RNAi Agents And Compositions for Inhibiting Expression of Apolipoprotein C-III (APOC3)

20220064646 · 2022-03-03

    Inventors

    Cpc classification

    International classification

    Abstract

    The present disclosure relates to RNAi agents, e.g., double stranded RNAi agents, capable of inhibiting Apolipoprotein C-III (also called APOC3, apoC-III, APOC-III, and APO C-III) gene expression, and compositions that include APOC3 RNAi agents. The APOC3 RNAi agents disclosed herein may be conjugated to targeting ligands, including ligands that include N-acetyl-galactosamine, to facilitate the delivery to cells, including to hepatocytes. Pharmaceutical compositions that include one or more APOC3 RNAi agents, optionally with one or more additional therapeutics, are also described. Delivery of the APOC3 RNAi agents in vivo provides for inhibition of APOC3 gene expression, and can result in lower triglycerides and/or cholesterol levels in the subject. The APOC3 RNAi agents can be used in methods of treatment of APOC3-related diseases and disorders, including hypertriglyceridemia, cardiovascular disease, and other metabolic-related disorders and diseases.

    Claims

    1. An RNAi agent for inhibiting expression of an APOC3 gene, comprising: an antisense strand comprising at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2, Table 3, or Table 4; and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand.

    2. The RNAi agent of claim 1, wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences provided in Table 2, Table 3, or Table 4.

    3. The RNAi agent of claim 1, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sense strand sequences provided in Table 2, Table 3, or Table 5, and wherein the sense strand has a region of at least 85% complementarity over the 17 contiguous nucleotides to the antisense strand.

    4. The RNAi agent of claim 1, wherein at least one nucleotide of the RNAi agent is a modified nucleotide or includes a modified internucleoside linkage.

    5. The RNAi agent of claim 1, wherein all or substantially all of the nucleotides of the sense and/or antisense strand of the RNAi agent are modified nucleotides.

    6. The RNAi agent of claim 4, wherein the modified nucleotide is selected from the group consisting of: 2′-O-methyl nucleotide, 2′-fluoro nucleotide, 2′-deoxy nucleotide, 2′,3′-seco nucleotide mimic, locked nucleotide, 2′-F-arabino nucleotide, 2′-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2′-O-methyl nucleotide, inverted 2′-deoxy nucleotide, 2′-amino-modified nucleotide, 2′-alkyl-modified nucleotide, morpholino nucleotide, vinyl phosphonate deoxyribonucleotide, cyclopropyl phosphonate deoxyribonucleotide, and 3′-O-methyl nucleotide.

    7. The RNAi agent of claim 5, wherein all or substantially all of the modified nucleotides are either 2′-O-methyl nucleotides or 2′-fluoro nucleotides.

    8. The RNAi agent of claim 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified antisense strand sequences provided in Table 3 or Table 4.

    9. The RNAi agent of claim 8, wherein the antisense strand comprises the nucleotide sequence of any one of the modified antisense strand sequences provided in Table 4.

    10. The RNAi agent of claim 1, wherein the sense strand comprises the nucleotide sequence of any one of the modified sense strand sequences provided in Table 3 or Table 5.

    11. The RNAi agent of claim 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4 and the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 5.

    12. The RNAi agent of claim 1, wherein the RNAi agent is linked to a targeting ligand.

    13. The RNAi agent of claim 12, wherein the targeting ligand comprises N-acetyl-galactosamine.

    14. The RNAi agent of claim 12, wherein the targeting ligand comprises a structure selected from the group consisting of: (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s.

    15. The RNAi agent of claim 14, wherein the targeting ligand comprises the structure of (NAG37) or (NAG37)s.

    16. The RNAi agent of claim 12, wherein the targeting ligand is conjugated to the sense strand.

    17. The RNAi agent of claim 16, wherein the targeting ligand is conjugated to the 5′ terminal end of the sense strand.

    18. The RNAi agent of claim 1, wherein the sense strand is between 18 and 30 nucleotides in length, and the antisense strand is between 18 and 30 nucleotides in length.

    19. The RNAi agent of claim 18, wherein the sense strand and the antisense strand are each between 18 and 27 nucleotides in length.

    20. The RNAi agent of claim 19, wherein the sense strand and the antisense strand are each between 18 and 24 nucleotides in length.

    21. The RNAi agent of claim 20, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

    22. The RNAi agent of claim 21, wherein the RNAi agent has two blunt ends.

    23. The RNAi agent of claim 1, wherein the sense strand comprises one or two terminal caps.

    24. The RNAi agent of claim 23, wherein the sense strand comprises one or two inverted abasic residues.

    25. The RNAi agent of claim 1, wherein the RNAi agent is comprised of a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 3 or Table 6.

    26. The RNAi agent of claim 1 comprising an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′.fwdarw.3′): TABLE-US-00060 (SEQ ID NO: 3) UCACUGAGAAUACUGUCCCUC; (SEQ ID NO: 5) UCACUGAGAAUACUGUCCCGU; (SEQ ID NO: 8) UUCUUGUCCAGCUUUAUUGGC; (SEQ ID NO: 10) AGAAUACUGUCCCUUUUAGGG; (SEQ ID NO: 12) AGAAUACUGUCCCUUUUAAGC; or (SEQ ID NO: 14) UGAGAAUACUGUCCCUUUGCC.

    27. The RNAi agent of claim 26, wherein the sense strand consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′.fwdarw.3′): TABLE-US-00061 (SEQ ID NO: 16) GAGGGACAGUAUUCUCAGUIA; (SEQ ID NO: 18) ACGGGACAGUAUUCUCAGUIA; (SEQ ID NO: 21) GAGGGACAGUAUUCUCAGUGA; (SEQ ID NO: 23) GCCAAUAAAGCUGGACAAGAA; (SEQ ID NO: 25) GCCAAUAAAICUGGACAAGAA; (SEQ ID NO: 27) CCCUAAAAGGGACAGUAUUCU; (SEQ ID NO: 29) GCUUAAAAGGGACAGUAUUCU; or (SEQ ID NO: 31) GGCAAAGGGACAGUAUUCUCA; wherein I represents an inosine nucleotide.

    28. The RNAi agent of claim 26, wherein all or substantially all of the nucleotides on both the antisense strand and the sense strand are modified nucleotides.

    29. The RNAi agent of claim 26, wherein the sense strand further includes inverted abasic residues at the 3′ terminal end and at the 5′ end of the nucleotide sequence.

    30. The RNAi agent of claim 26, wherein the sense strand of the RNAi agent is linked to a targeting ligand.

    31. The RNAi agent of claim 30, wherein the targeting ligand has affinity for the asialoglycoprotein receptor.

    32. The RNAi agent of claim 31, wherein the targeting ligand comprises N-acetyl-galactosamine.

    33. The RNAi agent of claim 1, comprising an antisense strand that comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′.fwdarw.3′): TABLE-US-00062 (SEQ ID NO: 2) usCfsasCfuGfagaauAfcUfgUfcCfcUfsc; (SEQ ID NO: 4) usCfsasCfuGfagaauAfcUfgUfcCfcGfsu; (SEQ ID NO: 6) usCfsascugagaauAfcUfgUfcCfcUfsc; (SEQ ID NO: 7) usUfscsUfuGfuCfcAfgCfuUfuAfuUfgGfsc; (SEQ ID NO: 9) asGfsasAfuAfcUfgUfcCfcUfuUfuAfgGfsg; (SEQ ID NO: 11) asGfsasAfuAfcUfgUfcCfcUfuUfuAfaGfsc; and (SEQ ID NO: 13) usGfsasGfaAfuAfcUfgUfcCfcUfuUfgcsc; wherein a, c, g, and u represent 2′-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides.

    34. The RNAi agent of claim 33, wherein the sense strand comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′.fwdarw.3′): TABLE-US-00063 (SEQ ID NO: 15) gagggacaGfUfAfuucucaguia; (SEQ ID NO: 17) acgggacaGfUfAfuucucaguia; (SEQ ID NO: 19) gagggacaGfuAfuUfcucaguia; (SEQ ID NO: 20) gagggacaGfUfAfuucucaguga; (SEQ ID NO: 22) gccaauaaAfGfCfuggacaagaa; (SEQ ID NO: 24) gccaauaaAfIfCfuggacaagaa; (SEQ ID NO: 26) cccuaaaaGfGfGfacaguauucu; (SEQ ID NO: 28) gcuuaaaaGfGfGfacaguauucu; and (SEQ ID NO: 30) ggcaaaggGfAfCfaguauucuca; wherein a, c, g, i, and u represent 2′-O-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, If, and Uf represent 2′-fluoro adenosine, cytidine, guanosine, inosine or uridine, respectively; and s represents a phosphorothioate linkage.

    35. The RNAi agent of claim 33, wherein the sense strand further includes an inverted abasic residue at the 3′ terminal end and/or at the 5′ end of the nucleotide sequence.

    36. The RNAi agent of claim 33, wherein the sense strand of the RNAi agent is linked to a targeting ligand.

    37. The RNAi agent of claim 36, wherein the targeting ligand has affinity for the asialoglycoprotein receptor.

    38. The RNAi agent of claim 37, wherein the targeting ligand comprises N-acetyl-galactosamine.

    39. The RNAi agent of claim 1, wherein the RNAi agent has the duplex structure selected from the group consisting of: AD05251 (SEQ ID NOs: 2 and 501); AD05876 (SEQ ID NOs: 4 and 572); AD05769 (SEQ ID NOs: 6 and 557); AD05169 (SEQ ID NOs: 2 and 482); AD05220 (SEQ ID NOs: 7 and 494); AD05547 (SEQ ID NOs: 7 and 545); AD05299 (SEQ ID NOs: 9 and 521); AD05223 (SEQ ID NOs: 11 and 497); and AD05171 (SEQ ID NOs: 13 and 483).

    40. The RNAi agent of claim 39, wherein the RNAi agent has the duplex structure selected from the group consisting of: AD05251 (SEQ ID NOs: 2 and 501) and AD05876 (SEQ ID NOs: 4 and 572).

    41. A composition comprising the RNAi agent of claim 1, wherein the composition comprises a pharmaceutically acceptable excipient.

    42. The composition of claim 41, wherein the RNAi agent is conjugated to a targeting ligand.

    43. The composition of claim 42, wherein the targeting ligand comprises n-acetyl-galactosamine.

    44. The composition of claim 43, wherein the targeting ligand is selected from the targeting ligands in Table 7.

    45. The composition of claim 41, wherein the composition further comprises a second RNAi agent for inhibiting the expression of APOC3.

    46. The composition of claim 41, wherein the composition further comprises one or more additional therapeutics.

    47. A method for inhibiting expression of an APOC3 gene in a cell, the method comprising introducing into a cell an effective amount of the composition of claim 41.

    48. The method of claim 47, wherein the cell is within a subject.

    49. The method of claim 48, wherein the subject is a human subject.

    50. The method of claim 47, wherein the APOC3 gene expression is inhibited by at least about 30%.

    51. A method of treating an APOC3-related disease or disorder, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of claim 41.

    52. The method of claim 51, wherein the disease is a cardiometabolic disease.

    53. The method of claim 52, wherein disease hypertriglyceridemia, obesity, hyperlipidenia, abnormal lipid and/or cholesterol metabolism, atherosclerosis, cardiovascular disease, coronary artery disease, hypertriglyceridemia induced pancreatitis, metabolic syndrome, type II diabetes mellitus, familial chylomicronemia syndrome, or familial partial lipodystrophy.

    54. The method of claim 51, wherein the RNAi agent is administered at a dose of about 0.05 mg/kg to about 5.0 mg/kg of body weight of the human subject.

    55. The method of claim 51, wherein the RNAi agent is administered in two or more doses.

    56. The method of claim 51, wherein the dose is administered by subcutaneous injection.

    57. A method of lowering triglyceride levels in a subject, the method comprising administering to the subject an effective amount of a composition of claim 41.

    58. A method of lowering cholesterol levels in a subject, the method comprising administering to the subject an effective amount of a composition of claim 41.

    59. A method of lowering low density lipoprotein (LDL) levels in a subject, the method comprising administering to the subject an effective amount of a composition of claim 41.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0114] FIG. 1A. Schematic diagram of the modified sense and antisense strands of APOC3 RNAi agent AD05251 (see Tables 4-6), conjugated to a tridentate N-acetyl-galactosamine-containing targeting ligand having the structure of (NAG37)s (see Table 7). FIG. 1A discloses SEQ ID NOs: 2 and 501.

    [0115] The following abbreviations are used in FIGS. 1A to 11: a, c, g, i, and u are 2′-O-methyl modified nucleotides (for i, the nucleobase is hypoxanthine (i.e., the base for inosine nucleotides)); Af, Cf, Gf, If, and Uf are 2′-fluoro modified nucleotides (for I, the nucleobase is hypoxanthine (i.e., the base for inosine nucleotides); p is a phosphodiester linkage; s is a phosphorothioate linkage; invAb is an inverted abasic (deoxyribose) residue (see Table 7); and (NAG37)s is a tridentate N-acetyl-galactosamine targeting ligand having the structure depicted in Table 7.

    [0116] FIG. 1B. Schematic diagram of the modified sense and antisense strands of APOC3 RNAi agent AD05876 (see Tables 4-6), conjugated to a tridentate N-acetyl-galactosamine-containing targeting ligand having the structure of (NAG37)s (see Table 7). FIG. 1B discloses SEQ ID NOs: 4 and 572.

    [0117] FIG. 1C. Schematic diagram of the modified sense and antisense strands of APOC3 RNAi agent AD05769 (see Tables 4-6), conjugated to a tridentate N-acetyl-galactosamine-containing targeting ligand having the structure of (NAG37)s (see Table 7). FIG. 1C discloses SEQ ID NOs: 6 and 557.

    [0118] FIG. 1D. Schematic diagram of the modified sense and antisense strands of APOC3 RNAi agent AD05169 (see Tables 4-6), conjugated to a tridentate N-acetyl-galactosamine-containing targeting ligand having the structure of (NAG37)s (see Table 7). FIG. 1D discloses SEQ ID NOs: 2 and 482.

    [0119] FIG. 1E. Schematic diagram of the modified sense and antisense strands of APOC3 RNAi agent AD05220 (see Tables 4-6), conjugated to a tridentate N-acetyl-galactosamine-containing targeting ligand having the structure of (NAG37)s (see Table 7). FIG. 1E discloses SEQ ID NOs: 7 and 494.

    [0120] FIG. 1F. Schematic diagram of the modified sense and antisense strands of APOC3 RNAi agent AD05547 (see Tables 4-6), conjugated to a tridentate N-acetyl-galactosamine-containing targeting ligand having the structure of (NAG37)s (see Table 7). FIG. 1F discloses SEQ ID NOs: 7 and 545.

    [0121] FIG. 1G. Schematic diagram of the modified sense and antisense strands of APOC3 RNAi agent AD05299 (see Tables 4-6), conjugated to a tridentate N-acetyl-galactosamine-containing targeting ligand having the structure of (NAG37)s (see Table 7). FIG. 1G discloses SEQ ID NOs: 9 and 521.

    [0122] FIG. 1H. Schematic diagram of the modified sense and antisense strands of APOC3 RNAi agent AD05223 (see Tables 4-6), conjugated to a tridentate N-acetyl-galactosamine-containing targeting ligand having the structure of (NAG37)s (see Table 7). FIG. 1H discloses SEQ ID NOs: 11 and 497.

    [0123] FIG. 1I. Schematic diagram of the modified sense and antisense strands of APOC3 RNAi agent AD05171 (see Tables 4-6), conjugated to a tridentate N-acetyl-galactosamine-containing targeting ligand having the structure of (NAG37)s (see Table 7). FIG. 1A discloses SEQ ID NOs: 13 and 483.

    [0124] FIG. 2A to 2D. Chemical structure representation of APOC3 RNAi agent AD05251, including a tridentate N-acetyl-galactosamine-containing targeting ligand (having the structure of (NAG37)s) conjugated at the 5′ terminal end of the sense strand, shown as a free acid.

    [0125] FIG. 3A to 3D. Chemical structure representation of APOC3 RNAi agent AD05251, including a tridentate N-acetyl-galactosamine-containing targeting ligand (having the structure of (NAG37)s) conjugated at the 5′ terminal end of the sense strand, shown as a sodium salt.

    [0126] FIG. 4A to 4D. Chemical structure representation of APOC3 RNAi agent AD05876, including a tridentate N-acetyl-galactosamine-containing targeting ligand (having the structure of (NAG37)s) conjugated at the 5′ terminal end of the sense strand, shown as a free acid.

    [0127] FIG. 5A to 5D. Chemical structure representation of APOC3 RNAi agent AD05876, including a tridentate N-acetyl-galactosamine-containing targeting ligand (having the structure of (NAG37)s) conjugated at the 5′ terminal end of the sense strand, shown as a sodium salt.

    [0128] FIG. 6A to 6D. Chemical structure representation of APOC3 RNAi agent AD05220, including a tridentate N-acetyl-galactosamine-containing targeting ligand (having the structure of (NAG37)s) conjugated at the 5′ terminal end of the sense strand, shown as a free acid.

    [0129] FIG. 7A to 7D. Chemical structure representation of APOC3 RNAi agent AD05220, including a tridentate N-acetyl-galactosamine-containing targeting ligand (having the structure of (NAG37)s) conjugated at the 5′ terminal end of the sense strand, shown as a sodium salt.

    DETAILED DESCRIPTION

    RNAi Agents

    [0130] RNAi agents for inhibiting expression of an APOC3 gene (referred to herein as APOC3 RNAi agents or APOC3 RNAi triggers) are described herein. Each APOC3 RNAi agent comprises a sense strand and an antisense strand. The sense strand and the antisense strand each can be 16 to 30 nucleotides in length. The sense and antisense strands can be either the same length or they can be different lengths. In some embodiments, the sense and antisense strands are each independently 17 to 27 nucleotides in length. In some embodiments, the sense and antisense strands are each independently 17-21 nucleotides in length. In some embodiments, the sense and antisense strands are each 21-26 nucleotides in length. In some embodiments, the sense and antisense strands are each 21-24 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length while the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length while the antisense strand is about 23 nucleotides in length. In some embodiments, a sense strand is 23 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21 nucleotides in length. In some embodiments, the RNAi agent sense and antisense strands are each independently 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. In some embodiments, a double-stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides.

    [0131] In some embodiments, the region of perfect, substantial, or partial complementarity between the sense strand and the antisense strand is 16-26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and occurs at or near the 5′ end of the antisense strand (e.g., this region may be separated from the 5′ end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfectly, substantially, or partially complementary).

    [0132] The sense strand and antisense strand each contain a core stretch (also referred to herein as a “core sequence” or a “core stretch sequence”) that is 16 to 23 nucleotides in length. An antisense strand core stretch is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a nucleotide sequence (sometimes referred to, e.g., as a target sequence) present in the APOC3 mRNA target. A sense strand core stretch sequence is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a core stretch sequence in the antisense strand, and thus the sense strand core stretch sequence is typically perfectly identical or at least about 85% identical to a nucleotide sequence (target sequence) present in the APOC3 mRNA target. A sense strand core stretch sequence can be the same length as a corresponding antisense core sequence or it can be a different length. In some embodiments, the antisense strand core stretch sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core stretch sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.

    [0133] Examples of sense and antisense strand nucleotide sequences used in forming APOC3 RNAi agents are provided in Tables 2, 3, 4, and 5. Examples of RNAi agent duplexes, that include the sense strand and antisense strand sequences in Tables 2, 4, and 5, are shown in Table 6.

    [0134] The APOC3 RNAi agent sense and antisense strands anneal to form a duplex. A sense strand and an antisense strand of an APOC3 RNAi agent can be partially, substantially, or fully complementary to each other. Within the complementary duplex region, the sense strand core stretch sequence is at least 85% complementary or 100% complementary to the antisense core stretch sequence. In some embodiments, the sense strand core stretch sequence contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense core stretch sequences of an APOC3 RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% base paired or 100% base paired.)

    [0135] In some embodiments, the antisense strand of an APOC3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2, Table 3, or Table 4. In some embodiments, the sense strand of an APOC3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2, Table 3, or Table 5.

    [0136] The sense strand and/or the antisense strand can optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3′ end, the 5′ end, or both the 3′ and 5′ ends of the core stretch sequences. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sequence in the APOC3 mRNA. The sense strand additional nucleotides, if present, may or may not be identical to the corresponding sequence in the APOC3 mRNA. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sense strand's additional nucleotides, if present.

    [0137] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5′ and/or 3′ end of the sense strand core stretch sequence and/or antisense strand core stretch sequence. The extension nucleotides on a sense strand may or may not be complementary to nucleotides, either core stretch sequence nucleotides or extension nucleotides, in the corresponding antisense strand. Conversely, the extension nucleotides on an antisense strand may or may not be complementary to nucleotides, either core stretch nucleotides or extension nucleotides, in the corresponding sense strand. In some embodiments, both the sense strand and the antisense strand of an RNAi agent contain 3′ and 5′ extensions. In some embodiments, one or more of the 3′ extension nucleotides of one strand base pairs with one or more 5′ extension nucleotides of the other strand. In other embodiments, one or more of 3′ extension nucleotides of one strand do not base pair with one or more 5′ extension nucleotides of the other strand. In some embodiments, an APOC3 RNAi agent has an antisense strand having a 3′ extension and a sense strand having a 5′ extension. In some embodiments, the extension nucleotide(s) are unpaired and form an overhang. As used herein, an “overhang” refers to a stretch of one or more unpaired nucleotides located at a terminal end of either the sense strand or the antisense strand that does not form part of the hybridized or duplexed portion of an RNAi agent disclosed herein.

    [0138] In some embodiments, an APOC3 RNAi agent comprises an antisense strand having a 3′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, an APOC3 RNAi agent comprises an antisense strand having a 3′ extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise uracil or thymidine nucleotides or nucleotides that are complementary to the corresponding APOC3 mRNA sequence.

    [0139] In some embodiments, the 3′ end of the antisense strand can include abasic residues (Ab), which can also be referred to as an “abasic site” or “abasic nucleotide.” An abasic residue (Ab) is a nucleotide or nucleoside that lacks a nucleobase at the 1′ position of the sugar moiety. (See, e.g., U.S. Pat. No. 5,998,203). In some embodiments, Ab or AbAb can be added to the 3′ end of the antisense strand.

    [0140] In some embodiments, the sense strand or the antisense strand may include a “terminal cap,” which as used herein is a non-nucleotide compound or other moiety that can be incorporated at one or more termini of a strand of an RNAi agent disclosed herein, and can provide the RNAi agent, in some instances, with certain beneficial properties, such as, for example, protection against exonuclease degradation. In some embodiments, inverted abasic residues (invAb) are added as terminal caps (see Table 76). (See, e.g., F. Czaudema, Nucleic Acids Res., 2003, 31(11), 2705-16). Terminal caps are generally known in the art, and include, for example, inverted abasic residues as well as carbon chains such as a terminal C3, C6, or C12 groups. In some embodiments, a terminal cap is present at either the 5′ terminal end, the 3′ terminal end, or both the 5′ and 3′ terminal ends of the sense strand.

    [0141] In some embodiments, an APOC3 RNAi agent comprises a sense strand having a 3′ extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises adenosine, uracil, or thymidine nucleotides, AT dinucleotide, or nucleotides that correspond to nucleotides in the APOC3 mRNA sequence. In some embodiments, the 3′ sense strand extension includes or consists of one of the following sequences, but is not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (each listed 5′ to 3′).

    [0142] In some embodiments, the 3′ end of the sense strand may include additional abasic residues or inverted abasic terminal caps. In some embodiments, UUAb, UAb, or Ab are added to the 3′ end of the sense strand.

    [0143] In some embodiments, one or more inverted abasic residues (invAb) are added to the 3′ end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues or inverted abasic sites at or near the terminal end or terminal ends of the sense strand of an RNAi agent allows for enhanced activity or other desired properties of an RNAi agent.

    [0144] In some embodiments, an APOC3 RNAi agent comprises a sense strand having a 5′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise uracil or adenosine nucleotides or nucleotides that correspond to nucleotides in the APOC3 mRNA sequence. In some embodiments, the sense strand 5′ extension is one of the following sequences, but is not limited to: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (each listed 5′ to 3′). A sense strand can have a 3′ extension and/or a 5′ extension.

    [0145] In some embodiments, the 5′ end of the sense strand can include one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, one or more inverted abasic residues (invAb) are added to the 5′ end of the sense strand. In some embodiments, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues at or near the terminal end or terminal ends of the sense strand of an RNAi agent may allow for enhanced activity or other desired properties of an RNAi agent. In some embodiments, an abasic (deoxyribose) residue can be replaced with a ribitol (abasic ribose) residue.

    [0146] In some embodiments, the 3′ end of the antisense strand core stretch sequence, or the 3′ end of the antisense strand sequence, may include an inverted abasic residue (invAb (see Table 7)).

    [0147] Examples of sequences used in forming APOC3 RNAi agents are provided in Tables 2, 3, 4, and 5. In some embodiments, an APOC3 RNAi agent antisense strand includes a sequence of any of the sequences in Tables 2, 3, or 4. In certain embodiments, an APOC3 RNAi agent antisense strand comprises or consists of any one of the modified sequences in Table 4. In some embodiments, an APOC3 RNAi agent antisense strand includes the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any of the sequences in Tables 2 or 4. In some embodiments, an APOC3 RNAi agent sense strand includes the sequence of any of the sequences in Tables 2 or 5. In some embodiments, an APOC3 RNAi agent sense strand includes the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1-24, 1-25, 1-26, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 3-20, 3-21, 3-22, 3-23. 3-24, 4-21, 4-22, 4-23, 4-24, 5-22, 5-23, or 5-24 of any of the sequences in Tables 2 or 5. In certain embodiments, an APOC3 RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 5.

    [0148] In some embodiments, the sense and antisense strands of the RNAi agents described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the sense strand 5′ end and the antisense strand 3′ end of an RNAi agent form a blunt end. In some embodiments, the sense strand 3′ end and the antisense strand 5′ end of an RNAi agent form a blunt end. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt-ended. As used herein a “blunt end” refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form a complementary base-pair).

    [0149] In some embodiments, the sense strand 5′ end and the antisense strand 3′ end of an RNAi agent form a frayed end. In some embodiments, the sense strand 3′ end and the antisense strand 5′ end of an RNAi agent form a frayed end. In some embodiments, both ends of an RNAi agent form a frayed end. In some embodiments, neither end of an RNAi agent is a frayed end. As used herein a frayed end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands from a pair (i.e., do not form an overhang) but are not complementary (i.e. form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of a double stranded RNAi agent form an overhang. The unpaired nucleotides may be on the sense strand or the antisense strand, creating either 3′ or 5′ overhangs. In some embodiments, the RNAi agent contains: a blunt end and a frayed end, a blunt end and 5′ overhang end, a blunt end and a 3′ overhang end, a frayed end and a 5′ overhang end, a frayed end and a 3′ overhang end, two 5′ overhang ends, two 3′ overhang ends, a 5′ overhang end and a 3′ overhang end, two frayed ends, or two blunt ends. Typically, when present, overhangs are located at the 3′ terminal ends of the sense strand, the antisense strand, or both the sense strand and the antisense strand.

    [0150] Modified nucleotides, when used in various polynucleotide or oligonucleotide constructs, can preserve activity of the compound in cells while at the same time increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans upon administering of the polynucleotide or oligonucleotide construct.

    [0151] In some embodiments, an APOC3 RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. In some embodiments, an APOC3 RNAi agent is prepared as a sodium salt. Such forms that are well known in the art are within the scope of the inventions disclosed herein.

    Modified Nucleotides

    [0152] In some embodiments, an APOC3 RNAi agent contains one or more modified nucleotides. As used herein, a “modified nucleotide” is a nucleotide other than a ribonucleotide (2′-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides can include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides (represented herein as Ab), 2′-modified nucleotides, 3′ to 3′ linkages (inverted) nucleotides (represented herein as invdN, invN, invn), modified nucleobase-comprising nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2′,3′-seco nucleotide mimics (unlocked nucleobase analogues, represented herein as N.sub.UNA or NUNA), locked nucleotides (represented herein as N.sub.LNA or NLNA), 3′-O-methoxy (2′ internucleoside linked) nucleotides (represented herein as 3′-OMen), 2′-F-Arabino nucleotides (represented herein as NfANA or Nf.sub.ANA), 5′-Me, 2′-fluoro nucleotide (represented herein as 5Me-Nf), morpholino nucleotides, vinyl phosphonate deoxyribonucleotides (represented herein as vpdN), vinyl phosphonate containing nucleotides, and cyclopropyl phosphonate containing nucleotides (cPrpN). 2′-modified nucleotides (i.e., a nucleotide with a group other than a hydroxyl group at the 2′ position of the five-membered sugar ring) include, but are not limited to, 2′-O-methyl nucleotides (represented herein as a lower case letter ‘n’ in a nucleotide sequence), 2′-deoxy-2′-fluoro nucleotides (also referred to herein as 2′-fluoro nucleotide, and represented herein as Nf), 2′-deoxy nucleotides (represented herein as dN), 2′-methoxyethyl (2′-O-2-methoxylethyl) nucleotides (also referred to herein as 2′-MOE, and represented herein as NM), 2′-amino nucleotides, and 2′-alkyl nucleotides. It is not necessary for all positions in a given compound to be uniformly modified. Conversely, more than one modification can be incorporated in a single APOC3 RNAi agent or even in a single nucleotide thereof. The APOC3 RNAi agent sense strands and antisense strands can be synthesized and/or modified by methods known in the art. Modification at one nucleotide is independent of modification at another nucleotide.

    [0153] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrinidines and N-2, N-6 and 0-6 substituted purines, (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyl uracil, 5-propynyl cytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-mnethylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.

    [0154] In some embodiments, all or substantially all of the nucleotides of an RNAi agent are modified nucleotides. As used herein, an RNAi agent wherein substantially all of the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand being ribonucleotides (i.e., unmodified). As used herein, a sense strand wherein substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand being unmodified ribonucleotides. As used herein, an antisense sense strand wherein substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand being unmodified ribonucleotides. In some embodiments, one or more nucleotides of an RNAi agent is an unmodified ribonucleotide.

    Modified Internucleoside Linkages

    [0155] In some embodiments, one or more nucleotides of an APOC3 RNAi agent are linked by non-standard linkages or backbones (i.e., modified internucleoside linkages or modified backbones). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein as a lower case “s”), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkyl phosphonates (e.g., methyl phosphonates or 3′-alkylene phosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3′-amino phosphoramidate, aminoalkylphosphoramidates, or thionophosphoramidates), thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of boranophosphates, or boranophosphates having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′-2′. In some embodiments, a modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl inter-sugar linkages, mixed heteroatom and alkyl or cycloalkyl inter-sugar linkages, or one or more short chain heteroatomic or heterocyclic inter-sugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methylene formacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH.sub.2 components.

    [0156] In some embodiments, a sense strand of an APOC3 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, an antisense strand of an APOC3 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, a sense strand of an APOC3 RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, an antisense strand of an APOC3 RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, or 4 phosphorothioate linkages.

    [0157] In some embodiments, an APOC3 RNAi agent sense strand contains at least two phosphorothioate internucleoside linkages. In some embodiments, the at least two phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 from the 3′ end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is at the 5′ end of the sense strand, and another phosphorothioate linkage is at the 3′ end of the sense strand. In some embodiments, two phosphorothioate internucleoside linkage are located at the 5′ end of the sense strand, and another phosphorothioate linkage is at the 3′ end of the sense strand. In some embodiments, the sense strand dose not include any phosphorothioate internucleoside linkages between the nucleotides, but contains one, two, or three phosphorothioate linkages between the terminal nucleotides on both the 5′ and 3′ ends and the optionally present inverted abasic residue terminal caps. In some embodiments, the targeting ligand is linked to the sense strand via a phosphorothioate linkage.

    [0158] In some embodiments, an APOC3 RNAi agent antisense strand contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 from the 5′ end of the antisense strand and between the nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5′ end. In some embodiments, three phosphorothioate internucleoside linkages are located between positions 1-4 from the 5′ end of the antisense strand, and a fourth phosphorothioate internucleoside linkage is located between positions 20-21 from the 5′ end of the antisense strand. In some embodiments, an APOC3 RNAi agent contains at least three or four phosphorothioate internucleoside linkages in the antisense strand.

    [0159] In some embodiments, an APOC3 RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, a 2′-modified nucleoside is combined with modified internucleoside linkage.

    APOC3 RNAi Agents

    [0160] In some embodiments, the APOC3 RNAi agents disclosed herein target an APOC3 gene at or near the positions of the APOC3 gene show in Table 1. In some embodiments, the antisense strand of an APOC3 RNAi agent disclosed herein includes a core stretch sequence that is fully, substantially, or at least partially complementary to a target APOC3 19-mer sequence disclosed in Table 1.

    TABLE-US-00015 TABLE 1 APOC3 19-mer mRNA target sequences (taken from homo sapiens apolipoprotein C3 (APOC3) transcript, GenBank NM_000040.1 (SEQ ID NO: 1)). APOC3 19-mer Corresponding Target Sequences Positions on SEQ ID No. (5′ .fwdarw. 3′) SEQ ID NO: 1 32 GGGACAGUAUUCUCAGUGC 438-456 33 CAAUAAAGCUGGACAAGAA 506-524 34 UUAAAAGGGACAGUAUUCU 432-450 35 CGGGUACUCCUUGUUGUUG 56-74 36 GGUACUCCUUGUUGUUGCC 58-76 37 GCUGGGUGACCGAUGGCUU 228-246 38 GACCGAUGGCUUCAGUUCC 235-253 39 GCUUCAGUUCCCUGAAAGA 243-261 40 UCAGUUCCCUGAAAGACUA 246-264 41 GACUACUGGAGCACCGUUA 260-278 42 ACUACUGGAGCACCGUUAA 261-279 43 GCACCGUUAAGGACAAGUU 270-288 44 ACCGUUAAGGACAAGUUCU 272-290 45 CCGUUAAGGACAAGUUCUC 273-291 46 CCUCAAUACCCCAAGUCCA 349-367 47 AAAAGGGACAGUAUUCUCA 434-452 48 AGGGACAGUAUUCUCAGUG 437-455

    [0161] In some embodiments, an APOC3 RNAi agent includes an antisense strand wherein position 19 of the antisense strand (5′.fwdarw.3′) is capable of forming a base pair with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an APOC3 RNAi agent includes an antisense strand wherein position 1 of the antisense strand (5′.fwdarw.3′) is capable of forming a base pair with position 19 of the 19-mer target sequence disclosed in Table 1.

    [0162] In some embodiments, an APOC3 RNAi agent includes an antisense strand wherein position 2 of the antisense strand (5′.fwdarw.3′) is capable of forming a base pair with position 18 of the 19-mer target sequence disclosed in Table 1. In some embodiments, an APOC3 RNAi agent includes an antisense strand wherein positions 2 through 18 of the antisense strand (5′.fwdarw.3′) are capable of forming base pairs with each of the respective complementary bases located at positions 18 through 2 of the 19-mer target sequence disclosed in Table 1.

    [0163] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5′ end.fwdarw.3′ end) can be perfectly complementary to the APOC3 gene, or can be non-complementary to the APOC3 gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end.fwdarw.3′ end) is a U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end.fwdarw.3′ end) forms an A:U or U:A base pair with the sense strand.

    [0164] In some embodiments, an APOC3 RNAi agent antisense strand comprises the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3, or Table 4. In some embodiments, an APOC3 RNAi sense strand comprises the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-17, 1-18, or 2-18 of any of the sense strand sequences in Table 2, Table 3, or Table 5.

    [0165] In some embodiments, an APOC3 RNAi agent is comprised of (i) an antisense strand comprising the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3, or Table 4, and (ii) a sense strand comprising the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 3, or Table 5.

    [0166] In some embodiments, the APOC3 RNAi agents include core 19-mer nucleotide sequences shown in the following Table 2.

    TABLE-US-00016 TABLE 2 APOC3 RNAi Agent Antisense Strand and Sense Strand Core Stretch Base Sequences (N = any nucleobase). Antisense Strand Base Sense Strand Base Sequence (5′ .fwdarw. 3′) Sequence (5′ .fwdarw. 3′) Corresponding SEQ (Shown as an Unmodified SEQ ID (Shown as an Unmodified Positions on ID No. Nucleotide Sequence) No. Nucleotide Sequence) SEQ ID NO: 1 49 UCACUGAGAAUACUGUCCC 114 GGGACAGUAUUCUCAGUGA 438-456 49 UCACUGAGAAUACUGUCCC 115 GGGACAGUAUUCUCAGUIA 438-456 50 GCACUGAGAAUACUGUCCC 116 GGGACAGUAUUCUCAGUGC 438-456 Si NCACUGAGAAUACUGUCCC 117 GGGACAGUAUUCUCAGUGN 438-456 52 NCACUGAGAAUACUGUCCN 118 NGGACAGUAUUCUCAGUGN 438-456 53 UUCUUGUCCAGCUUUAUUG 119 CAAUAAAGCUGGACAAGAA 506-524 53 UUCUUGUCCAGCUUUAUUG 120 CAAUAAAICUGGACAAGAA 506-524 54 NUCUUGUCCAGCUUUAUUG 121 CAAUAAAGCUGGACAAGAN 506-524 55 NUCUUGUCCAGCUUUAUUN 122 NAAUAAAGCUGGACAAGAN 506-524 56 UGAAUACUGUCCCUUUUAA 123 UUAAAAGGGACAGUAUUCA 432-450 57 AGAAUACUGUCCCUUUUAA 124 UUAAAAGGGACAGUAUUCU 432-450 58 AGAAUACUGUCCCUUUUAG 125 CUAAAAGGGACAGUAUUCU 432-450 59 NGAAUACUGUCCCUUUUAA 126 UUAAAAGGGACAGUAUUCN 432-450 60 NGAAUACUGUCCCUUUUAG 127 CUAAAAGGGACAGUAUUCN 432-450 61 NGAAUACUGUCCCUUUUAN 128 NUAAAAGGGACAGUAUUCN 432-450 62 UAACAACAAGGAGUACCCG 129 CGGGUACUCCUUGUUGUUA 56-74 63 CAACAACAAGGAGUACCCG 130 CGGGUACUCCUUGUUGUUG 56-74 64 NAACAACAAGGAGUACCCG 131 CGGGUACUCCUUGUUGUUN 56-74 65 NAACAACAAGGAGUACCCN 132 NGGGUACUCCUUGUUGUUN 56-74 66 UGCAACAACAAGGAGUACC 133 GGUACUCCUUGUUGUUGCA 58-76 67 GGCAACAACAAGGAGUACC 134 GGUACUCCUUGUUGUUGCC 58-76 68 NGCAACAACAAGGAGUACC 135 GGUACUCCUUGUUGUUGCN 58-76 69 NGCAACAACAAGGAGUACN 136 NGUACUCCUUGUUGUUGCN 58-76 70 UAGCCAUCGGUCACCCAGC 137 GCUGGGUGACCGAUGGCUA 228-246 71 AAGCCAUCGGUCACCCAGC 138 GCUGGGUGACCGAUGGCUU 228-246 72 NAGCCAUCGGUCACCCAGC 139 GCUGGGUGACCGAUGGCUN 228-246 73 NAGCCAUCGGUCACCCAGN 140 NCUGGGUGACCGAUGGCUN 228-246 74 UGAACUGAAGCCAUCGGUC 141 GACCGAUGGCUUCAGUUCA 235-253 75 GGAACUGAAGCCAUCGGUC 142 GACCGAUGGCUUCAGUUCC 235-253 76 NGAACUGAAGCCAUCGGUC 143 GACCGAUGGCUUCAGUUCN 235-253 77 NGAACUGAAGCCAUCGGUN 144 NACCGAUGGCUUCAGUUCN 235-253 78 UCUUUCAGGGAACUGAAGC 145 GCUUCAGUUCCCUGAAAGA 243-261 79 NCUUUCAGGGAACUGAAGC 146 GCUUCAGUUCCCUGAAAGN 243-261 80 NCUUUCAGGGAACUGAAGN 147 NCUUCAGUUCCCUGAAAGN 243-261 81 UAGUCUUUCAGGGAACUGA 148 UCAGUUCCCUGAAAGACUA 246-264 82 NAGUCUUUCAGGGAACUGA 149 UCAGUUCCCUGAAAGACUN 246-264 83 NAGUCUUUCAGGGAACUGN 150 NCAGUUCCCUGAAAGACUN 246-264 84 UAACGGUGCUCCAGUAGUC 151 GACUACUGGAGCACCGUUA 260-278 85 NAACGGUGCUCCAGUAGUC 152 GACUACUGGAGCACCGUUN 260-278 86 NAACGGUGCUCCAGUAGUN 153 NACUACUGGAGCACCGUUN 260-278 87 UUAACGGUGCUCCAGUAGU 154 ACUACUGGAGCACCGUUAA 261-279 88 NUAACGGUGCUCCAGUAGU 155 ACUACUGGAGCACCGUUAN 261-279 89 NUAACGGUGCUCCAGUAGN 156 NCUACUGGAGCACCGUUAN 261-279 90 UACUUGUCCUUAACGGUGC 157 GCACCGUUAAGGACAAGUA 270-288 91 AACUUGUCCUUAACGGUGC 158 GCACCGUUAAGGACAAGUU 270-288 92 NACUUGUCCUUAACGGUGC 159 GCACCGUUAAGGACAAGUN 270-288 93 NACUUGUCCUUAACGGUGN 160 NCACCGUUAAGGACAAGUN 270-288 94 UGAACUUGUCCUUAACGGU 161 ACCGUUAAGGACAAGUUCA 272-290 95 AGAACUUGUCCUUAACGGU 162 ACCGUUAAGGACAAGUUCU 272-290 96 NGAACUUGUCCUUAACGGU 163 ACCGUUAAGGACAAGUUCN 272-290 97 NGAACUUGUCCUUAACGGN 164 NCCGUUAAGGACAAGUUCN 272-290 98 UAGAACUUGUCCUUAACGG 165 CCGUUAAGGACAAGUUCUA 273-291 99 GAGAACUUGUCCUUAACGG 166 CCGUUAAGGACAAGUUCUC 273-291 100 NAGAACUUGUCCUUAACGG 167 CCGUUAAGGACAAGUUCUN 273-291 101 NAGAACUUGUCCUUAACGN 168 NCGUUAAGGACAAGUUCUN 273-291 102 UGGACUUGGGGUAUUGAGG 169 CCUCAAUACCCCAAGUCCA 349-367 103 NGGACUUGGGGUAUUGAGG 170 CCUCAAUACCCCAAGUCCN 349-367 104 NGGACUUGGGGUAUUGAGN 171 NCUCAAUACCCCAAGUCCN 349-367 105 UGAGAAUACUGUCCCUUUU 172 AAAAGGGACAGUAUUCUCA 434-452 106 UGAGAAUACUGUCCCUUUG 173 CAAAGGGACAGUAUUCUCA 434-452 107 NGAGAAUACUGUCCCUUUU 174 AAAAGGGACAGUAUUCUCN 434-452 108 NGAGAAUACUGUCCCUUUG 175 CAAAGGGACAGUAUUCUCN 434-452 109 NGAGAAUACUGUCCCUUUN 176 NAAAGGGACAGUAUUCUCN 434-452 110 UACUGAGAAUACUGUCCCU 177 AGGGACAGUAUUCUCAGUA 437-455 111 CACUGAGAAUACUGUCCCU 178 AGGGACAGUAUUCUCAGUG 437-455 112 NACUGAGAAUACUGUCCCU 179 AGGGACAGUAUUCUCAGUN 437-455 113 NACUGAGAAUACUGUCCCN 180 NGGGACAGUAUUCUCAGUN 437-455

    [0167] The APOC3 RNAi agent sense strands and antisense strands that comprise or consist of the nucleotide sequences in Table 2 can be modified nucleotides or unmodified nucleotides. In some embodiments, the APOC3 RNAi agents having the sense and antisense strand sequences that comprise or consist of the nucleotide sequences in Table 2 are all or substantially all modified nucleotides.

    [0168] In some embodiments, the antisense strand of an APOC3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of an APOC3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2.

    [0169] As used herein, each N listed in a sequence disclosed in Table 2 may be independently selected from any and all nucleobases (including those found on both modified and unmodified nucleotides). In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is the same as the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is different from the N nucleotide at the corresponding position on the other strand.

    [0170] Certain modified APOC3 RNAi agent antisense strands, as well as their underlying unmodified nucleobase sequences, are provided in Tables 3 and 4. Certain modified APOC3 RNAi agent sense strands, as well as their underlying unmodified nucleobase sequences, are provided in Tables 3 and 5. In forming APOC3 RNAi agents, each of the nucleotides in each of the underlying base sequences listed in Tables 3, 4, and 5, as well as in Table 2, above, can be a modified nucleotide.

    [0171] The APOC3 RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 3, or Table 5, can be hybridized to any antisense strand containing a sequence listed in Table 2, Table 3, or Table 4, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.

    [0172] In some embodiments, an APOC3 RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2, Table 3, or Table 4.

    [0173] In some embodiments, an APOC3 RNAi agent comprises or consists of a duplex having the nucleobase sequences of the sense strand and the antisense strand of any of the sequences in Table 2, Table 3, Table 4, or Table 5.

    [0174] Examples of antisense strands containing modified nucleotides are provided in Table 4. Examples of sense strands containing modified nucleotides are provided in Table 5. Further examples of antisense strands and sense strands containing modified nucleotides are provided in Table 3.

    [0175] As used in Tables 3, 4, and 5, the following notations are used to indicate modified nucleotides, targeting groups, and linking groups:

    [0176] A=adenosine-3′-phosphate;

    [0177] C=cytidine-3′-phosphate;

    [0178] G=guanosine-3′-phosphate;

    [0179] U=uridine-3′-phosphate

    [0180] I=inosine-3′-phosphate

    [0181] n=any 2′-OMe modified nucleotide

    [0182] a=2′-O-methyladenosine-3′-phosphate

    [0183] as =2′-O-methyladenosine-3′-phosphorothioate

    [0184] c=2′-O-methylcytidine-3′-phosphate

    [0185] cs=2′-O-methylcytidine-3′-phosphorothioate

    [0186] g=2′-O-methylguanosine-3′-phosphate

    [0187] gs=2′-O-methylguanosine-3′-phosphorothioate

    [0188] t=2′-O-methyl-5-methyluridine-3′-phosphate

    [0189] ts=2′-O-methyl-5-methyluridine-3′-phosphorothioate

    [0190] u=2′-O-methyluridine-3′-phosphate

    [0191] us=2′-O-methyluridine-3′-phosphorothioate

    [0192] i=2′-O-methylinosine-3′-phosphate

    [0193] is =2′-O-methylinosine-3′-phosphorothioate

    [0194] Nf=any 2′-fluoro modified nucleotide

    [0195] Af 32 2′-fluoroadenosine-3′-phosphate

    [0196] Afs=2′-fluoroadenosine-3′-phosporothioate

    [0197] Cf 32 2′-fluorocytidine-3′-phosphate

    [0198] Cfs=2′-fluorocytidine-3′-phosphorothioate

    [0199] Gf =2′-fluoroguanosine-3′-phosphate

    [0200] Gfs=2′-fluoroguanosine-3′-phosphorothioate

    [0201] If =2′-fluoroinosine-3′-phosphate

    [0202] Ifs=2′-fluoroinosine-3′-phosphorothioate

    [0203] Tf =2′-nuoro-5′-methyluridine-3′-phosphate

    [0204] Tfs=2′-fluoro-5′-methyluridine-3,-phosphorothioate

    [0205] Uf =2′-fluorouridine-3′-phosphate

    [0206] Ufs=2′-fluorouridine-3′-phosphorothioate

    [0207] dN =any 2′-deoxyribonucleotide

    [0208] dA =2′-deoxyadenosine-3′-phosphate

    [0209] dAs=2′-deoxyadenosine-3′-phosphorothioate

    [0210] dC =2′-deoxycytidine-3′-phosphate

    [0211] dCs=2′-deoxycytidine-3′-phosphorothioate

    [0212] dG =2′-deoxyguanosine-3′-phosphate

    [0213] dGs=2′-deoxyguanosine-3′-phosphorothioate

    [0214] dT =2′-deoxythymidine-3 ′-phosphate

    [0215] dTs=2′-deoxythymidine-3′-phosphorothioate

    [0216] dU =2′-deoxyuridine-3′-phosphate

    [0217] dUs=2,-deoxyuridine-3′-phosphorothioate

    [0218] Nuna=2′,3′-seco nucleotide mimics (unlocked nucleobase analogs)-3′-Phosphate

    [0219] Nunas=2′,3′-seco nucleotide mimics (unlocked nucleobase analogs)-3′-phosphorothioate

    [0220] Auna=2′,3′-seco-adenosine-3′-phosphate

    [0221] Aunas=2′,3′-seco-adenosine-3′-phosphorothioate

    [0222] CUNA=2′,3′-seco-cytidine-3′-phosphate

    [0223] Cunas=2′,3′-seco-cytidine-3′-phosphorothioate

    [0224] Guna=2′,3′-seco-guanosine-3′-phosphate

    [0225] Gunas=2′,3′-seco-guanosine-3′-phosphorothioate

    [0226] UuNA=2′,3′-seco-uridine-3′-phosphate

    [0227] UUNAS=2′,3′-seco-uridine-3′-phosphorothioate

    [0228] a_2N=see Table 7

    [0229] a_2Ns=see Table 7

    [0230] pu_2N=see Table 7

    [0231] pu_2Ns=see Table 7

    [0232] N.sub.LNA=locked nucleotide

    [0233] Nf.sub.ANA=2′-F-Arabino nucleotide

    [0234] NM =2′-O-methoxyethyl nucleotide

    [0235] AM =2′-O-methoxyethyladenosine-3′-phosphate

    [0236] AMs=2,-O-methoxyethyladenosine-3′-phosphorothioate

    [0237] GM =2′-O-methoxyethylguanosine-3′-phosphate

    [0238] GMs=2′-O-methoxyethylguanosine-3′-phosphorothioate

    [0239] TM =2′-O-methoxyethylthymidine-3′-phosphate

    [0240] TMs=2′-O-methoxyethylthymidine-3′-phosphorothioate

    [0241] mCM=see Table 7

    [0242] mCMs=see Table 7

    [0243] R=ribitol

    [0244] (invdN)=any inverted deoxyribonucleotide (3′-3′linked nucleotide)

    [0245] (invAb)=inverted (3′-3′linked) abasic deoxyribonucleotide, see Table 7

    [0246] (invAb)s=inverted (3′-3′linked) abasic deoxyribonucleotide-5′-phosphorothioate, see Table 7

    [0247] (invn)=any inverted 2′-OMe nucleotide (3′-3′linked nucleotide)

    [0248] s=phosphorothioate linkage

    [0249] sp =see Table 7

    [0250] D2u=see Table 7

    [0251] pD2u=see Table 7

    [0252] vpdN=vinyl phosphonate deoxyribonucleotide

    [0253] (5Me-Nf)=5′-Me, 2′-fluoro nucleotide

    [0254] cPrp=cvclopropyl phosphonate, see Table 7

    [0255] epTcPr=see Table 7

    [0256] epTM=see Table 7

    [0257] As the person of ordinary skill in the art would readily understand, unless otherwise indicated by the sequence (such as, for example, by a phosphorothioate linkage “s”), when present in an oligonucleotide, the nucleotide monomers are mutually linked by 5′-3′-phosphodiester bonds. As the person of ordinary skill in the art would clearly understand, the inclusion of a phosphorothioate linkage as shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkage typically present in oligonucleotides (see, e.g., FIGS. 1A through 1I showing all internucleoside linkages). Further, the person of ordinary skill in the art would readily understand that the terminal nucleotide at the 3′ end of a given oligonucleotide sequence would typically have a hydroxyl (—OH) group at the respective 3′ position of the given monomer instead of a phosphate moiety ex vivo. Moreover, as the person of ordinary skill would readily understand and appreciate, while the phosphorothioate chemical structures depicted herein typically show the anion on the sulfur atom, the inventions disclosed herein encompass all phosphorothioate tautomers and/or diastereomers (e.g., where the sulfur atom has a double-bond and the anion is on an oxygen atom). Unless expressly indicated otherwise herein, such understandings of the person of ordinary skill in the art are used when describing the APOC3 RNAi agents and compositions of APOC3 RNAi agents disclosed herein.

    [0258] Certain examples of targeting groups and linking groups used with the APOC3 RNAi agents disclosed herein are provided below in Table 7. More specifically, targeting groups and linking groups include the following, for which their chemical structures are provided below in Table 7: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. Each sense strand and/or antisense strand can have any targeting groups or linking groups listed herein, as well as other targeting or linking groups, conjugated to the 5′ and/or 3′ end of the sequence.

    TABLE-US-00017 TABLE 3 APOC3 RNAi Agent Modified Antisense Strand and Modified Sense Strand Duplexes DUPLEX ID SEQ ID Antisense Sequence SEQ Sense Sequence NO.: NO. (5′ .fwdarw. 3′) ID NO. (5′ .fwdarw. 3′) 56_1 181 uAfaCfaAfcAfAfGfgAfgUfaCfcCfguu 246 cgGfgUfaCfUfCfcUfuGfuUfgUfuauu 56_2 182 uAfaCfaAfcAfaGfgAfgUfaCfcCfguu 247 cggguaCfUfCfcuuguuguuauu 56_3 183 uAfaCfaAfcAfaGfgAfgUfaCfcCfggu 248 ccggguaCfUfCfcuuguuguua 56_4 184 uAfaCfaAfcAfaGfgAfgUfaCfcCfggg 249 cccggguaCfUfCfcuuguuguua 56_5 185 uAfaCfaAfcaaggAfgUfaCfcCfggg 250 cccggguaCfUfCfcuuguuguua 58_1 186 uGfcAfaCfaAfCfAfaGfgAfgUfaCfcuu 251 ggUfaCfuCfCfUfuGfuUfgUfuGfcauu 58_2 187 uGfcAfaCfaAfcAfaGfgAfgUfaCfcuu 252 gguacuCfCfUfuguuguugcauu 58_3 188 uGfcAfaCfaAfcAfaGfgAfgUfaCfccu 253 ggguacuCfCfUfuguuguugca 58_4 189 uGfcAfaCfaAfcAfaGfgAfgUfaCfccg 254 cggguacuCfCfUfuguuguugca 58_5 190 uGfcAfaCfaacaaGfgAfgUfaCfccg 255 cggguacuCfCfUfuguuguugca 228_1 191 uAfgCfcAfuCfGfGfuCfaCfcCfaGfcuu 256 gcUfgGfgUfGfAfcCfgAfuGfgCfuauu 228_2 192 uAfgCfcAfuCfgGfuCfaCfcCfaGfcuu 257 gcugggUfGfAfccgauggcuauu 228_3 193 uAfgCfcAfuCfgGfuCfaCfcCfaGfccu 258 ggcugggUfGfAfccgauggcua 228_4 194 uAfgCfcAfuCfgGfuCfaCfcCfaGfccc 259 gggcugggUfGfAfccgauggcua 228_5 195 uAfgCfcAfucgguCfaCfcCfaGfccc 260 gggcugggUfGfAfccgauggcua 235_1 196 uGfaAfcUfgAfAfGfcCfaUfcGfgUfcuu 261 gaCfcGfaUfGfGfcUfuCfaGfuUfcauu 235_2 197 uGfaAfcUfgAfaGfcCfaUfcGfgUfcuu 262 gaccgaUfGfGfcuucaguucauu 235_3 198 uGfaAfcUfgAfaGfcCfaUfcGfgUfcau 263 ugaccgaUfGfGfcuucaguuca 235_4 199 uGfaAfcUfgAfaGfcCfaUfcGfgUfcac 264 gugaccgaUfGfGfcuucaguuca 235_5 200 uGfaAfcUfgaagcCfaUfcGfgUfcac 265 gugaccgaUfGfGfcuucaguuca 243_1 201 uCfuUfuCfaGfGfGfaAfcUfgAfaGfcuu 266 gcUfuCfaGfUfUfcCfcUfgAfaAfgauu 243_2 202 uCfuUfuCfaGfgGfaAfcUfgAfaGfcuu 267 gcuucaGfUfUfcccugaaagauu 243_3 203 uCfuUfuCfaGfgGfaAfcUfgAfaGfccu 268 ggcuucaGfUfUfcccugaaaga 243_4 204 uCfuUfuCfaGfgGfaAfcUfgAfaGfcca 269 uggcuucaGfUfUfcccugaaaga 243_5 205 uCfuUfuCfagggaAfcUfgAfaGfcca 270 uggcuucaGfUfUfcccugaaaga 260_1 206 uAfaCfgGfuGfCfUfcCfaGfuAfgUfcuu 271 gaCfuAfcUfGfGfaGfcAfcCfgUfuauu 260_2 207 uAfaCfgGfuGfcUfcCfaGfuAfgUfcuu 272 gacuacUfGfGfagcaccguuauu 260_3 208 uAfaCfgGfuGfcUfcCfaGfuAfgUfcuu 273 agacuacUfGfGfagcaccguua 260_4 209 uAfaCfgGfuGfcUfcCfaGfuAfgUfcuu 274 aagacuacUfGfGfagcaccguua 260_5 210 uAfaCfgGfugcucCfaGfuAfgUfcuu 275 aagacuacUfGfGfagcaccguua 261_1 211 uUfaAfcGfgUfGfCfuCfcAfgUfaGfuuu 276 acUfaCfuGfGfAfgCfaCfcGfuUfaauu 261_2 212 uUfaAfcGfgUfgCfuCfcAfgUfaGfuuu 277 acuacuGfGfAfgcaccguuaauu 261_3 213 uUfaAfcGfgUfgCfuCfcAfgUfaGfucu 278 gacuacuGfGfAfgcaccguuaa 261_4 214 uUfaAfcGfgUfgCfuCfcAfgUfaGfucu 279 agacuacuGfGfAfgcaccguuaa 261_5 215 uUfaAfcGfgugcuCfcAfgUfaGfucu 280 agacuacuGfGfAfgcaccguuaa 270_1 216 uAfcUfuGfuCfCfUfuAfaCfgGfuGfcuu 281 gcAfcCfgUfUfAfaGfgAfcAfaGfuauu 270_2 217 uAfcUfuGfuCfcUfuAfaCfgGfuGfcuu 282 gcaccgUfUfAfaggacaaguauu 270_3 218 uAfcUfuGfuCfcUfuAfaCfgGfuGfcuu 283 agcaccgUfUfAfaggacaagua 270_4 219 uAfcUfuGfuCfcUfuAfaCfgGfuGfcuc 284 gagcaccgUfUfAfaggacaagua 270_5 220 uAfcUfuGfuccuuAfaCfgGfuGfcuc 285 gagcaccgUfUfAfaggacaagua 272_1 221 uGfaAfcUfuGfUfCfcUfuAfaCfgGfuuu 286 acCfgUfuAfAfGfgAfcAfaGfuUfcauu 272_2 222 uGfaAfcUfuGfuCfcUfuAfaCfgGfuuu 287 accguuAfAfGfgacaaguucauu 272_3 223 uGfaAfcUfuGfuCfcUfuAfaCfgGfugu 288 caccguuAfAfGfgacaaguuca 272_4 224 uGfaAfcUfuGfuCfcUfuAfaCfgGfugc 289 gcaccguuAfAfGfgacaaguuca 272_5 225 uGfaAfcUfuguccUfuAfaCfgGfugc 290 gcaccguuAfAfGfgacaaguuca 273_1 226 uAfgAfaCfuUfGfUfcCfuUfaAfcGfguu 291 ccGfuUfaAfGfGfaCfaAfgUfuCfuauu 273_2 227 uAfgAfaCfuUfgUfcCfuUfaAfcGfguu 292 ccguuaAfGfGfacaaguucuauu 273_3 228 uAfgAfaCfuUfgUfcCfuUfaAfcGfguu 293 accguuaAfGfGfacaaguucua 273_4 229 uAfgAfaCfuUfgUfcCfuUfaAfcGfgug 294 caccguuaAfGfGfacaaguucua 273_5 230 uAfgAfaCfuugucCfuUfaAfcGfgug 295 caccguuaAfGfGfacaaguucua 349_1 231 uGfgAfcUfuGfGfGfgUfaUfuGfaGfguu 296 ccUfcAfaUfAfCfcCfcAfaGfuCfcauu 349_2 232 uGfgAfcUfuGfgGfgUfaUfuGfaGfguu 297 ccucaaUfAfCfcccaaguccauu 349_3 233 uGfgAfcUfuGfgGfgUfaUfuGfaGfguu 298 accucaaUfAfCfcccaagucca 349_4 234 uGfgAfcUfuGfgGfgUfaUfuGfaGfguc 299 gaccucaaUfAfCfcccaagucca 349_5 235 uGfgAfcUfuggggUfaUfuGfaGfguc 300 gaccucaaUfAfCfcccaagucca 434_1 236 uGfaGfaAfuAfCfUfgUfcCfcUfuUfuuu 301 aaAfaGfgGfAfCfaGfuAfuUfcUfcauu 434_2 237 uGfaGfaAfuAfcUfgUfcCfcUfuUfuuu 302 aaaaggGfAfCfaguauucucauu 434_3 238 uGfaGfaAfuAfcUfgUfcCfcUfuUfuau 303 uaaaaggGfAfCfaguauucuca 434_4 239 uGfaGfaAfuAfcUfgUfcCfcUfuUfuaa 304 uuaaaaggGfAfCfaguauucuca 434_5 240 uGfaGfaAfuacugUfcCfcUfuUfuaa 305 uuaaaaggGfAfCfaguauucuca 437_1 241 uAfcUfgAfgAfAfUfaCfuGfuCfcCfuuu 306 agGfgAfcAfGfUfaUfuCfuCfaGfuauu 437_2 242 uAfcUfgAfgAfaUfaCfuGfuCfcCfuuu 307 agggacAfGfUfauucucaguauu 437_3 243 uAfcUfgAfgAfaUfaCfuGfuCfcCfuuu 308 aagggacAfGfUfauucucagua 437_4 244 uAfcUfgAfgAfaUfaCfuGfuCfcCfuuu 309 aaagggacAfGfUfauucucagua 437_5 245 uAfcUfgAfgaauaCfuGfuCfcCfuuu 310 aaagggacAfGfUfauucucagua

    TABLE-US-00018 TABLE 4 APOC3 RNAi Agent Antisense Strand Sequences Underlying Base Sequence (5′ .fwdarw. 3′) Antisense Modified Antisense Strand SEQ ID (Shown as an Unmodified  SEQ Strand ID: (5′ .fwdarw. 3′) NO. Nucleotide Sequence) ID NO. AM06203-AS usAfscsUfuGfuCfcUfuAfaCfgGfuGfcusu 311 UACUUGUCCUUAACGGUGCUU 603 AM06204-AS usAfscsUfuGfuCfcUfuAfaCfgGfuGfcusc 312 UACUUGUCCUUAACGGUGCUC 604 AM06205-AS asAfscsUfuGfuCfcUfuAfaCfgGfuGfcusu 313 AACUUGUCCUUAACGGUGCUU 655 AM06210-AS usGfsgsAfcUfuGfgGfgUfaUfuGfaGfgusu 314 UGGACUUGGGGUAUUGAGGUU 610 AM06211-AS usGfsgsAfcUfuGfgGfgUfaUfuGfaGfgusc 315 UGGACUUGGGGUAUUGAGGUC 611 AM06214-AS usCfsusUfuCfaGfgGfaAfcUfgAfaGfcusu 316 UCUUUCAGGGAACUGAAGCUU 597 AM06215-AS usCfsusUfuCfaGfgGfaAfcUfgAfaGfccsu 317 UCUUUCAGGGAACUGAAGCCU 598 AM06218-AS usGfsasAfcUfgAfaGfcCfaUfcGfgUfcusu 318 UGAACUGAAGCCAUCGGUCUU 594 AM06219-AS usGfsasAfcUfgAfaGfcCfaUfcGfgUfcasc 319 UGAACUGAAGCCAUCGGUCAC 596 AM06262-AS usGfsasGfaAfuAfcUfgUfcCfcUfuUfugsg 320 UGAGAAUACUGUCCCUUUUGG 656 AM06263-AS usGfsasGfaAfuAfcUfgUfcCfcUfuUfugcsg 321 UGAGAAUACUGUCCCUUUUGCG 657 AM06266-AS usAfsasCfgGfuGfcUfcCfaGfuAfgUfcusu 322 UAACGGUGCUCCAGUAGUCUU 500 AM06267-AS usAfsasCfgGfuGfcUfcCfaGfuAfgUfcgsu 323 UAACGGUGCUCCAGUAGUCGU 658 AM06272-AS usAfscsUfgAfgAfaUfaCfuGfuCfcCfuusu 324 UACUGAGAAUACUGUCCCUUU 615 AM06273-AS usAfscsUfgAfgAfaUfaCfuGfuCfcCfugsu 325 UACUGAGAAUACUGUCCCUGU 659 AM06276-AS usUfsasAfcGfgUfgCfuCfcAfgUfaGfucsu 326 UUAACGGUGCUCCAGUAGUCU 602 AM06277-AS usUfsasAfcGfgUfgCfuCfcAfgUfaGfgcsu 327 UUAACGGUGCUCCAGUAGGCU 660 AM06309-AS usAfsgsCfcAfuCfgGfuCfaCfcCfaGfcusu 328 UAGCCAUCGGUCACCCAGCUU 591 AM06310-AS asAfsgsCfcAfuCfgGfuCfaCfcCfaGfcusu 329 AAGCCAUCGGUCACCCAGCUU 661 AM06314-AS usAfsgsAfaCfuUfgUfcCfuUfaAfcGfgusu 330 UAGAACUUGUCCUUAACGGUU 608 AM06315-AS usAfsgsAfaCfuUfgUfcCfuUfaAfcGfgusg 331 UAGAACUUGUCCUUAACGGUG 609 AM06318-AS usGfsasAfcUfuGfuCfcUfuAfaCfgGfuusu 332 UGAACUUGUCCUUAACGGUUU 65 AM06319-AS asGfsasAfcUfuGfuCfcUfuAfaCfgGfuusu 333 AGAACUUGUCCUUAACGGUUU 662 AM06320-AS usGfsasAfcUfuGfuCfcUfuAfaCfgGfugsc 334 UGAACUUGUCCUUAACGGUGC 607 AM06324-AS usGfscsAfaCfaAfcAfaGfgAfgUfaCfcusu 335 UGCAACAACAAGGAGUACCUU 588 AM06325-AS usGfscsAfaCfaAfcAfaGfgAfgUfaCfccsg 336 UGCAACAACAAGGAGUACCCG 590 AM06328-AS usAfsasCfaAfcAfaGfgAfgUfaCfcCfgusu 337 UAACAACAAGGAGUACCCGUU 585 AM06330-AS usGfscsAfcUfgAfgAfaUfaCfuGfuCfccusu 338 UGCACUGAGAAUACUGUCCCUU 663 AM06331-AS asGfscsAfcUfgAfgAfaUfaCfuGfuCfccusu 339 AGCACUGAGAAUACUGUCCCUU 664 AM06469-AS cPrpusAfscsUfuGfuCfcUfuAfaCfgGfuGfcusu 340 UACUUGUCCUUAACGGUGCUU 603 AM06471-AS asAfscsUfuGfuCfcUfuAfaCfgGfuGfcusc 341 AACUUGUCCUUAACGGUGCUC 666 AM06472-AS usAfscsUfuGfuCfcUfuAfaCfgGfugsc 342 UACUUGUCCUUAACGGUGC 667 AM06475-AS usAfscsUfuGfuCfcUfuAfaCfgGfuGfcucsc 343 UACUUGUCCUUAACGGUGCUCC 668 AM06476-AS usAfscsUfuGfuCfcUfuAfaCfgGfuGfcucusu 344 UACUUGUCCUUAACGGUGCUCUU 669 AM06477-AS usAfscsUfuGfuCfcUfuAfaCfgGfuGfcuccsa 345 UACUUGUCCUUAACGGUGCUCCA 670 AM06478-AS asAfscsUfuGfuCfcUfuAfaCfgGfugsc 346 AACUUGUCCUUAACGGUGC 671 AM06481-AS asAfscsUfuGfuCfcUfuAfaCfgGfuGfcucsc 347 AACUUGUCCUUAACGGUGCUCC 672 AM06507-AS usGfsasGfaAfuAfcUfgUfcCfcUfuUfuusu 348 UGAGAAUACUGUCCCUUUUUU 612 AM06509-AS usGfsasGfaAfuAfcUfgUfcCfcUfuUfugsu 349 UGAGAAUACUGUCCCUUUUGU 673 AM06511-AS usGfsaGfaAfuAfcUfgUfcCfcUfuUfugsg 350 UGAGAAUACUGUCCCUUUUGG 656 AM06513-AS asGfsasGfaAfuAfcUfgUfcCfcUfuUfugsg 351 AGAGAAUACUGUCCCUUUUGG 674 AM06514-AS usGfscsAfaCfaAfcAfaGfgAfgUfaCfsc 352 UGCAACAACAAGGAGUACC 675 AM06517-AS usGfscsAfaCfaacaaGfgAfgUfaCfccsu 353 UGCAACAACAAGGAGUACCCU 589 AM06518-AS usGfscsAfaCfaacaaGfgAfgUfaCfcusu 354 UGCAACAACAAGGAGUACCUU 588 AM06519-AS usGfscsaacaAfcAfaGfgAfguaccusu 355 UGCAACAACAAGGAGUACCUU 588 AM06521-AS usGfcAfaCfaAfcAfaGfgAfgUfaCfcusu 356 UGCAACAACAAGGAGUACCUU 588 AM06523-AS asGfscsAfaCfaAfcAfaGfgAfgUfaCfcusu 357 AGCAACAACAAGGAGUACCUU 676 AM06712-AS usCfsusGfaAfgccauCfgGfuCfaCfcCfsa 358 UCUGAAGCCAUCGGUCACCCA 677 AM06714-AS asCfsusGfaAfgccauCfgGfuCfaCfcCfsa 359 ACUGAAGCCAUCGGUCACCCA 678 AM06716-AS usGfsgsAfaCfugaagCfcAfuCfgGfuCfsa 360 UGGAACUGAAGCCAUCGGUCA 679 AM06718-AS usGfsgsAfaCfugaagCfcAfuCfgGfuCfsc 361 UGGAACUGAAGCCAUCGGUCC 680 AM06720-AS usUfscsUfuUfcagggAfaCfuGfaAfgCfsc 362 UUCUUUCAGGGAACUGAAGCC 681 AM06722-AS usUfsusAfaCfggugcUfcCfaGfuAfgUfsc 363 UUUAACGGUGCUCCAGUAGUC 682 AM06724-AS usCfscsUfuAfacgguGfcUfcCfaGfuAfsg 364 UCCUUAACGGUGCUCCAGUAG 683 AM06726-AS usUfscsCfuUfaacggUfgCfuCfcAfgUfsa 365 UUCCUUAACGGUGCUCCAGUA 684 AM06728-AS usUfscsCfuUfaacggUfgCfuCfcAfgUfsc 366 UUCCUUAACGGUGCUCCAGUC 685 AM06730-AS usAfscsUfuGfuCfcUfuAfaCfgGfuGfcUfsc 367 UACUUGUCCUUAACGGUGCUC 604 AM06732-AS asAfscsUfuGfuCfcUfuAfaCfgGfuGfcsUfsc 368 AACUUGUCCUUAACGGUGCUC 666 AM06734-AS usUfsgsAfgGfucucaGfgCfaGfcCfaCfsu 369 UUGAGGUCUCAGGCAGCCACU 686 AM06736-AS usUfsasUfuGfaGfgUfcUfcAfgGfcAfgCfsc 370 UUAUUGAGGUCUCAGGCAGCC 687 AM06738-AS usGfsusAfuUfgAfgGfuCfuCfaGfgCfaGfsc 371 UGUAUUGAGGUCUCAGGCAGC 688 AM06740-AS usCfsasCfuGfaGfaAfuAfcUfgUfcCfcUfsu 372 UCACUGAGAAUACUGUCCCUU 689 AM06741-AS usCfsasCfuGfagaauAfcUfgUfcCfcUfsu 373 UCACUGAGAAUACUGUCCCUU 689 AM06743-AS usCfsasCfuGfagaauAfcUfgUfcCfcGfsu 4 UCACUGAGAAUACUGUCCCGU 5 AM06745-AS usCfsusUfuUfaAfgCfaAfcCfuAfcAfgGfsg 374 UCUUUUAAGCAACCUACAGGG 690 AM06780-AS usGfsasGfaAfuAfcUfgUfcCfcUfuUfucsc 375 UGAGAAUACUGUCCCUUUUCC 691 AM06783-AS usCfsasCfuGfagaauAfcUfgUfcCfcUfsc 2 UCACUGAGAAUACUGUCCCUC 3 AM06784-AS usUfsasUfuGfaggucUfcAfgGfcAfgCfsc 376 UUAUUGAGGUCUCAGGCAGCC 687 AM06786-AS usGfsasGfaAfuAfcUfgUfcCfcUfuUfgcsc 13 UGAGAAUACUGUCCCUUUGCC 14 AM06862-AS usGfsasGfaAfuAfcUfgUfcCfcUfuUfuCfsc 377 UGAGAAUACUGUCCCUUUUCC 691 AM06865-AS usGfsasGfaAfuAfcUfgUfcCfcUfuUfucsu 378 UGAGAAUACUGUCCCUUUUCU 692 AM06868-AS usUfscsUfuGfuCfcAfgCfuUfuAfuUfgGfsg 379 UUCUUGUCCAGCUUUAUUGGG 693 AM06870-AS usUfscsUfuGfuCfcAfgCfuUfuAfuUfgGfsc 7 UUCUUGUCCAGCUUUAUUGGC 8 AM06872-AS usAfsgsUfcUfuUfcAfgGfgAfaCfuGfaAfsg 380 UAGUCUUUCAGGGAACUGAAG 694 AM06874-AS usAfsgsUfcUfuUfcAfgGfgAfaCfuGfaAfsc 381 UAGUCUUUCAGGGAACUGAAC 695 AM06876-AS asGfsasAfuAfcUfgUfcCfcUfuUfuAfaGfsc 11 AGAAUACUGUCCCUUUUAAGC 12 AM06908-AS usCfsasCfuGfagaauAfcUfgUfcCfcusu 382 UCACUGAGAAUACUGUCCCUU 689 AM06928-AS usCfsasCfuGfagaauAfcUfgUfcCfgusu 383 UCACUGAGAAUACUGUCCGUU 696 AM06951-AS usAfsgsUfcUfuUfcAfgGfgAfaCfuGfaCfsg 384 UAGUCUUUCAGGGAACUGACG 697 AM06953-AS usAfsgsUfcUfuUfcAfgGfgAfaCfuGfaGfsg 385 UAGUCUUUCAGGGAACUGAGG 698 AM06956-AS usAfsgsUfcUfuUcAfgGfgAfaCfuGfaCfsc 386 UAGUCUUUCAGGGAACUGACC 699 AM06958-AS usAfsgsUfcUfuUfcAfgGfgAfaCfuGfaGfsc 387 UAGUCUUUCAGGGAACUGAGC 700 AM06961-AS asGfsasAfuAfcUfgUfcCfcUfulffuAfgGfsc 388 AGAAUACUGUCCCUUUUAGGC 701 AM06963-AS asGfsasAfuAfcUfgUfcCfcUfulffuAfaGfsg 389 AGAAUACUGUCCCUUUUAAGG 702 AM06988-AS asGfsasAfuAfcUfgUfcCfcUfulffuAfgGfsg 9 AGAAUACUGUCCCUUUUAGGG 10 AM07179-AS usGfscsAfaCfA.sub.UNAacaaGfgAfgUfaCfccsu 390 UGCAACAACAAGGAGUACCCU 589 AM07182-AS usAfsgsUfcUfU.sub.UNAUfcAfgGfgAfaCfuGfaAfsg 391 UAGUCUUUCAGGGAACUGAAG 694 AM07185-AS asGfsasAfuAfC.sub.UNAUfgUfcCfcUfuUfuAfaGfsc 392 AGAAUACUGUCCCUUUUAAGC 12 AM07188-AS usGfsasGfaAfU.sub.UNAAfcUfgUfcCfcUfuUfgcsc 393 UGAGAAUACUGUCCCUUUGCC 14 AM07190-AS usCfsasCfuGfA.sub.UNAgaauAfcUfgUfcCfcUfsc 394 UCACUGAGAAUACUGUCCCUC 3 AM07193-AS usfscsUfuGfU.sub.UNACfcAfgCfuUfuAfuUfgGfsc 395 UUCUUGUCCAGCUUUAUUGGC 8 AM07518-AS asGfsasAfuAfcUfgUfcCfcUfuUfuAfgGfsu 396 AGAAUACUGUCCCUUUUAGGU 707 AM07520-AS asGfsasAfuAfcUfgUfcCfcUfuUfuAfcGfsc 397 AGAAUACUGUCCCUUUUACGC 708 AM07522-AS asGfsasAfuAfcUfgUfcCfcUfuUfuAfgAfsc 398 AGAAUACUGUCCCUUUUAGAC 709 AM07524-AS usCfsascugagaauAfcUfgUfcCfcUfsc 6 UCACUGAGAAUACUGUCCCUC 3 AM07600-AS asGfsasauacugucCfcUfuUfuAfgGfsc 399 AGAAUACUGUCCCUUUUAGGC 701 AM07645-AS usUfscsuuguccagCfuUfuAfuUfgGfsc 400 UUCUUGUCCAGCUUUAUUGGC 8 AM07750-AS usCfsasCfuGfagaauAfcUfgUfcCfcUfsg 401 UCACUGAGAAUACUGUCCCUG 710 AM07753-AS usCfsasCfuGfagaauAfcUfgUfcCfcCfsu 402 UCACUGAGAAUACUGUCCCCU 711 AM07755-AS usCfsA.sub.UNASCfuGfagaauAfcUfgUfcCfcUfsc 403 UCACUGAGAAUACUGUCCCUC 3 AM07756-AS usCfsasC.sub.UNAuGfagaauAfcUfgUfcCfcUfsc 404 UCACUGAGAAUACUGUCCCUC 3 AM07757-AS usCfsasCfU.sub.UNAGfagaauAfcUfgUfcCfcUfsc 405 UCACUGAGAAUACUGUCCCUC 3 AM07758-AS usCfsasCfuG.sub.UNAagaauAfcUfgUfcCfcUfsc 406 UCACUGAGAAUACUGUCCCUC 3 AM07760-AS asGfsusGfcAfuccuuGfgCfgGfuCfuusu 407 AGUGCAUCCUUGGCGGUCUUU 712 AM07762-AS asGfsusGfcAfU.sub.UNAccuuGfgCfgGfuCfuusu 408 AGUGCAUCCUUGGCGGUCUUU 712 AM07764-AS asGfsusAfgUfcuuucAfgGfgAfaCfuGfsa 409 AGUAGUCUUUCAGGGAACUGA 713 AM07765-AS asGfsusAfgUfC.sub.UNAuuucAfgGfgAfaCfuGfsa 410 AGUAGUCUUUCAGGGAACUGA 713 AM07767-AS usGfsusAfgUfcuuucAfgGfgAfaCfuGfsa 411 UGUAGUCUUUCAGGGAACUGA 714 AM07769-AS usCfsusUfaAfcggugCfuCfcAfgUfaGfsu 412 UCUUAACGGUGCUCCAGUAGU 715 AM07771-AS usCfscsUfuUfuaagcAfaCfcUfaCfaGfsg 413 UCCUUUUAAGCAACCUACAGG 716 AM07773-AS usCfscsUfuUfuaagcAfaCfcUfaCfaGfsc 414 UCCUUUUAAGCAACCUACAGC 717 AM07775-AS usAfsgsUfcUfuucagGfgAfaCfuGfaCfsc 415 UAGUCUUUCAGGGAACUGACC 699

    TABLE-US-00019 TABLE 5 APOC3 RNAi Agent Sense Strand Sequences Underlying Base   Sequence (5′ .fwdarw. 3′) Sense SEQ (Shown as an SEQ Strand ID Unmodified Nucleotide ID ID: Modified Sense Strand (5′ .fwdarw. 3′) NO. Sequence) NO. AM06206-SS (NAG37)s(invAb)sgcaccgUfUfAfaggacaaguauus(invAb) 416 GCACCGUUAAGGACAAGUAUU 718 AM06207-SS (NAG37)s(invAb)sgagcaccgUfUfAfaggacaagus(invdA) 417 GAGCACCGUUAAGGACAAGUA 719 AM06208-SS (NAG37)s(invAb)sgcaccgUfUfAfaggacaagus(invdA) 418 GCACCGUUAAGGACAAGUA 720 AM06209-SS (NAG37)s(invAb)sgcaccgUfUfAfaggacaaguus(invAb) 419 GCACCGUUAAGGACAAGUU 721 AM06212-SS (NAG37)s(invAb)sccucaaUfAfCfcccaaguccs(invdA) 420 CCUCAAUACCCCAAGUCCA 722 AM06213-SS (NAG37)s(invAb)sgaccucaaUfAfCfcccaaguccs(invdA) 421 GACCUCAAUACCCCAAGUCCA 723 AM06216-SS (NAG37)s(invAb)sgcuucaGfUfUfcccugaaags(invdA) 422 GCUUCAGUUCCCUGAAAGA 724 AM06217-SS (NAG37)s(invAb)sggcuucaGfUfUfcccugaaags(invdA) 423 GGCUUCAGUUCCCUGAAAGA 725 AM06220-SS (NAG37)s(invAb)sgaccgaUfGfGfcuucaguucs(invdA) 424 GACCGAUGGCUUCAGUUCA 726 AM06221-SS (NAG37)s(invAb)sgugaccgaUfGfGfcuucaguucs(invdA) 425 GUGACCGAUGGCUUCAGUUCA 727 AM06264-SS (NAG37)s(invAb)sccaaaaggGfAfCfaguauucucs(invdA) 426 CCAAAAGGGACAGUAUUCUCA 728 AM06265-SS (NAG37)scsgcaaaaggGfAfCfaguauucucs(invdA) 427 CGCAAAAGGGACAGUAUUCUCA 729 AM06268-SS (NAG37)s(invAb)sgacuacUfGfGfagcaccguus(invdA) 428 GACUACUGGAGCACCGUUA 730 AM06269-SS (NAG37)s(invAb)sgacuacUfGfGfagcacuguus(invdA) 429 GACUACUGGAGCACUGUUA 731 AM06270-SS (NAG37)s(invAb)scgacuacUfGfGfagcaccguus(invdA) 430 CGACUACUGGAGCACCGUUA 732 AM06271-SS (NAG37)s(invAb)sgacuacUfGfGfagcaucguus(invdA) 431 GACUACUGGAGCAUCGUUA 733 AM06274-SS (NAG37)s(invAb)sagggacAfGfUfauucucagus(invdA) 432 AGGGACAGUAUUCUCAGUA 734 AM06275-SS (NAG37)s(invAb)scagggacAfGfUfauucucagus(invdA) 433 CAGGGACAGUAUUCUCAGUA 735 AM06278-SS (NAG37)s(invAb)sgacuacuGfGfAfgcaccguuas(invdA) 434 GACUACUGGAGCACCGUUAA 736 AM06279-SS (NAG37)s(invAb)sgccuacuGfGfAfgcaccguuas(invdA) 435 GCCUACUGGAGCACCGUUAA 737 AM06280-SS (NAG37)s(invAb)sgccuacuGfGfAfgcacuguuas(invdA) 436 GCCUACUGGAGCACUGUUAA 738 AM06311-SS (NAG37)s(invAb)sgcugggUfGfAfccgauggcus(invdA) 437 GCUGGGUGACCGAUGGCUA 739 AM06312-SS (NAG37)s(invAb)sgcugggUfGfAfccgauggcuus(invAb) 438 GCUGGGUGACCGAUGGCUU 740 AM06313-SS (NAG37)s(invAb)sgcugggUfGfAfccgaugacus(invdA) 439 GCUGGGUGACCGAUGACUA 741 AM06316-SS (NAG37)s(invAb)sccguuaAfGfGfacaaguucus(invdA) 440 CCGUUAAGGACAAGUUCUA 742 AM06317-SS (NAG37)s(invAb)scaccguuaAfGfGfacaaguucus(invdA) 441 CACCGUUAAGGACAAGUUCUA 743 AM06321-SS (NAG37)s(invAb)saccguuAfAfGfgacaaguucs(invdA) 442 ACCGUUAAGGACAAGUUCA 744 AM06322-SS (NAG37)s(invAb)saccguuAfAfGfgacaaguucus(invAb) 443 ACCGUUAAGGACAAGUUCU 745 AM06323-SS (NAG37)s(invAb)sgcaccguuAfAfGfgacaaguucs(invdA) 444 GCACCGUUAAGGACAAGUUCA 746 AM06326-SS (NAG37)s(invAb)sgguacuCfCfUfuguuguugcs(invdA) 445 GGUACUCCUUGUUGUUGCA 747 AM06327-SS (NAG37)s(invAb)scggguacuCfCfUfuguuguugcs(invdA) 446 CGGGUACUCCUUGUUGUUGCA 748 AM06329-SS (NAG37)s(invAb)scggguaCfUfCfcuuguuguus(invdA) 447 CGGGUACUCCUUGUUGUUA 749 AM06332-SS (NAG37)s(invAb)sgggacagUfAfUfucucagugcs(invdA) 448 GGGACAGUAUUCUCAGUGCA 750 AM06333-SS (NAG37)s(invAb)sgggacagUfAfUfucucagugcus(invAb) 449 GGGACAGUAUUCUCAGUGCU 751 AM06470-SS (NAG37)sgscaccgUfUfAfaggacaaguuuus(invAb) 450 GCACCGUUAAGGACAAGUUUU 752 AM06473-SS (NAG37)sgsagcaccgUfUfAfaggacaagus(invdA) 451 GAGCACCGUUAAGGACAAGUA 719 AM06474-SS (NAG37)sgsgagcaccgUfUfAfaggacaagus(invdA) 452 GGAGCACCGUUAAGGACAAGUA 753 AM06479-SS (NAG37)sgsagcaccgUfUfAfaggacaaguus(invAb) 453 GAGCACCGUUAAGGACAAGUU 754 AM06480-SS (NAG37)sgsgagcaccgUfUfAfaggacaaguus(invAb) 454 GGAGCACCGUUAAGGACAAGUU 755 AM06506-SS (NAG37)s(invAb)saaaaggGfAfCfaguauucucauus(invAb) 455 AAAAGGGACAGUAUUCUCAUU 756 AM06508-SS (NAG37)s(invAb)scaaaaggGfAfCfaguauucucs(invdA) 456 CAAAAGGGACAGUAUUCUCA 757 AM06510-SS (NAG37)(invAb)ccaaaaggGfAfCfaguauucuc(invdA) 457 CCAAAAGGGACAGUAUUCUCA 728 AM06512-SS (NAG37)s(invAb)sccaaaaggGfAfCfaguauucucus(invAb) 458 CCAAAAGGGACAGUAUUCUCU 758 AM06515-SS (NAG37)s(invAb)sgguacuCfCfUfuguuguugcauus(invAb) 459 GGUACUCCUUGUUGUUGCAUU 759 AM06516-SS (NAG37)s(invAb)sggguacuCfCfUfuguuguugcs(invdA) 460 GGGUACUCCUUGUUGUUGCA 760 AM06520-SS (NAG37)(invAb)gguacuCfCfUfuguuguugc(invdA) 461 GGUACUCCUUGUUGUUGCA 747 AM06522-SS (NAG37)s(invAb)sgguacuCfCfUfuguuguugcus(invAb) 462 GGUACUCCUUGUUGUUGCU 761 AM06711-SS (NAG37)s(invAb)sugggugacCfGfAfuggcuucagas(invAb) 463 UGGGUGACCGAUGGCUUCAGA 762 AM06713-SS (NAG37)s(invAb)sugggugacCfGfAfuggcuucagus(invAb) 464 UGGGUGACCGAUGGCUUCAGU 763 AM06715-SS (NAG37)s(invAb)sugaccgauGfGfCfuucaguuccas(invAb) 465 UGACCGAUGGCUUCAGUUCCA 764 AM06717-SS (NAG37)s(invAb)sggaccgauGfGfCfuucaguuccas(invAb) 466 GGACCGAUGGCUUCAGUUCCA 765 AM06719-SS (NAG37)s(invAb)sggcuucagUfUfCfccugaaagaas(invAb) 467 GGCUUCAGUUCCCUGAAAGAA 766 AM06721-SS (NAG37)s(invAb)sgacuacugGfAfGfcaccguuaaas(invAb) 468 GACUACUGGAGCACCGUUAAA 767 AM06723-SS (NAG37)s(invAb)scuacuggaGfCfAfccguuaaggas(invAb) 469 CUACUGGAGCACCGUUAAGGA 768 AM06725-SS (NAG37)s(invAb)suacuggagCfAfCfcguuaaggaas(invAb) 470 UACUGGAGCACCGUUAAGGAA 769 AM06727-SS (NAG37)s(invAb)sgacuggagCfAfCfcguuaaggaas(invAb) 471 GACUGGAGCACCGUUAAGGAA 770 AM06729-SS (NAG37)s(invAb)sgagcaccgUfUfAfaggacaaguas(invAb) 472 GAGCACCGUUAAGGACAAGUA 719 AM06731-SS (NAG37)s(invAb)sgagcaccgUfUfAfaggacaaguus(invAb) 473 GAGCACCGUUAAGGACAAGUU 754 AM06733-SS (NAG37)s(invAb)saguggcugCfCfUfgagaccucaas(invAb) 474 AGUGGCUGCCUGAGACCUCAA 771 AM06735-SS (NAG37)s(invAb)sggcugccuGfAfGfaccucaauaas(invAb) 475 GGCUGCCUGAGACCUCAAUAA 772 AM06737-SS (NAG37)s(invAb)sgcugccugAfGfAfccucaauacas(invAb) 476 GCUGCCUGAGACCUCAAUACA 773 AM06739-SS (NAG37)s(invAb)saagggacaGfUfAfuucucagugas(invAb) 477 AAGGGACAGUAUUCUCAGUGA 774 AM06742-SS (NAG37)s(invAb)sacgggacaGfUfAfuucucagugas(invAb) 478 ACGGGACAGUAUUCUCAGUGA 775 AM06744-SS (NAG37)s(invAb)scccuguagGfUfUfgcuuaaaagas(invAb) 479 CCCUGUAGGUUGCUUAAAAGA 776 AM06779-SS (NAG37)s(invAb)sggaaaaggGfAfCfaguauucucas(invAb) 480 GGAAAAGGGACAGUAUUCUCA 777 AM06781-SS (NAG37)gsgaaaaggGfAfCfaguauucucas(invAb) 481 GGAAAAGGGACAGUAUUCUCA 777 AM06782-SS (NAG37)s(invAb)sgagggacaGfUfAfuucucagugas(invAb) 482 GAGGGACAGUAUUCUCAGUGA  21 AM06785-SS (NAG37)s(invAb)sggcaaaggGfAfCfaguauucucas(invAb) 483 GGCAAAGGGACAGUAUUCUCA  31 AM06787-SS (NAG37)gsgcaaaggGfAfCfaguauucucas(invAb) 484 GGCAAAGGGACAGUAUUCUCA  31 AM06788-SS (NAG37)s(invAb)susgaccgauGfGfCfuucaiuuccas 485 UGACCGAUGGCUUCAIUUCCA 780 (invAb) AM06789-SS (NAG37)usgaccgauGfGfCfuucaguuccas(invAb) 486 UGACCGAUGGCUUCAGUUCCA 764 AM06790-SS (NAG37)usgaccgauGfGfCfuucaiuuccas(invAb) 487 UGACCGAUGGCUUCAIUUCCA 780 AM06791-SS (NAG37)gsagggacaGfUfAfuucucagugas(invAb) 488 GAGGGACAGUAUUCUCAGUGA  21 AM06792-SS (NAG37)gsgcugccuGfAfGfaccucaauaas(invAb) 489 GGCUGCCUGAGACCUCAAUAA 772 AM06863-SS (NAG37)s(invAb)sgga_2NaaaggGfAfCfaguauucucas 490 GG(A.sup.2N)AAAGGGACAGUAUU 781 (invAb) CUCA AM06864-SS (NAG37)s(invAb)sa_2NgaaaaggGfAfCfaguauucucas 491 (A.sup.2N)GAAAAGGGACAGUAUU 782 (invAb) CUCA AM06866-SS (NAG37)s(invAb)sa_2Na_2NaaaaggGfAfCf 492 (A.sup.2N)(A.sup.2N)AAAAGGGACAGUA 783 aguauucucas(invAb) UUCUCA AM06867-SS (NAG37)s(invAb)scccaauaaAfGfCfuggacaagaas(invAb) 493 CCCAAUAAAGCUGGACAAGAA 784 AM06869-SS (NAG37)s(invAb)sgccaauaaAfGfCfuggacaagaas(invAb) 494 GCCAAUAAAGCUGGACAAGAA  23 AM06871-SS (NAG37)s(invAb)scuucaguuCfCfCfugaaagacuas(invAb) 495 CUUCAGUUCCCUGAAAGACUA 786 AM06873-SS (NAG37)s(invAb)sguucaguuCfCfCfugaaagacuas(invAb) 496 GUUCAGUUCCCUGAAAGACUA 787 AM06875-SS (NAG37)s(invAb)sgcuuaaaaGfGfGfacaguauucus(invAb) 497 GCUUAAAAGGGACAGUAUUCU  29 AM06907-SS (NAG37)s(invAb)sgggacaGfUfAfuucucagugauus(invAb) 498 GGGACAGUAUUCUCAGUGAUU 789 AM06922-SS (NAG37)s (invAb)sa_2NagggacaGfUfAfuucucag 499 (A.sup.2N)AGGGACAGUAUUCUCA 790 ugas(invAb) GUGA AM06923-SS (NAG37)s(invAb)sgagggacaGfUfAfuucucaiugas(invAb) 500 GAGGGACAGUAUUCUCAIUGA 791 AM06924-SS (NAG37)s(invAb)sgagggacaGfUfAfuucucaguias(invAb) 501 GAGGGACAGUAUUCUCAGUIA  16 AM06925-SS (NAG37)ascgggacaGfUfAfuucucagugas(invAb) 502 ACGGGACAGUAUUCUCAGUGA 775 AM06926-SS (NAG37)gsggacaGfUfAfuucucagugauus(invAb) 503 GGGACAGUAUUCUCAGUGAUU 789 AM06927-SS (NAG37)s(invAb)scggacaGfUfAfuucucagugauus(invAb) 504 CGGACAGUAUUCUCAGUGAUU 793 AM06929-SS (NAG37)gsgcaaaggGfAfCfaGuauucucas(invAb) 505 GGCAAAGGGACAGUAUUCUCA  31 AM06932-SS (NAG37)s(invAb)sggcaaagiGfAfCfaguauucucas(invAb) 506 GGCAAAGIGACAGUAUUCUCA 794 AM06933-SS (NAG37)s(invAb)sggcaaaigGfAfCfaguauucucas(invAb) 507 GGCAAAIGGACAGUAUUCUCA 778 AM06934-SS (NAG37)s(invAb)saggguacuCfCfUfuguuguugcas(invAb) 508 AGGGUACUCCUUGUUGUUGCA 795 AM06948-SS (NAG37)s(invAb)scuucaguuCfUfCfugaaagacuas(invAb) 509 CUUCAGUUCUCUGAAAGACUA 796 AM06949-SS (NAG37)s(invAb)scuucaguuUfCfCfugaaagacuas(invAb) 510 CUUCAGUUUCCUGAAAGACUA 797 AM06950-SS (NAG37)s(invAb)scgucaguuCfCfCfugaaagacuas(invAb) 511 CGUCAGUUCCCUGAAAGACUA 798 AM06952-SS (NAG37)s(invAb)sccucaguuCfCfCfugaaagacuas(invAb) 512 CCUCAGUUCCCUGAAAGACUA 799 AM06954-SS (NAG37)s(invAb)scgucaguuCfUfCfugaaagacuas(invAb) 513 CGUCAGUUCUCUGAAAGACUA 800 AM06955-SS (NAG37)s(invAb)sggucaguuCfCfCfugaaagacuas(invAb) 514 GGUCAGUUCCCUGAAAGACUA 801 AM06957-SS (NAG37)s(invAb)sgcucaguuCfCfCfugaaagacuas(invAb) 515 GCUCAGUUCCCUGAAAGACUA 802 AM06960-SS (NAG37)s(invAb)sgccuaaaaGfGfGfacaguauucus(invAb) 516 GCCUAAAAGGGACAGUAUUCU 803 AM06962-SS (NAG37)s(invAb)sccuuaaaaGfGfGfacaguauucus(invAb) 517 CCUUAAAAGGGACAGUAUUCU 804 AM06964-SS (NAG37)s(invAb)sgcuuaaaaGfGfiacaguauucus(invAb) 518 GCUUAAAAGGIACAGUAUUCU 805 AM06965-SS (NAG37)s(invAb)sgcuuaaaaGfiGfacaguauucus(invAb) 519 GCUUAAAAGIGACAGUAUUCU 779 AM06966-SS (NAG37)s(invAb)sgcuuaaaaiGfGfacaguauucus(invAb) 520 GCUUAAAAIGGACAGUAUUCU 785 AM06987-SS (NAG37)s(invAb)scccuaaaaGfGfGfacaguauucus(invAb) 521 CCCUAAAAGGGACAGUAUUCU  27 AM07178-SS (NAG37)s(invAb)saggguacuCfCfUfuguuguuicas(invAb) 522 AGGGUACUCCUUGUUGUUICA 807 AM07180-SS (NAG37)s(invAb)saggguacuCfCfUfuGuuguugcas(invAb) 523 AGGGUACUCCUUGUUGUUGCA 795 AM07181-SS (NAG37)s(invAb)scuucaguuCfCfCfugaaagaivas(invAb) 524 CUUCAGUUCCCUGAAAGAIUA 808 AM07183-SS (NAG37)s(invAb)scuucaguuCfCfCfuGaaagacuas(invAb) 525 CUUCAGUUCCCUGAAAGACUA 786 AM07184-SS (NAG37)s(invAb)sgcuuaaaaGfGfGfacaguauuius(invAb) 526 GCUUAAAAGGGACAGUAUUIU 809 AM07186-SS (NAG37)s(invAb)sgcuuaaaaGfGfGfaCaguauucus(invAb) 527 GCUUAAAAGGGACAGUAUUCU  29 AM07187-SS (NAG37)s(invAb)sggcaaaggGfAfCfaguauucuias(invAb) 528 GGCAAAGGGACAGUAUUCUIA 810 AM07189-SS (NAG37)s(invAb)sggcaaaggGfAfCfaGuauucucas(invAb) 529 GGCAAAGGGACAGUAUUCUCA  31 AM07191-SS (NAG37)s(invAb)sgagggacaGfUfAfuUcucaguias(invAb) 530 GAGGGACAGUAUUCUCAGUIA  16 AM07192-SS (NAG37)s(invAb)sgccaauaaAfGfCfuggacaaiaas(invAb) 531 GCCAAUAAAGCUGGACAAIAA 811 AM07194-SS (NAG37)s(invAb)sgccaauaaAfGfCfuGgacaagaas(invAb) 532 GCCAAUAAAGCUGGACAAGAA  23 AM07309-SS (NAG37)s(invAb)saggguacuCfIfUfuguuguugcas(invAb) 533 AGGGUACUCIUUGUUGUUGCA 812 AM07310-SS (NAG37)s(invAb)saggguacuIfCfUfuguuguugcas(invAb) 534 AGGGUACUICUUGUUGUUGCA 788 AM07311-SS (NAG37)s(invAb)scuucaguuCfCfIfugaaagacuas(invAb) 535 CUUCAGUUCCIUGAAAGACUA 813 AM07312-SS (NAG37)s(invAb)scuucaguuCfIfCfugaaagacuas(invAb) 536 CUUCAGUUCICUGAAAGACUA 792 AM07313-SS (NAG37)s(invAb)scuucaguuIfCfCfugaaagacuas(invAb) 537 CUUCAGUUICCUGAAAGACUA 806 AM07314-SS (NAG37)s(invAb)sgcuuaaaaGfGfIfacaguauucus(invAb) 538 GCUUAAAAGGIACAGUAUUCU 805 AM07315-SS (NAG37)s(invAb)sgcuuaaaaGfIfGfacaguauucus(invAb) 539 GCUUAAAAGIGACAGUAUUCU 817 AM07316-SS (NAG37)s(invAb)sgcuuaaaaIfGfGfacaguauucus(invAb) 540 GCUUAAAAIGGACAGUAUUCU 824 AM07317-SS (NAG37)s(invAb)sggcaaaggGfAfIfaguauucucas(invAb) 541 GGCAAAGGGAIAGUAUUCUCA 814 AM07318-SS (NAG37)s(invAb)sggcaaaggIfAfCfaguauucucas(invAb) 542 GGCAAAGGIACAGUAUUCUCA 794 AM07319-SS (NAG37)s(invAb)sgagggacaIfUfAfuucucaguias(invAb) 543 GAGGGACAIUAUUCUCAGUIA 815 AM07320-SS (NAG37)s(invAb)sgccaauaaAfGfIfuggacaagaas(invAb) 544 GCCAAUAAAGIUGGACAAGAA 816 AM07321-SS (NAG37)s(invAb)sgccaauaaAfIfCfuggacaagaas(invAb) 545 GCCAAUAAAICUGGACAAGAA  25 AM07515-SS (NAG37)s(invAb)sgccuaaaaGfGfiacaguauucus(invAb) 546 GCCUAAAAGGIACAGUAUUCU 818 AM07516-SS (NAG37)s(invAb)sgccuaaaaGfGfIfacaguauucus(invAb) 547 GCCUAAAAGGIACAGUAUUCU 818 AM07517-SS (NAG37)s(invAb)saccuaaaaGfGfGfacaguauucus(invAb) 548 ACCUAAAAGGGACAGUAUUCU 819 AM07519-SS (NAG37)s(invAb)sgcguaaaaGfGfGfacaguauucus(invAb) 549 GCGUAAAAGGGACAGUAUUCU 820 AM07521-SS (NAG37)s(invAb)sgucuaaaaGfGfGfacaguauucus(invAb) 550 GUCUAAAAGGGACAGUAUUCU 821 AM07523-SS (NAG37)s(invAb)sgagggacaGfUfAfuUcucagugas(invAb) 551 GAGGGACAGUAUUCUCAGUGA  21 AM07525-SS (NAG37)s(invAb)sgggacaGfUfAfuucucaguiauus(invAb) 552 GGGACAGUAUUCUCAGUIAUU 822 AM07526-SS (NAG37)s(invAb)sgccaauaaAfGfCfudGgacaagaas 553 GCCAAUAAAGCUGGACAAGAA  23 (invAb) AM07598-SS (NAG37)s(invAb)sgccuaaaaGfgGfaCfaguauucus(invAb) 554 GCCUAAAAGGGACAGUAUUCU 803 AM07599-SS (NAG37)s(invAb)sgccuaaaaGfgIfaCfaguauucus(invAb) 555 GCCUAAAAGGIACAGUAUUCU 818 AM07601-SS (NAG37)s(invAb)sgagggacaGfuAfuUfcucagugas(invAb) 556 GAGGGACAGUAUUCUCAGUGA  21 AM07602-SS (NAG37)s(invAb)sgagggacaGfuAfuUfcucaguias(invAb) 557 GAGGGACAGUAUUCUCAGUIA  16 AM07644-SS (NAG37)s(invAb)sgcCfaAfuAfaAfGfCfuggacaagaas 558 GCCAAUAAAGCUGGACAAGAA  23 (invAb) AM07646-SS (NAG37)s(invAb)sgcCfaAfuAfaAfgCfuggacaagaas 559 GCCAAUAAAGCUGGACAAGAA  23 (invAb) AM07647-SS (NAG37)s(invAb)sgcCfaAfUfAfaAfGfCfuggacaagaas 560 GCCAAUAAAGCUGGACAAGAA  23 (invAb) AM07648-SS (NAG37)s(invAb)sgccaauaAMAfGfCfuggacaagaas 561 GCCAAUAAAGCUGGACAAGAA  23 (invAb) AM07649-SS (NAG37)s(invAb)sgccAMauaaAfGfCfuggacaagaas 562 GCCAAUAAAGCUGGACAAGAA  23 (invAb) AM07650-SS (NAG37)s(invAb)sgcCfaAfuAfaAfIfCfuggacaagaas 563 GCCAAUAAAICUGGACAAGAA  25 (invAb) AM07651-SS (NAG37)s(invAb)sgcCfaAfUfAfaAfIfCfuggacaagaas 564 GCCAAUAAAICUGGACAAGAA  25 (invAb) AM07652-SS (NAG37)s(invAb)sgccaauaaAfiCfuggacaagaas(invAb) 565 GCCAAUAAAICUGGACAAGAA  25 AM07653-SS (NAG37)s(invAb)sgcCfaAfuAfaAfGfCfuigacaagaas 566 GCCAAUAAAGCUIGACAAGAA 823 (invAb) AM07654-SS (NAG37)s(invAb)sgcCfaAfuAfaAfGfCfugiacaagaas 567 GCCAAUAAAGCUGIACAAGAA 836 (invAb) AM07655-SS (NAG37)s(invAb)sgcCfuAfaAfaGfGfGfacaguauucus 568 GCCUAAAAGGGACAGUAUUCU 803 (invAb) AM07656-SS (NAG37)s(invAb)sgcCfuAfaAfaGfgGfacaguauucus 569 GCCUAAAAGGGACAGUAUUCU 803 (invAb) AM07657-SS (NAG37)s(invAb)sgcCfuAfaAfaGfGfIfacaguauucus 570 GCCUAAAAGGIACAGUAUUCU 818 (invAb) AM07658-SS (NAG37)s(invAb)sgcCfuAfaAfaGfgIfacaguauucus 571 GCCUAAAAGGIACAGUAUUCU 818 (invAb) AM07748-SS (NAG37)s(invAb)sacgggacaGfUfAfuucucaguias(invAb) 572 ACGGGACAGUAUUCUCAGUIA  18 AM07749-SS (NAG37)s(invAb)scagggacaGfUfAfuucucagugas(invAb) 573 CAGGGACAGUAUUCUCAGUGA 825 AM07751-SS (NAG37)s(invAb)scagggacaGfUfAfuucucaguias(invAb) 574 CAGGGACAGUAUUCUCAGUIA 837 AM07752-SS (NAG37)s(invAb)saggggacaGfUfAfuucucagugas(invAb) 575 AGGGGACAGUAUUCUCAGUGA 826 AM07754-SS (NAG37)s(invAb)saggggacaGfUfAfuucucaguias(invAb) 576 AGGGGACAGUAUUCUCAGUIA 827 AM07759-SS (NAG37)s(invAb)sagaccgCfCfAfaggaugcacuuus(invAb) 577 AGACCGCCAAGGAUGCACUUU 828 AM07761-SS (NAG37)s(invAb)sagaccgCfCfAfaggauicacuuus(invAb) 578 AGACCGCCAAGGAUICACUUU 829 AM07763-SS (NAG37)s(invAb)sucaguuccCfUfGfaaagacuacus(invAb) 579 UCAGUUCCCUGAAAGACUACU 830 AM07766-SS (NAG37)s(invAb)sucaguuccCfUfGfaaagacuacas(invAb) 580 UCAGUUCCCUGAAAGACUACA 831 AM07768-SS (NAG37)s(invAb)sacuacuggAfGfCfacciuuaagas(invAb) 581 ACUACUGGAGCACCIUUAAGA 832 AM07770-SS (NAG37)s(invAb)sccuguaggUfUfGfcuuaaaaggas(invAb) 582 CCUGUAGGUUGCUUAAAAGGA 833 AM07772-SS (NAG37)s(invAb)sgcuguaggUfUfGfcuuaaaaggas(invAb) 583 GCUGUAGGUUGCUUAAAAGGA 834 AM07774-SS (NAG37)s(invAb)sggucaguuCfUfCfugaaagacuas(invAb) 584 GGUCAGUUCUCUGAAAGACUA 835 (A.sup.2N) = 2-aminoadenine nucleotide

    [0259] The APOC3 RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 3, or Table 5 can be hybridized to any antisense strand containing a sequence listed in Table 2, Table 3, or Table 4, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.

    [0260] In some embodiments, the antisense strand of an APOC3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 4. In some embodiments, the sense strand of an APOC3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 5.

    [0261] In some embodiments, an APOC3 RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2, Table 3, or Table 4. In some embodiments, an APOC3 RNAi agent antisense strand comprises the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24, 1-25, 2-25, 1-16, or 2-16 of any of the sequences in Table 2, Table 3, or Table 4. In certain embodiments, an APOC3 RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 4. In certain embodiments, an APOC3 RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3.

    [0262] In some embodiments, an APOC3 RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Table 2, Table 3, or Table 5. In some embodiments, an APOC3 RNAi agent sense strand comprises the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, 4-24, 1-25, 2-25, 3-25, 4-25, 1-26, 2-26, 3-26, or 4-26, of any of the sequences in Table 2, Table 3, or Table 5. In certain embodiments, an APOC3 RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 5. In certain embodiments, an APOC3 RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3.

    [0263] For the APOC3 RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5′ end.fwdarw.3′ end) can be perfectly complementary to an APOC3 gene, or can be non-complementary to an APOC3 gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end.fwdarw.3′ end) is a U, A, or dT (or a modified version thereof). In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end.fwdarw.3′ end) forms an A:U or U:A base pair with the sense strand.

    [0264] In some embodiments, an APOC3 RNAi agent antisense strand comprises the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 4. In some embodiments, an APOC3 RNAi sense strand comprises the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-17 or 1-18 of any of the sense strand sequences in Table 2 or Table 5.

    [0265] In some embodiments, an APOC3 RNAi agent includes (i) an antisense strand comprising the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3, or Table 4, and (ii) a sense strand comprising the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 3, or Table 5.

    [0266] A sense strand containing a sequence listed in Table 2, Table 3, or Table 5 can be hybridized to any antisense strand containing a sequence listed in Table 2, Table 3, or Table 4, provided the two sequences have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence. In some embodiments, the APOC3 RNAi agent has a sense strand consisting of the modified sequence of any of the modified sequences in Table 5, and an antisense strand consisting of the modified sequence of any of the modified sequences in Table 4. Representative sequence pairings are exemplified by the Duplex ID Nos. shown in Table 3 and Table 6.

    [0267] In some embodiments, an APOC3 RNAi agent comprises any of the duplexes represented by any of the Duplex ID Nos. presented herein. In some embodiments, an APOC3 RNAi agent consists of any of the duplexes represented by any of the Duplex ID Nos. presented herein. In some embodiments, an APOC3 RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos. presented herein. In some embodiments, an APOC3 RNAi agent includes the sense strand and antisense strand nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos. presented herein and a targeting group and/or linking group, wherein the targeting group and/or linking group is covalently linked (i.e., conjugated) to the sense strand or the antisense strand. In some embodiments, an APOC3 RNAi agent includes the sense strand and antisense strand modified nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos. presented herein. In some embodiments, an APOC3 RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos. presented herein and a targeting group and/or linking group, wherein the targeting group and/or linking group is covalently linked to the sense strand or the antisense strand.

    [0268] In some embodiments, an APOC3 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 2, Table 3, or Table 6, and comprises an asialoglycoprotein receptor ligand targeting group.

    [0269] In some embodiments, an APOC3 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 2, Table 3, or Table 6, and further comprises a targeting group selected from the group consisting of (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. In some embodiments, the targeting group is (NAG25) or (NAG25)s as defined in Table 7. In other embodiments, the targeting group is (NAG37) or (NAG37)s as defined in Table 7.

    [0270] In some embodiments, an APOC3 RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequence of any of the antisense strand and/or sense strand nucleotide sequences of any of the duplexes of Table 2, Table 3, or Table 6. In some embodiments, an APOC3 RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand and/or sense strand nucleotide sequences of any of the duplexes of Table 2, Table 3, or Table 6, and comprises an asialoglycoprotein receptor ligand targeting group.

    [0271] In some embodiments, an APOC3 RNAi agent comprises any of the duplexes of Table 2, Table 3, or Table 6.

    [0272] In some embodiments, an APOC3 RNAi agent consists of any of the duplexes of Table 2, Table 3, or Table 6.

    TABLE-US-00020 TABLE 6 APOC3 RNAi Agents Identified by Duplex ID NO. with Corresponding Sense and Antisense Strands. Duplex ID Antisense Strand ID Sense Strand ID AD04812 AM06203-AS AM06206-SS AD04813 AM06204-AS AM06207-SS AD04814 AM06203-AS AM06208-SS AD04815 AM06205-AS AM06209-SS AD04816 AM06210-AS AM06212-SS AD04817 AM06211-AS AM06213-SS AD04818 AM06214-AS AM06216-SS AD04819 AM06215-AS AM06217-SS AD04820 AM06218-AS AM06220-SS AD04821 AM06219-AS AM06221-SS AD04860 AM06262-AS AM06264-SS AD04861 AM06263-AS AM06265-SS AD04862 AM06266-AS AM06268-SS AD04863 AM06266-AS AM06269-SS AD04864 AM06267-AS AM06270-SS AD04865 AM06266-AS AM06271-SS AD04866 AM06272-AS AM06274-SS AD04867 AM06273-AS AM06275-SS AD04868 AM06276-AS AM06278-SS AD04869 AM06277-AS AM06279-SS AD04870 AM06277-AS AM06280-SS AD04886 AM06309-AS AM06311-SS AD04887 AM06310-AS AM06312-SS AD04888 AM06309-AS AM06313-SS AD04889 AM06314-AS AM06316-SS AD04890 AM06315-AS AM06317-SS AD04891 AM06318-AS AM06321-SS AD04892 AM06319-AS AM06322-SS AD04893 AM06320-AS AM06323-SS AD04894 AM06324-AS AM06326-SS AD04895 AM06325-AS AM06327-SS AD04896 AM06328-AS AM06329-SS AD04897 AM06330-AS AM06332-SS AD04898 AM06331-AS AM06333-SS AD04987 AM06469-AS AM06206-SS AD04988 AM06469-AS AM06208-SS AD04989 AM06471-AS AM06470-SS AD04990 AM06205-AS AM06470-SS AD04991 AM06472-AS AM06208-SS AD04992 AM06204-AS AM06473-SS AD04993 AM06475-AS AM06474-SS AD04994 AM06476-AS AM06207-SS AD04995 AM06477-AS AM06207-SS AD04996 AM06478-AS AM06209-SS AD04997 AM06471-AS AM06479-SS AD04998 AM06481-AS AM06480-SS AD05007 AM06507-AS AM06506-SS AD05008 AM06509-AS AM06508-SS AD05009 AM06511-AS AM06510-SS AD05010 AM06513-AS AM06512-SS AD05011 AM06514-AS AM06326-SS AD05012 AM06324-AS AM06515-SS AD05013 AM06517-AS AM06516-SS AD05014 AM06518-AS AM06326-SS AD05015 AM06519-AS AM06326-SS AD05016 AM06521-AS AM06520-SS AD05017 AM06523-AS AM06522-SS AD05127 AM06712-AS AM06711-SS AD05128 AM06714-AS AM06713-SS AD05129 AM06716-AS AM06715-SS AD05130 AM06718-AS AM06717-SS AD05131 AM06720-AS AM06719-SS AD05132 AM06722-AS AM06721-SS AD05133 AM06724-AS AM06723-SS AD05134 AM06726-AS AM06725-SS AD05135 AM06728-AS AM06727-SS AD05136 AM06730-AS AM06729-SS AD05137 AM06732-AS AM06731-SS AD05138 AM06734-AS AM06733-SS AD05139 AM06736-AS AM06735-SS AD05140 AM06738-AS AM06737-SS AD05141 AM06740-AS AM06739-SS AD05142 AM06741-AS AM06739-SS AD05143 AM06743-AS AM06742-SS AD05144 AM06745-AS AM06744-SS AD05167 AM06780-AS AM06779-SS AD05168 AM06780-AS AM06781-SS AD05169 AM06783-AS AM06782-SS AD05170 AM06784-AS AM06735-SS AD05171 AM06786-AS AM06785-SS AD05172 AM06786-AS AM06787-SS AD05173 AM06716-AS AM06788-SS AD05174 AM06716-AS AM06789-SS AD05175 AM06716-AS AM06790-SS AD05176 AM06783-AS AM06791-SS AD05177 AM06784-AS AM06792-SS AD05215 AM06862-AS AM06779-SS AD05216 AM06780-AS AM06863-SS AD05217 AM06865-AS AM06864-SS AD05218 AM06507-AS AM06866-SS AD05219 AM06868-AS AM06867-SS AD05220 AM06870-AS AM06869-SS AD05221 AM06872-AS AM06871-SS AD05222 AM06874-AS AM06873-SS AD05223 AM06876-AS AM06875-SS AD05239 AM06908-AS AM06907-SS AD05249 AM06741-AS AM06922-SS AD05250 AM06783-AS AM06923-SS AD05251 AM06783-AS AM06924-SS AD05252 AM06743-AS AM06925-SS AD05253 AM06908-AS AM06926-SS AD05254 AM06928-AS AM06927-SS AD05255 AM06786-AS AM06929-SS AD05258 AM06786-AS AM06932-SS AD05259 AM06786-AS AM06933-SS AD05260 AM06517-AS AM06934-SS AD05275 AM06872-AS AM06948-SS AD05276 AM06872-AS AM06949-SS AD05277 AM06951-AS AM06950-SS AD05278 AM06953-AS AM06952-SS AD05279 AM06951-AS AM06954-SS AD05280 AM06956-AS AM06955-SS AD05281 AM06958-AS AM06957-SS AD05282 AM06959-AS AM06875-SS AD05283 AM06961-AS AM06960-SS AD05284 AM06963-AS AM06962-SS AD05285 AM06876-AS AM06964-SS AD05286 AM06876-AS AM06965-SS AD05287 AM06876-AS AM06966-SS AD05299 AM06988-AS AM06987-SS AD05431 AM06517-AS AM07178-SS AD05432 AM07179-AS AM06934-SS AD05433 AM06517-AS AM07180-SS AD05434 AM06872-AS AM07181-SS AD05435 AM07182-AS AM06871-SS AD05436 AM06872-AS AM07183-SS AD05437 AM06876-AS AM07184-SS AD05438 AM07185-AS AM06875-SS AD05439 AM06876-AS AM07186-SS AD05440 AM06786-AS AM07187-SS AD05441 AM07188-AS AM06785-SS AD05442 AM06786-AS AM07189-SS AD05443 AM07190-AS AM06924-SS AD05444 AM06783-AS AM07191-SS AD05445 AM06870-AS AM07192-SS AD05446 AM07193-AS AM06869-SS AD05447 AM06870-AS AM07194-SS AD05535 AM06517-AS AM07309-SS AD05536 AM06517-AS AM07310-SS AD05537 AM06872-AS AM07311-SS AD05538 AM06872-AS AM07312-SS AD05539 AM06872-AS AM07313-SS AD05540 AM06876-AS AM07314-SS AD05541 AM06876-AS AM07315-SS AD05542 AM06876-AS AM07316-SS AD05543 AM06786-AS AM07317-SS AD05544 AM06786-AS AM07318-SS AD05545 AM06783-AS AM07319-SS AD05546 AM06870-AS AM07320-SS AD05547 AM06870-AS AM07321-SS AD05705 AM06961-AS AM07515-SS AD05706 AM06961-AS AM07516-SS AD05707 AM07518-AS AM07517-SS AD05708 AM07520-AS AM07519-SS AD05709 AM07522-AS AM07521-SS AD05710 AM07190-AS AM06782-SS AD05711 AM06783-AS AM07523-SS AD05712 AM07524-AS AM06924-SS AD05713 AM06908-AS AM07525-SS AD05714 AM06870-AS AM07526-SS AD05761 AM06961-AS AM07598-SS AD05762 AM06961-AS AM07599-SS AD05763 AM07600-AS AM06960-SS AD05764 AM07600-AS AM07516-SS AD05765 AM07600-AS AM07598-SS AD05766 AM07600-AS AM07599-SS AD05767 AM07524-AS AM06782-SS AD05768 AM07524-AS AM07601-SS AD05769 AM07524-AS AM07602-SS AD05811 AM06870-AS AM07644-SS AD05812 AM07645-AS AM07644-SS AD05813 AM07645-AS AM07646-SS AD05814 AM07645-AS AM07647-SS AD05815 AM06870-AS AM07648-SS AD05816 AM06870-AS AM07649-SS AD05817 AM07645-AS AM07650-SS AD05818 AM07645-AS AM07651-SS AD05819 AM06870-AS AM07652-SS AD05820 AM07645-AS AM07653-SS AD05821 AM07645-AS AM07654-SS AD05822 AM07600-AS AM07655-SS AD05823 AM07600-AS AM07656-SS AD05824 AM07600-AS AM07657-SS AD05825 AM07600-AS AM07658-SS AD05876 AM06743-AS AM07748-SS AD05877 AM07750-AS AM07749-SS AD05878 AM07750-AS AM07751-SS AD05879 AM07753-AS AM07752-SS AD05880 AM07753-AS AM07754-SS AD05881 AM07755-AS AM06782-SS AD05882 AM07756-AS AM06782-SS AD05883 AM07757-AS AM06782-SS AD05884 AM07758-AS AM06782-SS AD05885 AM07755-AS AM06924-SS AD05886 AM07756-AS AM06924-SS AD05887 AM07757-AS AM06924-SS AD05888 AM07758-AS AM06924-SS AD05889 AM07760-AS AM07759-SS AD05890 AM07762-AS AM07761-SS AD05891 AM07764-AS AM07763-SS AD05892 AM07765-AS AM07763-SS AD05893 AM07767-AS AM07766-SS AD05894 AM07769-AS AM07768-SS AD05895 AM07771-AS AM07770-SS AD05896 AM07773-AS AM07772-SS AD05897 AM07775-AS AM07774-SS

    [0273] In some embodiments, an APOC3 RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. The RNAi agents described herein, upon delivery to a cell expressing an APOC3 gene, inhibit or knockdown expression of one or more APOC3 genes in vivo.

    Targeting Groups, Linking Groups, and Delivery Vehicles

    [0274] In some embodiments, an APOC3 RNAi agent is conjugated to one or more non-nucleotide groups including, but not limited to a targeting group, linking group, delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance targeting, delivery or attachment of the RNAi agent. Examples of targeting groups and linking groups are provided in Table 7. The non-nucleotide group can be covalently linked to the 3′ and/or 5′ end of either the sense strand and/or the antisense strand. In some embodiments, an APOC3 RNAi agent contains a non-nucleotide group linked to the 3′ and/or 5′ end of the sense strand. In some embodiments, a non-nucleotide group is linked to the 5′ end of an APOC3 RNAi agent sense strand. A non-nucleotide group may be linked directly or indirectly to the RNAi agent via a linker/linking group. In some embodiments, a non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.

    [0275] In some embodiments, a non-nucleotide group enhances the pharmacokinetic or biodistribution properties of an RNAi agent or conjugate to which it is attached to improve cell- or tissue-specific distribution and cell-specific uptake of the RNAi agent or conjugate. In some embodiments, a non-nucleotide group enhances endocytosis of the RNAi agent.

    [0276] Targeting groups or targeting moieties can enhance the pharmacokinetic or biodistribution properties of a conjugate or RNAi agent to which they are attached to improve cell-specific distribution and cell-specific uptake of the conjugate or RNAi agent. A targeting group can be monovalent, divalent, trivalent, tetravalent, or have higher valency for the target to which it is directed. Representative targeting groups include, without limitation, compounds with affinity to cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity to cell surface molecules. In some embodiments, a targeting group is linked to an RNAi agent using a linker, such as a PEG linker or one, two, or three abasic and/or ribitol (abasic ribose) residues, which in some instances can serve as linkers. In some embodiments, a targeting group comprises a galactose-derivative cluster.

    [0277] The APOC3 RNAi agents described herein can be synthesized having a reactive group, such as an amine group, at the 5′-terminus. The reactive group can be used to subsequently attach a targeting group using methods typical in the art.

    [0278] In some embodiments, a targeting group comprises an asialoglycoprotein receptor ligand. As used herein, an asialoglycoprotein receptor ligand is a ligand that contains a compound having affinity for the asialoglycoprotein receptor, which is highly expressed on hepatocytes. In some embodiments, an asialoglycoprotein receptor ligand includes or consists of one or more galactose derivatives. As used herein, the term galactose derivative includes both galactose and derivatives of galactose having affinity for the asialoglycoprotein receptor that is equal to or greater than that of galactose. Galactose derivatives include, but are not limited to: galactose, galactosamine, N-formylgalactosamine, N-acetyl-galactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoylgalactos-amine (see for example: S. T. Iobst and K. Drickamer, J. B. C., 1996, 271, 6686). Galactose derivatives, and clusters of galactose derivatives, that are useful for in vivo targeting of oligonucleotides and other molecules to the liver are known in the art (see, for example, Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945).

    [0279] Galactose derivatives have been used to target molecules to hepatocytes in vivo through their binding to the asialoglycoprotein receptor expressed on the surface of hepatocytes. Binding of asialoglycoprotein receptor ligands to the asialoglycoprotein receptor(s) facilitates cell-specific targeting to hepatocytes and endocytosis of the molecule into hepatocytes. Asialoglycoprotein receptor ligands can be monomeric (e.g., having a single galactose derivative) or multimeric (e.g., having multiple galactose derivatives). The galactose derivative or galactose derivative cluster can be attached to the 3′ or 5′ end of the sense or antisense strand of the RNAi agent using methods known in the art. The preparation of targeting groups, such as galactose derivative clusters, is described in, for example, International Patent Application Publication No. WO 2018/044350 to Arrowhead Pharmaceuticals, Inc., and International Patent Application Publication No. WO 2017/156012 to Arrowhead Pharmaceuticals, Inc., the contents of both of which are incorporated by reference herein in their entirety.

    [0280] As used herein, a galactose derivative cluster comprises a molecule having two to four terminal galactose derivatives. A terminal galactose derivative is attached to a molecule through its C-1 carbon. In some embodiments, the galactose derivative cluster is a galactose derivative trimer (also referred to as tri-antennary galactose derivative or tri-valent galactose derivative). In some embodiments, the galactose derivative cluster comprises N-acetyl-galactosamines. In some embodiments, the galactose derivative cluster comprises three N-acetyl-galactosamines. In some embodiments, the galactose derivative cluster is a galactose derivative tetramer (also referred to as tetra-antennary galactose derivative or tetra-valent galactose derivative). In some embodiments, the galactose derivative cluster comprises four N-acetyl-galactosamines.

    [0281] As used herein, a galactose derivative trimer contains three galactose derivatives, each linked to a central branch point. As used herein, a galactose derivative tetramer contains four galactose derivatives, each linked to a central branch point. The galactose derivatives can be attached to the central branch point through the C-1 carbons of the saccharides. In some embodiments, the galactose derivatives are linked to the branch point via linkers or spacers. In some embodiments, the linker or spacer is a flexible hydrophilic spacer, such as a PEG group (see, for example, U.S. Pat. No. 5,885,968; Biessen et al. J. Med. Chem. 1995 Vol. 39 p. 1538-1546). In some embodiments, the PEG spacer is a PEG3 spacer. The branch point can be any small molecule which permits attachment of three galactose derivatives and further permits attachment of the branch point to the RNAi agent. An example of branch point group is a di-lysine or di-glutamate. Attachment of the branch point to the RNAi agent can occur through a linker or spacer. In some embodiments, the linker or spacer comprises a flexible hydrophilic spacer, such as, but not limited to, a PEG spacer. In some embodiments, the linker comprises a rigid linker, such as a cyclic group. In some embodiments, a galactose derivative comprises or consists of N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster is comprised of a galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.

    [0282] Embodiments of the present disclosure include pharmaceutical compositions for delivering an APOC3 RNAi agent to a liver cell in vivo. Such pharmaceutical compositions can include, for example, an APOC3 RNAi agent conjugated to a galactose derivative cluster.

    [0283] In some embodiments, the galactose derivative cluster is comprised of a galactose derivative trimer, which can be, for example, an N-acetyl-galactosamine trimer, or galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.

    [0284] Targeting groups include, but are not limited to, (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s as defined in Table 7. Other targeting groups, including galactose cluster targeting ligands, are known in the art.

    [0285] In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent linkage of the agent to a targeting group or delivery polymer or delivery vehicle. The linking group can be linked to the 3′ or the 5′ end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group is linked to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5′ or 3′ end of an RNAi agent sense strand. In some embodiments, a linking group is conjugated to the 5′ end of an RNAi agent sense strand. Examples of linking groups, can include, but are not limited to: reactive groups such a primary amines and alkynes, alkyl groups, abasic nucleotides, ribitol (abasic ribose), and/or PEG groups.

    [0286] A linker or linking group is a connection between two atoms that links one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting group or delivery polymer) or segment of interest via one or more covalent bonds. A labile linkage contains a labile bond. A linkage may optionally include a spacer that increases the distance between the two joined atoms. A spacer can further add flexibility and/or length to the linkage. Spacers can include, but are not be limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups; each of which can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art and the preceding list is not meant to limit the scope of the description.

    [0287] Any of the APOC3 RNAi agent nucleotide sequences listed in Tables 2, 3, 4, or 5, whether modified or unmodified, may contain 3′ or 5′ targeting group or linking group. Any of the APOC3 RNAi agent sequences listed in Table 4 or 5 which contain a 3′ or 5′ targeting group or linking group, may alternatively contain no 3′ or 5′ targeting group or linking group, or may contain a different 3′ or 5′ targeting group or linking group including, but not limited to, those depicted in Table 7. Any of the APOC3 RNAi agent duplexes listed in Table 2, Table 3, or Table 6, whether modified or unmodified, may further comprise a targeting group or linking group, including, but not limited to, those depicted in Table 7, and the targeting group or linking group may be attached to the 3′ or 5′ terminus of either the sense strand or the antisense strand of the APOC3 RNAi agent duplex.

    [0288] Examples of targeting groups and linking groups are provided in Table 7. Table 5 provides several embodiments of APOC3 RNAi agent sense strands having a targeting group or linking group linked to the 5′ or 3′ end.

    TABLE-US-00021 TABLE 7 Structures Representing Various Modified Nucleotides, Targeting Groups, and Linking Groups. [00001]embedded image vpdT [00002]embedded image 5Me-Gf [00003]embedded image cPrpTM [00004]embedded image (cPrp)u [00005]embedded image cPrpus [00006]embedded image sp [00007]embedded image D2u [00008]embedded image D2us [00009]embedded image pD2u [00010]embedded image pD2us [00011]embedded image a_2N [00012]embedded image a_2Ns [00013]embedded image pu_2N [00014]embedded image pu_2Ns [00015]embedded image mCM [00016]embedded image mCMs [00017]embedded image a_2N [00018]embedded image a_2Ns [00019]embedded image pu_2N [00020]embedded image pu_2Ns [00021]embedded image Npus [00022]embedded image Nus [00023]embedded image epTM [00024]embedded image epTcPr When positioned internally in oligonucleotide: linkage towards 5′ end of oligonucleotide [00025]embedded image linkage towards 3′ end of oligonucleotide (invAb) When positioned internally in oligonucleotide: linkage towards 5′ end of oligonucleotide [00026]embedded image linkage towards 3′ end of oligonucleotide (invAb)s When positioned at the 3′ terminal end of oligonucleotide: linkage towards 5′ end of oligonucleotide [00027]embedded image (invAb) [00028]embedded image (PAZ) [00029]embedded image (NAG13) [00030]embedded image (NAG13)s [00031]embedded image (NAG18) [00032]embedded image (NAG18)s [00033]embedded image (NAG24) [00034]embedded image (NAG24)s [00035]embedded image (NAG25) [00036]embedded image (NAG25)s [00037]embedded image (NAG26) [00038]embedded image (NAG26)s [00039]embedded image (NAG27) [00040]embedded image (NAG27)s [00041]embedded image (NAG28) [00042]embedded image (NAG28)s [00043]embedded image (NAG29) [00044]embedded image (NAG29)s [00045]embedded image (NAG30) [00046]embedded image (NAG30)s [00047]embedded image (NAG31) [00048]embedded image (NAG31)s [00049]embedded image (NAG32) [00050]embedded image (NAG32)s [00051]embedded image (NAG33) [00052]embedded image (NAG33)s [00053]embedded image (NAG34) [00054]embedded image (NAG34)s [00055]embedded image (NAG35) [00056]embedded image (NAG35)s [00057]embedded image (NAG36) [00058]embedded image (NAG36)s [00059]embedded image (NAG37) [00060]embedded image (NAG37)s [00061]embedded image (NAG 38) [00062]embedded image (NAG 38)s [00063]embedded image (NAG39) [00064]embedded image (NAG39)s

    [0289] In each of the above structures in Table 7, NAG comprises an N-acetyl-galactosamine or another galactose derivative, as would be understood by a person of ordinary skill in the art to be attached in view of the structures above and description provided herein. For example, in some embodiments, NAG in the structures provided in Table 7 is represented by the following structure:

    ##STR00065##

    [0290] Each (NAGx) may be attached to an APOC3 RNAi agent via a phosphate group (as in (NAG25), (NAG30), and (NAG31)), or a phosphorothioate group, (as is (NAG25)s, (NAG29)s, (NAG30)s, (NAG31)s, or (NAG37)s), or another linking group.

    ##STR00066##

    [0291] Other linking groups known in the art may be used.

    [0292] In some embodiments, a delivery vehicle can be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves delivery of the RNAi agent to a cell or tissue. A delivery vehicle can include, or consist of, but is not limited to: a polymer, such as an amphipathic polymer, a membrane active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane active polyamine. In some embodiments, the RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs or other delivery systems available in the art. The RNAi agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, for example WO 2000/053722, WO 2008/0022309, WO 2011/104169, and WO 2012/083185, WO 2013/032829, WO 2013/158141, each of which is incorporated herein by reference), or other delivery systems available in the art.

    Pharmaceutical Compositions and Formulations

    [0293] The APOC3 RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations. In some embodiments, pharmaceutical compositions include at least one APOC3 RNAi agent. These pharmaceutical compositions are particularly useful in the inhibition of the expression of the target mRNA in a target cell, a group of cells, a tissue, or an organism. The pharmaceutical compositions can be used to treat a subject having a disease or disorder that would benefit from reduction in the level of the target mRNA, or inhibition in expression of the target gene. The pharmaceutical compositions can be used to treat a subject at risk of developing a disease, disorder, or condition that would benefit from reduction of the level of the target mRNA or an inhibition in expression the target gene. In one embodiment, the method includes administering an APOC3 RNAi agent linked to a targeting ligand as described herein, to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and/or delivery polymers) are added to the pharmaceutical compositions including an APOC3 RNAi agent, thereby forming a pharmaceutical formulation suitable for in vivo delivery to a subject, including a human.

    [0294] The pharmaceutical compositions that include an APOC3 RNAi agent and methods disclosed herein may decrease the level of the target mRNA in a cell, group of cells, group of cells, tissue, or subject, including: administering to the subject a therapeutically effective amount of a herein described APOC3 RNAi agent, thereby inhibiting the expression of APOC3 mRNA in the subject. In some embodiments, the subject has been previously identified as having a pathogenic upregulation of the target gene in the targeted cell or tissue.

    [0295] In some embodiments, the described pharmaceutical compositions including an APOC3 RNAi agent are used for treating or managing clinical presentations associated with elevated TG levels and/or over-expression of APOC3 mRNA in a subject. In some embodiments, a therapeutically (including prophylactically) effective amount of one or more of pharmaceutical compositions is administered to a subject in need of such treatment (including the prevention or management of symptoms, diseases, or disorders). In some embodiments, administration of any of the disclosed APOC3 RNAi agents can be used to decrease the number, severity, and/or frequency of symptoms of a disease in a subject.

    [0296] The described pharmaceutical compositions including an APOC3 RNAi agent can be used to treat at least one symptom in a subject having a disease or disorder that would benefit from reduction or inhibition in expression of APOC3 mRNA. In some embodiments, the subject is administered a therapeutically effective amount of one or more pharmaceutical compositions including an APOC3 RNAi agent thereby treating the symptom. In other embodiments, the subject is administered a prophylactically effective amount of one or more APOC3 RNAi agents, thereby preventing the at least one symptom.

    [0297] The route of administration is the path by which an APOC3 RNAi agent is brought into contact with the body. In general, methods of administering drugs and oligonucleotides and nucleic acids for treatment of a mammal are well known in the art and can be applied to administration of the compositions described herein. The APOC3 RNAi agents disclosed herein can be administered via any suitable route in a preparation appropriately tailored to the particular route. Thus, herein described pharmaceutical compositions can be administered by injection, for example, intravenously, intramuscularly, intracutaneously, subcutaneously, intraarticularly, or intraperitoneally. In some embodiments, the herein described pharmaceutical compositions are administered via subcutaneous injection.

    [0298] The pharmaceutical compositions including an APOC3 RNAi agent described herein can be delivered to a cell, group of cells, tissue, or subject using oligonucleotide delivery technologies known in the art. In general, any suitable method recognized in the art for delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be by local administration, (e.g., direct injection, implantation, or topical administering), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by subcutaneous or intravenous infusion or injection.

    [0299] Accordingly, in some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

    [0300] As used herein, a pharmaceutical composition or medicament includes a pharmacologically effective amount of at least one of the described therapeutic compounds and one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients (excipients) are substances other than the Active Pharmaceutical Ingredient (API, therapeutic product, e.g., APOC3 RNAi agent) that are intentionally included in the drug delivery system. Excipients do not exert or are not intended to exert a therapeutic effect at the intended dosage. Excipients may act to a) aid in processing of the drug delivery system during manufacture, b) protect, support or enhance stability, bioavailability or patient acceptability of the API, c) assist in product identification, and/or d) enhance any other attribute of the overall safety, effectiveness, of delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.

    [0301] Excipients include, but are not limited to: absorption enhancers, anti-adherents, anti-foaming agents, anti-oxidants, binders, buffering agents, carriers, coating agents, colors, delivery enhancers, delivery polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavors, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickening agents, tonicity agents, vehicles, water-repelling agents, and wetting agents.

    [0302] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® ELTM (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). Suitable carriers should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

    [0303] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation include vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

    [0304] Formulations suitable for intra-articular administration can be in the form of a sterile aqueous preparation of the drug that can be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems can also be used to present the drug for both intra-articular and ophthalmic administration.

    [0305] The active compounds can be prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.

    [0306] The APOC3 RNAi agents can be formulated in compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the disclosure are dictated by and directly dependent on the unique characteristics of the active compound and the therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.

    [0307] A pharmaceutical composition can contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to: anti-pruritics, astringents, local anesthetics, analgesics, antihistamines, or anti-inflammatory agents (e.g., acetaminophen, NSAIDs, diphenhydramine, etc.). It is also envisioned that cells, tissues or isolated organs that express or comprise the herein defined RNAi agents may be used as “pharmaceutical compositions.” As used herein, “pharmacologically effective amount,” “therapeutically effective amount,” or simply “effective amount” refers to that amount of an RNAi agent to produce a pharmacological, therapeutic or preventive result.

    [0308] In some embodiments, the methods disclosed herein further comprise the step of administering a second therapeutic or treatment in addition to administering an RNAi agent disclosed herein. In some embodiments, the second therapeutic is another APOC3 RNAi agent (e.g., an APOC3 RNAi agent which targets a different sequence within the APOC3 target). In other embodiments, the second therapeutic can be a small molecule drug, an antibody, an antibody fragment, or an aptamer.

    [0309] Generally, an effective amount of an active compound will be in the range of from about 0.1 to about 100 mg/kg of body weight/day, e.g., from about 1.0 to about 50 mg/kg of body weight/day. In some embodiments, an effective amount of an active compound will be in the range of from about 0.25 to about 5 mg/kg of body weight per dose. In some embodiments, an effective amount of an active ingredient will be in the range of from about 0.5 to about 4 mg/kg of body weight per dose. The amount administered will also likely depend on such variables as the overall health status of the patient, the relative biological efficacy of the compound delivered, the formulation of the drug, the presence and types of excipients in the formulation, and the route of administration. Also, it is to be understood that the initial dosage administered can, in some instances, be increased beyond the above upper level in order to rapidly achieve the desired blood-level or tissue level, or the initial dosage can, in some instances, be smaller than the optimum.

    [0310] For treatment of disease or for formation of a medicament or composition for treatment of a disease, the pharmaceutical compositions described herein including an APOC3 RNAi agent can be combined with an excipient or with a second therapeutic agent or treatment including, but not limited to: a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, peptide and/or a aptamer.

    [0311] The described APOC3 RNAi agents, when added to pharmaceutically acceptable excipients or adjuvants, can be packaged into kits, containers, packs, or dispensers. The pharmaceutical compositions described herein may be packaged in pre-filled syringes or vials.

    Methods of Treatment and Inhibition of Expression

    [0312] The APOC3 RNAi agents disclosed herein can be used to treat a subject (e.g., a human or other mammal) having a disease or disorder that would benefit from administration of the compound. In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) having a disease or disorder that would benefit from a reduction and/or an inhibition in expression of APOC3 mRNA, for example, a subject that has been diagnosed with or is at risk of developing symptoms related to obesity, hyperlipidemia, hypertriglyceridemia, abnormal lipid and/or cholesterol metabolism, atherosclerosis, cardiovascular disease, coronary artery disease, hypertriglyceridemia mediated pancreatitis, metabolic syndrome, type II diabetes mellitus, familial chylomicronemia syndrome, familial partial lipodystrophy, and/or other metabolic-related disorders and diseases.

    [0313] The subject is administered a therapeutically effective amount of any one or more RNAi agents. The subject can be a human, patient, or human patient. The subject may be an adult, adolescent, child, or infant. Administration of a pharmaceutical composition described herein can be to a human being or animal.

    [0314] In some embodiments, the APOC3 RNAi agents described herein are used to treat a subject with an APOC3-related disease or disorder. In some embodiments, the APOC3 RNAi agents described herein are used to treat a subject that would benefit from a reduction and/or inhibition of APOC3 gene expression. In some embodiments, the described APOC3 RNAi agents are used to treat (including prophylactically) at least one symptom or pathological stated mediated at least in part by APOC3 gene expression. The subject is administered a therapeutically effective amount of any one or more of the described RNAi agents. In some embodiments, the subject is administered a prophylactically effective amount of any one or more of the described RNAi agents, thereby preventing the at least one symptom.

    [0315] In certain embodiments, the present invention provides methods for treatment of diseases, disorders, conditions, or pathological states mediated at least in part by APOC3 expression, in a patient in need thereof, wherein the methods include administering to the patient any of the APOC3 RNAi agents described herein.

    [0316] In some embodiments, the APOC3 RNAi agents are used to treat or manage a clinical presentation of a subject with an APOC3-related disease or disorder. The subject is administered a therapeutically effective amount of one or more of the APOC3 RNAi agents or APOC3 RNAi agent-containing compositions described herein. In some embodiments, the method comprises administering a composition comprising an APOC3 RNAi agent described herein to a subject to be treated.

    [0317] In some embodiments, the gene expression level and/or mRNA level of an APOC3 gene in a subject to whom a described APOC3 RNAi agent is administered is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the APOC3 RNAi agent or to a subject not receiving the APOC3 RNAi agent. The gene expression level and/or mRNA level in the subject is reduced in a cell, group of cells, and/or tissue of the subject.

    [0318] In some embodiments, the protein level of APOC3 in a subject to whom a described APOC3 RNAi agent has been administered is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the APOC3 RNAi agent or to a subject not receiving the APOC3 RNAi agent. The protein level in the subject is reduced in a cell, group of cells, tissue, blood, and/or other fluid of the subject.

    [0319] In some embodiments, the triglyceride (TG) levels in a subject to whom a described APOC3 RNAi agent has been administered is reduced by at least about 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the APOC3 RNAi agent or to a subject not receiving the APOC3 RNAi agent. The TG level in the subject may be reduced in a cell, group of cells, tissue, blood, and/or other fluid of the subject.

    [0320] In some embodiments, the total cholesterol levels in a subject to whom a described APOC3 RNAi agent has been administered is reduced by at least about 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the APOC3 RNAi agent or to a subject not receiving the APOC3 RNAi agent. In some embodiments, the low-density lipoprotein (LDL) cholesterol levels in a subject to whom a described APOC3 RNAi agent has been administered is reduced by at least about 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the APOC3 RNAi agent or to a subject not receiving the APOC3 RNAi agent. The total cholesterol levels and/or LDL cholesterol levels in the subject may be reduced in a cell, group of cells, tissue, blood, and/or other fluid of the subject.

    [0321] A reduction in gene expression, mRNA, APOC3 protein levels, TG levels, cholesterol levels, and LDL cholesterol levels can be assessed by any methods known in the art. As used herein, a reduction or decrease in APOC3 mRNA level and/or protein level are collectively referred to herein as a reduction or decrease in APOC3 or inhibiting or reducing or knocking down the expression of APOC3. The Examples set forth herein illustrate known methods for assessing inhibition of APOC3 gene expression.

    [0322] Cells, Tissues, Organs, and Non-Human Organisms

    [0323] Cells, tissues, organs, and non-human organisms that include at least one of the APOC3 RNAi agents described herein are contemplated. The cell, tissue, organ, or non-human organism is made by delivering the RNAi agent to the cell, tissue, organ, or non-human organism.

    [0324] The above provided embodiments and items are now illustrated with the following, non-limiting examples.

    EXAMPLES

    Example 1. Synthesis of APOC3 RNAi Agents

    [0325] APOC3 RNAi agent duplexes shown in Table 3 and Table 6, above, were synthesized in accordance with the following general procedures:

    [0326] A. Synthesis. The sense and antisense strands of the APOC3 RNAi agents were synthesized according to phosphoramidite technology on solid phase used in oligonucleotide synthesis. Depending on the scale, either a MerMade96E® (Bioautomation), a MerMade12® (Bioautomation), or an OP Pilot 100 (GE Healthcare) was used. Syntheses were performed on a solid support made of controlled pore glass (CPG, 500 Å or 600 Å, obtained from Prime Synthesis, Aston, Pa., USA). All RNA and 2′-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, Wis., USA). Specifically, the following 2′-O-methyl phosphoramidites were used: (5′-O-dimethoxytrityl-N.sup.6-(benzoyl)-2′-O-methyl-adenosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, 5′-O-dimethoxy-trityl-N.sup.4-(acetyl)-2′-O-methyl-cytidine-3′-O-(2-cyanoethyl-N,N-diisopropyl-amino) phosphoramidite, (5′-O-dimethoxytrityl-N.sup.2-(isobutyryl)-2′-O-methyl-guanosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, and 5′-O-dimethoxytrityl-2′-O-methyl-uridine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite. The 2′-deoxy-2′-fluoro-phosphoramidites carried the same protecting groups as the 2′-O-methyl amidites. 5′-dimethoxytrityl-2′-O-methyl-inosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites were purchased from Glen Research (Virginia) or Hongene Biotech. The inverted abasic (3′-O-dimethoxytrityl-2′-deoxyribose-5′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites were purchased from ChemGenes (Wilmington, Mass., USA). 5′-(4,4′-Dimethoxytrityl)-2′,3′-seco-uridine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite was also purchased from Thermo Fisher Scientific or Hongene Biotech. The 5′-O-dimethoxytrityl-N.sup.2,N.sup.6-(phenoxyacetate)-2′-O-methyl-diaminopurine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was obtained from ChemGenes or Hongene Biotech.

    [0327] Targeting ligand containing phosphoramidites were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidites were dissolved in anhydrous acetonitrile (50 mM), or anhydrous dimethylformamide and molecular sieves (3 Å) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-Ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as activator solution. Coupling times were 12 min (RNA), 15 min (targeting ligand), 90 sec (2′OMe), and 60 sec (2′F). In order to introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl 1,2,4-dithiazoline-5-one (POS, obtained from PolyOrg, Inc., Leominster, Mass., USA) in anhydrous Acetonitrile was employed. Unless specifically identified as a “naked” RNAi agent having no targeting ligand present, each of the APOC3 RNAi agent duplexes synthesized and tested in the following Examples utilized N-acetyl-galactosamine as “NAG” in the targeting ligand chemical structures represented in Table 7.

    [0328] B. Cleavage and deprotection of support bound oligomer. After finalization of the solid phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt. % methylamine in water and 28% ammonium hydroxide solution (Aldrich) for 1.5 hours at 30° C. The solution was evaporated and the solid residue was reconstituted in water (see below).

    [0329] C. Purification. Crude oligomers were purified by anionic exchange HPLC using a TSKgel SuperQ-5PW 13 μm column and Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0 and contained 20% Acetonitrile and buffer B was the same as buffer A with the addition of 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled then run on size exclusion HPLC using a GE Healthcare XK 26/40 column packed with Sephadex G-25 fine with a running buffer of filtered DI water or 100 mM ammonium bicarbonate, pH 6.7 and 20% Acetonitrile.

    [0330] D. Annealing. Complementary strands were mixed by combining equimolar RNA solutions (sense and antisense) in 1× Phosphate-Buffered Saline (Corning, Cellgro) to form the RNAi agents. Some RNAi agents were lyophilized and stored at −15 to −25° C. Duplex concentration was determined by measuring the solution absorbance on a UV-Vis spectrometer in 1× Phosphate-Buffered Saline. The solution absorbance at 260 nm was then multiplied by a conversion factor and the dilution factor to determine the duplex concentration. Unless otherwise stated, all conversion factor was 0.037 mg/(mL-cm). For some experiments, a conversion factor was calculated from an experimentally determined extinction coefficient.

    Example 2. In Vitro Testing of APOC3 RNAi Agents

    [0331] Candidate sequence duplexes shown in Table 3, above, were tested in vitro. The APOC3 RNAi agents were prepared in accordance with the procedures set forth in Example 1.

    [0332] Evaluation of APOC3 RNAi agents in vitro was performed by transfection of HuH7 cells, a human hepatocellular carcinoma line. Cells were plated at ˜7,500 cells per well in 96-well format, and each of the 65 APOC3 RNAi agent duplexes shown in Table 3 was transfected at three concentrations (10 nM, 1 nM, and 0.1 nM), using LipoFectamine RNAiMax (Thermo Fisher) transfection reagent. Relative expression of each of the APOC3 RNAi agents was determined by qRT-PCR by comparing the expression levels of APOC3 mRNA to an endogenous control, and normalized to untreated HuH7 cells (ΔΔC.sub.T analysis), as shown in Table 8. Thus, for Duplex ID No. 56_1, average relative expression at 1 nM of 0.126 shows APOC3 gene knockdown of 87.4%.

    TABLE-US-00022 TABLE 8 In Vitro Testing of APOC3 RNAi Agents. Duplex Avg. Rel. High Low Avg. Rel. High Low Avg. Rel. High Low ID No. Exp. 10 nM (error) (error) Exp. 1 nM (error) (error) Exp. 0.1 nM (error) (error)  56_1 0.081 0.013 0.016 0.126 0.033 0.045 0.249 0.083 0.125  56_2 0.076 0.014 0.017 0.116 0.027 0.035 0.190 0.060 0.088  56_3 0.084 0.016 0.020 0.124 0.028 0.036 0.313 0.114 0.179  56_4 0.098 0.023 0.031 0.155 0.045 0.063 0.534 0.122 0.157  56_5 0.100 0.026 0.034 0.138 0.029 0.036 0.511 0.161 0.236  58_1 0.130 0.028 0.035 0.237 0.021 0.023 0.713 0.177 0.235  58_2 0.118 0.018 0.021 0.319 0.039 0.045 0.602 0.058 0.064  58_3 0.070 0.011 0.013 0.152 0.018 0.020 0.383 0.025 0.026  58_4 0.069 0.012 0.015 0.168 0.022 0.025 0.453 0.031 0.034  58_5 0.062 0.009 0.011 0.189 0.047 0.062 0.557 0.045 0.049 228_1 0.055 0.011 0.014 0.377 0.039 0.043 0.684 0.043 0.046 228_2 0.096 0.011 0.013 0.472 0.040 0.043 0.720 0.074 0.083 228_3 0.143 0.023 0.027 0.525 0.021 0.022 0.804 0.035 0.036 228_4 0.115 0.018 0.022 0.518 0.036 0.038 0.740 0.029 0.030 228_5 0.165 0.029 0.035 0.547 0.040 0.043 0.721 0.036 0.038 235_1 0.142 0.025 0.030 0.566 0.045 0.049 0.737 0.035 0.036 235_2 0.064 0.013 0.016 0.370 0.030 0.033 0.713 0.042 0.045 235_3 0.029 0.008 0.011 0.085 0.015 0.018 0.535 0.048 0.053 235_4 0.050 0.010 0.012 0.197 0.018 0.019 0.652 0.045 0.048 235_5 0.079 0.019 0.025 0.328 0.043 0.050 0.719 0.113 0.134 243_1 0.044 0.012 0.017 0.222 0.046 0.058 0.671 0.114 0.137 243_2 0.035 0.008 0.011 0.358 0.041 0.047 0.701 0.068 0.076 243_3 0.022 0.007 0.009 0.142 0.033 0.042 0.567 0.070 0.080 243_4 0.016 0.007 0.013 0.115 0.018 0.021 0.502 0.073 0.086 243_5 0.039 0.011 0.016 0.123 0.019 0.022 0.597 0.050 0.055 260_1 0.021 0.007 0.011 0.390 0.062 0.074 0.719 0.034 0.035 260_2 0.042 0.008 0.010 0.728 0.062 0.068 0.719 0.042 0.045 260_3 0.026 0.008 0.012 0.747 0.067 0.073 0.685 0.044 0.047 260_4 0.021 0.009 0.015 0.507 0.064 0.073 0.749 0.064 0.070 260_5 0.057 0.014 0.019 0.572 0.040 0.043 0.745 0.051 0.054 261_1 0.046 0.007 0.008 0.295 0.039 0.045 0.766 0.044 0.046 261_2 0.052 0.017 0.024 0.611 0.037 0.039 0.823 0.050 0.053 261_3 0.032 0.007 0.009 0.303 0.025 0.028 0.727 0.024 0.025 261_4 0.027 0.005 0.007 0.756 0.031 0.032 0.690 0.032 0.033 261_5 0.041 0.005 0.006 0.868 0.099 0.112 0.737 0.031 0.032 270_1 0.031 0.006 0.008 0.294 0.052 0.063 0.719 0.046 0.049 270_2 0.055 0.015 0.020 0.344 0.066 0.082 0.738 0.036 0.038 270_3 0.047 0.014 0.019 0.359 0.019 0.020 0.811 0.028 0.029 270_4 0.023 0.005 0.006 0.212 0.019 0.021 0.706 0.034 0.035 270_5 0.027 0.007 0.010 0.615 0.030 0.032 0.685 0.036 0.038 272_1 0.046 0.011 0.015 0.398 0.024 0.025 0.696 0.015 0.015 272_2 0.057 0.012 0.015 0.343 0.030 0.033 0.719 0.059 0.064 272_3 0.071 0.010 0.012 0.269 0.034 0.039 0.736 0.034 0.036 272_4 0.061 0.018 0.026 0.135 0.016 0.018 0.747 0.041 0.044 272_5 0.089 0.023 0.031 0.322 0.025 0.027 0.793 0.029 0.030 273_1 0.014 0.004 0.006 0.066 0.019 0.026 0.665 0.043 0.046 273_2 0.016 0.004 0.005 0.064 0.012 0.015 0.676 0.040 0.042 273_3 0.012 0.003 0.005 0.041 0.007 0.008 0.606 0.041 0.044 273_4 0.016 0.003 0.004 0.060 0.009 0.011 0.687 0.036 0.038 273_5 0.024 0.004 0.004 0.101 0.008 0.009 0.736 0.055 0.059 349_1 0.044 0.007 0.009 0.196 0.017 0.018 0.711 0.091 0.104 349_2 0.054 0.017 0.025 0.226 0.015 0.016 0.820 0.058 0.063 349_3 0.031 0.012 0.020 0.157 0.019 0.021 0.761 0.073 0.081 349_4 0.033 0.013 0.022 0.148 0.015 0.017 0.810 0.096 0.108 349_5 0.043 0.016 0.024 0.214 0.013 0.014 0.853 0.077 0.084 434_1 0.074 0.008 0.009 0.147 0.019 0.021 0.860 0.044 0.047 434_2 0.031 0.004 0.005 0.055 0.012 0.016 0.390 0.080 0.101 434_3 0.026 0.003 0.004 0.053 0.011 0.015 0.418 0.015 0.016 434_4 0.020 0.004 0.005 0.085 0.023 0.032 0.488 0.018 0.019 434_5 0.024 0.002 0.002 0.096 0.024 0.032 0.661 0.039 0.042 437_1 0.028 0.005 0.006 0.073 0.022 0.031 0.689 0.033 0.034 437_2 0.046 0.006 0.006 0.150 0.037 0.049 0.798 0.030 0.031 437_3 0.044 0.005 0.005 0.043 0.006 0.007 0.591 0.023 0.024 437_4 0.023 0.004 0.006 0.030 0.005 0.006 0.759 0.033 0.035 437_5 0.024 0.002 0.003 0.061 0.006 0.006 0.750 0.048 0.051

    Example 3. APOC3-SEAP Mouse Model

    [0333] Six to eight week old female C57BL/6 albino mice were transiently transfected in vivo with plasmid by hydrodynamic tail vein injection, administered at least 15 days prior to administration of an APOC3 RNAi agent or control. The plasmid contains the APOC3 cDNA sequence (GenBank NM_000040.1 (SEQ ID NO:1)) inserted into the 3′ UTR of the SEAP (secreted human placental alkaline phosphatase) reporter gene. 50 μg of the plasmid containing the APOC3 cDNA sequence in Ringer's Solution in a total volume of 10% of the animal's body weight was injected into mice via the tail vein to create APOC3-SEAP model mice. The solution was injected through a 27-gauge needle in 5-7 seconds as previously described (Zhang G et al., “High levels of foreign gene expression in hepatocytes after tail vein injection of naked plasmid DNA.” Human Gene Therapy 1999 Vol. 10, p1735-1737.). Inhibition of expression of APOC3 by an APOC3 RNAi agent results in concomitant inhibition of SEAP expression, which is measured. At day −1, SEAP expression levels in serum were measured by the Phospha-Light™ SEAP Reporter Gene Assay System (Invitrogen), and the mice were grouped according to average SEAP levels.

    [0334] Analyses: SEAP levels may be measured at various times, both before and after administration of APOC3 RNAi agents.

    [0335] i) Serum collection: Mice were anesthetized with 2-3% isoflurane and blood samples were collected from the submandibular area into serum separation tubes (Sarstedt AG & Co., Numbrecht, Germany). Blood was allowed to coagulate at ambient temperature for 20 min. The tubes were centrifuged at 8,000×g for 3 min to separate the serum and stored at 4° C.

    [0336] ii) Serum SEAP levels: Serum was collected and measured by the Phospha-Light™ SEAP Reporter Gene Assay System (Invitrogen) according to the manufacturer's instructions. Serum SEAP levels for each animal was normalized to the control group of mice injected with saline in order to account for the non-treatment related decline in APOC3 expression with this model. First, the SEAP level for each animal at a time point was divided by the pre-treatment level of expression in that animal (Day −1) in order to determine the ratio of expression “normalized to pre-treatment”. Expression at a specific time point was then normalized to the control group by dividing the “normalized to pre-treatment” ratio for an individual animal by the average “normalized to pre-treatment” ratio of all mice in the normal saline control group. Alternatively, in some Examples set forth herein, the serum SEAP levels for each animal were assessed by normalizing to pre-treatment levels only.

    Example 4. In Vivo Testing of APOC3 RNAi Agents in APOC3-SEAP Mice

    [0337] The APOC3-SEAP mouse model described in Example 3, above, was used. At day 1, each mouse was given a single subcutaneous administration of 200 μl containing either 5 mg/kg (mpk) of an APOC3 RNAi agent, 3 mg/kg of an APOC3 RNAi agent, or 200 μl of phosphate buffered saline without an APOC3 RNAi agent to be used as a control, according to the following Table 9.

    TABLE-US-00023 TABLE 9 Dosing groups of APOC3-SEAP mice of Example 4. Group RNAi Agent and Dose Dosing Regimen A Saline (no RNAi agent) Single injection on day 1 B 5.0 mg/kg AD04812 Single injection on day 1 C 5.0 mg/kg AD04813 Single injection on day 1 D 5.0 mg/kg AD04814 Single injection on day 1 E 3.0 mg/kg AD04814 Single injection on day 1 F 5.0 mg/kg AD04815 Single injection on day 1 G 5.0 mg/kg AD04816 Single injection on day 1 H 3.0 mg/kg AD04816 Single injection on day 1 I 5.0 mg/kg AD04817 Single injection on day 1 J 5.0 mg/kg AD04818 Single injection on day 1 K 5.0 mg/kg AD04819 Single injection on day 1 L 5.0 mg/kg AD04820 Single injection on day 1 M 5.0 mg/kg AD04821 Single injection on day 1

    [0338] Each of the APOC3 RNAi agents included modified nucleotides that were conjugated at the 5′ terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein. (See Tables 4, 5, 6, and 7 for specific modifications and structure information related to the APOC3 RNAi agents).

    [0339] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected on day 8, day 15, day 22, and day 29, and SEAP expression levels were determined pursuant to the procedure set forth in Example 3, above. Data from the experiment is shown in the following Table 10, with Average SEAP reflecting the normalized average value of SEAP:

    TABLE-US-00024 TABLE 10 Average SEAP Normalized to Pre-Treatment and Saline Control in APOC3-SEAP Mice from Example 4. Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID SEAP (+/−) SEAP (+/−) SEAP (+/−) SEAP (+/−) Group A (Saline) 1.000 0.157 1.000 0.603 1.000 0.864 1.000 0.701 Group B (5.0 mg/kg AD04812) 0.112 0.009 0.112 0.009 0.047 0.014 0.089 0.032 Group C (5.0 mg/kg AD04813) 0.091 0.009 0.046 0.015 0.052 0.019 0.102 0.045 Group D (5.0 mg/kg AD04814) 0.065 0.023 0.045 0.016 0.039 0.017 0.073 0.027 Group E (3.0 mg/kg AD04814) 0.075 0.021 0.041 0.037 0.047 0.046 0.059 0.053 Group F (5.0 mg/kg AD04815) 0.090 0.005 0.032 0.015 0.026 0.012 0.046 0.018 Group G (5.0 mg/kg AD04816) 0.401 0.122 0.399 0.136 0.274 0.053 0.331 0.094 Group H (3.0 mg/kg AD04816) 0.389 0.129 0.292 0.090 0.218 0.070 0.185 0.039 Group I (5.0 mg/kg AD04817) 0.371 0.210 0.266 0.091 0.098 0.014 0.144 0.033 Group J (5.0 mg/kg AD04818) 0.373 0.028 0.467 0.190 0.218 0.153 0.323 0.232 Group K (5.0 mg/kg AD04819) 0.216 0.123 0.334 0.034 0.407 0.053 0.408 0.042 Group L (5.0 mg/kg AD04820) 0.164 0.085 0.226 0.206 0.219 0.165 0.252 0.157 Group M (5.0 mg/kg AD04821) 0.169 0.097 0.128 0.061 0.150 0.105 0.191 0.143

    [0340] Each of the APOC3 RNAi agents in each of the dosing groups (i.e., Groups B through M) showed substantial reduction in SEAP as compared to the saline control (Group A) across all measured time points. For example, APOC3 RNAi agent AD04815 exhibited approximately a 97.4% reduction in SEAP at day 22 after a single 5.0 mg/kg injection (0.026).

    Example 5. APOC3 Transgenic Mouse Model

    [0341] To assess and evaluate the effect of certain other APOC3 RNAi agents in vivo, APOC3 transgenic mice were acquired commercially and used (The Jackson Laboratory, 006907-B6; CBA-Tg(APOC3)3707Bres/J). For APOC3 transgenic mice, human APOC3 protein levels in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.

    [0342] For normalization, the APOC3 level for each animal at a time point was divided by the pre-treatment level of expression in that animal to determine the ratio of expression “normalized to pre-dose”. In some Examples reported herein, the expression at a specific time point was also then normalized to the vehicle control group by dividing the “normalized to pre-dose” ratio for an individual animal by the mean “normalized to pre-dose” ratio of all mice in the vehicle control group. This resulted in expression for each time point normalized to that in the control group.

    [0343] APOC3 levels may be measured at various times, both before and after administration of APOC3 RNAi agents. Unless noted otherwise herein, mice were anesthetized with 2-3% isoflurane and blood samples were collected from the submandibular area into serum separation tubes (Sarstedt AG & Co., Numbrecht, Germany). Blood was allowed to coagulate at ambient temperature for 20 min. The tubes were centrifuged at 8,000×g for 3 min to separate the serum and stored at 4° C.

    Example 6. In Vivo Testing of APOC3 RNAi Agents in APOC3 Transgenic Mice

    [0344] The APOC3 Transgenic Mouse Model described in Example 5, above, was used. At day 1, each mouse was given a single subcutaneous administration of 200 μl of the respective RNAi agent dissolved in D5W (dextrose in 5% water) or control (D5W), which included the dosing groups shown in the following Table 11.

    TABLE-US-00025 TABLE 11 Dosing Groups of APOC3 Transgenic Mice of Example 6. Group RNAi Agent and Dose Dosing Regimen A D5W (no RNAi agent) Single injection on day 1 B 4.0 mg/kg AD05172 Single injection on day 1 C 2.0 mg/kg AD05172 Single injection on day 1 D 1.0 mg/kg AD05172 Single injection on day 1 E 0.5 mg/kg AD05172 Single injection on day 1 F 1.0 mg/kg AD05215 Single injection on day 1 G 1.0 mg/kg AD05216 Single injection on day 1 H 1.0 mg/kg AD05217 Single injection on day 1 I 1.0 mg/kg AD05218 Single injection on day 1 J 1.0 mg/kg AD05171 Single injection on day 1 K 2.0 mg/kg AD05219 Single injection on day 1 L 2.0 mg/kg AD05222 Single injection on day 1 M 2.0 mg/kg AD05221 Single injection on day 1 N 2.0 mg/kg AD05223 Single injection on day 1

    [0345] Each of the APOC3 RNAi agents was conjugated to a targeting ligand that included three N-acetyl-galactosamines (i.e., a tridentate NAG ligand), having the modified sequences and NAG structures as set forth herein. (See Tables 4, 5, 6, and 7 for specific modifications and structure information for the APOC3 RNAi agents used in Example 6).

    [0346] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected from the mice, including on day −1 (pre-dose bleed with a four hour fast), and days 8, 15, 22, and 29. Mice were fasted for four hours prior to each collection. APOC3 expression levels were determined pursuant to the procedure set forth in Example 5, above. Data are shown in the following Table 12, with Average APOC3 reflecting the normalized average value of APOC3 protein expressed in serum:

    TABLE-US-00026 TABLE 12 Average APOC3 Protein Normalized to Pre-Treatment and Vehicle Control (D5W) in APOC3 Transgenic Mice from Example 6. Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID APOC3 (+/−) APOC3 (+/−) APOC3 (+/−) APOC3 (+/−) Group A (D5W) 1.000 0.038 1.000 0.177 1.000 0.154 1.000 0.152 Group B (4.0 mg/kg AD05172) 0.074 0.018 0.067 0.018 0.083 0.008 0.105 0.019 Group C (2.0 mg/kg AD05172) 0.094 0.022 0.084 0.017 0.101 0.013 0.126 0.029 Group D (1.0 mg/kg AD05172) 0.113 0.039 0.115 0.038 0.150 0.050 0.212 0.095 Group E (0.5 mg/kg AD05172) 0.153 0.050 0.191 0.087 0.245 0.102 0.461 0.169 Group F (1.0 mg/kg AD05215) 0.114 0.003 0.124 0.016 0.173 0.037 0.550 0.119 Group G (1.0 mg/kg AD05216) 0.148 0.042 0.136 0.016 0.185 0.031 0.342 0.034 Group H (1.0 mg/kg AD05217) 0.161 0.020 0.179 0.025 0.241 0.048 0.464 0.306 Group I (1.0 mg/kg AD05218) 0.168 0.064 0.210 0.127 0.517 0.248 0.779 0.418 Group J (1.0 mg/kg AD05171) 0.125 0.039 0.126 0.043 0.165 0.050 0.302 0.117 Group K (2.0 mg/kg AD05219) 0.091 0.044 0.070 0.018 0.084 0.025 0.095 0.034 Group L (2.0 mg/kg AD05222) 0.130 0.054 0.230 0.114 0.265 0.147 0.484 0.047 Group M (2.0 mg/kg AD05221) 0.131 0.026 0.148 0.041 0.289 0.126 0.410 0.098 Group N (2.0 mg/kg AD05223) 0.082 0.047 0.062 0.019 0.073 0.021 0.080 0.022

    [0347] Each of the APOC3 RNAi agents in each of the dosing groups (i.e., Groups B through M) showed a reduction in APOC3 as compared to the control (Group A) across the measured time points. For example, after a single 2.0 mg/kg dose on day 1, APOC3 RNAi agent AD05223 showed an approximately 94% reduction (0.062) at day 15.

    Example 7. In Vivo Testing of APOC3 RNAi Agents in APOC3 Transgenic Mice

    [0348] The APOC3 Transgenic Mouse Model described in Example 5, above, was used. At day 1, each mouse was given a single subcutaneous administration of 200 μl of the respective RNAi agent dissolved in D5W (dextrose in 5% water) or control (D5W) according to the dosing groups shown in the following Table 13.

    TABLE-US-00027 TABLE 13 Dosing Groups of APOC3 Transgenic Mice of Example 7. Group RNAi Agent and Dose Dosing Regimen 1 D5W (no RNAi agent) Single injection on day 1 2 1.0 mg/kg AD05172 Single injection on day 1 3 1.0 mg/kg AD05255 Single injection on day 1 4 1.0 mg/kg AD05169 Single injection on day 1 5 1.0 mg/kg AD05249 Single injection on day 1 6 1.0 mg/kg AD05250 Single injection on day 1 7 1.0 mg/kg AD05251 Single injection on day 1 8 1.0 mg/kg AD05252 Single injection on day 1 9 1.0 mg/kg AD05253 Single injection on day 1 10 1.0 mg/kg AD05254 Single injection on day 1 11 1.0 mg/kg AD05220 Single injection on day 1

    [0349] Each of the APOC3 RNAi agents included modified nucleotides that were conjugated at the 5′ terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein. (See Tables 4, 5, 6, and 7 for specific modifications and structure information related to the APOC3 RNAi agents).

    [0350] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3). Serum was collected from the mice, including on day −1 (pre-dose bleed with a four hour fast), and days 8, 15, 22, and 29. Mice were fasted for four hours prior to each collection. APOC3 expression levels were determined pursuant to the procedure set forth in Example 5, above. Data from day 8 of the experiment are shown in the following Table 14, with Average APOC3 reflecting the normalized average value of APOC3 protein expressed in serum:

    TABLE-US-00028 TABLE 14 Average APOC3 Protein Normalized to Pre-Treatment and Vehicle Control (D5W) in APOC3 Transgenic Mice from Example 7. Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID APOC3 (+/−) APOC3 (+/−) APOC3 (+/−) APOC3 (+/−) Group 1 (D5W) 1.000 0.092 1.000 0.096 1.000 0.089 1.000 0.103 Group 2 (1.0 mg/kg AD05172) 0.125 0.033 0.133 0.040 0.175 0.050 0.198 0.061 Group 3 (1.0 mg/kg AD05255) N/A* N/A* 0.279 0.394 0.969 0.050 1.103 0.216 Group 4 (1.0 mg/kg AD05169) 0.179 0.056 0.185 0.067 0.206 0.058 0.245 0.084 Group 5 (1.0 mg/kg AD05249) 0.212 0.045 0.263 0.055 0.460 0.083 0.863 0.586 Group 6 (1.0 mg/kg AD05250) 0.167 0.070 0.146 0.048 0.169 0.062 0.203 0.051 Group 7 (1.0 mg/kg AD05251) 0.140 0.071 0.121 0.077 0.170 0.094 0.181 0.103 Group 8 (1.0 mg/kg AD05252) 0.143 0.045 0.167 0.050 0.184 0.048 0.296 0.088 Group 9 (1.0 mg/kg AD05253) 0.192 0.068 0.202 0.063 0.238 0.096 0.473 0.220 Group 10 (1.0 mg/kg AD05254) 0.184 0.075 0.225 0.075 0.296 0.124 0.294 0.137 Group 11 (1.0 mg/kg AD05220) 0.089 0.012 0.109 0.014 0.107 0.018 0.118 0.027 *samples for Group 3, Day 8 were lost due to equipment failure

    [0351] Each of the APOC3 RNAi agents in each of the dosing groups (i.e., Groups 2 through 11) showed a reduction in APOC3 protein levels as compared to the control (Group 1) at days 8 and 15. In particular, APOC3 RNAi agents AD05251 and AD05169 (each having an antisense strand sequence designed to target position 438 of an APOC3 gene (i.e., SEQ ID NO:1), as well as APOC3 RNA agent AD05220 (having an antisense strand sequence designed to target position 506 of an APOC3 gene), showed particularly potent inhibitory effect. (See, e.g., Groups 4, 7, and 11 in Table 14, above).

    Example 8. In Vivo Testing of APOC3RNAi Agents in APOC3 Transgenic Mice

    [0352] The APOC3 Transgenic Mouse Model described in Example 5, above, was used. At day 1, each mouse was given a single subcutaneous administration of 200 da of the respective RNAi agent dissolved in D5W (dextrose in 50 water) or control (D5W) according to the dosing groups shown in the following Table 13.

    TABLE-US-00029 TABLE 15 Dosing groups of Example 8. Group RNAi Agent and Dose Dosing Regimen 1 D5W (no RNAi agent) Single injection on day 1 2 0.5 mg/kg AD05540 Single injection on day 1 3 0.5 mg/kg AD05283 Single injection on day 1 4 0.5 mg/kg AD05705 Single injection on day 1 5 0.5 mg/kg AD05706 Single injection on day 1 6 0.5 mg/kg AD05707 Single injection on day 1 7 0.5 mg/kg AD05708 Single injection on day 1 8 0.5 mg/kg AD05709 Single injection on day 1 9 0.5 mg/kg AD05251 Single injection on day 1 10 0.5 mg/kg AD05169 Single injection on day 1 11 0.5 mg/kg AD05710 Single injection on day 1 12 0.5 mg/kg AD05711 Single injection on day 1 13 0.5 mg/kg AD05712 Single injection on day 1 14 0.5 mg/kg AD05713 Single injection on day 1 15 0.5 mg/kg AD05220 Single injection on day 1 16 0.5 mg/kg AD05714 Single injection on day 1

    [0353] Each of the APOC3 RNAi agents included modified nucleotides that were conjugated at the 5′ terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein. (See Tables 4, 5, 6, and 7 for specific modifications and structure information related to the APOC3 RNAi agents).

    [0354] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each Group were tested (n=3), except for Group 1 (D5W vehicle) where four (4) mice were tested (n=4). Serum was collected on day −1 (pre-dose bleed with a 4 hour fast), and days 8, and 15, 22, and 29. Mice were fasted for four hours prior to each collection. APOC3 expression levels were determined pursuant to the procedure set forth in Example 5, above. Triglycerides, high-density lipoprotein (HDL), low-density lipoprotein (LDL), and total cholesterol in serum were also measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.

    [0355] The APOC3 protein levels, triglyceride levels, HDL levels, and total cholesterol levels for each animal were normalized. For normalization, the level of APOC3 protein, triglyceride, HDL, LDL, and total cholesterol, respectively, for each animal at a time point, was divided by the pre-treatment level of expression in that animal (in this case at day −1) to determine the ratio of expression “normalized to pre-treatment.” Expression at a specific time point was then normalized to the vehicle control group by dividing the “normalized to pre-treatment” ratio for an individual animal by the mean “normalized to pretreatment” ratio of all mice in the vehicle control group. This resulted in expression for each time point normalized to that in the control group. Data from the experiment are shown in the following Tables 16 through 20:

    TABLE-US-00030 TABLE 16 Average APOC3 Protein Normalized to Pre-Treatment and Vehicle Control (D5W) from Example 8. Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID APOC3 (+/−) APOC3 (+/−) APOC3 (+/−) APOC3 (+/−) Group 1 (D5W) 1.000 0.104 1.000 0.297 1.000 0.343 1.000 0.354 Group 2 (0.5 mg/kg AD05540) 0.196 0.020 0.203 0.044 0.254 0.079 0.370 0.128 Group 3 (0.5 mg/kg AD05283) 0.178 0.077 0.195 0.080 0.282 0.070 0.331 0.038 Group 4 (0.5 mg/kg AD05705) 0.146 0.053 0.150 0.050 0.239 0.080 0.330 0.111 Group 5 (0.5 mg/kg AD05706) 0.153 0.067 0.156 0.076 0.206 0.068 0.309 0.065 Group 6 (0.5 mg/kg AD05707) 0.102 0.030 0.158 0.023 0.227 0.035 0.441 0.160 Group 7 (0.5 mg/kg AD05708) 0.203 0.091 0.211 0.079 0.264 0.098 0.504 0.237 Group 8 (0.5 mg/kg AD05709) 0.213 0.086 0.190 0.078 0.299 0.143 0.467 0.250 Group 9 (0.5 mg/kg AD05251) 0.170 0.062 0.142 0.062 0.138 0.073 0.184 0.061 Group 10 (0.5 mg/kg AD05169) 0.290 0.131 0.320 0.054 0.309 0.039 0.433 0.060 Group 11 (0.5 mg/kg AD05710) 0.379 0.024 0.481 0.146 0.696 0.116 0.790 0.171 Group 12 (0.5 mg/kg AD05711) 0.331 0.028 0.325 0.036 0.334 0.037 0.545 0.238 Group 13 (0.5 mg/kg AD05712) 0.208 0.058 0.223 0.130 0.247 0.132 0.419 0.227 Group 14 (0.5 mg/kg AD05713) 0.216 0.092 0.305 0.131 0.453 0.070 0.646 0.053 Group 15 (0.5 mg/kg AD05220) 0.232 0.104 0.125 0.071 0.205 0.129 0.333 0.192 Group 16 (0.5 mg/kg AD05714) 0.338 0.025 0.259 0.069 0.422 0.012 0.550 0.092

    TABLE-US-00031 TABLE 17 Average Triglycerides Normalized to Pre-Treatment and Vehicle Control (D5W) from Example 8. Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID TG (+/−) TG (+/−) TG (+/−) TG (+/−) Group 1 (D5W) 1.000 0.279 1.000 0.454 1.000 0.423 1.000 0.440 Group 2 (0.5 mg/kg AD05540) 0.232 0.041 0.218 0.072 0.264 0.111 0.370 0.192 Group 3 (0.5 mg/kg AD05283) 0.222 0.154 0.225 0.153 0.319 0.188 0.358 0.117 Group 4 (0.5 mg/kg AD05705) 0.141 0.036 0.123 0.033 0.237 0.088 0.338 0.098 Group 5 (0.5 mg/kg AD05706) 0.154 0.073 0.145 0.093 0.218 0.124 0.316 0.121 Group 6 (0.5 mg/kg AD05707) 0.109 0.049 0.156 0.069 0.184 0.030 0.433 0.267 Group 7 (0.5 mg/kg AD05708) 0.279 0.154 0.259 0.139 0.229 0.118 0.674 0.426 Group 8 (0.5 mg/kg AD05709) 0.283 0.155 0.221 0.134 0.274 0.154 0.606 0.393 Group 9 (0.5 mg/kg AD05251) 0.340 0.248 0.322 0.232 0.294 0.203 0.372 0.262 Group 10 (0.5 mg/kg AD05169) 0.274 0.202 0.306 0.078 0.276 0.062 0.341 0.118 Group 11 (0.5 mg/kg AD05710) 0.360 0.087 0.409 0.197 0.700 0.155 0.707 0.276 Group 12 (0.5 mg/kg AD05711) 0.268 0.096 0.288 0.061 0.293 0.054 0.488 0.248 Group 13 (0.5 mg/kg AD05712) 0.170 0.068 0.171 0.100 0.213 0.127 0.448 0.264 Group 14 (0.5 mg/kg AD05713) 0.183 0.088 0.262 0.148 0.399 0.083 0.581 0.135 Group 15 (0.5 mg/kg AD05220) 0.208 0.121 0.081 0.048 0.280 0.135 0.351 0.263 Group 16 (0.5 mg/kg AD05714) 0.319 0.082 0.242 0.101 0.461 0.059 0.596 0.150

    TABLE-US-00032 TABLE 18 Average Total Cholesterol Normalized to Pre-Treatment and Vehicle Control (D5W) from Example 8. Day 8 Day 15 Day 22 Day 29 Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Group ID Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Group 1 (D5W) 1.000 0.063 1.000 0.370 1.000 0.386 1.000 0.335 Group 2 (0.5 mg/kg AD05540) 0.414 0.103 0.464 0.144 0.483 0.179 0.583 0.214 Group 3 (0.5 mg/kg AD05283) 0.488 0.215 0.498 0.203 0.573 0.197 0.597 0.155 Group 4 (0.5 mg/kg AD05705) 0.377 0.230 0.359 0.205 0.401 0.198 0.429 0.199 Group 5 (0.5 mg/kg AD05706) 0.342 0.108 0.357 0.099 0.360 0.098 0.437 0.091 Group 6 (0.5 mg/kg AD05707) 0.271 0.196 0.294 0.176 0.322 0.176 0.441 0.235 Group 7 (0.5 mg/kg AD05708) 0.435 0.203 0.457 0.203 0.523 0.230 0.629 0.290 Group 8 (0.5 mg/kg AD05709) 0.455 0.233 0.436 0.197 0.454 0.216 0.590 0.321 Group 9 (0.5 mg/kg AD05251) 0.504 0.313 0.554 0.345 0.533 0.327 0.636 0.398 Group 10 (0.5 mg/kg AD05169) 0.544 0.240 0.595 0.285 0.538 0.235 0.578 0.155 Group 11 (0.5 mg/kg AD05710) 0.686 0.138 0.810 0.240 0.916 0.185 0.987 0.242 Group 12 (0.5 mg/kg AD05711) 0.493 0.105 0.457 0.094 0.483 0.076 0.658 0.222 Group 13 (0.5 mg/kg AD05712) 0.414 0.214 0.440 0.258 0.416 0.227 0.556 0.322 Group 14 (0.5 mg/kg AD05713) 0.354 0.148 0.441 0.187 0.557 0.108 0.658 0.014 Group 15 (0.5 mg/kg AD05220) 0.393 0.227 0.418 0.273 0.427 0.288 0.526 0.271 Group 16 (0.5 mg/kg AD05714) 0.632 0.014 0.706 0.011 0.797 0.030 0.932 0.070

    TABLE-US-00033 TABLE 19 Average HDL Normalized to Pre-Treatment and Vehicle Control (D5W) from Example 8. Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID HDL (+/−) HDL (+/−) HDL (+/−) HDL (+/−) Group 1 (D5W) 1.000 0.365 1.000 0.141 1.000 0.100 1.000 0.338 Group 2 (0.5 mg/kg AD05540) 1.489 0.197 1.676 0.305 2.040 0.388 1.629 0.375 Group 3 (0.5 mg/kg AD05283) 2.192 1.116 2.227 1.009 2.859 1.499 1.982 0.785 Group 4 (0.5 mg/kg AD05705) 1.558 0.433 1.531 0.260 1.772 0.334 0.953 0.316 Group 5 (0.5 mg/kg AD05706) 2.248 0.626 2.556 0.938 2.736 0.875 1.878 0.629 Group 6 (0.5 mg/kg AD05707) 1.179 0.038 1.221 0.162 1.352 0.204 1.100 0.266 Group 7 (0.5 mg/kg AD05708) 1.086 0.158 1.187 0.252 1.670 0.203 0.972 0.400 Group 8 (0.5 mg/kg AD05709) 1.251 0.187 1.308 0.280 1.519 0.299 1.000 0.346 Group 9 (0.5 mg/kg AD05251) 1.337 0.326 1.369 0.372 1.961 0.901 1.426 0.438 Group 10 (0.5 mg/kg AD05169) 1.239 0.023 1.050 0.436 1.180 0.633 1.242 0.416 Group 11 (0.5 mg/kg AD05710) 1.169 0.089 1.417 0.356 1.359 0.149 1.244 0.290 Group 12 (0.5 mg/kg AD05711) 1.666 0.481 1.360 0.314 1.607 0.627 1.486 0.824 Group 13 (0.5 mg/kg AD05712) 1.255 0.577 1.214 0.560 1.344 0.587 0.939 0.427 Group 14 (0.5 mg/kg AD05713) 1.324 0.264 1.347 0.402 1.519 0.673 1.047 0.507 Group 15 (0.5 mg/kg AD05220) 0.763 0.345 0.954 0.539 1.042 0.533 0.963 0.093 Group 16 (0.5 mg/kg AD05714) 0.960 0.145 1.099 0.151 1.382 0.108 1.124 0.022

    TABLE-US-00034 TABLE 20 Average LDL Normalized to Pre-Treatment and Vehicle Control (D5W) from Example 8. Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID LDL (+/−) LDL (+/−) LDL (+/−) LDL (+/−) Group 1 (D5W) 1.000 0.314 1.000 0.350 1.000 0.448 1.000 0.268 Group 2 (0.5 mg/kg AD05540) 0.265 0.076 0.318 0.100 0.340 0.104 0.517 0.199 Group 3 (0.5 mg/kg AD05283) 0.404 0.201 0.426 0.209 0.560 0.292 0.596 0.166 Group 4 (0.5 mg/kg AD05705) 0.303 0.245 0.271 0.209 0.315 0.191 0.378 0.224 Group 5 (0.5 mg/kg AD05706) 0.226 0.101 0.272 0.056 0.266 0.052 0.367 0.067 Group 6 (0.5 mg/kg AD05707) 0.160 0.128 0.204 0.146 0.259 0.159 0.337 0.164 Group 7 (0.5 mg/kg AD05708) 0.251 0.130 0.281 0.100 0.459 0.214 0.445 0.137 Group 8 (0.5 mg/kg AD05709) 0.242 0.135 0.230 0.077 0.389 0.209 0.371 0.166 Group 9 (0.5 mg/kg AD05251) 0.467 0.338 0.542 0.351 0.688 0.478 0.836 0.547 Group 10 (0.5 mg/kg AD05169) 0.341 0.064 0.495 0.395 0.396 0.197 0.459 0.106 Group 11 (0.5 mg/kg AD05710) 0.742 0.257 0.997 0.398 0.944 0.357 1.228 0.474 Group 12 (0.5 mg/kg AD05711) 0.526 0.135 0.401 0.116 0.737 0.388 0.919 0.367 Group 13 (0.5 mg/kg AD05712) 0.373 0.156 0.423 0.182 0.440 0.193 0.477 0.294 Group 14 (0.5 mg/kg AD05713) 0.312 0.159 0.370 0.144 0.736 0.194 1.007 0.242 Group 15 (0.5 mg/kg AD05220) 0.369 0.164 0.337 0.204 0.401 0.278 0.465 0.191 Group 16 (0.5 mg/kg AD05714) 0.440 0.062 0.500 0.055 0.710 0.114 0.842 0.229

    [0356] Each of the APOC3 RNAi agents in each of the dosing groups (i.e., Groups 2 through 16) showed a reduction in APOC3 protein levels, triglyceride levels, total cholesterol levels, and LDL levels as compared to the control (Group 1). For example, a single 0.5 mg/kg dose of APOC3 RNAi agent AD05251 (Group 7) showed at day 22 a reduction of approximately 86% of APOC3 protein levels (0.138), a reduction of approximately 70% in triglyceride levels (0.294), a reduction of approximately 47% of total cholesterol levels (0.533), and a reduction of approximately 31% in LDL levels (0.688). Further, as anticipated, on day 22 the administration of AD05251 showed an increase in HDL levels (see, e.g., Table 19 above).

    Example 9. In Vivo Dose Response Testing of APOC3 RNAi Agents in APOC3 Transgenic Mice

    [0357] The APOC3 Transgenic Mouse Model described in Example 5, above, was used. At day 1, each mouse was given a single subcutaneous administration of 200 μl of the respective RNAi agent dissolved in D5W (dextrose in 5% water) or control (D5W) according to the dosing groups shown in the following Table 21:

    TABLE-US-00035 TABLE 21 Dosing groups of Example 9. Group RNAi Agent and Dose Dosing Regimen 1 D5W (no RNAi agent) Single injection on day 1 2 0.01 mg/kg AD05876 Single injection on day 1 3 0.05 mg/kg AD05876 Single injection on day 1 4 0.1 mg/kg AD05876 Single injection on day 1 5 0.25 mg/kg AD05876 Single injection on day 1 6 0.5 mg/kg AD05876 Single injection on day 1 7 1.0 mg/kg AD05876 Single injection on day 1 8 3.0 mg/kg AD05876 Single injection on day 1 9 0.01 mg/kg AD05251 Single injection on day 1 10 0.05 mg/kg AD05251 Single injection on day 1 11 0.1 mg/kg AD05251 Single injection on day 1 12 0.25 mg/kg AD05251 Single injection on day 1 13 0.5 mg/kg AD05251 Single injection on day 1 14 1.0 mg/kg AD05251 Single injection on day 1 15 3.0 mg/kg AD05251 Single injection on day 1

    [0358] Each of the APOC3 RNAi agents included modified nucleotides that were conjugated at the 5′ terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the structure of (NAG37)s. (See Tables 4, 5, 6, and 7 for specific modifications and structure information related to the APOC3 RNAi agents).

    [0359] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Four (4) mice in each Group were tested. Serum was collected on day −1 (pre-dose bleed with a 4 hour fast), and days 8, 15, 22, 29, and 36. Mice were fasted for four hours prior to each collection. APOC3 expression levels, triglycerides, high-density lipoprotein (HDL), low-density lipoprotein (LDL), and total cholesterol in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.

    [0360] The APOC3 protein levels, triglyceride levels, HDL levels, and total cholesterol levels for each animal were normalized. For normalization, the level of APOC3 protein, triglyceride, HDL, LDL, and total cholesterol, respectively, for each animal at a time point, was divided by the pre-treatment level of expression in that animal (in this case at day −1) to determine the ratio of expression “normalized to pre-dose.” Data from the experiment are shown in the following Tables 22 through 26:

    TABLE-US-00036 TABLE 22 Average APOC3 Protein Normalized to Pre-Dose from Example 9. Day 8 Day 15 Day 22 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID APOC3 (+/−) APOC3 (+/−) APOC3 (+/−) APOC3 (+/−) APOC3 (+/−) Group 1 (D5W) 1.205 0.162 1.224 0.145 1.102 0.257 1.011 0.148 1.103 0.133 Group 2 (0.01 mg/kg AD05876) 0.859 0.255 0.970 0.231 1.050 0.101 1.001 0.091 0.990 0.121 Group 3 (0.05 mg/kg AD05876) 0.835 0.048 0.933 0.154 0.919 0.166 1.094 0.259 1.111 0.244 Group 4 (0.1 mg/kg AD05876) 0.472 0.053 0.630 0.047 0.742 0.100 0.798 0.117 0.937 0.064 Group 5 (0.25 mg/kg AD05876) 0.342 0.049 0.423 0.045 0.495 0.056 0.734 0.066 0.812 0.097 Group 6 (0.5 mg/kg AD05876) 0.188 0.030 0.211 0.045 0.289 0.029 0.386 0.047 0.504 0.050 Group 7 (1.0 mg/kg AD05876) 0.164 0.033 0.207 0.036 0.250 0.045 0.332 0.097 0.446 0.152 Group 8 (3.0 mg/kg AD05876) 0.086 0.015 0.110 0.024 0.128 0.037 0.141 0.023 0.157 0.031 Group 9 (0.01 mg/kg AD05251) 1.165 0.101 1.051 0.040 0.955 0.105 1.038 0.033 0.968 0.079 Group 10 (0.05 mg/kg AD05251) 0.675 0.051 0.694 0.056 0.692 0.046 0.836 0.139 0.921 0.087 Group 11 (0.1 mg/kg AD05251) 0.590 0.098 0.478 0.073 0.562 0.067 0.625 0.054 0.686 0.084 Group 12 (0.25 mg/kg AD05251) 0.273 0.067 0.295 0.039 0.354 0.055 0.479 0.137 0.580 0.071 Group 13 (0.5 mg/kg AD05251) 0.219 0.066 0.211 0.045 0.283 0.070 0.291 0.090 0.338 0.085 Group 14 (1.0 mg/kg AD05251) 0.157 0.026 0.143 0.034 0.230 0.067 0.280 0.093 0.310 0.072 Group 15 (3.0 mg/kg AD05251) 0.135 0.033 0.131 0.022 0.164 0.036 0.157 0.048 0.191 0.056

    TABLE-US-00037 TABLE 23 Average Triglycerides Normalized to Pre-Dose from Example 9. Day 8 Day 15 Day 22 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID TG (+/−) TG (+/−) TG (+/−) TG (+/−) TG (+/−) Group 1 (D5W) 1.441 0.335 1.723 0.177 1.253 0.377 1.151 0.301 1.304 0.221 Group 2 (0.01 mg/kg AD05876) 0.988 0.436 1.139 0.421 1.177 0.271 1.209 0.242 1.259 0.325 Group 3 (0.05 mg/kg AD05876) 1.146 0.303 1.321 0.459 0.964 0.355 1.428 0.613 1.275 0.456 Group 4 (0.1 mg/kg AD05876) 0.671 0.176 0.700 0.131 0.912 0.204 0.918 0.265 1.073 0.175 Group 5 (0.25 mg/kg AD05876) 0.391 0.081 0.581 0.174 0.608 0.141 0.960 0.205 0.989 0.196 Group 6 (0.5 mg/kg AD05876) 0.216 0.060 0.202 0.054 0.306 0.092 0.465 0.147 0.493 0.066 Group 7 (1.0 mg/kg AD05876) 0.227 0.099 0.326 0.147 0.366 0.096 0.427 0.150 0.600 0.261 Group 8 (3.0 mg/kg AD05876) 0.090 0.024 0.166 0.037 0.165 0.044 0.184 0.048 0.222 0.037 Group 9 (0.01 mg/kg AD05251) 1.357 0.266 1.197 0.099 1.024 0.129 1.197 0.101 1.118 0.215 Group 10 (0.05 mg/kg AD05251) 0.784 0.137 0.950 0.278 0.725 0.137 1.013 0.270 1.108 0.257 Group 11 (0.1 mg/kg AD05251) 0.634 0.182 0.583 0.110 0.587 0.160 0.641 0.123 0.702 0.172 Group 12 (0.25 mg/kg AD05251) 0.330 0.119 0.397 0.076 0.393 0.042 0.583 0.236 0.614 0.057 Group 13 (0.5 mg/kg AD05251) 0.250 0.084 0.197 0.040 0.283 0.034 0.309 0.102 0.355 0.118 Group 14 (1.0 mg/kg AD05251) 0.213 0.054 0.171 0.073 0.273 0.059 0.384 0.135 0.347 0.079 Group 15 (3.0 mg/kg AD05251) 0.210 0.067 0.172 0.024 0.235 0.089 0.213 0.032 0.263 0.106

    TABLE-US-00038 TABLE 24 Average Total Cholesterol Normalized to Pre-Dose from Example 9. Day 8 Day 15 Day 22 Day 29 Day 36 Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Group ID Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Group 1 (D5W) 1.177 0.079 1.261 0.169 1.161 0.297 1.049 0.188 1.151 0.167 Group 2 (0.01 mg/kg AD05876) 1.020 0.231 1.099 0.186 1.193 0.147 1.132 0.087 1.141 0.157 Group 3 (0.05 mg/kg AD05876) 0.975 0.105 1.003 0.193 1.010 0.192 1.169 0.296 1.160 0.265 Group 4 (0.1 mg/kg AD05876) 0.694 0.115 0.749 0.101 0.851 0.122 0.876 0.155 1.005 0.063 Group 5 (0.25 mg/kg AD05876) 0.670 0.188 0.744 0.229 0.792 0.190 0.953 0.116 0.928 0.157 Group 6 (0.5 mg/kg AD05876) 0.556 0.146 0.600 0.178 0.628 0.127 0.672 0.126 0.768 0.107 Group 7 (1.0 mg/kg AD05876) 0.596 0.081 0.634 0.145 0.664 0.134 0.710 0.101 0.760 0.083 Group 8 (3.0 mg/kg AD05876) 0.547 0.057 0.556 0.104 0.589 0.130 0.564 0.098 0.572 0.101 Group 9 (0.01 mg/kg AD05251) 1.236 0.107 1.142 0.063 1.023 0.139 1.099 0.107 1.106 0.115 Group 10 (0.05 mg/kg AD05251) 0.785 0.083 0.813 0.107 0.784 0.106 0.944 0.147 0.995 0.135 Group 11 (0.1 mg/kg AD05251) 0.721 0.080 0.691 0.068 0.706 0.065 0.737 0.028 0.814 0.060 Group 12 (0.25 mg/kg AD05251) 0.562 0.115 0.617 0.104 0.632 0.081 0.705 0.076 0.777 0.044 Group 13 (0.5 mg/kg AD05251) 0.479 0.055 0.492 0.037 0.540 0.073 0.543 0.098 0.564 0.095 Group 14 (1.0 mg/kg AD05251) 0.634 0.137 0.687 0.163 0.634 0.172 0.669 0.163 0.700 0.174 Group 15 (3.0 mg/kg AD05251) 0.602 0.106 0.611 0.101 0.632 0.121 0.627 0.167 0.594 0.121

    TABLE-US-00039 TABLE 25 Average HDL Normalized to Pre-Dose from Example 9. Day 8 Day 15 Day 22 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID HDL (+/−) HDL (+/−) HDL (+/−) HDL (+/−) HDL (+/−) Group 1 (D5W) 0.883 0.115 0.855 0.013 0.919 0.081 1.070 0.128 0.905 0.109 Group 2 (0.01 mg/kg AD05876) 1.029 0.087 1.086 0.209 0.987 0.191 1.096 0.088 0.969 0.100 Group 3 (0.05 mg/kg AD05876) 0.786 0.184 0.968 0.121 1.052 0.130 0.951 0.252 0.886 0.221 Group 4 (0.1 mg/kg AD05876) 1.129 0.133 1.147 0.098 1.022 0.213 1.109 0.106 0.911 0.177 Group 5 (0.25 mg/kg AD05876) 1.280 0.238 1.336 0.253 1.244 0.172 1.083 0.083 0.992 0.082 Group 6 (0.5 mg/kg AD05876) 1.516 0.241 1.574 0.182 1.368 0.185 1.327 0.172 1.350 0.237 Group 7 (1.0 mg/kg AD05876) 1.361 0.243 1.327 0.318 1.298 0.173 1.330 0.208 1.206 0.262 Group 8 (3.0 mg/kg AD05876) 1.620 0.459 1.452 0.347 1.542 0.371 1.477 0.227 1.417 0.322 Group 9 (0.01 mg/kg AD05251) 0.833 0.143 0.808 0.133 0.856 0.154 0.936 0.127 1.041 0.193 Group 10 (0.05 mg/kg AD05251) 1.036 0.111 0.913 0.017 1.027 0.030 0.974 0.168 0.976 0.142 Group 11 (0.1 mg/kg AD05251) 1.075 0.087 1.087 0.065 1.033 0.116 1.021 0.114 1.074 0.074 Group 12 (0.25 mg/kg AD05251) 1.118 0.094 1.175 0.062 1.100 0.051 1.142 0.146 1.152 0.113 Group 13 (0.5 mg/kg AD05251) 1.344 0.178 1.455 0.124 1.329 0.190 1.347 0.156 1.279 0.188 Group 14 (1.0 mg/kg AD05251) 1.338 0.143 1.501 0.175 1.179 0.221 1.218 0.247 1.282 0.179 Group 15 (3.0 mg/kg AD05251) 1.332 0.150 1.426 0.264 1.348 0.133 1.431 0.339 1.265 0.184

    TABLE-US-00040 TABLE 26 Average LDL Normalized to Pre-Dose from Example 9. Day 8 Day 15 Day 22 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID LDL (+/−) LDL (+/−) LDL (+/−) LDL (+/−) LDL (+/−) Group 1 (D5W) 1.060 0.159 0.990 0.210 1.078 0.325 0.989 0.365 0.881 0.135 Group 2 (0.01 mg/kg AD05876) 1.031 0.068 1.071 0.181 1.077 0.082 0.992 0.154 0.958 0.081 Group 3 (0.05 mg/kg AD05876) 0.799 0.179 0.682 0.223 0.859 0.177 0.959 0.289 0.954 0.176 Group 4 (0.1 mg/kg AD05876) 0.535 0.019 0.593 0.071 0.636 0.145 0.692 0.100 0.840 0.089 Group 5 (0.25 mg/kg AD05876) 0.645 0.153 0.570 0.152 0.660 0.158 0.783 0.083 0.676 0.096 Group 6 (0.5 mg/kg AD05876) 0.624 0.238 0.645 0.192 0.620 0.067 0.581 0.086 0.893 0.088 Group 7 (1.0 mg/kg AD05876) 0.481 0.124 0.464 0.201 0.396 0.127 0.524 0.181 0.588 0.174 Group 8 (3.0 mg/kg AD05876) 0.455 0.161 0.465 0.154 0.428 0.159 0.359 0.099 0.382 0.140 Group 9 (0.01 mg/kg AD05251) 1.260 0.097 1.237 0.202 1.091 0.244 1.162 0.209 1.356 0.249 Group 10 (0.05 mg/kg AD05251) 0.682 0.048 0.641 0.127 0.715 0.032 0.792 0.123 0.847 0.223 Group 11 (0.1 mg/kg AD05251) 0.717 0.293 0.635 0.146 0.693 0.260 0.679 0.234 0.845 0.128 Group 12 (0.25 mg/kg AD05251) 0.439 0.151 0.502 0.147 0.614 0.190 0.552 0.037 0.716 0.205 Group 13 (0.5 mg/kg AD05251) 0.413 0.086 0.474 0.048 0.508 0.149 0.542 0.209 0.514 0.162 Group 14 (1.0 mg/kg AD05251) 0.614 0.268 0.747 0.292 0.601 0.266 0.633 0.282 0.669 0.271 Group 15 (3.0 mg/kg AD05251) 0.488 0.162 0.469 0.099 0.498 0.176 0.445 0.230 0.405 0.142

    [0361] Each of the APOC3 RNAi agents tested exhibited a dose response in the reduction of APOC3 protein levels, triglyceride levels, total cholesterol levels, and LDL levels.

    Example 10. In Vivo Dose Response Testing of APOC3 RNAi Agents in APOC3 Transgenic Mice

    [0362] The APOC3 Transgenic Mouse Model described in Example 5, above, was used. At day 1, each mouse was given a single subcutaneous administration of 200 μl of the respective RNAi agent dissolved in D5W (dextrose in 5 water) or control vehicle (D5W) according to the dosing groups shown in the following Table 27:

    TABLE-US-00041 TABLE 27 Dosing groups of Example 10. Group RNAi Agent and Dose Dosing Regimen 1 D5W (no RNAi agent) Single injection on day 1 2 0.25 mg/kg AD05891 Single injection on day 1 3 0.25 mg/kg AD05892 Single injection on day 1 4 0.25 mg/kg AD05893 Single injection on day 1 5 0.25 mg/kg AD05894 Single injection on day 1 6 0.25 mg/kg AD05895 Single injection on day 1 7 0.25 mg/kg AD05896 Single injection on day 1 8 0.25 mg/kg AD05897 Single injection on day 1 9 0.25 mg/kg AD05889 Single injection on day 1 10 0.25 mg/kg AD05890 Single injection on day 1 11 0.25 mg/kg AD05876 Single injection on day 1 12 0.25 mg/kg AD05877 Single injection on day 1 13 0.25 mg/kg AD05878 Single injection on day 1 14 0.25 mg/kg AD05879 Single injection on day 1 15 0.25 mg/kg AD05880 Single injection on day 1 16 0.25 mg/kg AD05882 Single injection on day 1 17 0.25 mg/kg AD05884 Single injection on day 1 18 0.25 mg/kg AD05885 Single injection on day 1 19 0.25 mg/kg AD05886 Single injection on day 1 20 0.25 mg/kg AD05887 Single injection on day 1 21 0.25 mg/kg AD05888 Single injection on day 1 22 0.25 mg/kg AD05769 Single injection on day 1

    [0363] Each of the APOC3 RNAi agents included modified nucleotides that were conjugated at the 5′ terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein. (See Tables 4, 5, 6, and 7 for specific modifications and structure information related to the APOC3 RNAi agents).

    [0364] The APOC3 RNAi agents tested in Example 10 included nucleotide sequences that were designed to target different positions on the APOC3 gene (i.e., SEQ ID NO:1). More specifically, Groups 2-4 (i.e., APOC3 RNAi agents AD05891, AD05892, and AD05893) included antisense strand sequences designed to target position 248 of an APOC3 gene; Group 5 (i.e., APOC3 RNAi agent AD05894) included an antisense strand sequence designed to target position 263 of an APOC3 gene; Groups 6-7 (i.e., APOC3 RNAi agents AD05895 and AD05896) included antisense strand sequences designed to target position 422 of an APOC3 gene; Group 8 (i.e., APOC3 RNAi agent AD05897) included an antisense strand sequence designed to target position 246 of an APOC3 gene; Groups 9-10 (i.e., APOC3 RNAi agents AD05889 and AD05890) included antisense strand sequences designed to target position 168 of an APOC3 gene; and Groups 11-22 (i.e., APOC3 RNAi agents AD05876, AD05877, AD05878, AD05878, AD05880, AD05882, AD05884, AD05885, AD05886, AD05887, AD05888, and AD05769) included antisense strand sequences designed to target position 438 of an APOC3 gene.

    [0365] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each Group were tested (n=3). Serum was collected on day −1 (pre-dose bleed with a 4 hour fast), and days 8, 15. For mice dosed with the certain RNAi agents that exhibited relatively high inhibitory activity and for the mice dosed with the vehicle control, additional serum samples were collected on days 22 and 29. Mice were fasted for four hours prior to each collection. APOC3 expression levels, triglycerides, high-density lipoprotein (HDL), low-density lipoprotein (LDL), and total cholesterol in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.

    [0366] The APOC3 protein levels, triglyceride levels, HDL levels, and total cholesterol levels for each animal were normalized. For normalization, the level of APOC3 protein, triglyceride, HDL, LDL, and total cholesterol, respectively, for each animal at a time point, was divided by the pre-treatment level of expression in that animal (in this case at day −1) to determine the ratio of expression “normalized to pre-dose.” Data from the experiment are shown in the following Tables 28 through 32:

    TABLE-US-00042 TABLE 28 Average APOC3 Protein Normalized to Pre-Dose from Example 10. Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID APOC3 (+/−) APOC3 (+/−) APOC3 (+/−) APOC3 (+/−) Group 1 (D5W) 1.130 0.131 0.892 0.155 1.182 0.272 1.126 0.174 Group 2 (0.25 mg/kg AD05891) 0.944 0.060 0.874 0.037 N/A N/A N/A N/A Group 3 (0.25 mg/kg AD05892) 0.831 0.101 0.840 0.116 N/A N/A N/A N/A Group 4 (0.25 mg/kg AD05893) 1.030 0.030 1.020 0.137 N/A N/A N/A N/A Group 5 (0.25 mg/kg AD05894) 0.835 0.136 0.774 0.134 N/A N/A N/A N/A Group 6 (0.25 mg/kg AD05895) 0.771 0.186 0.632 0.157 N/A N/A N/A N/A Group 7 (0.25 mg/kg AD05896) 0.912 0.109 0.836 0.218 N/A N/A N/A N/A Group 8 (0.25 mg/kg AD05897) 0.726 0.102 0.777 0.134 N/A N/A N/A N/A Group 9 (0.25 mg/kg AD05889) 1.059 0.187 0.987 0.123 N/A N/A N/A N/A Group 10 (0.25 mg/kg AD05890) 0.984 0.091 1.119 0.145 N/A N/A N/A N/A Group 11 (0.25 mg/kg AD05876) 0.222 0.021 0.258 0.034 0.361 0.027 0.523 0.126 Group 12 (0.25 mg/kg AD05877) 0.457 0.034 0.392 0.065 0.492 0.134 N/A N/A Group 13 (0.25 mg/kg AD05878) 0.366 0.115 0.406 0.134 0.567 0.232 N/A N/A Group 14 (0.25 mg/kg AD05879) 0.560 0.082 0.493 0.121 0.679 0.085 N/A N/A Group 15 (0.25 mg/kg AD05880) 0.572 0.205 0.652 0.274 N/A N/A N/A N/A Group 16 (0.25 mg/kg AD05882) 1.117 0.230 1.160 0.188 N/A N/A N/A N/A Group 17 (0.25 mg/kg AD05884) 0.425 0.103 0.444 0.158 0.580 0.180 N/A N/A Group 18 (0.25 mg/kg AD05885) 0.629 0.024 0.782 0.109 N/A N/A N/A N/A Group 19 (0.25 mg/kg AD05886) 1.041 0.474 1.256 0.634 N/A N/A N/A N/A Group 20 (0.25 mg/kg AD05887) 0.390 0.106 0.608 0.159 N/A N/A N/A N/A Group 21 (0.25 mg/kg AD05888) 0.429 0.107 0.591 0.105 N/A N/A N/A N/A Group 22 (0.25 mg/kg AD05769) 0.229 0.039 0.346 0.078 0.325 0.061 0.407 0.017

    TABLE-US-00043 TABLE 29 Average Triglycerides Normalized to Pre-Dose from Example 10. Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID TG (+/−) TG (+/−) TG (+/−) TG (+/−) Group 1 (D5W) 1.357 0.213 0.942 0.220 1.389 0.468 1.225 0.268 Group 2 (0.25 mg/kg AD05891) 1.123 0.127 0.908 0.057 N/A N/A N/A N/A Group 3 (0.25 mg/kg AD05892) 0.924 0.039 0.859 0.202 N/A N/A N/A N/A Group 4 (0.25 mg/kg AD05893) 1.262 0.056 1.168 0.189 N/A N/A N/A N/A Group 5 (0.25 mg/kg AD05894) 0.903 0.297 0.834 0.239 N/A N/A N/A N/A Group 6 (0.25 mg/kg AD05895) 0.728 0.300 0.632 0.207 N/A N/A N/A N/A Group 7 (0.25 mg/kg AD05896) 0.929 0.107 0.907 0.268 N/A N/A N/A N/A Group 8 (0.25 mg/kg AD05897) 0.836 0.178 0.936 0.212 N/A N/A N/A N/A Group 9 (0.25 mg/kg AD05889) 1.162 0.270 1.096 0.270 N/A N/A N/A N/A Group 10 (0.25 mg/kg AD05890) 0.992 0.341 1.486 0.505 N/A N/A N/A N/A Group 11 (0.25 mg/kg AD05876) 0.234 0.054 0.316 0.091 0.333 0.026 0.581 0.203 Group 12 (0.25 mg/kg AD05877) 0.496 0.096 0.530 0.175 0.653 0.215 N/A N/A Group 13 (0.25 mg/kg AD05878) 0.450 0.214 0.619 0.314 0.781 0.434 N/A N/A Group 14 (0.25 mg/kg AD05879) 0.664 0.033 0.664 0.072 0.905 0.030 N/A N/A Group 15 (0.25 mg/kg AD05880) 0.726 0.384 0.790 0.399 N/A N/A N/A N/A Group 16 (0.25 mg/kg AD05882) 1.289 0.436 1.695 0.408 N/A N/A N/A N/A Group 17 (0.25 mg/kg AD05884) 0.376 0.132 0.554 0.283 0.605 0.296 N/A N/A Group 18 (0.25 mg/kg AD05885) 0.620 0.064 0.998 0.219 N/A N/A N/A N/A Group 19 (0.25 mg/kg AD05886) 1.315 0.665 1.941 1.267 N/A N/A N/A N/A Group 20 (0.25 mg/kg AD05887) 0.445 0.193 0.867 0.335 N/A N/A N/A N/A Group 21 (0.25 mg/kg AD05888) 0.467 0.227 0.700 0.190 N/A N/A N/A N/A Group 22 (0.25 mg/kg AD05769) 0.204 0.033 0.377 0.068 0.373 0.097 0.370 0.071

    TABLE-US-00044 TABLE 30 Average Total Cholesterol Normalized to Pre-Dose from Example 10. Day 8 Day 15 Day 22 Day 29 Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Group ID Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Group 1 (D5W) 1.186 0.199 0.761 0.107 1.131 0.325 1.203 0.267 Group 2 (0.25 mg/kg AD05891) 1.056 0.104 0.947 0.161 N/A N/A N/A N/A Group 3 (0.25 mg/kg AD05892) 0.860 0.111 0.856 0.142 N/A N/A N/A N/A Group 4 (0.25 mg/kg AD05893) 1.132 0.037 1.137 0.163 N/A N/A N/A N/A Group 5 (0.25 mg/kg AD05894) 0.776 0.145 0.795 0.144 N/A N/A N/A N/A Group 6 (0.25 mg/kg AD05895) 0.852 0.275 0.808 0.220 N/A N/A N/A N/A Group 7 (0.25 mg/kg AD05896) 0.995 0.080 0.943 0.114 N/A N/A N/A N/A Group 8 (0.25 mg/kg AD05897) 0.978 0.160 1.015 0.136 N/A N/A N/A N/A Group 9 (0.25 mg/kg AD05889) 1.094 0.205 1.018 0.166 N/A N/A N/A N/A Group 10 (0.25 mg/kg AD05890) 1.032 0.055 1.015 0.196 N/A N/A N/A N/A Group 11 (0.25 mg/kg AD05876) 0.573 0.180 0.565 0.117 0.657 0.107 0.782 0.052 Group 12 (0.25 mg/kg AD05877) 0.673 0.141 0.595 0.156 0.688 0.235 N/A N/A Group 13 (0.25 mg/kg AD05878) 0.598 0.231 0.609 0.227 0.689 0.293 N/A N/A Group 14 (0.25 mg/kg AD05879) 0.705 0.052 0.655 0.041 0.848 0.111 N/A N/A Group 15 (0.25 mg/kg AD05880) 0.596 0.230 0.635 0.235 N/A N/A N/A N/A Group 16 (0.25 mg/kg AD05882) 1.169 0.241 1.268 0.327 N/A N/A N/A N/A Group 17 (0.25 mg/kg AD05884) 0.597 0.290 0.574 0.254 0.668 0.284 N/A N/A Group 18 (0.25 mg/kg AD05885) 0.765 0.192 0.837 0.089 N/A N/A N/A N/A Group 19 (0.25 mg/kg AD05886) 1.043 0.285 1.336 0.497 N/A N/A N/A N/A Group 20 (0.25 mg/kg AD05887) 0.679 0.087 0.843 0.174 N/A N/A N/A N/A Group 21 (0.25 mg/kg AD05888) 0.674 0.292 0.807 0.302 N/A N/A N/A N/A Group 22 (0.25 mg/kg AD05769) 0.479 0.094 0.551 0.122 0.537 0.075 0.583 0.125

    TABLE-US-00045 TABLE 31 Average HDL Normalized to Pre-Dose from Example 10. Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID HDL (+/−) HDL (+/−) HDL (+/−) HDL (+/−) Group 1 (D5W) 0.837 0.062 0.761 0.079 0.697 0.019 0.910 0.079 Group 2 (0.25 mg/kg AD05891) 0.668 0.206 0.809 0.267 N/A N/A N/A N/A Group 3 (0.25 mg/kg AD05892) 0.612 0.231 0.833 0.182 N/A N/A N/A N/A Group 4 (0.25 mg/kg AD05893) 0.779 0.343 0.820 0.331 N/A N/A N/A N/A Group 5 (0.25 mg/kg AD05894) 0.856 0.148 0.942 0.212 N/A N/A N/A N/A Group 6 (0.25 mg/kg AD05895) 1.235 0.117 1.241 0.079 N/A N/A N/A N/A Group 7 (0.25 mg/kg AD05896) 1.279 0.792 1.248 0.740 N/A N/A N/A N/A Group 8 (0.25 mg/kg AD05897) 1.122 0.285 0.992 0.298 N/A N/A N/A N/A Group 9 (0.25 mg/kg AD05889) 0.783 0.278 0.718 0.203 N/A N/A N/A N/A Group 10 (0.25 mg/kg AD05890) 0.885 0.294 0.661 0.131 N/A N/A N/A N/A Group 11 (0.25 mg/kg AD05876) 2.059 0.818 1.747 0.597 1.981 0.319 1.748 0.825 Group 12 (0.25 mg/kg AD05877) 1.317 0.148 1.295 0.273 1.176 0.130 N/A N/A Group 13 (0.25 mg/kg AD05878) 1.421 0.294 1.273 0.262 0.999 0.328 N/A N/A Group 14 (0.25 mg/kg AD05879) 1.037 0.074 0.945 0.125 0.924 0.141 N/A N/A Group 15 (0.25 mg/kg AD05880) 0.905 0.266 0.855 0.051 N/A N/A N/A N/A Group 16 (0.25 mg/kg AD05882) 0.784 0.098 0.621 0.103 N/A N/A N/A N/A Group 17 (0.25 mg/kg AD05884) 1.529 0.486 1.228 0.309 1.149 0.257 N/A N/A Group 18 (0.25 mg/kg AD05885) 1.123 0.323 0.651 0.143 N/A N/A N/A N/A Group 19 (0.25 mg/kg AD05886) 1.047 0.343 0.675 0.181 N/A N/A N/A N/A Group 20 (0.25 mg/kg AD05887) 2.093 1.089 1.487 0.748 N/A N/A N/A N/A Group 21 (0.25 mg/kg AD05888) 1.452 0.065 1.245 0.177 N/A N/A N/A N/A Group 22 (0.25 mg/kg AD05769) 1.289 0.219 1.186 0.202 1.125 0.231 1.325 0.044

    TABLE-US-00046 TABLE 32 Average LDL Normalized to Pre-Dose from Example 10. Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID LDL (+/−) LDL (+/−) LDL (+/−) LDL (+/−) Group 1 (D5W) 1.456 0.391 1.107 0.243 1.506 0.751 1.568 0.650 Group 2 (0.25 mg/kg AD05891) 1.417 0.351 1.593 0.488 N/A N/A N/A N/A Group 3 (0.25 mg/kg AD05892) 0.875 0.398 0.951 0.170 N/A N/A N/A N/A Group 4 (0.25 mg/kg AD05893) 1.243 0.217 1.400 0.311 N/A N/A N/A N/A Group 5 (0.25 mg/kg AD05894) 0.776 0.175 0.934 0.244 N/A N/A N/A N/A Group 6 (0.25 mg/kg AD05895) 1.223 0.413 1.208 0.361 N/A N/A N/A N/A Group 7 (0.25 mg/kg AD05896) 1.347 0.475 1.224 0.331 N/A N/A N/A N/A Group 8 (0.25 mg/kg AD05897) 1.206 0.398 1.255 0.137 N/A N/A N/A N/A Group 9 (0.25 mg/kg AD05889) 1.291 0.294 1.329 0.267 N/A N/A N/A N/A Group 10 (0.25 mg/kg AD05890) 1.171 0.363 1.091 0.284 N/A N/A N/A N/A Group 11 (0.25 mg/kg AD05876) 0.679 0.457 0.703 0.329 0.881 0.237 0.896 0.252 Group 12 (0.25 mg/kg AD05877) 0.575 0.162 0.531 0.187 0.624 0.304 N/A N/A Group 13 (0.25 mg/kg AD05878) 0.534 0.191 0.532 0.163 0.666 0.321 N/A N/A Group 14 (0.25 mg/kg AD05879) 0.602 0.043 0.671 0.060 0.939 0.171 N/A N/A Group 15 (0.25 mg/kg AD05880) 0.527 0.098 0.525 0.122 N/A N/A N/A N/A Group 16 (0.25 mg/kg AD05882) 1.252 0.279 1.568 0.525 N/A N/A N/A N/A Group 17 (0.25 mg/kg AD05884) 0.814 0.591 0.590 0.363 0.850 0.453 N/A N/A Group 18 (0.25 mg/kg AD05885) 0.827 0.171 0.798 0.043 N/A N/A N/A N/A Group 19 (0.25 mg/kg AD05886) 1.045 0.206 1.180 0.134 N/A N/A N/A N/A Group 20 (0.25 mg/kg AD05887) 0.756 0.118 0.794 0.156 N/A N/A N/A N/A Group 21 (0.25 mg/kg AD05888) 0.745 0.460 0.945 0.499 N/A N/A N/A N/A Group 22 (0.25 mg/kg AD05769) 0.634 0.293 0.568 0.243 0.625 0.189 0.644 0.136

    [0367] As shown in Tables 28-32 above, the RNAi agents in Groups 2 through 10 (i.e., RNAi agents with antisense strands designed to target an APOC3 gene at positions 248, 263, 422, 246, and 168) showed relatively limited inhibitory effect, particularly when compared to the RNAi agents in Groups 11 through 22, which all included antisense strand nucleotide sequences designed to target position 438 of an APOC3 gene. Further, of those RNAi agents that included sequences targeting position 438 of the APOC3 gene, Group 11 (AD05876) and Group 22 (AD05769) showed the greatest level of inhibitory effect with respect to APOC3 protein levels, triglycerides, and total cholesterol levels.

    Example 11. In Vivo Testing of APOC3RNAi Agents in APOC3 Transgenic Mice

    [0368] The APOC3 Transgenic Mouse Model described in Example 5, above, was used. At day 1, each mouse was given a single subcutaneous administration of 200 da of the respective RNAi agent dissolved in D5W (dextrose in 50 water) or control vehicle (D5W) according to the dosing groups shown in the following Table 33:

    TABLE-US-00047 TABLE 33 Dosing groups of Example 11. Group RNAi Agent and Dose Dosing Regimen 1 D5W (no RNAi agent) Single injection on day 1 2 0.5 mg/kg AD05260 Single injection on day 1 3 0.5 mg/kg AD05221 Single injection on day 1 4 0.5 mg/kg AD05223 Single injection on day 1 5 0.5 mg/kg AD05299 Single injection on day 1 6 0.5 mg/kg AD05283 Single injection on day 1 7 0.5 mg/kg AD05284 Single injection on day 1 8 0.5 mg/kg AD05167 Single injection on day 1 9 0.5 mg/kg AD05168 Single injection on day 1 10 0.5 mg/kg AD05171 Single injection on day 1 11 0.5 mg/kg AD05258 Single injection on day 1 12 0.5 mg/kg AD05259 Single injection on day 1 13 0.5 mg/kg AD05169 Single injection on day 1 14 0.5 mg/kg AD05239 Single injection on day 1 15 0.5 mg/kg AD05251 Single injection on day 1 16 0.5 mg/kg AD05220 Single injection on day 1

    [0369] Each of the APOC3 RNAi agents included modified nucleotides that were conjugated at the 5′ terminal end of the sense strand to a targeting ligand that included three N-acetyl-galactosamine groups (tridentate ligand) having the modified sequences as set forth in the duplex structures herein. (See Tables 4, 5, 6, and 7 for specific modifications and structure information related to the APOC3 RNAi agents).

    [0370] The APOC3 RNAi agents tested in Example 11 included nucleotide sequences that were designed to target different positions on the APOC3 gene (i.e., SEQ ID NO:1). More specifically, Group 2 (i.e., APOC3 RNAi agent AD05260) included an antisense strand sequence designed to target position 58 of an APOC3 gene; Group 3 (i.e., APOC3 RNAi agent AD05221) included an antisense strand sequence designed to target position 246 of an APOC3 gene; Groups 4-7 (i.e., APOC3 RNAi agents AD05223, AD05299, AD05283, and AD05284) included antisense strand sequences designed to target position 432 of an APOC3 gene; Groups 8-12 (i.e., APOC3 RNAi agents AD05167, AD05168, AD05171, AD05258, and AD05259) included antisense strand sequences designed to target position 434 of an APOC3 gene; Groups 13-15 (i.e., APOC3 RNAi agents AD05169, AD05239, and AD05251) included antisense strand sequences designed to target position 438 of an APOC3 gene; and Group 16 (i.e., APOC3 RNAi agent AD05220) included an antisense strand sequence designed to target position 506 of an APOC3 gene.

    [0371] The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each Group were tested (n=3). Serum was collected on day −1 (pre-dose bleed with a 4 hour fast), and days 8, 15. For mice dosed with the certain RNAi agents that exhibited relatively high inhibitory activity and for the mice dosed with the vehicle control, additional serum samples were collected on days 22 and 29. Mice were fasted for four hours prior to each collection. APOC3 expression levels, triglycerides, high-density lipoprotein (HDL), low-density lipoprotein (LDL), and total cholesterol in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.

    [0372] The APOC3 protein levels, triglyceride levels, HDL levels, and total cholesterol levels for each animal were normalized. For normalization, the level of APOC3 protein, triglyceride, HDL, LDL, and total cholesterol, respectively, for each animal at a time point, was divided by the pre-treatment level of expression in that animal (in this case at day −1) to determine the ratio of expression “normalized to pre-dose.” Data from the experiment are shown in the following Tables 34 through 38:

    TABLE-US-00048 TABLE 34 Average APOC3 Protein Normalized to Pre-Dose from Example 11. Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID APOC3 (+/−) APOC3 (+/−) APOC3 (+/−) APOC3 (+/−) Group 1 (D5W) 0.854 0.102 0.866 0.140 0.881 0.079 0.857 0.140 Group 2 (0.5 mg/kg AD05260) 0.297 0.031 0.352 0.042 N/A N/A N/A N/A Group 3 (0.5 mg/kg AD05221) 0.483 0.060 0.619 0.046 N/A N/A N/A N/A Group 4 (0.5 mg/kg AD05223) 0.123 0.048 0.242 0.101 0.311 0.099 0.424 0.152 Group 5 (0.5 mg/kg AD05299) 0.272 0.047 0.589 0.016 N/A N/A N/A N/A Group 6 (0.5 mg/kg AD05283) 0.108 0.014 0.121 0.011 0.163 0.009 0.201 0.032 Group 7 (0.5 mg/kg AD05284) 0.174 0.111 0.208 0.123 0.313 0.124 0.405 0.144 Group 8 (0.5 mg/kg AD05167) 0.466 0.093 0.656 0.286 N/A N/A N/A N/A Group 9 (0.5 mg/kg AD05168) 0.146 0.046 0.452 0.098 N/A N/A N/A N/A Group 10 (0.5 mg/kg AD05171) 0.191 0.088 0.199 0.095 0.419 0.070 0.548 0.087 Group 11 (0.5 mg/kg AD05258) 0.545 0.147 0.624 0.142 N/A N/A N/A N/A Group 12 (0.5 mg/kg AD05259) 0.236 0.047 0.300 0.115 N/A N/A N/A N/A Group 13 (0.5 mg/kg AD05169) 0.643 0.172 0.613 0.161 N/A N/A N/A N/A Group 14 (0.5 mg/kg AD05239) 0.438 0.065 0.542 0.014 N/A N/A N/A N/A Group 15 (0.5 mg/kg AD05251) 0.125 0.013 0.132 0.037 0.157 0.033 0.188 0.049 Group 16 (0.5 mg/kg AD05220) 0.211 0.012 0.201 0.087 0.230 0.045 0.342 0.166

    TABLE-US-00049 TABLE 35 Average Triglycerides Normalized to Pre-Dose from Example 11. Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID TG (+/−) TG (+/−) TG (+/−) TG (+/−) Group 1 (D5W) 0.939 0.217 0.835 0.235 0.965 0.215 1.051 0.136 Group 2 (0.5 mg/kg AD05260) 0.259 0.085 0.324 0.124 N/A N/A N/A N/A Group 3 (0.5 mg/kg AD05221) 0.352 0.134 0.481 0.077 N/A N/A N/A N/A Group 4 (0.5 mg/kg AD05223) 0.133 0.034 0.228 0.057 0.327 0.060 0.451 0.105 Group 5 (0.5 mg/kg AD05299) 0.352 0.134 0.481 0.086 N/A N/A N/A N/A Group 6 (0.5 mg/kg AD05283) 0.130 0.022 0.150 0.026 0.245 0.056 0.286 0.023 Group 7 (0.5 mg/kg AD05284) 0.203 0.162 0.275 0.231 0.350 0.199 0.477 0.260 Group 8 (0.5 mg/kg AD05167) 0.318 0.126 0.483 0.330 N/A N/A N/A N/A Group 9 (0.5 mg/kg AD05168) 0.188 0.014 0.330 0.010 N/A N/A N/A N/A Group 10 (0.5 mg/kg AD05171) 0.183 0.092 0.282 0.150 0.423 0.124 0.549 0.138 Group 11 (0.5 mg/kg AD05258) 0.479 0.167 0.622 0.187 N/A N/A N/A N/A Group 12 (0.5 mg/kg AD05259) 0.294 0.015 0.360 0.190 N/A N/A N/A N/A Group 13 (0.5 mg/kg AD05169) 0.728 0.253 0.561 0.163 N/A N/A N/A N/A Group 14 (0.5 mg/kg AD05239) 0.381 0.038 0.422 0.057 N/A N/A N/A N/A Group 15 (0.5 mg/kg AD05251) 0.110 0.032 0.092 0.019 0.134 0.051 0.186 0.072 Group 16 (0.5 mg/kg AD05220) 0.161 0.045 0.216 0.029 0.184 0.075 0.358 0.141

    TABLE-US-00050 TABLE 36 Average Total Cholesterol Normalized to Pre-Dose from Example 11. Day 8 Day 15 Day 22 Day 29 Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Group ID Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Group 1 (D5W) 0.769 0.127 0.684 0.182 0.835 0.167 0.796 0.180 Group 2 (0.5 mg/kg AD05260) 0.320 0.081 0.367 0.072 N/A N/A N/A N/A Group 3 (0.5 mg/kg AD05221) 0.397 0.078 0.456 0.050 N/A N/A N/A N/A Group 4 (0.5 mg/kg AD05223) 0.393 0.176 0.450 0.189 0.476 0.186 0.606 0.193 Group 5 (0.5 mg/kg AD05299) 0.522 0.092 0.611 0.031 N/A N/A N/A N/A Group 6 (0.5 mg/kg AD05283) 0.413 0.058 0.372 0.053 0.450 0.100 0.501 0.040 Group 7 (0.5 mg/kg AD05284) 0.430 0.270 0.444 0.241 0.519 0.252 0.604 0.315 Group 8 (0.5 mg/kg AD05167) 0.464 0.231 0.557 0.382 N/A N/A N/A N/A Group 9 (0.5 mg/kg AD05168) 0.298 0.034 0.388 0.012 N/A N/A N/A N/A Group 10 (0.5 mg/kg AD05171) 0.360 0.179 0.391 0.180 0.473 0.147 0.538 0.141 Group 11 (0.5 mg/kg AD05258) 0.619 0.094 0.668 0.135 N/A N/A N/A N/A Group 12 (0.5 mg/kg AD05259) 0.643 0.053 0.511 0.187 N/A N/A N/A N/A Group 13 (0.5 mg/kg AD05169) 0.731 0.089 0.636 0.013 N/A N/A N/A N/A Group 14 (0.5 mg/kg AD05239) 0.571 0.106 0.561 0.085 N/A N/A N/A N/A Group 15 (0.5 mg/kg AD05251) 0.248 0.065 0.287 0.147 0.260 0.074 0.305 0.114 Group 16 (0.5 mg/kg AD05220) 0.400 0.081 0.438 0.048 0.422 0.065 0.524 0.080

    TABLE-US-00051 TABLE 37 Average HDL Normalized to Pre-Dose from Example 11. Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID HDL (+/−) HDL (+/−) HDL (+/−) HDL (+/−) Group 1 (D5W) 0.825 0.119 0.893 0.217 0.912 0.179 0.886 0.262 Group 2 (0.5 mg/kg AD05260) 1.356 0.337 1.331 0.435 N/A N/A N/A N/A Group 3 (0.5 mg/kg AD05221) 1.483 0.266 0.953 0.166 N/A N/A N/A N/A Group 4 (0.5 mg/kg AD05223) 1.058 0.198 1.032 0.300 0.856 0.209 0.868 0.349 Group 5 (0.5 mg/kg AD05299) 1.456 0.345 1.137 0.460 N/A N/A N/A N/A Group 6 (0.5 mg/kg AD05283) 2.494 0.174 2.150 0.465 1.731 0.397 1.738 0.156 Group 7 (0.5 mg/kg AD05284) 1.559 0.237 1.791 0.849 1.598 0.448 1.605 0.131 Group 8 (0.5 mg/kg AD05167) 1.239 0.287 1.310 0.108 N/A N/A N/A N/A Group 9 (0.5 mg/kg AD05168) 1.666 0.551 1.425 0.251 N/A N/A N/A N/A Group 10 (0.5 mg/kg AD05171) 1.514 0.286 1.435 0.248 0.941 0.005 0.827 0.111 Group 11 (0.5 mg/kg AD05258) 1.170 0.082 1.081 0.212 N/A N/A N/A N/A Group 12 (0.5 mg/kg AD05259) 1.964 0.955 1.221 0.228 N/A N/A N/A N/A Group 13 (0.5 mg/kg AD05169) 1.059 0.236 1.101 0.230 N/A N/A N/A N/A Group 14 (0.5 mg/kg AD05239) 1.323 0.088 1.120 0.224 N/A N/A N/A N/A Group 15 (0.5 mg/kg AD05251) 1.728 0.173 2.143 0.688 1.632 0.312 1.737 0.452 Group 16 (0.5 mg/kg AD05220) 1.660 0.391 1.797 0.384 1.803 0.637 1.479 0.333

    TABLE-US-00052 TABLE 38 Average LDL Normalized to Pre-Dose from Example 11. Day 8 Day 15 Day 22 Day 29 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID LDL (+/−) LDL (+/−) LDL (+/−) LDL (+/−) Group 1 (D5W) 0.699 0.129 0.621 0.201 0.778 0.259 0.646 0.216 Group 2 (0.5 mg/kg AD05260) 0.398 0.108 0.317 0.046 N/A N/A N/A N/A Group 3 (0.5 mg/kg AD05221) 0.441 0.024 0.422 0.013 N/A N/A N/A N/A Group 4 (0.5 mg/kg AD05223) 0.441 0.280 0.437 0.219 0.514 0.264 0.589 0.219 Group 5 (0.5 mg/kg AD05299) 0.504 0.160 0.577 0.100 N/A N/A N/A N/A Group 6 (0.5 mg/kg AD05283) 0.464 0.122 0.428 0.173 0.551 0.277 0.595 0.195 Group 7 (0.5 mg/kg AD05284) 0.394 0.258 0.404 0.179 0.398 0.214 0.471 0.290 Group 8 (0.5 mg/kg AD05167) 0.572 0.306 0.678 0.536 N/A N/A N/A N/A Group 9 (0.5 mg/kg AD05168) 0.329 0.067 0.374 0.017 N/A N/A N/A N/A Group 10 (0.5 mg/kg AD05171) 0.303 0.186 0.280 0.134 0.401 0.113 0.429 0.180 Group 11 (0.5 mg/kg AD05258) 0.669 0.105 0.702 0.140 N/A N/A N/A N/A Group 12 (0.5 mg/kg AD05259) 0.588 0.208 0.407 0.211 N/A N/A N/A N/A Group 13 (0.5 mg/kg AD05169) 0.626 0.116 0.672 0.057 N/A N/A N/A N/A Group 14 (0.5 mg/kg AD05239) 0.473 0.138 0.488 0.124 N/A N/A N/A N/A Group 15 (0.5 mg/kg AD05251) 0.254 0.147 0.344 0.257 0.234 0.063 0.306 0.166 Group 16 (0.5 mg/kg AD05220) 0.364 0.043 0.439 0.045 0.461 0.157 0.455 0.101

    Example 12. In Vivo Testing of APOC3 RNAi Agents in Cynomolgus Monkeys

    [0373] APOC3 RNAi agents were evaluated in cynomolgus monkeys. On day 1, cynomolgus macaque (Macaca fascicularis) primates (also referred to herein as “cynos”) were administered a single subcutaneous injection of 0.3 mL/kg (approximately 2-3 mL volume, depending on animal mass) containing 3.0 mg/kg of APOC3 RNAi agent AD05876, formulated in saline. APOC3 RNAi agent AD05876 included modified nucleotides and a tridentate N-acetyl-galactosamine targeting ligand ((NAG37)s) conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4, 5, 6, and 7.

    [0374] Two (2) cynos were tested (n=2). On days −8 (pre-dose), 29, and 50, liver biopsies were taken. For one of the monkeys, additional liver biopsy samples were taken on day 15. On the date of each biopsy collection, cynos were anesthetized and ultrasound-guided liver biopsies were performed to extract two or three liver tissue samples approximately 1 mm×4 mm in size. The biopsy samples were then homogenized, and levels of APOC3 mRNA in the cyno livers were measured by RT-qPCR. Resulting values were then normalized to the pre-dose (in this case, at day −8) APOC3 mRNA measurements. The resulting mRNA data is reflected in the following Tables 39 and 40:

    TABLE-US-00053 TABLE 39 APOC3 mRNA Levels Normalized to Pre-Dose from Example 12 of Cyno #1 (cy0713). Day 29 Day 50 Relative APOC3 Low High Relative APOC3 Low High mRNA Expression Error Error mRNA Expression Error Error 0.125 0.003 0.003 0.167 0.002 0.002

    TABLE-US-00054 TABLE 40 APOC3 mRNA Levels Normalized to Pre-Dose from Example 12 of Cyno #2 (cy0716). Day 15 Day 29 Relative APOC3 Low High Relative APOC3 Low High mRNA Expression Error Error mRNA Expression Error Error 0.250 0.007 0.007 0.112 0.005 0.00 Day 50 Relative APOC3 Low High mRNA Expression Error Error 0.239 0.003 0.003

    [0375] Both of the cynos dosed with AD05876 showed a significant reduction in liver-specific APOC3 mRNA compared to pre-treatment measurements at all measured time points. On day 29, for example, the first cyno had a reduction of APOC3 mRNA of approximately 87.5% (0.125), while the second cyno had a reduction of approximately 88.8% (0.112), compared to pre-dose levels.

    Example 13. In Vivo Testing of APOC3 RNAi Agents in High Fructose Corn Syrup (HFCS) Diet-Fed Rhesus Monkeys

    [0376] APOC3 RNAi agent AD05876 was further evaluated in high-fructose corn syrup (HFCS) diet-fed Rhesus monkeys. Rhesus monkeys were placed on an HFCS diet 37 days prior to dosing. These animals were known to develop increased plasma triglycerides greater than 180 mg/dL on the HFCS diet. On day 1 and again on day 29, four (4) Rhesus monkeys were administered a subcutaneous injection containing 4.0 mg/kg of APOC3 RNAi agent AD05876 formulated in saline (n=4). Two additional Rhesus monkeys were administered normal saline control. APOC3 RNAi agent AD05876 contained modified nucleotides and included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4, 5, 6, and 7.

    [0377] Both fed and fasting blood samples were drawn for analysis, and fasting serum samples were analyzed on days −8 (predose), 8, and 15. Monkeys were fasted overnight prior to each collection. APOC3 protein levels in serum were measured by ELISA assay (R&D Systems), according to the manufacturer's recommendations. Triglycerides, total cholesterol, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) in serum were measured on a Cobas® Integra 400 (Roche Diagnostics), according to the manufacturer's recommendations.

    [0378] The APOC3 protein levels, triglyceride levels, total cholesterol levels, HDL levels, and LDL levels for each animal were normalized. For normalization, the level of APCO3 protein, triglyceride, HDL, and total cholesterol, respectively, for each animal at a time point, was divided by the pre-treatment level of expression in that animal (in this case at day −8) to determine the ratio of expression “normalized to pre-treatment.”

    [0379] Data from the study set forth in this Example are shown in the following Tables 41-45:

    TABLE-US-00055 TABLE 41 Average APOC3 Protein Normalized to Pre-Treatment from Example 13 (Fasted) Day 8 Day 15 Day 21 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID APOC3 (+/−) APOC3 (+/−) APOC3 (+/−) APOC3 (+/−) APOC3 (+/−) Group 1 (saline control) 0.921 0.007 0.902 0.009 0.922 0.026 0.905 0.025 0.922 0.006 Group 2 (4.0 mg/kg AD05876) 0.509 0.150 0.388 0.159 0.347 0.114 0.358 0.086 0.335 0.100

    TABLE-US-00056 TABLE 42 Average TG Normalized to Pre-Treatment from Example 13 (Fasted) Day 8 Day 15 Day 21 Day 29 Day 36 Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Avg Std Dev Group ID TG (+/−) TG (+/−) TG (+/−) TG (+/−) TG (+/−) Group 1 (saline control) 0.743 0.055 0.717 0.054 1.017 0.155 0.758 0.263 0.659 0.111 Group 2 (4.0 mg/kg AD05876) 0.599 0.338 0.433 0.286 0.395 0.247 0.435 0.212 0.408 0.269

    TABLE-US-00057 TABLE 43 Average Total Cholesterol Normalized to Pre-Treatment from Example 13 (Fasted) Day 8 Day 15 Day 21 Day 29 Day 36 Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Group ID Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Group 1 (saline control) 0.972 0.050 0.944 0.079 0.957 0.0.18 0.882 0.021 0.894 0.038 Group 2 (4.0 mg/kg AD05876) 0.860 0.177 0.826 0.1119 0.825 0.084 0.780 0.162 0.751 0.203

    TABLE-US-00058 TABLE 44 Average HDL Normalized to Pre-Treatment from Example 13 (Fasted) Day 8 Day 15 Day 21 Day 29 Day 36 Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Group ID Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Group 1 (saline control) 1.082 0.098 1.071 0.111 1.003 0.158 1.025 0.131 1.027 0.071 Group 2 (4.0 mg/kg AD05876) 1.370 0.267 1.445 0.479 1.465 0.537 1.316 0.294 1.370 0.425

    TABLE-US-00059 TABLE 45 Average LDL Normalized to Pre-Treatment from Example 13 (Fasted) Day 8 Day 15 Day 21 Day 29 Day 36 Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Avg Total Std Dev Group ID Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Chol (+/−) Group 1 (saline control) 0.892 0.060 0.928 0.046 0.823 0.034 0.804 0.076 0.804 0.172 Group 2 (4.0 mg/kg AD05876) 0.777 0.129 0.856 0.136 0.842 0.186 0.755 0.144 0.716 0.228

    [0380] The Rhesus monkeys dosed with AD05876 at 4.0 mg/kg dosage levels showed a reduction in APOC3 protein compared to pre-treatment measurements across each of the measured time points. Further, substantial reductions in both triglyceride levels and total cholesterol levels are also shown. For example, in one animal, triglycerides were reduced by approximately 89% on day 22, and as shown in Table 42 above, mean triglyceride levels were reduced by approximately 60% (0.395) on day 22. Additionally, mean HDL levels increased by approximately 47% on day 22 (see Table 44 (1.465)), with one animal having a 2.2-fold increase in HDL levels.

    OTHER EMBODIMENTS

    [0381] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.