DNA APTAMERS SPECIFIC OF ADENOVIRUS TYPES

20220073920 · 2022-03-10

    Inventors

    Cpc classification

    International classification

    Abstract

    A single stranded nucleic acid aptamer able to specifically bind to at least one Adenovirus type, the aptamer comprising or consisting of one of sequences SEQ ID NO:1 to 3, or variants thereof having at least 50% sequence identity. Additionally, a composition comprising the aptamer. Furthermore, use of the aptamer, for detecting, capturing, concentrating and/or quantifying at least one Adenovirus type. Still further, in vitro methods for capturing, detecting and/or quantifying at least one Adenovirus type. Further yet, a kit for detecting, quantifying, capturing and/or concentrating at least one Adenovirus type.

    Claims

    1.-14. (canceled)

    15. A single stranded nucleic acid aptamer able to specifically bind to at least one Adenovirus type, said aptamer comprising at least one of sequences SEQ ID NO:1 to 3, or variants thereof having at least 50% sequence identity.

    16. A composition comprising at least one single stranded nucleic acid aptamer able to specifically bind to at least one Adenovirus type, said aptamer comprising at least one of sequences SEQ ID NO:1 to 3 or variants thereof having at least 50% sequence identity and at least one Adenovirus type.

    17. An In vitro method for capturing at least one Adenovirus type in a sample, comprising the step of contacting the sample with a single strand nucleic acid aptamer able to specifically bind to at least one Adenovirus type, said aptamer comprising at least one of sequences SEQ ID NO:1 to 3 or variants thereof having at least 50% sequence identity.

    18. An In vitro method for at least one of detecting and quantifying at least one Adenovirus type in a sample, comprising: in vitro capturing of at least one Adenovirus type in a sample by contacting the sample with a single strand nucleic acid aptamer able to specifically bind to at least one Adenovirus type, said aptamer comprising at least one of sequences SEQ ID NO:1 to 3 or variants thereof having at least 50% sequence identity; one of quantifying or detecting one of the presence or absence of bound aptamer to Adenovirus; deducing therefrom one of the amount or the presence or the absence of Adenovirus in the sample.

    19. The In vitro method according to claim 18, wherein the one of quantifying or detecting the presence or absence of bound aptamer to Adenovirus is performed via comparison with a control group.

    20. The In vitro method according to claim 18, wherein detecting one of the presence or absence of bound aptamer to Adenovirus in the sample is carried out by performing a PCR intended to amplify the aptamer, the PCR being performed with a set of two primers corresponding to at least one of sequences 5′-GTGCCAGCTATGCCATTG-3′ and 5′-GCAGCAGAGATAGACGCTA-3′ and by Enzyme-Linked Aptamer Sorbent Assay.

    21. The In vitro method according to claim 18, wherein the at least one aptamer comprises a detectable label and detecting the presence or absence of bound aptamer to Adenovirus in the sample is carried out by detecting the label.

    22. A Kit for at least one of detecting, quantifying, capturing and concentrating at least one Adenovirus type comprising at least one single strand of nucleic acid aptamer able to specifically bind to at least one Adenovirus type, the aptamer comprising at least one of sequences SEQ ID NO:1 to 3 or variants thereof having at least 50% sequence identity.

    23. The kit according to claim 22 further comprises one of a support or a solution with at least one capture element of the at least one Adenovirus type and detection means.

    24. The kit according to claim 23, wherein the at least one capture element comprises one or more of the at least one aptamer.

    25. The kit according to claim 23, wherein the detection means comprises one or more of the aptamers with a detectable label linked thereto.

    26. The kit according to claim 25, wherein the detectable label is bound to the 5′ or 3′ end of the aptamer.

    27. The kit according to claim 22, further comprising a set of two primers able to bound the at least one aptamer and corresponding to sequences 5′-GTGCCAGCTATGCCATTG-3′ and 5′-GCAGCAGAGATAGACGCTA-3′ in order to amplify the aptamer bound to Adenovirus.

    Description

    DRAWINGS

    [0024] FIG. 1 represents direct ELISA results of HAdV-2 (approximatively 107 MPN/well) incubated with twenty biotinylated candidate aptamers. All aptamers were used at the same concentration of 1 μM, in accordance with various embodiment of the invention.

    [0025] FIG. 2 shows the percentage of bound HAdV-2 according to the concentration of aptamer 10 comprising SEQ ID NO:1. The concentration of aptamer ranges from 0 to 1000 nM, in accordance with various embodiment of the invention.

    [0026] FIG. 3 is an enlarged view of FIG. 2 for concentration of aptamer ranging from 0 to 20 nM, in accordance with various embodiment of the invention.

    [0027] FIG. 4 shows the percentage of bound HAdV-2 according to the concentration of aptamer 20 comprising SEQ ID NO:3. The concentration of aptamer ranges from 0 to 1000 nM, in accordance with various embodiment of the invention.

    [0028] FIG. 5 shows the specificity of aptamer 10 for various viruses, in accordance with various embodiment of the invention.

    [0029] FIG. 6 shows the specificity of aptamer 20 for various viruses, in accordance with various embodiment of the invention.

    DETAILED DESCRIPTION

    [0030] Production and Purification of Viral Stocks

    [0031] HAdV-2 (Human adenovirus type 2) was chosen to perform the selection of aptamers. HAdV-2 was obtained from the Health Protection Agency culture collection (NCPV #213) and was propagated on the human embryonic kidney cell line 293A (Invitrogen). The cells were grown in Dulbecco's Modified Eagle Medium (D-MEM) containing high glucose concentration and Glutamax (Life Technologies), and supplemented with 1% of non-essential amino acids (Life Technologies) and 5% of non-heat inactivated foetal bovine serum (Life Technologies). HAdV-2 stock was prepared from infected 293A monolayers by freeze-thaw lysis followed by centrifugation (1200 rpm, 10 min, 4° C.) to remove cell debris. The viral suspension was then purified by cesium chloride equilibrium density gradient centrifugation. The purified AdV band was collected using a syringe and directly injected into a float-a-lyser dialysis device with a molecular weight cut off of 100 KDa (Spectrum Labs, USA). The dialysis device was placed in a 2 L container filled with Dubelcco's PBS (DPBS) (Gibco) with gentle rotation (50 rpm) at 4° C. The DPBS was changed after 2-4 hours, 6-8 hours and 12-14 hours. After the dialysis step, the viral suspension was collected and stored at 4° C. The quantification of the purified HAdV-2 stock was performed by a most probable number (MPN) assay using 293A cells (Ogorzaly et al. 2013).

    [0032] Selection of Aptamers

    [0033] A 65 base pair combinatorial DNA library (GTGCCAGCTATGCCATTG-N28-TAGCGTCTATCTCTGCTGC) with a constant forward and reverse regions and a 28 base-pair random region (N28) containing equimolar incorporation of A, T, C and G at each position was synthetized (Eurogentec). Before selection, 1 μM of the single-stranded DNA (ss DNA) pool in the selection buffer (herein referred to as SB) (consisting of DPBS (Gibco) supplemented with MgCl.sub.2 (3 mM) and NaCl.sub.2 (20 mM) at pH 7.4, and sterilised by autoclave followed by 0.2 μm membrane filtration), was heated to 95° C. to denature the DNA, then allowed to cool to room temperature for 30 min before incubating with the virus.

    [0034] The following table 1 discloses the oligonucleotides used in the selection of aptamers for AdV.

    TABLE-US-00001 TABLE 1 Details of oligonucleotides Sequence 5-3′ D1-DNA Lib D1 DNA aptamer GTGCCAGCTATGCCATTG- library N28-TAGCGTCTATCTCTGCT GC D1-Rev_Ph D1 Phosphorylated P-GCAGCAGAGATAGACGCTA Reverse D1-For D1 Forward GTGCCAGCTATGCCATTG D1-Rev D1 Reverse GCAGCAGAGATAGACGCTA

    [0035] The target complex for SELEX was produced by immobilising purified HAdV-2 to the antibody-magnetic bead complex. Biotinylated monoclonal antibody 8C4 (HyTest, Finland) against AdV was conjugated to Streptavidin Dynabeads (ThermoFisher Scientific Aalst, Belgium) according to manufacturer's instructions. In brief, 100 μL of Streptavidin Dynabeads were aliquot and washed three times with wash buffer DPBS-T (PBS containing 0.005% Tween20). A three-fold excess of biotinylated monoclonal antibody 8C4 (30 μg) was bound to the Streptavidin Dynabeads by incubating for 1 hour at room temperature with mixing by pipetting every 5-10 minutes. The antibody-bead complex was separated by a magnet, washed three times with DPBS-T and eluted in 100 μL DPBS containing 0.05% bovine serum albumin (BSA, Sigma Darmstadt, Germany). One hundred μL of the purified HAdV-2 stock (corresponding to about 107 MPN/mL) was mixed with 10 μL of antibody-bead complex suspended in 490 μL of SB and incubated 2 hours at room temperature. The target complex HAdV-2-antibody-bead was washed three-times with PBS supplemented by 0.1% BSA and finally re-suspended in 20 μL of DPBS.

    [0036] SELEX was performed using the target complex (HAdV-2-antibody-bead) and negative SELEX was performed using the antibody-bead complex. Briefly 500 pmol/500 μL of the DNA library in selection buffer, was denatured by heating to 95° C. for 5 min and cooled to room temperature for 30 min. A negative selection was performed initially by incubating the DNA library with the antibody-bead complex for 45 min at room temperature, in-order to reduce the non-specific interactions of the DNA pool with the surface. The bound DNA was separated by magnet and the supernatant (recovered DNA library) was used directly for the first round of SELEX. The recovered DNA was added to 10 μL of target complex (corresponding to approximatively 107 infectious viral particles/reaction) and incubated at room temperature for 30 min. The bound DNA sequences were recovered by magnetic capture and washed three times with DPBS-T to facilitate the removal of non-binders and/or poor binders. One hundred microliters of nuclease free water were added to the beads and the sample heated to 90° C. for 5 min to release the DNA. The ss-DNA was amplified by PCR using the constant forward primer and the phosphorylated reverse primer (Table 1). The PCR final volume was 50 μL of which 10 μL contained the DNA target. The reaction was performed on a Biometra T-Advanced 96SG System, (Germany) and the following conditions applied, 95° C. for 2 min followed by various cycles of 95° C. for 15 sec, 67° C. for 1 min, 72° C. for 30 sec and a final extension of 72° C. for 2 min. The PCR products were visualized on a 4% agarose gel stained with ethidium bromide. The PCR reaction was stopped when the 65 bp band appeared on the agarose gel. The double stranded DNA (ds DNA) was purified using spin columns (Nucleospin Gel and PCR clean-up system, Machery and Nagel). For the separation of the dsDNA, 1 μL of 1 U Lambda exonuclease (Thermo Scientific, UK) was incubated for 1 hour at 37° C. followed by ssDNA confirmation by 4% agarose gel electrophoresis. All selection rounds were carried out in the same manner, however with decreasing concentrations of HAdV-2 infectious particles and decreasing concentrations of DNA pool. The incubation time was also decreased between each round and the washing steps increased both in volume and in amount to increase the selection pressure on the process.

    [0037] Identification of Aptamer Sequences

    [0038] The ssDNA obtained from the 9.sup.th, 10.sup.th and 11.sup.th SELEX rounds were amplified by non-modified primers (D1 Forward and reverse in Table 1) at the same conditions described previously. The products were analyzed by 4% agarose gel stained with ethidium bromide and the 65 bp band excised and purified using the Purelink Quick gel extraction and PCR purification combo kit (Invitrogen). The purified products were cloned into a dual promoter PCR2.1 TOPO vector using the TOPO TA cloning kit (Invitrogen) according to manufacturer's instructions. In total, eighty-six white clones were selected for sequencing which was performed on the Sanger sequencer (Applied Biosystems).

    [0039] Binding Affinity Study

    [0040] A direct ELASA (Enzyme Linked Aptamer Sorbent Assay) method was undertaken to test the binding activity of each of the selected aptamers. Ninety-six-well polystyrene plates (Greiner) were coated with HAdV-2 particles at a concentration of 107 MPN/mL (approximately 10.sup.6 particles/well) and incubated at 37° C. for one hour. After washing five times with 300 μL of DPBS, wells were blocked with 300 μL of 3% BSA overnight at 4° C. After washing five times with 300 μL of DPBS, 1 μM of each biotinylated candidate aptamer diluted in 100 μL of selection buffer, were added to the wells and allowed to incubate for 1 hour at room temperature. Wells were washed twice with 300 μL of DPBS-T and twice with 300 μL of 1% BSA. One hundred microliters of streptavidin conjugated HRP (1/300, ThermoScientific) diluted in 1% BSA were added to each well and incubated for 30 min at room temperature in the dark. The plate was washed three times with 300 μL of DPBS and developed with 50 μL of TMB substrate solution (ThermoScientific) for 30 min in the dark at room temperature. Finally, 50 μL of 2M sulphuric acid was added to each well and the absorbance recorded at 450 nm (Tecan). Based on the results, the top three aptamers were chosen for further analysis.

    [0041] The binding affinity of the selected aptamers were analyzed using the ELASA method described previously. HAdV-2 at a concentration of 107 MPN/mL was coated onto 96 well polystyrene plates (Greiner) and reacted with varying concentrations (0-1000 nM) of the biotinylated aptamers 10 and 20. The plates were read at 450 nm and the OD values were inputted into SigmaPlot software and processed using one site saturation equation with non-specific binding to determine the Kd values.

    [0042] FIG. 1 represents the results obtained for direct ELASA of purified HAdV-2 incubated with various biotinylated candidate aptamers at 1 μM.

    [0043] Based on results from FIG. 1 aptamers 10, 18, 20 are the most promising candidates.

    [0044] FIGS. 2 and 3 represent the ELASA binding study of HAdV-2 and aptamer 10. The results indicate that aptamer 10 is able to specifically bind to HAdV-2 with high affinity. The Kd of the aptamer was calculated to be 3.6±0.7 nM. Each point is the mean of 6 independent experiments.

    [0045] FIG. 4 represents the ELASA binding study of HAdV-2 and aptamers 20. The results show that aptamer 20 is able to specifically bind to HAdV-2 with high affinity. The Kd value was estimated to be 75.9±68.6 nM. Each point is the mean of 7 independent experiments.

    [0046] Specificity Study

    [0047] The specificity of the aptamers 10 and 20 were analyzed by ELASA using various types of adenoviruses (Ovine adenovirus type 1 and bovine adenovirus type 9) and various types of other waterborne viruses (F-specific RNA bacteriophages strain MS2, GA, QP and SP). Target and non-target viruses were coated on the plate at the same initial concentration (approximatively 107 viral particles/well) and tested against an 80 nM concentration of aptamers 10 and 20, respectively, according to the ELASA protocol previously described.

    [0048] The results are represented on FIGS. 5 and 6 and show that aptamers 10 and 20 are specific for adenovirus types. It produces a signal only for the adenoviruses and not for the other waterborne viruses.

    [0049] Motif and Structure Analysis

    [0050] Motif analysis was carried out by the online software program, MEME motif discovery tool. The predicted 2D folding of each aptamer was carried out by the online software program, MFOLD.

    TABLE-US-00002 Apt. dG SELEX ID Value Round Random Region Sequence 10 6.83 11 [00001]embedded image 18 7.72 11 [00002]embedded image 20 −7.44 11 [00003]embedded image [00004]text missing or illegible when filed

    [0051] The following sequences have been identified:

    TABLE-US-00003 SEQ ID NO: 1: GTGCCAGCTATGCCATTGGGGGACAATATCGCAGTGCATCTTCCTCTAGC GTCTATCTCTGCTGC. SEQ ID NO: 2: GTGCCAGCTATGCCATTGGCCAGTAGTTTCAGTCTACCAACGGTCATAGC GTCTATCTCTGCTGC. SEQ ID NO: 3: GTGCCAGCTATGCCATTGGGCGGGTCGTCCAATTCGAGAGGTCCCCTAGC GTCTATCTCTGCTGC.

    [0052] Aptamers 10, 18 and 20 respectively comprise SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3.

    [0053] In accordance with various embodiments, the invention provides single stranded nucleic acid aptamer comprising or consisting of one of sequences SEQ ID NO:1 to 3, or variants thereof having at least 50% sequence identity. In various instances, the variants have at least 80% sequence identity, for example 90%.

    [0054] The aptamers have at least one stem-loop structure.

    [0055] In accordance with various embodiments, the invention also provides a composition comprising at least one single stranded nucleic acid aptamer comprising or consisting of one of sequences SEQ ID NO:1 to 3 or variants thereof having at least 50% sequence identity and at least one Adenovirus type.

    [0056] The Adenovirus type can for example be a human or animal adenovirus.

    [0057] In accordance with various embodiments, the invention also provides the use of a single stranded nucleic acid aptamer comprising or consisting of one of sequences SEQ ID NO:1 to 3 or variants thereof having at least 50% sequence identity, for detecting, capturing, quantifying and/or concentrating at least one Adenovirus type.

    [0058] In accordance with various embodiments, the invention also provides an in vitro method for capturing at least one Adenovirus type in a sample, comprising the step of contacting the sample with a single strand nucleic acid aptamer comprising or consisting of one of sequences SEQ ID NO:1 to 3 or variants thereof having at least 50% sequence identity.

    [0059] In accordance with various embodiments, the invention also provides an in vitro method for detecting and/or quantifying at least one Adenovirus type in a sample, comprising the steps of: performing the in vitro method for capturing as defined above, quantifying, or detecting the presence or absence of bound aptamer; and deducing therefrom the amount or the presence or absence of Adenovirus in the sample. Quantifying, or detecting the presence or absence of bound aptamer is performed via comparison with a control group. The method can comprise a step of removing unbound aptamer prior to the step of quantifying, or detecting the presence or absence of bound aptamer.

    [0060] Detecting the presence or absence of bound aptamer in the sample is carried out by performing a PCR intended to amplify the bound aptamer, the PCR being performed with a set of two primers corresponding to sequences 5′-GTGCCAGCTATGCCATTG-3′ (forward) and 5′-GCAGCAGAGATAGACGCTA-3′ (reverse) and/or by Enzyme-Linked Aptamer Sorbent Assay (ELASA). Alternatively, the at least one aptamer comprises a detectable label, detecting the presence or absence of bound aptamer to Adenovirus in the sample is carried out by detecting the label.

    [0061] In accordance with various embodiments, the invention also provides a kit for detecting, quantifying, capturing and/or concentrating at least one Adenovirus type comprising at least one single strand of nucleic acid comprising or consisting of one of sequences SEQ ID NO:1 to 3 or variants thereof having at least 50% sequence identity. According to an exemplary embodiment, the kit further comprises a support or a solution with at least one capture element of the at least one Adenovirus type and/or detection means. The support can be a solid support such as a polystyrene plate, magnetic beats or an extraction, chromatography or affinity column but are not limited to. According to an exemplary embodiment of the invention, the at least one capture element of the at least one Adenovirus type is at least one aptamer immobilized on the support or in solution.

    [0062] The kit can also comprise detection means of bound aptamer with an adenovirus. According to an exemplary embodiment, the detection means comprises one or more of the aptamers with a detectable label linked thereto.

    [0063] The detectable label may be a moiety, which may be detected by methods known in the art. For example, the detectable label may be an optical label, an electrochemical label, a radioisotope or a combination thereof. The detectable label may be attached to a specific base of the aptamer, a specific site of a specific structure such as a hairpin-loop structure of the aptamer, or a 3′-end or 5′-end of the aptamer. The optical label may be, for example, a fluorescent material. In addition, the optical label may be an enzyme, and such an enzyme may be used for enzyme-linked immunosorbent assay (ELISA). Other materials may be appropriately selected by one of ordinary skill in the art.

    [0064] The kit further comprises a set of two primers able to bound the at least one aptamer and corresponding to sequences 5′-GTGCCAGCTATGCCATTG-3′ and 5′-GCAGCAGAGATAGACGCTA-3′ in order to amplify the aptamer bound to Adenovirus.

    [0065] The kit may further include instructions for use. The kit may further comprise a positive control, for example an inactivated adenovirus particle and a negative control.

    [0066] The samples can be clinical samples such as faeces, blood; environmental samples such as water, sediment and/or food samples but are not limited to.