides a basis for rational combinatorial therapy. J Clin Invest. [0419] 20. Cerchietti, L. C., Lopes, E. C., Yang, S. N., Hatzi, K., Bunting, K. L., Tsikitas, L. A., Mallik, A., Robles, A. I., Walling, J., Varticovski, L., et al. (2009a). A purine scaffold Hsp90 inhibitor destabilizes BCL-6 and has specific antitumor activity in BCL-6-dependent B cell lymphomas. Nat Med 15, 1369-1376. [0420] 21. Cerchietti, L. C., Yang, S. N., Shaknovich, R., Hatzi, K., Polo, J. M., Chadbum, A., Dowdy, S. F., and Melnick, A. (2009b). A peptomimetic inhibitor of BCL6 with potent antilymphoma effects in vitro and in vivo. Blood 113, 3397-3405. [0421] 22. Chamovitz, D. A., Wei, N., Osterlund, M. T., von Arnim, A. G., Staub, J. M., Matsui, M., and Deng, X. W. (1996). The COPS complex, a novel multisubunit nuclear regulator involved in light control of a plant developmental switch. Cell 86, 115-121. [0422] 23. Chan, V. W., Meng, F., Soriano, P., DeFranco, A. L., and Lowell, C. A. (1997). Characterization of the B lymphocyte populations in Lyn-deficient mice and the role of Lyn in signal initiation and down-regulation. Immunity 7, 69-81. [0423] 24. Chandarlapaty, S., Sawai, A., Ye, Q., Scott, A., Silinski, M., Huang, K., Fadden, P., Partdrige, J., Hall, S., Steed, P., Norton, L., Rosen, N., and Solit, D. B. (2008). Clin. Cancer Res. 14, 240-248. [0424] 25. Chen, L., Juszczynski, P., Takeyama, K., Aguiar, R. C., and Shipp, M. A. (2006). Protein tyrosine phosphatase receptor-type 0 truncated (PTPROt) regulates SYK phosphorylation, proximal Bcell-receptor signaling, and cellular proliferation. Blood 108, 3428-3433. [0425] 26. Chen, L., Monti, S., Juszczynski, P., Daley, J., Chen, W., Witzig, T. E., Habermann, T. M., Kutok, J. L., and Shipp, M. A. (2008). SYK-dependent tonic B-cell receptor signaling is a rational treatment target in diffuse large B-cell lymphoma. Blood 111, 2230-2237. [0426] 27. Cheung, K. M.; Matthews, T. P.; James, K.; Rowlands, M. G.; Boxall, K. J.; Sharp, S. Y.; Maloney, A.; Roe, S. M.; Prodromou, C.; Pearl, L. H.; Aherne, G. W.; McDonald, E.; Workman, P., Bioorg. Med. Chem. Lett. 2005, 15, 3338-3343. [0427] 28. Chiba, T., and Tanaka, K. (2004). Cullin-based ubiquitin ligase and its control by NEDD8-conjugating system. Curr Protein Pept Sci 5, 177-184. [0428] 29. Chiosis, G., and Neckers, L. (2006). Tumor selectivity of Hsp90 inhibitors: the explanation remains elusive. ACS Chem Biol 1, 279-284. [0429] 30. Chiosis, G., Timaul, M. N., Lucas, B., Munster, P. N., Zheng, F. F., Sepp-Lorenzino, L., and Rosen, N. (2001). A small molecule designed to bind to the adenine nucleotide pocket of Hsp90 causes Her2 degradation and the growth arrest and differentiation of breast cancer cells. Chem Biol 8, 289-299. [0430] 31. Chou, T. C. (2006). Theoretical basis, experimental design, and computerized simulation of synergism and antagonism in drug combination studies. Pharmacol. Rev. 58, 621-681. [0431] 32. Chou, T. C. & Talalay, P. (1984). Quantitative analysis of dose-effect relationships: the combined effects of multiple drugs or enzyme inhibitors. Adv. Enzyme Regul. 22, 27-55. [0432] 33. Claramunt, R. M.; Lopez, C.; Perez-Medina, C.; Pinilla, E.; Tones, M. R.; Elguero, J., Tetrahedron 2006, 62, 11704-11713. [0433] 34. Clevenger, R. C.; Raibel, J. M.; Peck, A. M.; Blagg, B. S. J., J. Org. Chem. 2004, 69, 4375-4380. [0434] 35. Coiffier, B., Lepage, E., Briere, J., Herbrecht, R., Tilly, H., Bouabdallah, R., Morel, P., Van Den Neste, E., Salles, G., Gaulard, P., et al. (2002). CHOP chemotherapy plus rituximab compared with CHOP alone in elderly patients with diffuse large-B-cell lymphoma. N Engl J Med 346, 235-242. [0435] 36. Compagno, M., Lim, W. K., Grunn, A., Nandula, S. V., Brahmachary, M., Shen, Q., Bertoni, F., Ponzoni, M., Scandurra, M., Califano, A., et al. (2009). Mutations of multiple genes cause deregulation of NF-kappaB in diffuse large B-cell lymphoma. Nature 459, 717-721. [0436] 37. Cope, G. A., Suh, G. S., Aravind, L., Schwarz, S. E., Zipursky, S. L., Koonin, E. V., and Deshaies, R. J. (2002). Role of predicted metalloprotease motif of Jab1/Csn5 in cleavage of Nedd8 from Cul1. Science 298, 608-611. [0437] 38. Crestey, F.; Ottesen, L. K.; Jaroszewski, J. W.; Franzyk, H., Tetrahedron Lett. 2008, 49, 5890-5893. [0438] 39. da Silva Correia, J., Miranda, Y., Leonard, N., and Ulevitch, R. J. (2007). The subunit CSN6 of the COP9 signalosome is cleaved during apoptosis. J Biol Chem 282, 12557-12565. [0439] 40. Dai, B., Zhao, X. F., Hagner, P., Shapiro, P., Mazan-Mamczarz, K., Zhao, S., Natkunam, Y., and Gartenhaus, R. B. (2009). Extracellular signal-regulated kinase positively regulates the oncogenic activity of MCT-1 in diffuse large B-cell lymphoma. Cancer Res 69, 7835-7843. [0440] 41. Dal Porto, J. M., Gauld, S. B., Merrell, K. T., Mills, D., Pugh-Bernard, A. E., and Cambier, J. (2004). B cell antigen receptor signaling 101. Mol lmmunol 41, 599-613. [0441] 42. Davis, R. E., Brown, K. D., Siebenlist, U., and Staudt, L. M. (2001). Constitutive nuclear factor kappaB activity is required for survival of activated B cell-like diffuse large B cell lymphoma cells. J Exp Med 194, 1861-1874. [0442] 43. Davis, R. E., Ngo, V. N., Lenz, G., Tolar, P., Young, R. M., Romesser, P. B., Kohlhammer, H., Lamy, L., Zhao, H., Yang, Y., et al. (2010). Chronic active B-cell-receptor signalling in diffuse large B-cell lymphoma. Nature 463, 88-92. [0443] 44. de Groot, R. P., Raaijmakers, J. A., Lammers, J. W., Jove, R. & Koenderman, L. (1999). STAT5 activation by BCR-Abl contributes to transformation of K562 leukemia cells. Blood 94, 1108-1112. [0444] 45. de Jong, D., and Enblad, G. (2008). Inflammatory cells and immune microenvironment in malignant lymphoma. J Intern Med 264, 528-536. [0445] 46. da Rocha Dias, S. et al. (2005). Activated B-RAF is an Hsp90 client protein that is targeted by the anticancer drug 17-allylamino-17-demethoxygeldanamycin. Cancer Res. 65, 10686-10691. [0446] 47. Dealy, M. J., Nguyen, K. V., Lo, J., Gstaiger, M., Krek, W., Elson, D., Arbeit, J., Kipreos, E. T., and Johnson, R. S. (1999). Loss of Cul1 results in early embryonic lethality and dysregulation of cyclin E. Nat Genet 23, 245-248. [0447] 48. Deininger, M. W. & Druker, B. J. (2003). Specific targeted therapy of chronic myelogenous leukemia with imatinib. Pharmacol. Rev. 55, 401-423. [0448] 49. Deng, X. W., Dubiel, W., Wei, N., Hofmann, K., and Mundt, K. (2000). Unified nomenclature for the COPS signalosome and its subunits: an essential regulator of development. Trends Genet 16, 289. [0449] 50. Dezwaan, D. C. & Freeman, B. C. (2008). HSP90: the Rosetta stone for cellular protein dynamics? Cell Cycle 7, 1006-1012. [0450] 51. Dierov, J., Dierova. R. & Carroll, M. (2004). BCR/ABL translocates to the nucleus and disrupts an ATR-dependent intra-S phase checkpoint. Cancer Cell 5, 275-85. [0451] 52. Du, Y.; Moulick, K.; Rodina, A.; Aguirre, J.; Felts, S.; Dingledine, R.; Fu, H.; Chiosis, G., J. Biomol. Screen. 2007, 12, 915-924. [0452] 53. Dymock, B. W.; Barril, X.; Brough, P. A.; Cansfield, J. E.; Massey, A.; McDonald, E.; Hubbard, R. E.; Surgenor, A.; Roughley, S. D.; Webb, P.; Workman, P.; Wright, L.; Drysdale, M. J., J. Med. Chem. 2005, 48, 4212-4215. [0453] 54. Eldridge, M. D.; Murray, C. W.; Auton, T. R.; Paolini, G. V.; Mee, R. P., J. Comput.-Aided Mol. Des. 1997, 11, 425-445. [0454] 55. Erdjument-Bromage, H. et al. (1998). Micro-tip reversed-phase liquid chromatographic extraction of peptide pools for mass spectrometric analysis. J. Chromatogr. A 826, 167-181. [0455] 56. Fabian, M. A. et al. (2005). A small molecule-kinase interaction map for clinical kinase inhibitors. Nat. Biotechnol. 23, 329-336. [0456] 57. Fowler, N., Sharman, J., Smith, S., Boyd, T., Grant, B., Kolibaba, K., Furman, R., Buggy, J., Loury, D., Hamdy, A., et al. (2010). The Btk Inhibitor, PCI-32765, Induces Durable Responses with Minimal Toxicity In Patients with Relapsed/Refractory B-Cell Malignancies: Results From a Phase I Study 52nd ASH Annual Meeting and Exposition. [0457] 58. Friday, B. B., and Adjei, A. A. (2008). Advances in targeting the Ras/Raf/MEK/Erk mitogcnactivated protein kinase cascade with MEK inhibitors for cancer therapy. Clin Cancer Res 14, 342-346. [0458] 59. Friedberg, J. W., Sharman, J., Sweetenham, J., Johnston, P. B., Vose, J. M., Lacasce, A., SchaeferCutillo, J., De Vos, S., Sinha, R., Leonard, J. P., et al. (2010). Inhibition of Syk with fostamatinib disodium has significant clinical activity in non-Hodgkin lymphoma and chronic lymphocytic leukemia. Blood 115, 2578-2585. [0459] 60. Friesner, R. A.; Banks, J. L.; Murphy, R. B.; Halgren, T. A.; Klicic, J. J.; Mainz, D. T.; Repasky, M. P.; Knoll, E. H.; Shelley, M.; Perry, J. K.; Shaw, D. E.; Francis, P.; Shenkin, P. S., J. Med. Chem. 2004, 47, 1739-1749. [0460] 61. Fukumoto, A., Tomoda, K., Yoneda-Kato, N., Nakajima, Y., and Kato, J. Y. (2006). Depletion of Jab1 inhibits proliferation of pancreatic cancer cell lines. FEBS Lett 580, 5836-5844. [0461] 62. Gorre, M. E., Ellwood-Yen, K., Chiosis, G., Rosen, N., and Sawyers, C. L. (2002). BCR-ABL point mutants isolated from patients with imatinib mesylate-resistant chronic myeloid leukemia remain sensitive to inhibitors of the BCR-ABL chaperone heat shock protein 90. Blood 100, 3041-3044. [0462] 63. Grbovic, O. M. et al. (2006). V600E B-Raf requires the Hsp90 chaperone for stability and is degraded in response to Hsp90 inhibitors. Proc. Natl. Acad. Sci. USA 103, 57-62. [0463] 64. Gupta, M., Ansell, S. M., Novak, A. J., Kumar, S., Kaufmann, S. H., and Witzig, T. E. (2009) Inhibition of histone deacetylase overcomes rapamycin-mediated resistance in diffuse large Bcell lymphoma by inhibiting Akt signaling through mTORC2. Blood 114, 2926-2935. [0464] 65. Häcker, H. & Karin, M. (2006). Regulation and function of IKK and IKK-related kinases. Sci. STKE. (357):rel3. [0465] 66. Halgren, T. A.; Murphy, R. B.; Friesner, R. A.; Beard, H. S.; Frye, L. L.; Pollard, W. T.; Banks, J. L., J. Med. Chem. 2004, 47, 1750-1759. [0466] 67. Hanahan, D., and Weinberg, R. A. (2000). The hallmarks of cancer. Cell 100, 57-70. [0467] 68. Hanash, S. & Taguchi, A. (2010). The grand challenge to decipher the cancer proteome. Nat. Rev. Cancer 10, 652-660. [0468] 69. Hansen, J. B.; Nielsen, M. C.; Ehrbar, U.; Buchardt, O., Synthesis 1982, 404-405. [0469] 70. He, H. et al. (2006). Identification of potent water soluble purine-scaffold inhibitors of the heat shock protein 90. J. Med. Chem. 49, 381-390. [0470] 71. Hendriks, R. W. & Kersseboom, R. (2006). Involvement of SLP-65 and Btk in tumor suppression and malignant transformation of pre-B cells. Semin. Immunol. 18, 67-76. [0471] 72. Hiegel, G. A.; Burk, P., J. Org. Chem. 1973, 38, 3637-3639. [0472] 73. Hofmann, K., and Bucher, P. (1998). The PCI domain: a common theme in three multiprotein complexes. Trends Biochem Sci 23, 204-205. [0473] 74. Honigberg, L. A., Smith, A. M., Sirisawad, M., Verner, E., Loury, D., Chang, B., Li, S., Pan, Z., Thamm, D. H., Miller, R. A., et al. (2010). The Bruton tyrosine kinase inhibitor PCI-32765 blocks B-cell activation and is efficacious in models of autoimmune disease and B-cell malignancy. Proc Natl Acad Sci USA 107, 13075-13080. [0474] 75. Horn, T., Sandmann, T. & Boutros, M. (2010). Design and evaluation of genome-wide libraries for RNA interference screens. Genome Biol. 11(6):R61. [0475] 76. Huang, K. H., Veal, J. M., Fadden, R. P., Rice, J. W., Eaves, J., Strachan, J.-P., Barabasz, A. F., Foley, B. E., Barta, T. E., Ma, W., Silinski, M. A., Hu, M., Partridge, J. M., Scott, A., DuBois, L. G., Freed, T., Steed, P. M., Ommen, A. J., Smith, E. D., Hughes, P. F., Woodward, A. R., Hanson, G. J., McCall, W. S., Markworth, C. J., Hinkley, L., Jenks, M., Geng, L., Lewis, M., Otto, J., Fronk, B., Verleysen, K., and Hall, S. E. (2009) J. Med. Chem. 52, 4288-4305. [0476] 77. Hudes, G., Carducci, M., Tomczak, P., Dutcher, J., Figlin, R., Kapoor, A., Staroslawska, E., Sosman, J., McDermott, D., Bodrogi, I., et al. (2007). Temsirolimus, interferon alfa, or both for advanced renal-cell carcinoma. N Engl J Med 356, 2271-2281. [0477] 78. Hurvitz, S. A.; Finn, R. S., Future Oncol. 2009, 5, 1015-1025. [0478] 79. Immormino, R. M.; Kang, Y.; Chiosis, G.; Gewirth, D. T., J. Med. Chem. 2006, 49, 4953-4960. [0479] 80. Jaganathan, S., Yue, P. & Turkson, J. (2010). Enhanced sensitivity of pancreatic cancer cells to concurrent inhibition of aberrant signal transducer and activator of transcription 3 and epidermal growth factor receptor or Src. J. Pharmacol. Exp. Ther. 333, 373-381. [0480] 81. Janin, Y. L. (2010). ATPase inhibitors of heat-shock protein 90, second season. Drug Discov. Today 15, 342-353. [0481] 82. Jorgensen, W. L.; Maxwell, D.; Tirado-Rives, J., J. Am. Chem. Soc. 1996, 118, 11225-11236. [0482] 83. Kamal, A. et al. (2003). A high-affinity conformation of Hsp90 confers tumour selectivity on Hsp90 inhibitors, Nature 425, 407-410. [0483] 84. Kato, J. Y., and Yoneda-Kato, N. (2009). Mammalian COP9 signalosome. Genes Cells 14, 1209-1225. [0484] 85. Katzav, S. (2007). Flesh and blood: the story of Vav1, a gene that signals in hematopoietic cells but can be transforming in human malignancies. Cancer Lett. 255, 241-254. [0485] 86. Klejman, A. et al. (2002). The Src family kinase Hck couples BCR/ABL to STAT5 activation in myeloid leukemia cells. EMBO J. 21, 5766-5774. [0486] 87. Kolch, W. & Pitt, A. (2010). Functional proteomics to dissect tyrosine kinase signalling pathways in cancer. Nat. Rev. Cancer 10, 618-629. [0487] 88. Kufe D W, P. R., Weichselbaum P R, Bast R C, Gansler T S, Holland J F, Frei E (2003). Cancer Medicine 6, Vol Two (Hamilton, BC Decker). [0488] 89. Lam, K. P., Kuhn, R., and Rajewsky, K. (1997). In vivo ablation of surface immunoglobulin on mature B cells by inducible gene targeting results in rapid cell death. Cell 90, 1073-1083. [0489] 90. Lam, L. T., Davis, R. E., Pierce, J., Hepperle, M., Xu, Y., Hottelet, M., Nong, Y., Wen, D., Adams, J., Dang, L., et al. (2005). Small molecule inhibitors of IkappaB kinase are selectively toxic for subgroups of diffuse large B-cell lymphoma defined by gene expression profiling. Clin Cancer Res 11, 28-40. [0490] 91. Law, J. H.; Habibi, G.; Hu, K.; Masoudi, H.; Wang, M. Y.; Stratford, A. L.; Park, E.; Gee, J. M.; Finlay, P.; Jones, H. E.; Nicholson, R. I.; Carboni, J.; Gottardis, M.; Pollak, M.; Dunn, S. E., Cancer Res. 2008, 68, 10238-10246. [0491] 92. Le, Y. et al. (2009). FAK silencing inhibits leukemogenesis in BCR/ABL-transformed hematopoietic cells. Am. J. Hematol. 84, 273-278. [0492] 93. Leal, J. F., Fominaya, J., Cascon, A., Guijarro, M. V., Blanco-Aparicio, C., Lleonart, M., Castro, M. E., Ramon, Y. C. S., Robledo, M., Beach, D. H., et al. (2008). Cellular senescence bypass screen identifies new putative tumor suppressor genes. Oncogene 27, 1961-1970. [0493] 94. Lenz, G., Davis, R. E., Ngo, V. N., Lam, L., George, T. C., Wright, G. W., Dave, S. S., Zhao, H., Xu, W., Rosenwald, A., et al. (2008). Oncogenic CARD11 mutations in human diffuse large B cell lymphoma. Science 319, 1676-1679. [0494] 95. Levy, D. S., Kahana, J. A., and Kumar, R. (2009). AKT inhibitor, GSK690693, induces growth inhibition and apoptosis in acute lymphoblastic leukemia cell lines. Blood 113, 1723-1729. [0495] 96. Ley, T. J. et al. (2008). DNA sequencing of a cytogenetically normal acute myeloid leukaemia genome. Nature 456, 66-72. [0496] 97. Li, B., Ruiz, J. C., and Chun, K. T. (2002). CUL-4A is critical for early embryonic development. Mol Cell Biol 22, 4997-5005. [0497] 98. Li, J., Wang, Y., Yang, C., Wang, P., Oelschlager, D. K., Zheng, Y., Tian, D. A., Grizzle, W. E., Buchsbaum, D. J., and Wan, M. (2009). Polyethylene glycosylated curcumin conjugate inhibits pancreatic cancer cell growth through inactivation of Jab1. Mol Pharmacol 76, 81-90. [0498] 99. Lim, C. P. & Cao, X. (2006). Structure, function and regulation of STAT proteins. Mol. BioSyst, 2, 536-550. [0499] 100. Luo, W.; Dou, F.; Rodina, A.; Chip, S.; Kim, J.; Zhao, Q.; Moulick, K.; Aguirre, J.; Wu, N.; Greengard, P.; Chiosis, G., Proc. Natl. Acad. Sci. USA 2007, 104, 9511-9518. [0500] 101. Luo, W.; Rodina, A.; Chiosis, G., BMC Neurosci. 2008, 9(Suppl 2):S7. [0501] 102. Luo, W.; Sun, W.; Taldone, T.; Rodina, A.; Chiosis, G., Mol Neurodegener. 2010, 5: 24. [0502] 103. Lykke-Andersen, K., Schaefer, L., Menon, S., Deng, X. W., Miller, J. B., and Wei, N. (2003). Disruption of the COP9 signalosome Csn2 subunit in mice causes deficient cell proliferation, accumulation of p53 and cyclin E, and early embryonic death. Mol Cell Biol 23, 6790-6797. [0503] 104. Mahajan, S. et al. (2001). Transcription factor STAT5A is a substrate of Bruton's tyrosine kinase in B cells. J. Biol. Chem. 276, 31216-31228. [0504] 105. Maloney, A. et al. (2007). Gene and protein expression profiling of human ovarian cancer cells treated with the heat shock protein 90 inhibitor 17-allylamino-17-demethoxygeldanamycin. Cancer Res. 67, 3239-3253. [0505] 106. Marubayashi, S.; Koppikar, P.; Taldone, T.; Abdel-Wahab, O.; West, N.; Bhagwat, N.; Lopes-Vazquez, E. C.; Ross, K. N.; Gönen, M.; Gozman, A.; Ahn, J.; Rodina, A.; Ouerfelli, O.; Yang, G.; Hedvat, C.; Bradner, J. E.; Chiosis, G.; Levine, R. L., J. Clin. Invest. 2010, 120, 3578-3593. [0506] 107. McClellan, A. J. et al. (2007). Diverse cellular functions of the Hsp90 molecular chaperone uncovered using systems approaches. Cell 131, 121-135. [0507] 108. McCubrey, J. A. et al. (2008). Targeting survival cascades induced by activation of Ras/Raf/MEK/ERK, PI3K/PTEN/Akt/mTOR and Jak/STAT pathways for effective leukemia therapy. Leukemia 22, 708-722. [0508] 109. Menon, S., Chi, H., Zhang, H., Deng, X. W., Flavell, R. A., and Wei, N. (2007). COPS signalosome subunit 8 is essential for peripheral T cell homeostasis and antigen receptor-induced entry into the cell cycle from quiescence. Nat Immunol 8, 1236-1245. [0509] 110. Mihailovic, T. et al. (2004). Protein kinase D2 mediates activation of nuclear factor kappaB by Bcr-Abl in Bcr-Abl+ human myeloid leukemia cells. Cancer Res. 64, 8939-8944. [0510] 111. Milhollen, M. A., Traore, T., Adams-Duffy, J., Thomas, M. P., Berger, A. J., Dang, L., Dick, L. R., Garnsey, J. J., Koenig, E., Langston, S. P., et al. (2010). MLN4924, a NEDD8-activating enzyme inhibitor, is active in diffuse large B-cell lymphoma models: rationale for treatment of NF-{kappa}B-dependent lymphoma. Blood 116, 1515-1523. [0511] 112. Moffat, J. et al. (2006). A Lentiviral RNAi Library for Human and Mouse Genes Applied to an Arrayed Viral High-Content Screen. Cell 124, 1283-1298. [0512] 113. Monti, S., Savage, K. J., Kutok, J. L., Feuerhake, F., Kurtin, P., Mihm, M., Wu, B., Pasqualucci, L., Neuberg, D., Aguiar, R. C., et al. (2005). Molecular profiling of diffuse large B-cell lymphoma identifies robust subtypes including one characterized by host inflammatory response. Blood 105, 1851-1861. [0513] 114. Munday, D. et al. (2010). Quantitative proteomic analysis of A549 cells infected with human respiratory syncytial virus. Mol. Cell Proteomics 9, 2438-2459. [0514] 115. Naka, K. et al. (2010). TGF-beta-FOXO signaling maintains leukemia-initiating cells in chronic myeloid leukemia. Nature 463, 676-678. [0515] 116. Neckers, L. (2007). Heat shock protein 90: the cancer chaperone. J Biosci 32, 517-530. [0516] 117. Ngo, V. N., Davis, R. E., Lamy, L., Yu, X., Zhao, H., Lenz, G., Lam, L. T., Dave, S., Yang, L., Powell, J., et al. (2006). A loss-of-function RNA interference screen for molecular targets in cancer. Nature 441, 106-110. [0517] 118. Nimmanapalli, R., O'Bryan, E., and Bhalla, K. (2001). Geldanamycin and its analogue 17-allylamino-17-demethoxygeldanamycin lowers Bcr-Abl levels and induces apoptosis and differentiation of Bcr-Abl-positive human leukemic blasts. Cancer Res 61, 1799-1804. [0518] 119. Nishiya, Y.; Shibata, K.; Saito, S.; Yano, K.; Oneyama, C.; Nakano, H.; Sharma, S. V., Anal. Biochem. 2009, 385, 314-320. [0519] 120. Nobukuni, T., Kozma, S. C. & Thomas, G. (2007). hvps34, an ancient player, enters a growing game: mTOR Complex1/S6K1 signaling. Curr. Opin. Cell Biol. 19, 135-141. [0520] 121. Nomura, D. K., Dix, M. M. & Cravatt, B. F. (2010). Activity-based protein profiling for biochemical pathway discovery in cancer. Nat. Rev. Cancer 10, 630-638. [0521] 122. Obermann, W. M. J., Sondermann, H., Russo, A. A., Pavletich, N. P., and Hartl, F. U. (1998). J. Cell Biol. 143, 901-910. [0522] 123. Oda, A., Wakao, H. & Fujita, H. (2002). Calpain is a signal transducer and activator of transcription (STAT) 3 and STAT5 protease. Blood 99, 1850-1852. [0523] 124. Ohh, M., Kim, W. Y., Moslehi, J. J., Chen, Y., Chau, V., Read, M. A., and Kaelin, W. G., Jr. (2002). An intact NEDD8 pathway is required for Cullin-dependent ubiquitylation in mammalian cells. EMBO Rep 3, 177-182. [0524] 125. Old, D. W.; Wolfe, J. P.; Buchwald, S. L., J. Am. Chem. Soc. 1998, 120, 9722-9723. [0525] 126. Oron, E., Mannervik, M., Rencus, S., Harari-Steinberg, O., Neuman-Silberberg, S., Segal, D., and Chamovitz, D. A. (2002). COP9 signalosome subunits 4 and 5 regulate multiple pleiotropic pathways in Drosophila melanogaster. Development 129, 4399-4409. [0526] 127. Panaretou, B., Prodromou, C., Roe, S. M., O'Brien, R., Ladbury, J. E., Piper, P. W., and Pearl, L. H. (1998). EMBO 17, 4829-4836. [0527] 128. Panattoni, M., Sanvito, F., Basso, V., Doglioni, C., Casorati, G., Montini, E., Bender, J. R., Mondino, A., and Pardi, R. (2008). Targeted inactivation of the COP9 signalosome impairs multiple stages of T cell development. J Exp Med 205, 465-477. [0528] 129. Parsons, D. W. et al. (2008). An integrated genomic analysis of human glioblastoma multiforme. Science 321, 1807-1812. [0529] 130. Patel, P. D.; Patel, M. R.; Kaushik-Basu, N.; Talele, T. T., J. Chem. Inf. Model. 2008, 48, 42-55. [0530] 131. Paukku, K. & Silvennoinen, 0. (2004). STATs as critical mediators of signal transduction and transcription: lessons learned from STAT5. Cytokine Growth Factor Rev. 15, 435-455. [0531] 132. Peth, A., Berndt, C., Henke, W., and Dubiel, W. (2007). Downregulation of COP9 signalosome subunits differentially affects the CSN complex and target protein stability. BMC Biochem 8, 27. [0532] 133. Powers, M. V., Clarke, P. A., Workman, P. (2008). Dual targeting of Hsc70 and Hsp72 inhibits Hsp90 function and induces tumor-specific apoptosis. Cancer Cell 14, 250-262. [0533] 134. Pratt, W. B., Morishima, Y. & Osawa, Y. (2008). The Hsp90 chaperone machinery regulates signaling by modulating ligand binding clefts. J. Biol. Chem. 283, 22885-22889. [0534] 135. Reeder C, G. M., Habermann T, Ansell S, Micallef I, Porrata L, Johnston P, Maurer M, LaPlant B, Kabat B, Inwards D, Colgan J, Call T, Markovic S, Zent C, Zeldenrust S, Tun H, and Witzig T (2007). A Phase II Trial of the Oral mTOR Inhibitor Everolimus (RAD001) in Relapsed Aggressive Non-Hodgkin Lymphoma (NHL). Blood (ASH Annual Meeting Abstracts) 110, 121. [0535] 136. Ren, R. (2005). Mechanisms of BCR-ABL in the pathogenesis of chronic myelogenous leukaemia. Nat. Rev. Cancer 5, 172-183. [0536] 137. Richardson, K. S., and Zundel, W. (2005). The emerging role of the COP9 signalosome in cancer. Mol Cancer Res 3, 645-653. [0537] 138. Rix, U. & Superti-Furga, G. (2009). Target profiling of small molecules by chemical proteomics. Nat. Chem. Biol. 5, 616-624. [0538] 139. Roe, S. M.; Prodromou, C.; O'Brien, R.; Ladbury, J. E.; Piper, P. W.; Pearl, L. H., J. Med. Chem. 1999, 42, 260-266. [0539] 140. Salgia, R. et al. (1995). Increased tyrosine phosphorylation of focal adhesion proteins in myeloid cell lines expressing p210BCR/ABL. Oncogene 11, 1149-1155. [0540] 141. Sawyers, C. L. (1993). The role of myc in transformation by Bcr-Abl. Leuk. Lymphoma. 11, 45-46. [0541] 142. Schrodinger, L. L. C., New York. [0542] 143. Schwechheimer, C., and Deng, X. W. (2001). COP9 signalosome revisited: a novel mediator of protein degradation. Trends Cell Biol 11, 420-426. [0543] 144. Schweitzer, K., Bozko, P. M., Dubiel, W., and Naumann, M. (2007). CSN controls NF-kappaB by deubiquitinylation of IkappaBalpha. EMBO J 26, 1532-1541. [0544] 145. Schweitzer, K., and Naumann, M. (2010). Control of NF-kappaB activation by the COP9 signalosome. Biochem Soc Trans 38, 156-161. [0545] 146. Serenex; Huang, K.; Ommen, A. J.; Barta, T. E.; Hughes, P. F.; Veal, J. M.; Ma, W.; Smith, E. D.; Woodward, A. R.; McCall, W. S., WO-2008130879A2 2008. [0546] 147. Serenex; Huang, K.; Ommen, A. J.; Barta, T. E.; Hughes, P. F.; Veal, J. M.; Ma, W.; Smith, E. D.; Woodward, A. R.; McCall, W. S., US-20080269193A1 2008. [0547] 148. Sharon, M., Mao, H., Boeri Erba, E., Stephens, E., Zheng, N., and Robinson, C. V. (2009). Symmetrical modularity of the COP9 signalosome complex suggests its multifunctionality. Structure 17, 31-40. [0548] 149. Si, J. & Collins, S. J. (2008). Activated Ca2+/calmodulin-dependent protein kinase Ilgamma is a critical regulator of myeloid leukemia cell proliferation. Cancer Res. 68, 3733-3742. [0549] 150. Sidera, K.; Patsavoudi, E., Cell Cycle 2008, 7, 1564-1568. [0550] 151. Solit, D. B., Zheng, F. F., Drobnjak, M., Munster, P. N., Higgins, B., Verbel, D., Heller, G., Tong, W., Cardon-Cardo, C., Agus, D. B., Scher, H. I., and Rosen, N. (2002). Clin. Cancer Res. 8, 986-993. [0551] 152. Stebbins, C. E.; Russo, A. A.; Schneider, C.; Rosen, N.; Hartl, F. U.; Pavletich, N. P., Cell 1997, 89, 239-250. [0552] 153. Su, T. T., Guo, B., Kawakami, Y., Sommer, K., Chae, K., Humphries, L. A., Kato, R. M., Kang, S., Patrone, L., Wall, R., et al. (2002). PKC-beta controls I kappa B kinase lipid raft recruitment and activation in response to BCR signaling. Nat Immunol 3, 780-786. [0553] 154. Supriatno, Harada, K., Yoshida, H., and Sato, M. (2005). Basic investigation on the development of molecular targeting therapy against cyclin-dependent kinase inhibitor p27Kip1 in head and neck cancer cells. Int J Oncol 27, 627-635. [0554] 155. Taldone, T. & Chiosis, G. (2009). Purine-scaffold hsp90 inhibitors. Curr. Top. Med. Chem. 9, 1436-1446. [0555] 156. Taldone, T., Gozman, A., Maharaj, R., and Chiosis, G. (2008). Targeting Hsp90: small-molecule inhibitors and their clinical development. Curr Opin Pharmacol 8, 370-374. [0556] 157. Taldone, T., Sun, W., Chiosis, G. (2009). Bioorg. Med. Chem. 17, 2225-2235. [0557] 158. Taldone T, Zatorska D, Patel P D, Zong H, Rodina A, Ahn J H, Moulick K, Guzman M L, Chiosis G. Design, synthesis, and evaluation of small molecule Hsp90 probes. Bioorg Med Chem. 2011 Apr. 15; 19(8):2603-14. Epub 2011 Mar. 12. PMID: 21459002 [0558] 159. Taldone T, Gomes-DaGama E M, Zong H, Sen S, Alpaugh M L, Zatorska D, Alonso-Sabadell R, Guzman M L, Chiosis G. Synthesis of purine-scaffold fluorescent probes for heat shock protein 90 with use in flow cytometry and fluorescence microscopy. Bioorg Med Chem Lett. 2011 Sep. 15; 21(18):5347-52. Epub 2011 Jul. 14. PMID: 21802945 [0559] 160. Tateishi, K., Omata, M., Tanaka, K., and Chiba, T. (2001). The NEDD8 system is essential for cell cycle progression and morphogenetic pathway in mice. J Cell Biol 155, 571-579. [0560] 161. Thome, M. (2004). CARMA1, BCL-10 and MALT1 in lymphocyte development and activation. Nat Rev Immunol 4, 348-359. [0561] 162. Tomoda, K., Kubota, Y., Arata, Y., Mori, S., Maeda, M., Tanaka, T., Yoshida, M., Yoneda-Kato, N., and Kato, J. Y. (2002). The cytoplasmic shuttling and subsequent degradation of p27Kip1 mediated by Jab1/CSN5 and the COP9 signalosome complex. J Biol Chem 277, 2302-2310. [0562] 163. Tomoda, K., Kubota, Y., and Kato, J. (1999). Degradation of the cyclin-dependent-kinase inhibitor p27Kip1 is instigated by Jab1. Nature 398, 160-165. [0563] 164. Tomoda, K., Yoneda-Kato, N., Fukumoto, A., Yamanaka, S., and Kato, J. Y. (2004). Multiple functions of Jab1 are required for early embryonic development and growth potential in mice. J Biol Chem 279, 43013-43018. [0564] 165. Trinkle-Mulcahy, L., et al. (2008). Identifying specific protein interaction partners using quantitative mass spectrometry and bead proteomes. J. Cell. Biol. 183, 223-239. [0565] 166. Tsaytler, P. A., Krijgsveld, J., Goerdayal, S. S., Rudiger, S. & Egmond, M. R. (2009). Novel Hsp90 partners discovered using complementary proteomic approaches. Cell Stress Chaperones 14, 629-638. [0566] 167. Wang, J., Li, C., Liu, Y., Mei, W., Yu, S., Liu, C., Zhang, L., Cao, X., Kimberly, R. P., Grizzle, W., et al. (2006). JAB1 determines the response of rheumatoid arthritis synovial fibroblasts to tumor necrosis factor-alpha. Am J Pathol 169, 889-902. [0567] 168. Wang, Y., Penfold, S., Tang, X., Hattori, N., Riley, P., Harper, J. W., Cross, J. C., and Tyers, M. (1999). Deletion of the Cul1 gene in mice causes arrest in early embryogenesis and accumulation of cyclin E. Curr Biol 9, 1191-1194. [0568] 169. Wanner, K., Hipp, S., Oelsner, M., Ringshausen, I., Bogner, C., Peschel, C., and Decker, T. (2006). Mammalian target of rapamycin inhibition induces cell cycle arrest in diffuse large B cell lymphoma (DLBCL) cells and sensitises DLBCL cells to rituximab. Br J Haematol 134, 475-484. [0569] 170. Wei, N., and Deng, X. W. (1998). Characterization and purification of the mammalian COP9 complex, a conserved nuclear regulator initially identified as a repressor of photomorphogenesis in higher plants. Photochem Photobiol 68, 237-241. [0570] 171. Welteke, V., Eitelhuber, A., Duwel, M., Schweitzer, K., Naumann, M., and Krappmann, D. (2009). COP9 signalosome controls the Carma1-Bcl10-Malt1 complex upon T-cell stimulation. EMBO Rep 10, 642-648. [0571] 172. Whitesell, L. & Lindquist, S. L. (2005). Nat. Rev. Cancer 5, 761-772. [0572] 173. Whitesell, L., Mimnaugh, E. G., De Costa, B., Myers, C. E., and Neckers, L. M. (1994). Proc. Natl. Acad. Sci. USA 91, 8324-8328. [0573] 174. Winkler, G S. et al. (2002). Isolation and mass spectrometry of transcription factor complexes. Methods 26, 260-269. [0574] 175. Workman, P., Burrows, F., Neckers, L. & Rosen, N. (2007). Drugging the cancer chaperone HSP90: combinatorial therapeutic exploitation of oncogene addiction and tumor stress. Ann. N. Y. Acad. Sci. 1113, 202-216. [0575] 176. Wright, G., Tan, B., Rosenwald, A., Hurt, E. H., Wiestner, A., and Staudt, L. M. (2003). A gene expression-based method to diagnose clinically distinct subgroups of diffuse large B cell lymphoma. Proc Natl Acad Sci USA 100, 9991-9996. [0576] 177. Xu, D. & Qu, C. K. (2008). Protein tyrosine phosphatases in the JAK/STAT pathway. Front. Biosci. 13, 4925-4932. [0577] 178. Yan, J., Walz, K., Nakamura, H., Carattini-Rivera, S., Zhao, Q., Vogel, H., Wei, N., Justice, M. J., Bradley, A., and Lupski, J. R. (2003). COP9 signalosome subunit 3 is essential for maintenance of cell proliferation in the mouse embryonic epiblast. Mol Cell Biol 23, 6798-6808. [0578] 179. Yap, T. A., Garrett, M. D., Walton, M. I., Raynaud, F., de Bono, J. S., and Workman, P. (2008). Targeting the PI3K-AKT-mTOR pathway: progress, pitfalls, and promises. Curr Opin Pharmacol 8, 393-412. [0579] 180. Ye, B. H., Cattoretti, G., Shen, Q., Zhang, J., Hawe, N., de Waard, R., Leung, C., Nouri-Shirazi, M., Orazi, A., Chaganti, R. S., et al. (1997). The BCL-6 proto-oncogene controls germinal-centre formation and Th2-type inflammation. Nat Genet 16, 161-170. [0580] 181. Ye, B. H., Lista, F., Lo Coco, F., Knowles, D. M., Offit, K., Chaganti, R. S., and Dalla-Favera, R. (1993). Alterations of a zinc finger-encoding gene, BCL-6, in diffuse large-cell lymphoma. Science 262, 747-750. [0581] 182. Yoneda-Kato, N., Tomoda, K., Umehara, M., Arata, Y., and Kato, J. Y. (2005). Myeloid leukemia factor 1 regulates p53 by suppressing COP1 via COP9 signalosome subunit 3. EMBO J 24, 1739-1749. [0582] 183. Zhao, X. et al. (2009). Methylation of RUNX1 by PRMT1 abrogates SIN3A binding and potentiates its transcriptional activity. Genes Dev. 22, 640-653. [0583] 184. Zuehlke, A. & Johnson, J. L. (2010). Hsp90 and co-chaperones twist the functions of diverse client proteins. Biopolymers 93, 211-217.