ARTIFICIAL NUCLEIC ACIDS FOR RNA EDITING

20220073915 · 2022-03-10

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention concerns artificial nucleic acids for site-directed editing of a target RNA. In particular, the present invention provides artificial nucleic acids capable of site-directed editing of endogenous transcripts by harnessing an endogenous deaminase. Further, the present invention provides artificial nucleic acids for sited-directed editing of a target RNA, which are chemically modified, in particular according to a modification pattern as described herein. The invention also comprises a vector encoding said artificial nucleic acid and a composition comprising said artificial nucleic acid. Moreover, the invention provides the use of the artificial nucleic acid, the composition or the vector for site-directed editing of a target RNA or for in vitro diagnosis. In addition, the artificial nucleic acid, the composition or the vector as described herein are provided for use as a medicament or for use in diagnosis of a disease or disorder.

    Claims

    1. Artificial nucleic acid for site-directed editing of a target RNA, the artificial nucleic acid comprising a) a targeting sequence, which comprises a nucleic acid sequence complementary to a target sequence in the target RNA, and b) a recruiting moiety for recruiting a deaminase, wherein the targeting sequence comprises at least one nucleotide, wherein the nucleobase is chemically modified, and/or wherein the targeting sequence comprises at least one backbone modification.

    2. The artificial nucleic acid according to claim 1, wherein the targeting sequence comprises at least one chemically modified nucleotide, which is chemically modified at the 2′ position.

    3. The artificial nucleic acid according to claim 2, wherein the chemically modified nucleotide comprises a substituent at the 2′ carbon atom, wherein the substituent is selected from the group consisting of a halogen, an alkoxy group, a hydrogen, an aryloxy group, an amino group and an aminoalkoxy group, preferably from 2′-hydrogen, 2′-O-methyl, 2′-O-methoxyethyl and 2′-fluoro; and/or wherein the chemically modified nucleotide is selected from the group consisting of a locked nucleic acid (LNA) nucleotide, an ethylene bridged nucleic acid (ENA) nucleotide and an (S)-constrained ethyl cEt nucleotide.

    4. The artificial nucleic acid according to any of the preceding claims, wherein the targeting sequence comprises at least one backbone modification and wherein a nucleotide comprises a modified phosphate group, preferably selected from the group consisting of a phosphorothioate, a phosphoroselenate, a borano phosphate, a borano phosphate ester, a hydrogen phosphonate, a phosphoroamidate, an alkyl phosphonate, an aryl phosphonate and a phosphotriester.

    5. The artificial nucleic acid according to any of the preceding claims, wherein at least 40% of the nucleotides of the targeting sequence are chemically modified at the 2′ position.

    6. The artificial nucleic acid according to any of the preceding claims, wherein the targeting sequence comprises at the position corresponding to a nucleotide to be edited, preferably an adenosine or a cytidine nucleotide to be edited, in the target sequence a cytidine nucleotide or a variant thereof, a deoxycytidine nucleotide or a variant thereof, or an abasic site.

    7. The artificial nucleic acid according to any of the preceding claims, wherein at least one, preferably both, of the two nucleotides or variants thereof, which are positioned 5′ or 3′ of the position corresponding to a nucleotide to be edited in the target sequence, is chemically modified at the 2′ carbon atom, wherein the 2′ carbon atom is linked to a substituent selected from the group consisting of a halogen, an alkoxy group, a hydrogen, an aryloxy group, an amino group and an aminoalkoxy group, preferably selected from 2′-O-methyl, 2′-O-methoxyethyl, 2′-hydrogen and 2′-fluoro; and/or wherein at least one, preferably both, of the two nucleotides or variants thereof, which are positioned 5′ or 3′ of the position corresponding to a nucleotide to be edited in the target sequence, comprises a modified phosphate group, preferably a phosphorothioate group.

    8. The artificial nucleic acid according to any of the preceding claims, wherein the targeting sequence comprises at the position corresponding to a nucleotide to be edited in the target sequence a cytidine nucleotide or a variant thereof, a deoxycytidine nucleotide or a variant thereof, or an abasic site, and wherein the nucleotide, which is positioned 5′ of the position corresponding to the nucleotide to be edited, is a pyrimidine nucleotide, preferably a pyrimidine ribonucleotide or a pyrimidine deoxynucleotide, and wherein said pyrimidine nucleotide comprises a nucleobase, which is chemically modified at the 2′ position, preferably by 2′-hydrogen, 2′-O-methyl, 2′-O-methoxyethyl or 2′-O-fluoro.

    9. The artificial nucleic acid according to any of the preceding claims, wherein the targeting sequence comprises the nucleic acid sequence
    3′AcC5′, wherein A is an adenosine nucleotide or a variant thereof, preferably an adenosine ribonucleotide or a deoxyadenosine nucleotide; c is a cytidine nucleotide or a variant thereof, a deoxycytidine nucleotide or a variant thereof, or an abasic site, at the position corresponding to a nucleotide, preferably an adenosine or a cytidine, more preferably an adenosine, to be edited in the target sequence; and C is a cytidine nucleotide or a variant thereof, preferably a cytidine ribonucleotide, a modified cytidine ribonucleotide, a deoxycytidine nucleotide or a modified deoxycytidine nucleotide, more preferably a deoxycytidine nucleotide or a modified deoxycytidine nucleotide.

    10. The artificial nucleic acid according to any of the preceding claims, wherein the targeting sequence comprises the nucleic acid sequence
    3′As*cC*5′, wherein As is an adenosine nucleotide or a variant thereof, preferably an adenosine ribonucleotide or a deoxyadenosine nucleotide, further comprising a phosphorothioate group; c is a cytidine nucleotide or a variant thereof, a deoxycytidine nucleotide or a variant thereof, or an abasic site, at the position corresponding to a nucleotide, preferably an adenosine or a cytidine, more preferably an adenosine, to be edited in the target sequence; and C is a cytidine nucleotide or a variant thereof; wherein an asterisk (*) indicates a chemical modification of the preceding nucleotide at the 2′ carbon atom with 2′-hydrogen (2′-deoxy), 2′-O-methyl, 2′-O-methoxyethyl or 2′-fluoro.

    11. The artificial nucleic acid according to any of claims 1 to 8, wherein the targeting sequence comprises the nucleic acid sequence
    3′Us*cC*5′, wherein Us is an uridine nucleotide or a variant thereof, preferably an uridine ribonucleotide or a deoxyuridine nucleotide, further comprising a phosphorothioate group; c is a cytidine nucleotide or a variant thereof, a deoxycytidine nucleotide or a variant thereof, or an abasic site, at the position corresponding to a nucleotide, preferably an adenosine or a cytidine, more preferably an adenosine, to be edited in the target sequence; and C is a cytidine nucleotide or a variant thereof; wherein an asterisk (*) indicates a chemical modification of the preceding nucleotide at the 2′ carbon atom with 2′-hydrogen (2′-deoxy), 2′-O-methyl, 2′-O-methoxyethyl or 2′-fluoro;

    12. The artificial nucleic acid according to any of the preceding claims, wherein at least two of the five nucleotides at the 3′ terminus of the targeting sequence comprise a modified phosphate group, preferably a phosphorothioate group.

    13. The artificial nucleic acid according to any of the preceding claims, wherein at least two of the five nucleotides at the 3′ terminus of the targeting sequence are LNA nucleotides, ENA nucleotides or (S)-constrained ethyl cEt nucleotides.

    14. The artificial nucleic acid according to any of the preceding claims, wherein the targeting sequence comprises at least one nucleotide comprising a modified phosphate group, preferably a phosphorothioate nucleotide; at least one nucleotide selected from the group consisting of an LNA nucleotide, an ENA nucleotide and an (S)-constrained ethyl cEt nucleotide, preferably an LNA nucleotide; and at least one nucleotide comprising a substituent at the 2′ carbon atom, wherein the substituent is selected from the group consisting of a halogen, an alkoxy group, a hydrogen, an aryloxy group, an amino group and an aminoalkoxy group, preferably from 2′-hydrogen, 2′-O-methyl, 2′-O-methoxyethyl and 2′-fluoro.

    15. The artificial nucleic acid according to any one of the preceding claims, wherein the targeting sequence is characterized by a modification pattern according to any one of formulae (Ia), (Ib) or (Ic):
    3′N.sub.aCN.sub.b5′  (Ia) wherein N is a nucleotide or a variant thereof, preferably a ribonucleotide or a variant thereof, a deoxynucleotide or a variant thereof, more preferably a modified ribonucleotide, or a modified deoxynucleotide; C is the nucleotide at the position corresponding to the nucleotide to be edited in the target sequence and wherein C is a cytidine nucleotide or a variant thereof, a deoxycytidine nucleotide or a variant thereof, or an abasic site; a is an integer in a range from 1 to 40, preferably from 6 to 10; b is an integer in a range from 4 to 40; and wherein a+b is in a range from 15 to 80;
    3′N.sub.cNs.sub.dN.sub.aCN.sub.bNs.sub.eN.sub.f5′  (Ib) wherein N is a nucleotide or a variant thereof, preferably a ribonucleotide or a variant thereof, a deoxynucleotide or a variant thereof, more preferably a modified ribonucleotide, or a modified deoxynucleotide; C is the nucleotide at the position corresponding to the nucleotide to be edited in the target sequence and wherein C is a cytidine nucleotide or a variant thereof, a deoxycytidine nucleotide or a variant thereof, or an abasic site; Ns is a nucleotide comprising a modified phosphate group, preferably a phosphorothioate group; c is an integer in a range from 0 to 4; d is an integer in a range from 1 to 10; a is an integer in a range from 1 to 26; b is an integer in a range from 4 to 40; e is an integer in a range from 0 to 4; f is an integer in a range from 0 to 4; wherein a+d+c is in a range from 1 to 40; wherein b+e+f is in a range from 4 to 40; and wherein a+d+c+b+e+f is in a range from 15 to 80;
    3′N.sub.cNI.sub.gN.sub.hNI.sub.iN.sub.aCN.sub.bNI.sub.jN.sub.kNI.sub.lN.sub.m5′  (Ic) wherein N is a nucleotide or a variant thereof, preferably a ribonucleotide or a variant thereof, a deoxynucleotide or a variant thereof, more preferably a modified ribonucleotide, or a modified deoxynucleotide; C is the nucleotide at the position corresponding to the nucleotide to be edited in the target sequence and wherein C is a cytidine nucleotide or a variant thereof, a deoxycytidine nucleotide or a variant thereof, or an abasic site; NI is an LNA nucleotide or a modified LNA nucleotide; c is an integer in a range from 0 to 4, preferably from 1 to 3; g, i is an integer in a range from 1 to 5; h is an integer in a range from 1 to 30, preferably from 1 to 5; a is an integer in a range from 1 to 15; b is an integer in a range from 4 to 30; j is an integer in a range from 0 to 5, preferably from 1 to 3; k is an integer in a range from 4 to 30; l is an integer in a range from 0 to 5, preferably from 1 to 3; m is an integer in a range from 0 to 3; wherein c+g+h+i+a is in a range from 1 to 40; wherein b+j+k+I+m is in a range from 4 to 40; and wherein c+g+h+i+a+b+j+k+I+m is in a range from 15 to 80.

    16. The artificial nucleic acid according to any of the preceding claims, wherein the targeting sequence is characterized by a modification pattern selected from any one of the formulae II(a) to II(l):
    3′Ns.sub.4N.sub.6CN.sub.7-295′;  (a)
    3′Ns.sub.4N.sub.6-10CN.sub.9-12Ns.sub.25′;  (b)
    3′Ns.sub.2N.sub.11-15CN.sub.9-12Ns.sub.25′;  (c)
    3′NIs.sub.2Ns.sub.2NIN.sub.6-10CN.sub.5-9NI.sub.2NNs.sub.25′;  (d)
    3′NIsNsNIsNsN.sub.6-10CN.sub.4-8NINNINNs.sub.25′;  (e)
    3′NsNIsNsNIsN.sub.6-10CN.sub.3-7NINNIN.sub.2Ns.sub.25′;  (f)
    3′Ns.sub.2NNINNIN.sub.6-10CN.sub.4-8NINNINNs.sub.25′,  (g)
    3′NsNIsNs.sub.2NIN.sub.5CN.sub.5NIN.sub.1-235′;  (h)
    3′NIsNsNIsNsN.sub.8CN.sub.6NIN.sub.1-235′  (i)
    3′NsNIsNs.sub.2NIN.sub.5CN.sub.5NIN.sub.20NI.sub.25′;  (j)
    3′NIsNsNIsNsN.sub.8CN.sub.6NIN.sub.20NI.sub.25′; and  (k)
    3′Ns.sub.4N.sub.6CN.sub.9Ns.sub.25′,  (l) wherein N is a nucleotide or a variant thereof, preferably a ribonucleotide or a variant thereof, a deoxynucleotide or a variant thereof, more preferably a modified ribonucleotide, or a modified deoxynucleotide; Ns is a nucleotide comprising a modified phosphate group, preferably a phosphorothioate group; NI is an LNA nucleotide or a modified LNA nucleotide; NIs is an LNA nucleotide or a modified LNA nucleotide, further comprising a modified phosphate group, preferably a phosphorothioate group; C is the nucleotide at the position corresponding to the nucleotide to be edited in the target sequence and wherein C is a cytidine nucleotide or a variant thereof, a deoxycytidine or a variant thereof, preferably a deoxycytidine nucleotide, or an abasic site.

    17. The artificial nucleic acid according to any of the preceding claims, wherein the targeting sequence comprises a nucleic acid sequence, wherein, with the exception of the cytidine nucleotide or the variant thereof, the deoxycytidine nucleotide or the variant thereof, or the abasic site, at the position corresponding to the nucleotide to be edited in the target sequence, with the exception of LNA nucleotides, and optionally with the exception of at least one of the two nucleotides, which are positioned 5′ or 3′ to said nucleotide at the position corresponding to the nucleotide to be edited in the target sequence, all nucleotides are chemically modified at the 2′ carbon atom, which is linked to a substituent selected from the group consisting of a halogen, an alkoxy group, a hydrogen, an aryloxy group, an amino group and an aminoalkoxy group, preferably from 2′-hydrogen, 2′-O-methyl, 2′-O-methoxyethyl and 2′-fluoro.

    18. The artificial nucleic acid according to any of the preceding claims, wherein the targeting sequence comprises a nucleic acid sequence selected from the group consisting of TABLE-US-00014 (SEQ ID NO: 1) 5′ U*U*C*A*C*U* UcA G*U*G*U*As*Us*Gs*Cs*C* 3′; (SEQ ID NO: 2) 5′ U*U*C*A*C*U* UcA G*U*G*U*As*Us*Gs*Cs*C* 3′; (SEQ ID NO: 3) 5′ A*C*C*U*C*C* AcU C*A*G*U*Gs*Us*Gs*As*U* 3′; (SEQ ID NO: 4) 5′ U*U*U*C*C*U* CcA C*U*G*U*Us*Gs*Cs*As*A* 3′; (SEQ ID NO: 5) 5′ U*G*U*G*U*A* UcU U*G*C*U*Gs*Us*Gs*As*G* 3′; (SEQ ID NO: 6) 5′ G*A*G*G*U*C* CcU G*G*G*G*Gs*Cs*Gs*Cs*U* 3′; (SEQ ID NO: 7) 5′ G*A*U*C*U*U* CcU G*A*U*G*Gs*Cs*Cs*As*C* 3′; (SEQ ID NO: 8) 5′ A*G*C*C*A*C* AcA C*U*C*C*Gs*Us*Cs*As*G* 3′; (SEQ ID NO: 9) 5′ G*A*U*U*U*U* CcU G*A*U*A*Gs*Cs*Us*As*C* 3′; (SEQ ID NO: 10) 5′ G*G*C*C*A*C* AcA U*U*C*U*Gs*Us*Cs*As*G* 3′; (SEQ ID NO: 11) 5′ G*A*U*C*U*U* CcU G*A*U*G*Gs*Cs*Cs*As*C* 3′; (SEQ ID NO: 12) 5′ G*G*C*C*A*C* AcA C*U*C*C*Gs*Us*Cs*As*G* 3′; (SEQ ID NO: 13) 5′ G*A*U*U*U*U* CcU G*A*U*A*Gs*Cs*As*As*C* 3′; (SEQ ID NO: 14) 5′ G*G*C*U*A*C* GcA C*U*C*U*Gs*Us*Cs*As*A* 3′; (SEQ ID NO: 15) 5′ A*G*G*C*C*G* CcG U*C*G*U*Gs*Gs*Cs*Gs*G* 3′; (SEQ ID NO: 16) 5′ C*C*G*C*U*C* CcU CcU C*A*G*C*Cs*Cs*Gs*Us* C* 3′; (SEQ ID NO: 17) 5′ A*C*G*C*C*A* CcA G*C*U*C*Cs*As*As*Cs*U* 3′; (SEQ ID NO: 18) 5′ G*U*C*U*C*A* CcA A*U*U*G*Cs*Us*Cs*Us*C* 3′; (SEQ ID NO: 19) 5′ G*A*A*A*U*A* CcA U*C*A*G*As*Us*Us*Us*G* 3′; (SEQ ID NO: 20) 5′ A*A*U*U*A*G* CcU U*C*U*G*Gs*Cs*Cs*As*U* 3′; (SEQ ID NO: 21) 5′ G*A*U*C*A*G* CcU C*C*U*G*Gs*Cs*Cs*As*U* 3′; (SEQ ID NO: 22) 5′ G*A*U*C*A*G* CcU U*C*U*G*Gs*Cs*Cs*As*U* 3′; (SEQ ID NO: 23) 5′ G*A*U*C*A*G* CcU U*C*U*G*Gs*Cs*Cs*As*U* 3′; (SEQ ID NO: 24) 5′ C*A*C*U*G*C* CcA G*G*C*A*Us*Cs*As*Gs*C* 3′; (SEQ ID NO: 25) 5′ C*A*C*U*G*C* CcG G*G*C*A*Us*Cs*As*Gs*C* 3′; (SEQ ID NO: 26) 5′ U*C*C*G*C*C* CcG A*U*C*C*As*Cs*Gs*As*U* 3′; (SEQ ID NO: 27) 5′ C*C*U*U*U*C* UcG U*C*G*A*Us*Gs*Gs*Us*C* 3′; (SEQ ID NO: 28) 5′ C*C*U*U*U*C* U*cG U*C*G*A*Us*Gs*Gs*Us*C* 3′; (SEQ ID NO: 29) 5′ C*U*U*G*A*U* AcA U*C*C*A*Gs*Us*Us*Cs*C* 3′; (SEQ ID NO: 30) 5′ U*U*U*C*A*G* GcA U*U*U*C*Cs*Us*Cs*Cs*G* 3′; (SEQ ID NO: 31) 5′ C*U*U*C*A*G* GcA U*G*G*G*Gs*Cs*As*Gs*C* 3′; (SEQ ID NO: 32) 5′ A*G*G*A*A*C* AcA A*C*C*U*Us*Us*Gs*Us*C* 3′; (SEQ ID NO: 33) 5′ U*U*U*C*A*C* AcA U*C*C*A*Us*Cs*As*As*C* 3′; (SEQ ID NO: 34) 5′ C*U*U*C*A*C* GcA U*C*C*A*Us*Cs*As*As*C* 3′; (SEQ ID NO: 35) 5′ U*G*G*G*A*C* AcA A*C*C*C*Cs*Us*Gs*Cs*C* 3′; (SEQ ID NO: 36) 5′ C*G*A*C*U*C* CcU C*U*G*G*As*Us*Gs*Us*U* 3′; (SEQ ID NO: 37) 5′ C*G*A*C*U*C* UcU C*U*G*G*As*Us*Gs*Us*U* 3′; or a fragment or variant of any of these nucleic acid sequences; wherein A is an adenosine nucleotide or a variant thereof, preferably an adenosine ribonucleotide, an adenosine deoxynucleotide, a modified adenosine ribonucleotide or a modified adenosine deoxynucleotide; C is a cytidine nucleotide or a variant thereof, preferably a cytidine ribonucleotide, a cytidine deoxynucleotide, a modified cytidine ribonucleotide or a modified cytidine deoxynucleotide; G is a guanosine nucleotide or a variant thereof, preferably a guanosine ribonucleotide, a guanosine deoxynucleotide, a modified guanosine ribonucleotide or a modified guanosine deoxynucleotide; U is an uridine nucleotide or a variant thereof, preferably an uridine ribonucleotide, an uridine deoxynucleotide, a modified uridine ribonucleotide or a modified uridine deoxynucleotide; As, Cs, Gs and Us are nucleotides or variants thereof, preferably ribonucleotides or deoxynucleotides as defined above, further comprising a phosphorothioate group; wherein an asterisk (*) indicates a chemical modification of the preceding nucleotide at the 2′ carbon atom, preferably with 2′-hydrogen, 2′-O-methyl, 2′-O-methoxyethyl or 2′-fluoro; and wherein a lower case letter c indicates the position corresponding to a nucleotide or a variant thereof, preferably an adenosine or cytidine, more preferably an adenosine, to be edited in the target sequence and wherein c represents a cytidine nucleotide or a variant thereof, a deoxycytidine nucleotide or a variant thereof, or an abasic site.

    19. The artificial nucleic acid according to any of the preceding claims, wherein the targeting sequence comprises at the position corresponding to a nucleotide to be edited in the target sequence a cytidine nucleotide or a variant thereof, a deoxycytidine nucleotide or a variant thereof, or an abasic site, and wherein at least one, preferably both, of the two nucleotides or variants thereof, which are positioned 5′ or 3′ of the position corresponding to a nucleotide to be edited in the target sequence, is chemically modified at the 2′ carbon atom, wherein the 2′ carbon atom is linked to a substituent selected from the group consisting of a halogen, an alkoxy group, a hydrogen, an aryloxy group, an amino group and an aminoalkoxy group, preferably selected from 2′-O-methyl, 2′-O-methoxyethyl, 2′-hydrogen and 2′-fluoro; and/or wherein at least one, preferably both, of the two nucleotides or variants thereof, which are positioned 5′ or 3′ of the position corresponding to a nucleotide to be edited in the target sequence, comprises a modified phosphate group, preferably a phosphorothioate group.

    20. The artificial nucleic acid according to any of the preceding claims, wherein the targeting sequence comprises at the position corresponding to a nucleotide to be edited in the target sequence a cytidine nucleotide or a variant thereof, a deoxycytidine nucleotide or a variant thereof, or an abasic site, and wherein the nucleotide, which is positioned 5′ of the position corresponding to the nucleotide to be edited, is a pyrimidine nucleotide, preferably a pyrimidine ribonucleotide or a pyrimidine deoxynucleotide, and wherein said pyrimidine nucleotide comprises a nucleobase, which is chemically modified at the 2′ position, preferably by 2′-hydrogen, 2′-O-methyl, 2′-O-methoxyethyl or 2′-O-fluoro.

    21. The artificial nucleic acid according to any of the preceding claims, wherein the targeting sequence comprises a nucleic acid sequence as defined in any of claims 9 to 11.

    22. The artificial nucleic acid according to any of the preceding claims, wherein the recruiting moiety comprises at least one coupling agent capable of recruiting a deaminase comprising a moiety that binds to said coupling agent, wherein the coupling agent is preferably covalently linked to the 5′-terminus or to the 3′-terminus of the targeting sequence or to an internal nucleotide within the targeting sequence.

    23. The artificial nucleic acid according to claim 22, wherein the coupling agent is selected from the group consisting of O6-benzylguanine, O2-benzylcytosine, chloroalkane, 1×BG, 2×BG, 4×BG, and a variant of any of these.

    24. The artificial nucleic acid according to claim 22 or 23, wherein the moiety binding to said coupling agent is selected from the group consisting of a SNAP-tag, a CLIP-tag, a HaloTag, and a fragment or variant of any one of these.

    25. The artificial nucleic acid according to any of the preceding claims, wherein the recruiting moiety comprises 06-benzylguanine, 1×BG, 2×BG, 4×BG or a variant of any one of these and the deaminase, preferably an adenosine deaminase, comprises a SNAP-tag or a fragment or variant thereof; the recruiting moiety comprises a chloroalkane and the deaminase, preferably an adenosine deaminase, comprises a HaloTag or a fragment or variant thereof; or the recruiting moiety comprises O2-benzylcytosine or a variant thereof and the deaminase, preferably an adenosine deaminase, comprises a Clip-tag or a fragment or variant thereof.

    26. The artificial nucleic acid according to any of the preceding claims, wherein the recruiting moiety comprises a coupling agent, which is capable of recruiting more than one deaminase molecule, wherein the coupling agent is preferably selected from 2×BG, 4×BG and a variant of any one of these; and/or the recruiting moiety comprises at least two moieties of a coupling agent, wherein the at least two moieties represent the same coupling agent or a different coupling agent.

    27. The artificial nucleic acid according to any one of claims 1 to 21, wherein the recruiting moiety comprises a nucleic acid sequence capable of specifically binding to the deaminase, preferably an adenosine or cytidine deaminase.

    28. The artificial nucleic acid according to claim 27, wherein the recruiting moiety comprises a nucleic acid sequence capable of specifically binding to the dsRNA binding domain of the deaminase, preferably an adenosine or cytidine deaminase.

    29. The artificial nucleic acid according to any one of claims 1 to 21, 27 and 28, wherein the recruiting moiety comprises a nucleic acid sequence that is capable of intramolecular base pairing, preferably capable of forming a stem-loop structure.

    30. The artificial nucleic acid according to claim 29, wherein the stem-loop structure comprises a double-helical stem comprising at least two mismatches.

    31. The artificial nucleic acid according to claim 29 or 30, wherein the stem loop structure comprises a loop consisting of from 3 to 8, preferably from 4 to 6, more preferably 5, nucleotides, wherein the loop preferably comprises the nucleic acid sequence GCUAA or GCUCA.

    32. The artificial nucleic acid according to any of claims 1 to 21 and 27 to 31, wherein the recruiting moiety comprises a nucleic acid sequence comprising at least one nucleotide, wherein the nucleobase is chemically modified, and/or wherein the nucleic acid sequence comprises at least one backbone modification.

    33. The artificial nucleic acid according to claim 32, wherein the recruiting moiety comprises a nucleic acid sequence comprising at least one chemically modified nucleotide, which is chemically modified at the 2′ position.

    34. The artificial nucleic acid according to claim 33, wherein the chemically modified nucleotide comprises a substituent at the 2′ carbon atom, wherein the substituent is selected from the group consisting of a halogen, an alkoxy group, a hydrogen, an aryloxy group, an amino group and an aminoalkoxy group, preferably from 2′-hydrogen, 2′-O-methyl, 2′-O-methoxyethyl and 2′-fluoro; and/or wherein the chemically modified nucleotide is a locked nucleic acid (LNA) nucleotide, an ethylene bridged nucleic acid (ENA) nucleotide or an (S)-constrained ethyl cEt nucleotide.

    35. The artificial nucleic acid according to any of claims 32 to 34, wherein the recruiting moiety comprises a nucleic acid sequence comprising at least one backbone modification and wherein the phosphate group linking the sugars of two neighbouring nucleotides is a modified phosphate group, preferably selected from the group consisting of a phosphorothioate, a phosphoroselenate, a borano phosphate, a borano phosphate ester, a hydrogen phosphonate, a phosphoroamidate, an alkyl phosphonate, an aryl phosphonate and a phosphotriester.

    36. The artificial nucleic acid according to any of claims 32 to 35, wherein the recruiting moiety comprises a nucleic acid sequence, wherein at least 40% of the nucleotides are chemically modified at the 2′ position.

    37. The artificial nucleic acid according to any of claims 32 to 36, wherein the recruiting moiety comprises a nucleic acid sequence, wherein at least of two of the five nucleotides at the 5′ terminus of the nucleic acid sequence comprise a phosphorothioate group.

    38. The artificial nucleic acid according to any of claims 32 to 37, wherein the recruiting moiety comprises a nucleic acid sequence, wherein at least of two of the five nucleotides at the 5′ terminus of the nucleic acid sequence are LNA nucleotides, ENA nucleotides or (S)-constrained ethyl cEt nucleotides.

    39. The artificial nucleic acid according to any of claims 32 to 38, wherein the recruiting moiety comprises a nucleic acid sequence comprising at least one nucleotide comprising a modified phosphate group, preferably a phosphorothioate group; at least one LNA nucleotide, ENA nucleotide or (S)-constrained ethyl cEt nucleotide; and at least one nucleotide comprising a substituent at the 2′ carbon atom, wherein the substituent is selected from the group consisting of a halogen, an alkoxy group, a hydrogen, an aryloxy group, an amino group and an aminoalkoxy group, preferably from 2′-hydrogen, 2′-O-methyl, 2′-O-methoxyethyl and 2′-fluoro.

    40. The artificial nucleic acid according to any of claims 1 to 21 and 27 to 39, wherein the recruiting moiety comprises a nucleic acid sequence selected from the group consisting of TABLE-US-00015 (a) (SEQ ID NO: 38) 5′ GGUGUCGAG-Na-AGA-N.sub.c-GAGAACAAUAU-G CU A/C A-AUGUUGUUCUC-N.sub.d-UCU-N.sub.b-CUCGA CACC 3′; (b) (SEQ ID NO: 39) 5′ GsGsUGUCGAG-N.sub.a-AGA-N.sub.c-GAGAACAAUAU- GCU A/C A-AUGUUGUUCUC-N.sub.d-UCU-N.sub.b-CUCGA CACC 3′; and (c) (SEQ ID NO: 40) 5′ GslGslUGUCGAG-N.sub.a-AGA-N.sub.c-GAGAACAAU AU-GCU A/C A-AUGUUGUUCUC-N.sub.d-UCU-N.sub.b-CU CGACACC 3′; or a fragment or variant of any of these nucleic acid sequences; wherein N.sub.a and N.sub.b form a mismatch, preferably wherein N.sub.a is adenosine and N.sub.b is cytidine; N.sub.c and N.sub.d form a mismatch, preferably wherein N.sub.c and N.sub.d are guanosine; Gs is a guanosine comprising a phosphorothioate group; and GsI is an LNA guanosine comprising a phosphorothioate group.

    41. The artificial nucleic acid according to any of claims 1 to 21 and 27 to 39, wherein the recruiting moiety comprises a nucleic acid sequence derived from VA RNA I, or a fragment or variant thereof.

    42. The artificial nucleic acid according to any of claims 1 to 21, 27 to 39 and 41, wherein the recruiting moiety comprises the nucleic acid sequence TABLE-US-00016 (SEQ ID NO: 41) GCACACCTGGGTTCGACACGCGGGCGGTAACCGCATG GATCACGGCGGACGGCCGGATTCGGGGTTCGAACCCC GGTCGTCCGCCATGATACCCTTGC, or a fragment or variant thereof.

    43. The artificial nucleic acid according to any of claims 40 to 42, wherein the recruiting moiety comprises a nucleic acid sequence as defined in said claims, wherein at least one nucleotide, preferably at least 40%,50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% of the nucleotides, comprises a substituent at the 2′ carbon atom, wherein the substituent is selected from the group consisting of a halogen, an alkoxy group, a hydrogen, an aryloxy group, an amino group and an aminoalkoxy group, preferably from 2′-hydrogen, 2′-O-methyl, 2′-O-methoxyethyl and 2′-fluoro.

    44. The artificial nucleic acid according to any of the preceding claims, wherein the recruiting moiety comprises a nucleic acid sequence selected from the group consisting of TABLE-US-00017 (a) (SEQ ID NO: 42) 5′ G*G*U*GU*C*GAG-N.sub.a-AGA-N.sub.c-GAGAAC*AA U*AU*-GC*U* A/C A- AU*GU*U*GU*U*C*U* C*-N.sub.d-U*C*U*-N.sub.b*-C*U*C*GAC*AC*C* 3′; (b) (SEQ ID NO: 43) 5′ Gs*Gs*U*GU*C*GAG-N.sub.a-AGA-N.sub.c-GAGAAC* AAU*AU*-GC*U* A/C A-AU*GU*U*GU*U*C*U* C*-N.sub.d-U*C*U*-N.sub.b*-C*U*C*GAC*AC*C* 3′; and (c) (SEQ ID NO: 44) 5′ Gsl*Gsl*U*GU*C*GAG-N.sub.a-AGA-N.sub.c-GAGA AC*AAU*AU*-GC*U* A/C A-AU*GU*U*GU*U*C *U*C*-N.sub.d-U*CU*-N.sub.b*-C*U*C*GAC*AC*C* 3′; or a fragment or variant of any of these sequences; wherein N.sub.a and N.sub.b form a mismatch, preferably wherein N.sub.a is adenosine and N.sub.b is cytidine; N.sub.c and N.sub.d form a mismatch, preferably wherein N.sub.c and N.sub.d are guanosine; Gs is a guanosine comprising a phosphorothioate group; GsI is an LNA guanosine comprising a phosphorothioate group; and wherein an asterisk (*) indicates a modification of the nucleotide at the 2′ carbon atom, preferably with 2′-hydrogen, 2′-O-methyl, 2′-O-methoxyethyl or 2′-fluoro.

    45. Artificial nucleic acid for site-directed editing of a target RNA, the artificial nucleic acid comprising a) a targeting sequence, which comprises or consists of a nucleic acid sequence complementary or partially complementary to a target sequence in the target RNA, and b) a recruiting moiety for recruiting a deaminase, wherein the recruiting moiety comprises a nucleic acid sequence capable of specifically binding to the deaminase, preferably an adenosine or cytidine deaminase, wherein the recruiting moiety is characterized by any one of the features defined in claims 27 to 44.

    46. The artificial nucleic acid according to any of the preceding claims, which further comprises a moiety, which enhances cellular uptake of the artificial nucleic acid.

    47. The artificial nucleic acid according to claim 46, wherein the moiety enhancing cellular uptake is a triantennary N-acetyl galactosamine (GalNAc3), which is preferably conjugated with the 3′ terminus or with the 5′ terminus of the artificial nucleic acid.

    48. The artificial nucleic acid according to any of the preceding claims, comprising in 5′ to 3′ direction the recruiting moiety and the targeting sequence defined in the preceding claims.

    49. The artificial nucleic acid according to any of the preceding claims, which is an RNA.

    50. The artificial nucleic acid according to any of the preceding claims, wherein the deaminase is an adenosine deaminase or a fragment or variant thereof, preferably selected from the group consisting of ADAR1, ADAR2 and a fragment or variant thereof, more preferably a peptide or protein comprising an adenosine deaminase domain; or a cytidine deaminase or a fragment or variant thereof, preferably Apobec1 or a fragment or variant thereof, more preferably a peptide or protein comprising a cytidine deaminase domain.

    51. The artificial nucleic acid according to any of the preceding claims, wherein the deaminase is an adenosine deaminase, preferably a eukaryotic adenosine deaminase, more preferably a vertebrate adenosine deaminase, even more preferably a mammalian adenosine deaminase, most preferably a human adenosine deaminase, or a cytidine deaminase, preferably a eukaryotic cytidine deaminase, more preferably a vertebrate cytidine deaminase, even more preferably a mammalian cytidine deaminase, even more preferably a murine or a human cytidine deaminase, most preferably mApobec1.

    52. The artificial nucleic acid according to any of the preceding claims, wherein the site-directed editing comprises the deamination of adenosine or cytidine in the target sequence.

    53. Vector encoding the artificial nucleic acid according to any of the preceding claims.

    54. Cell comprising the artificial nucleic acid according to any of claims 1 to 52 or the vector according to claim 53.

    55. Composition comprising the artificial nucleic acid according to any one of claims 1 to 52, the vector according to claim 53 or the cell according to claim 54, and an additional excipient, preferably a pharmaceutically acceptable excipient.

    56. The composition according to claim 55 comprising the artificial nucleic acid or the vector in the form of a nanoparticle, preferably a lipid nanoparticle or a liposome.

    57. The composition according to claim 55 or 56, wherein the artificial nucleic acid or the vector is complexed by a cationic compound.

    58. The composition according to claim 57, wherein the cationic compound is a cationic lipid.

    59. Kit comprising the artificial nucleic acid according to any one of claims 1 to 52, the vector according to claim 53, the cell according to claim 54, or the composition according to any of claims 55 to 58.

    60. Use of the artificial nucleic acid according to any of claims 1 to 52, the vector according to claim 53, the cell according to claim 54, the composition according to any of claims 55 to 58 or the kit according to claim 59 for site-directed editing of a target RNA.

    61. Use of the artificial nucleic acid according to any of claims 1 to 52, the vector according to claim 53, the cell according to claim 54, the composition according to any of claims 55 to 58 or the kit according to claim 59 for in vitro diagnosis of a disease or disorder.

    62. Method for site-directed editing of a target RNA, which comprises contacting a target RNA with the artificial nucleic acid according to any of claims 1 to 52.

    63. The artificial nucleic acid according to any of claims 1 to 52, the vector according to claim 53, the cell according to claim 54, the composition according to any of claims 55 to 58 or the kit according to claim 59 for use as a medicament.

    64. The artificial nucleic acid according to any of claims 1 to 52, the vector according to claim 53, the cell according to claim 54, the composition according to any of claims 55 to 58 or the kit according to claim 59 for use in the treatment or prophylaxis of a disease or disorder selected from the group consisting of infectious diseases, tumour diseases, cardiovascular diseases, autoimmune diseases, allergies and neurological diseases or disorders.

    65. The artificial nucleic acid according to any of claims 1 to 52, the vector according to claim 53, the cell according to claim 54, the composition according to any of claims 55 to 58 or the kit according to claim 59 for use in the treatment or prophylaxis of a disease or disorder, wherein the treatment or prophylaxis comprises a step of site-directed editing of a target RNA.

    66. The artificial nucleic acid according to any of claims 1 to 52, the vector according to claim 53, the cell according to claim 54, the composition according to any of claims 55 to 58 or the kit according to claim 59 for use in the diagnosis of a disease or disorder, which is preferably selected from the group consisting of infectious diseases, tumour diseases, cardiovascular diseases, autoimmune diseases, allergies and neurological diseases or disorders.

    67. Method for treating a subject with a disease or a disorder, the method comprising administering an effective amount of the artificial nucleic acid according to any of claims 1 to 52, the vector according to claim 53, the cell according to claim 54, or the composition according to any of claims 55 to 58 to the subject.

    68. The method according to claim 67, wherein the disease or the disorder is selected from the group consisting of infectious diseases, tumour diseases, cardiovascular diseases, autoimmune diseases, allergies and neurological diseases or disorders.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0147] The figures shown in the following are merely illustrative and shall describe the present invention in a further way. These figures shall not be construed to limit the present invention thereto.

    [0148] FIG. 1: Editing in engineered ADAR-expressing cell lines (293 Flp-In T-REx). A) Sequences and chemical modification patterns of several ASO designs. B) Initial sequence screening with plasmid-encoded guideRNAs by editing of a luciferase reporter. C) Comparative editing of two endogenous transcripts (ACTB, GAPDH) by transfection of the respective chemically modified ASOs into the indicated ADAR-expressing cell line. Either a single ASO (against GAPDH or ACTB) or two ASOs (against GAPDH and ACTB) were transfected. Data in B) are shown as the mean±SD, N=2 independent experiments. Data in C) are shown as the mean±SD, N=3 independent experiments. A1p110=ADAR1P110; A1p150=ADAR1p150.

    [0149] FIG. 2: Editing of endogenous transcripts (GAPDH, ACTB, each 5′-UAG triplet in the 3′-UTR) by recruitment of endogenous ADARs in various cells and cell lines by transfection with various ASOs. Experiments were performed in presence or absence of IFN-α, as indicated. [0150] A) Comparing three different ASOs for the recruitment of endogenous ADAR in HeLa cells. Either a single guideRNA (against GAPDH or ACTB) or both guideRNAs (against GAPDH and ACTB) were transfected. “no R/G” means an ASO lacking the ADAR recruiting domain. B) Comparative editing of guideRNA v9.4 and v9.5 on GAPDH. C) Effect of isoform-specific ADAR knockdown on the GADPH editing yield in HeLa cells. D) The knock-down efficiency was verified by Western blot. E) Determination of the effective dose (ED50) of ASO v9.5 for editing GAPDH in HeLa cells in a 96-well format. ED50=0.2 pmol/well (with IFN-α) and 0.4 pmol/well (without IFN-α). F) Time-course of GAPDH editing yields in HeLa cells with and without IFN-α. G) GAPDH editing yields with 5 pmol/96 well (25 pmol/24 well for SH-SYSY) ASO v9.5 in various standard (cancer) cells lines. H) GAPDH editing yields with ASO v9.5 (25 pmol/24 well, if not indicated differently) in various primary human cells. HUVEC=human umbilical vein endothelial cells; HAEC=human aortic endothelial cells; NHA=normal human astrocytes; RPE=human retinal pigment epithelium; NHBE=normal human bronchial epithelium. A-H) Data are shown as the mean±SD, N=3 independent experiments, experiments in hepatocytes are single determinations for each donor or an average (mean±SD) of the indicated donors. A1p150=ADAR1p150.

    [0151] FIG. 3: ORF editing in primary cells and applications. [0152] A) Editing of 5′-UAG codons in the ORF (site #2) versus 3′-UTR of endogenous GAPDH in 293-Flp-ln cells expressing the respective ADAR isoform applying ASO v9.4. B) ASO design v25 for ORF editing. C) Editing of a 5′-UAG site (#1) in the GAPDH ORF with ASO v25 in HeLa and primary cells. D) Editing of the Tyr701 site (5′-UAU codon) of STAT1 in HeLa and primary cells. E) Editing of the PiZZ mutation (E342K in SERPINA1, 5′-CAA codon) in ADAR1p150-expressing 293 cells, and in HeLa cells. SERPINA1 E342K cDNA was either co-transfected or genetically integrated into HeLa cells. A1AT secretion was data are shown as the mean±SD, N=3 independent experiments; experiments in hepatocytes are single determinations for each donor; n.d.=no editing was detectable.

    [0153] FIG. 4: Editing yields for the editing of a 5′-UAG codon in the ORF of GAPDH in HeLa cells with ASO v25 containing a chemically unmodified versus modified ADAR recruiting domain. [0154] ASO v25 with a chemically unmodified ADAR recruiting domain (unmod R/G), was compared to ASO of the same sequence with additional chemical modification (all pyrimidine nucleotides in the ADAR recruiting domain are backbone 2′-O-methylated). ASOs were transfected in HeLa cells. Data are shown as the mean±SD, N=3 independent experiments.

    [0155] FIG. 5: Preferred embodiments of ASOs according to the invention. [0156] A) General architecture of targeting sequence and recruiting moiety. Shown are different sequence variations of the recruiting moiety and different architectures of the targeting sequence. B) Exemplary modification patterns of the targeting sequence and the recruiting moiety, respectively.

    [0157] FIG. 6: Serum stability of unmodified and modified ASOs. [0158] A) Serum stability of a guideRNA targeting the codon 5′-AAA. GuideRNAs having a modified (2′-O-methyl or 2′-fluoro) nucleotide at the 5′ position of the anticodon were compared with the respective unmodified guideRNA. FIG. 2A shows an urea PAGE gel after incubation of the guideRNAs for from 5 minutes to 12 hours (see Example 5). B) Influence of the targeted codon on serum stability. C) Influence of the modification pattern of the targeting anticodon (3′-ACC) on serum stability.

    [0159] FIG. 7: Site-directed RNA editing by SNAP-tagged ADARs driven by short, chemically modified guideRNAs. [0160] a) The double-stranded RNA-binding domains (dsRBDs) of hADAR have been substituted with the SNAP-tag. The latter is able to form a covalent bond to a guideRNA that is modified with benzylguanine (BG). When bound to the SNAP-ADAR, the guideRNA targets the attached SNAP-ADAR protein to the catalyzed by the deaminase domain. b) A typical BG-guideRNA that targets a UAG site with a 5′-CCA anticodon. The guideRNA is 22-nt long and is densely chemically stabilized by 2′-methoxylation and terminal phosphorothioate linkages. The first three 5′-terminal nucleotides do not base pair with the target RNA, but serve as a linker. The sequence preferably comprises an unmodified or partially modified ribonucleotide gap (5′-CCA) which faces the target site and contains a central mismatching cytosine opposite the targeted adenosine for efficient deamination. A C6-amino-linker is located at the 5′-end of the guideRNA to introduce the BG modification to the full length oligonucleotide. c) Experimental setup. Cells with stably integrated SNAP-ADAR (SA) are seeded into 24-well plates with medium containing doxycycline (dox) to induce SA expression. 24 h later, the cells were reverse-transfected with the guideRNA. After 24 h, the cells were lysed for RNA isolation to analyze RNA editing.

    [0161] FIG. 8: Editing performance of four SNAP-ADARs. a) Engineered 293 cell lines expressing the respective SA enzyme were transfected with either a single gRNA or 4 gRNAs against 5′-UAG triplets in the indicated endogenous transcripts. b), c) Time- and dose-dependency of editing in the GAPDH transcript. d) Editing of 5′-UAG sites in various transcripts, 5′-UTR versus ORF and 3′-UTR. e) Comparative editing of all 16 triplets (5′-NAN) in the ORF of the endogenous GAPDH transcript. a)-e) Data are shown as the mean±SD, N=3 independent experiments, black clots represent individual data points.

    [0162] FIG. 9: Controlling off-target editing in SAQ cells. [0163] a) In order to avoid unintended editing of an adjacent adenosine at the target site, the opposing base in the guideRNA can be modified by 2′-methoxylation (M) or 2′-fluorination (F). This is exemplary shown for the triplet CAA. b) Off-target editing of an adjacent adenosine was detected in the triplets CAA, AAA, AAC and UAA when particularly using SA2Q cells. However, off-target editing was remarkably reduced when the strategy was applied. Data are shown as the mean±SD, N=3 independent experiments, black dots represent individual data points.

    [0164] FIG. 10: Effect of chemical modification on editing yields and serum stabilities. Examples of chemical modifications that stabilize the 3′-ACC anticodon (A) and the 3′-UCC anticodon (B), respectively, in the targeting sequence, e.g. 2′-F, 2′-O-methyl, 2′-deoxy and by phosporthioate modification.

    [0165] FIG. 11: Conjugation of branched and multiple copies of the coupling agents to guideRNAs. Shown are schemes for the coupling of 1×BG, 2×BG, or 4×BG either to one terminus or to two sites at an ASO. Those architectures allow for recruiting several deaminases to the target, clearly improving their editing performance, e.g. with respect to potency (see FIG. 12).

    [0166] FIG. 12: Application of branched/multiple coupling agents results. [0167] Various guideRNAs having an architecture as shown in FIG. 11 have been tested for the editing of the Tyr701 codon in the endogenous STAT1 transcript in 293-Flp-In cells expressing SNAP-ADAR1Q. Specifically, we applied guideRNAs that contained either a 5′-amino linker or both, a 5′- and a 3′-amino linker and linked them to one (single) or two (double) of the coupling agents (1×BG, 2×BG, or 4×BG), respectively.

    EXAMPLES

    [0168] The examples shown in the following are merely illustrative and shall describe the present invention in a further way. These examples shall not be construed to limit the present invention thereto.

    Example 1

    [0169] Unmodified RNA oligonucleotides were produced by in vitro transcription from linear synthetic DNA templates (purchased from Sigma-Aldrich, Germany) with T7 RNA polymerase (Thermo Scientific, USA) at 37° C. overnight. The resulting RNA was precipitated in ethanol and purified via urea (7M) polyacrylamide (15%) gel electrophoresis (PAGE), extracted into water, precipitated with ethanol and resuspended and stored in nuclease-free water. All chemically modified RNA oligonucleotides purchased from Biospring (Germany), Eurogentec (Belgium) or Dharmacon (USA). Long sequences were assembled from two pieces by ligation. As a first step, a plasmid-borne approach was applied in order to screen for suitable guideRNA sequences. A reporter editing assay (FIG. 1B), led to the identification of sequence variant 9.4 that has additional 5 bp at the 5′-site of the RNA helix in the ADAR recruiting domain.

    [0170] In the reporter editing assay, Firefly luciferase was expressed under control of a CMV promotor from a pShuttle-CMV plasmid. The W417X amber mutation was introduced via overlap PCR. Sequences of the cloned products were determined by Sanger sequencing. The RIG-guideRNAs were expressed under control of the U6 promotor from a modified pSilencer backbone similar as described in Wettengel et al. (Wettengel, J., Reautschnig, J., Geisler, S., Kahle, P. J., Stafforst, T. Harnessing human ADAR2 for RNA repair—Recoding a PINK1 mutation rescues mitophagy. Nucl. Acids Res. 45, 2797-2808 (2017). Sequences of the cloned products were determined by Sanger sequencing. Sequences of the applied R/G-guideRNAs are provided in Table 1.

    TABLE-US-00012 TABLE 1 R/G guideRNAs R/G guide RNAs expressed from plasmid 5′-3′ sequence Luciferase R/G-v1 (GUGGAAUAGUAUAACAAUAU GCUAAAUGUUGUUAUAGUAUC CCACGUGCAGCCAGCCGUCCU CUAGAGGGCCCUGAAGAGGGC CC) (SEQ ID NO: 61) Luciferase R/G-v4 (GUGGAAGAGGAGAACAAUAU GCUAAAUGUUGUUCUCGUCUC CCACGUGCAGCCAGCCGUCCU CUAGAGGGCCCUGAAGAGGGC CC) (SEQ ID NO: 62) Luciferase R/G-v9.4 (GUGGUCGAGAAGAGGAGAAC AAUAUGCUAAAUGUUGUUCUC GUCUCCUCGACCACGUGCAGC CAGCCGUCCUCUAGAGGGCCC UGAAGAGGGCCC) (SEQ ID NO: 63) Chemically synthesized ASOs 5′-3′ sequence ACTB 3′UTR 18 nt [GC AAU G](CCA) [UC AC] [C*][U*][C*][C*][C] (SEQ ID NO: 64) ACTB 3′UTR ASO (GGUGA AUAGUAUAAC AAUAU v1 GCUAA AUGUUGUUAUAGUAUCC ACC) [GC AAU G](CCA) [UC AC][C*][U*][C*] [C*][C](SEQ ID NO: 65) ACTB 3′UTR ASO (GGUGAAG AGGAGAACAA  v4 UAUGCUAAAU GUUGUUCUC GUCUCCACC)[GC AAU G] (CCA) [UC AC][C*][U*] [C*][C*][C] (SEQ ID NO: 66) ACTB 3′UTR ASO (GGU GUC GAG AAG AGG  v9.4 AGA AC AAU AUG CUA AAU GUUGUU CUCGUC UCC UCG ACA CC) [GC AAU G] (CCA) [UC AC][C*][U*] [C*][C*][C] (SEQ ID NO: 67) GAPDH 3′UTR 18 nt [AG GGG U](CCA) [CA UG][G*][C*] [A*][A*][C] (SEQ ID NO: 68) GAPDH 3′UTR (GGUGA AUAGUAUAAC  ASO v1 AAUAUGCUAA AUGUUGU UAUAGUAUCCACC)  [AG GGG U](CCA) [CA UG][G*][C*] [A*][A*][C] (SEQ ID NO: 69) GAPDH 3′UTR (GGUGAAG AGGAGAACAA UAUGCUAAAU ASO v4 GUUGUUCUCGUCUCCACC)[AG GGG U] (CCA)[CA UG][G*][C*][A*][A*] [C](SEQID NO: 70) GAPDH 3′UTR (GGU GUC GAG AAG AGG AGA AC  ASO v9.4 AAU AUG CUA AAU GUUGUU CUCGUC UCC UCG ACA CC) [AG GGG U](CCA) [CA UG] [G*][C*][A*][A*][C] (SEQ ID NO: 71) GAPDH 3′UTR [G*][G*][U](G)[U][C] ASO v9.5 (GAG AAG AGG AGA A)[C] (AA)[U](A)[U](G) [C][U] (A AA)[U](G)[UU](G) [UUCUC](G)[UCUCCUC](GA) [C](A) [CCAGGGGU](CCA) [CAUG][G*][C*][A*][A*] [C](SEQ ID NO: 72) GAPDH ORF1 ASO [GGG GUG](CCA) [AG CA] 18 nt [G*][U*][U*][G*][G] (SEQ ID NO: 73) GAPDH ORF1 ASO (GGU GUC GAG AAG AGG AGA v9.4 AC AAU AUG CUA AAU GUUGUU  CUCGUC UCC UCG ACA CC) [GGG GUG](CCA)[AG CA][G*] [U*][U*][G*][G] (SEQ ID NO: 74) GAPDH ORF2 ASO [GGG GUG](CCA)[AG CA] 18 nt [G*][U*][U*][G*][G] (SEQ ID NO: 75) GAPDH ORF2 ASO (GGU GUC GAG AAG AGG AGA v9.4 AC AAU AUG CUA AAU GUUGUU CUCGUC UCC UCG ACA CC) [GU UUU U](CCA) [GA CG] [G*][C*][A*][G*][G] (SEQ ID NO: 76) GAPDH ORF1 ASO [G]*[G]*[U](G)[U][C] v25 (GAG AAG AGG AGA A)[C] (AA) [U](A)[U](G) [C] [U](A AA)[U](G)[U][U] (G)[U][U][C][U][C](G) [U][C][U][C][C][U][C] (G A)[C](A) [C][C] (UUGUCAUGGAUGACCUUGGCCA) [G]{G}[GG UG](CCA) [AGCA]{G*}[U*][U*]{G*} [G](SEQ ID NO: 77) GAPDH ORF1 ASO [G]*[G]*[U](GUCGAG AAG  R/G unmod v25 AGG AGA ACAAUAUGCUAAAUG UUGUUCUCGUCUCCUCG ACACC UUGUCAUGGAUGACCUU GGCCA) [G][G][GG UG](CCA) [AGCA][G*][U*][U*]{G*} [G](SEQ ID NO: 78) SERPINA ASO v9.4 (GGU GUC GAG AAG AGG AGA AC AAU AUG CUA AAU GUUGUU CUCGUC UCC UCG ACA CC)  [CCU UUC](UCG) [UCG A] [U*][G*][G*][U*][C] (SEQ ID NO: 79) SERPINA ASO 40 nt (CAUGGCCCCAGCAGCUUCAGUC) [C]{C}[UUUC](UCG)[UCGA] {T*}[G*][G*]{T*}[C] (SEQ ID NO: 80) SERPINA ASO v25 [G*][G*][U](G)[U][C] (GAG AAG AGG AGA A)[C] (AA) [U](A)[U](G) [C] [U](A AA)[U](G)[U][U] (G)[U][U][C][U][C](G) [U][C][U][C][C][U][C] (G ACACC CAUGGCCCCAGCA GCUUCAGUC)[C]{C}[UUUC] (UCG) [UCGA]{T*}[G*] [G*]{T*}[C] (SEQ ID NO: 81) SERPINA ASO v25 [G*][G*][U](G)[U][C] (GAG AAG AGG AGA A)[C] (AA) [U](A)[U](G) [C] [U](A AA)[U](G)[U][U] (G)[U][U][C][U][C](G) [U][C][U][C][C][U][C] (G ACACC CAUGGCCCCAGCA GCUUCAGUC)[C]{C}[UUUCU] (CG) [UCGA][T*][G*] [G*]{T*}[C] (SEQ ID NO: 82) STAT1 ASO v25 [G*][G*][U](G)[U][C] (GAG AAG AGG AGA A)[C] (AA) [U](A)[U](G) [C] [U](A AA)[U](G)[U][U] (G)[U][U][C][U][C] (G)[U][C][U][C] [C][U][C](GACACCCAG ACACAGAAAUCAACUCAGU) [C][T][UGAU](ACA) [UCCA]{G*}[U*][U*] {C*}[C] (SEQ ID NO: 83) GAPDH 3′UTR (GGUGA AUAGUAUAAC  unmod ASO v1 AAUAUGCUAA AUGUUGUUA UAGUAUCCACC AG GGG UCCACA UG GCAAC) (SEQ ID NO: 84) GAPDH 3′UTR (GGUGAAG AGGAGAACAA UAU unmod ASO v4 GCUAAAU GUUGUUCUCGUCUCC ACCAG GGG UCCACA UGGCAAC) (SEQ ID NO: 85) GAPDH 3′UTR (GGU GUC GAG AAG AGG AGA unmod ASO v9.4 AC AAU AUG CUA AAU GUUGUU CUCGUC UCC UCG ACA CCAG GGG U CCACAU GGCAAC) (SEQ ID NO: 86) Sense guideRNAs for RT PCR 5′-3′ sequence GAPDH sense (GGACCAACUGCUUGGCACCCCUG GCCAAGGUCAUCCAUGACAACUUU GGUAUCGUGGAAGGACC) (SEQ ID NO: 87) STAT1 sense (GGGAACUGGAUCUAUCAAGACUG AGUUGAUUUCUGUGUCUGAAGUGU AAGUGAACACAGAA)  (SEQ ID NO: 88) SERPINA1 sense (GGACCATCGACGAGAAAGGGACT GAAGCTGCTGGGGCCATGTTTTTA GAGGCCATACCCAT) (SEQ ID NO: 89) Legend to Table 1:(N) = RNA base, [N] = 2′-OMe RNA base, *= Phosphorothioate linkage, {N} = LNA base

    [0171] Flp-In 293 T-REx cells (R78007, Thermo Fisher scientific) containing the respective gnomically integrated ADAR version were generated as described in Wettengel et al. and in Heep et al. (Heep, M., Mach, P., Reautschnig, P., Wettengel, J., Stafforst, T. Applying Human ADAR1p110 and ADAR1p150 for Site-Directed RNA Editing—G/C Substitution Stabilizes GuideRNAs Against Editing. Genes 8, 34 (2017)). Cells were cultured in DMEM+10% FBS+100 μg/ml hygromycin B+15 μg/ml blasticidin S. For editing, 2.5×10.sup.5 cells/well (ADAR1p110, ADAR1p150) or 3×10.sup.5 cells/well (ADAR2) were seeded into poly-D-lysine-coated 24-well plates in 500 μl DMEM+10% FBS+10 ng/ml doxycycline. Twenty-four hours later, transfection was performed with the luciferase reporter plasmid (300 ng) and the R/G-guideRNA (1300 ng) using a Lipofectamine-2000 to plasmid ratio of 3:1. The medium was changed every 24 h until harvest. RNA was isolated and sequenced 72 h post transfection, as described above.

    [0172] Even though being less effective in recruiting ADAR2 (35% reduced editing yield), sequence variant 9.4 turned out to improve editing yield with ADAR1p110 by almost twofold.

    [0173] In a next step, the plasmid-borne expression of the guideRNA was replaced by the administration of chemically stabilized antisense oligonucleotides (ASO). In the first round, three chemically stabilized ASO designs (v1, v9, v9.4) were tested for the editing of a respective 5′-UAG site in the 3′-UTR of GAPDH and ACTB. While the ADAR recruiting domain comprised of natural ribonucleotides, the 17 nt antisense part of the ASO was designed as an Antagomir-like modified gapmer10 (global 2′-Omethylation, 3′-terminal phosporthioate linkages, FIG. 1A) with a gap of three natural ribonucleosides opposite to the editing site, similar as described in Vogel et al. (Vogel, P., Schneider, M. F., Wettengel, J., Stafforst, T. Improving Site-Directed RNA Editing In Vitro and in Cell Culture by Chemical Modification of the GuideRNA. Angew. Chem. Int. Ed. 53, 6267-6271 (2014)) for the SNAP-ADAR approach. We constructed ASOs targeting a specific 5′-UAG site either in the 3′-UTR of the housekeeping gene ACTB or GAPDH.

    [0174] To assess the individual ADAR preference of such ASOs, we lipofected them into engineered 293 Flp-In T-REx cells expressing a specific ADAR isoform (ADAR2, ADAR1p110 or ADAR1p150)11 under control of a CMV tet-on promotor. 48 Hours before ASO transfection, 2×10.sup.5 of the respective ADAR-Flp-In 293 T-REx cells per well were seeded in 24 well plates in DMEM+10% FBS containing 10 ng/mL doxycycline for induction of ADAR gene expression. After 48 hours cells were detached and reverse-transfected in 96 well plates. To this end, the respective ASO (5 pmol/well unless stated otherwise) and Lipofectamine 2000 (0.75 μL/well) were each diluted with OptiMEM to a volume of 10 μL in separate tubes, respectively. After 5 minutes, both solutions were mixed and 100 μL cell suspension (5×10.sup.4 cells) in DMEM+10% FBS+10 ng/mL doxycycline was added to the transfection mixture inside 96 wells. 24 hours later, cells were harvested for RNA isolation and sequencing, as described above.

    [0175] Notably, particularly high editing yields (75-85%) were detected for both targets in ADAR1p150-expressing cells (FIG. 1C). The editing yields were lower for the ADAR1-isoform p110, ranging from 12-50%, however, the data clearly shows the strong (2-3fold) benefit in the editing yield for the new guideRNA sequence 9.4 compared to the initial version 1. Editing with ADAR2 stayed in a range comparable to that of ADAR1p110 (15-50%), again being less effective with the new design 9.4 compared to the old version 1. Finally, we tested the concurrent editing of both transcripts by co-transfection of both ASOs (FIG. 1C, right panel). The editing yields stayed virtually unchanged demonstrating that site directed RNA editing can potentially be carried out at several sites or transcripts simultaneously.

    Example 2

    [0176] In a further series of experiments, endogenously expressed ADAR was harnessed for the editing of a 5′-UAG codon in the 3′-UTR of the two housekeeping genes GAPDH and ACTB in HeLa cells by simple lipofection of the respective ASOs.

    [0177] To this end, HeLa cells (Cat. No.: ATCC CCL-2) were cultured in DMEM+10% FBS+P/S (100U/mL penicillin and 100 μg/mL streptomycin. 5×10.sup.4 cells in 100 μL DMEM+10% FBS 600 units IFN-α, Merck, catalog number IF007, lot number 2937858) were added to a transfection mix of 0.5 μL Lipofectamine 2000 and 5 pmol guideRNA/well in a 96-well format. For concurrent editing with two different ASOs, 2.5 pmol of each respective ASO were co-transfected. After 24 hours cells were harvested for RNA isolation and sequencing.

    [0178] A control ASO comprising only of the specificity domain but lacking the ADAR recruiting domain did not elicit any editing (FIG. 1A, 2A). Some editing was observed with the initial sequence v1 and the design v4 (FIG. 2A). However, the new sequence v9.4 gave clearly higher editing in both transcripts with yields around 40%. In view of the circumstance that ASO design v9.4 worked particularly well with ADARp150, the experiment was repeated with HeLa cells that were pre-treated with IFN-α, which is known to induce ADAR1p150 expression. Indeed, IFN-α treatment almost doubled the editing yields for all ASO designs (v1, v4, v9.4) and for both transcripts to obtain editing yields up to 70%. The results confirmed that sequence v9.4 is superior in harnessing endogenously expressed ADARs.

    [0179] Also in this series of experiments, editing of both transcripts was further analysed after simultaneous co-transfection of two guideRNAs. Also in this setting, the editing yields remained unchanged at high levels (FIG. 2A, right panel). In order to assess the influence of the chemical modification, the recruitment of overexpressed ADARs in Flp-In cells was also tested with unmodified, in-vitro transcribed guideRNAs of the same sequence, and was found to be clearly inferior compared to the chemically stabilized ASOs.

    [0180] In a next step, the chemical modification was extended to the ADAR recruiting domain. Specifically, the 5′-terminus was stabilized by 2′-O-methylation and phosphorthioate linkages and all pyrimidines were substituted with their 2′-O-methylated analogs. Even though heavily modified, this ASO design v9.5 was equal or even better in recruiting endogenous ADAR in HeLa cells (FIG. 2B), demonstrating that ADARs′ dsRNA-binding domains accept extensive chemical modification.

    [0181] In order to assess, which ADAR isoform was recruited by ASO v9.5 in HeLa cells, the expression of ADARs was determined in Western Blot experiments.

    [0182] For western blotting, cells were harvested and lysed in urea-lysis buffer (8 M urea, 100 mM NaH.sub.2PO.sub.4, 10 mM Tris, pH 8.0) 72 h after reverse transfection of the siRNA. Shear force was applied using a 23-gauge syringe, and the cell debris were removed by centrifugation at 30.000 g for 15 min at 4° C. Then a Bradford assay was used to normalize total protein amounts, and appropriate amounts of protein lysate in 1× Laemmli-buffer were loaded onto an SDS-PAGE (4% stacking, 12% separating gel). Proteins were transferred on a PVDF membrane using a tank-blotting-system at 30 V overnight. The membrane was blocked in 5% nonfat dry milk TBST+50 μg/ml avidin for 2h at room temperature, and was afterwards incubated with the primary antibodies (5% nonfat dry milk TBST+1:1000 α-ADAR1, Santa Cruz, sc-73408 or α-ADAR2, Santa Cruz, sc-73409+1:40.000 α-beta-actin, Sigma Aldrich, A5441) at 4° C. overnight. The secondary antibodies (5% nonfat dry milk TBST+1:10.000 α-Mouse-HRP+1:50.000 Precision Protein™ StrepTactin-HRP Conjugate, Bio-Rad, #1610381) were incubated for 1.5h at room-temperature. After each antibody incubation, the membrane was washed 3×5 min with TBST. Detection was performed using 1 ml of Clarity Western ECL Substrate (Biorad) and a Fusion SL Vilber Lourmat (Vilber).

    [0183] In Western Blot, only ADAR1p110 was found to be well expressed, whereas ADAR1p150 was only faintly visible but clearly inducible by IFN-α (FIG. 2D). ADAR2 was not detectable (data not shown). RNA interference was applied in order to knockdown specific ADAR isoforms. To this end, HeLa cells were reverse transfected in 12-well format with 2.5 pmol siRNA against ADAR1 (both isoforms, Dharmacon, SMARTpool: ON-TARGETplus ADAR (103) siRNA, L-008630-00-0005), ADAR1p150 (Ambion (Life Technologies), Sense strand: 5′-GCCUCGCGGGCGCAAUGAAtt (SEQ ID NO: 90); Antisense strand: 5′-UUCAUUGCGCCCGCGAGGCat (SEQ ID NO: 91)), ADAR2 (Dharmacon, SMARTpool: ON-TARGETplus ADARB1 (104) siRNA, L-009263-01-0005) or mock (Dharmacon, siGENOME Non-Targeting siRNA Pool #2, D-001206-14-05). 200 μl of transfection mix, containing 2.5 μl of the respective siRNA (1 nM) and 3 μl HiPerFect (Qiagen, Germany) and OptiMEM, were distributed evenly in each well before adding 800 μl DMEM+10% FBS containing 1.2×10.sup.5 HeLa cells. Medium was changed every 24 h. For RNA editing experiments, cells were detached 48 hours after siRNA transfection and were reverse-transfected with the respective ASO as described above.

    [0184] When transfecting an siRNA against ADAR2 or mock, respectively, the editing yield remained unaffected at 35% and 70%, depending on IFN-α, respectively (FIG. 2C). However, the specific knockdown of the long isoform ADAR1p150 resulted in a decrease of the editing yield down to 10% and 20%. The concurrent knockdown of both ADAR1 isoforms abolished editing below detection. This suggests that both ADAR1 isoforms contribute to editing, however, the much weaker expressed p150 isoform of ADAR1 contributed most to the editing yields achieved. This is in good agreement with the observed positive effect of IFN-α treatment (FIG. 2), but also with the better performance of the ASO in ADAR1p150-expressing 293 Flp-In cells (FIG. 1C).

    [0185] When varying the amount of ASO v9.5 between 20 pmol and 40 fmol/96 well (FIG. 2E), a sigmoidal dependency of the editing yield was observed, reaching the half-maximum yield at a dose of 0.2 pmol ASO/96 well (with IFN-α) and 0.4 pmol/well (without IFN). The maximum editing yield was obtained at ≥2 pmol/96 well. The potency in HeLa cells seems to be in a range similar to that for the transfection of siRNA duplexes for RNA interference.

    [0186] The time profile of the editing yield was further assayed over five days after transfection of 5 pmol/well into quickly dividing HeLa cells (10% FBS). For that purpose, HeLa cells were transfected as described above. Prior to transfection, cells were treated with IFN-α for 24 hours (where indicated). Cells were harvested for RNA isolation at the respective time points indicated. For time points later than 24 hours post transfection, cells were detached after 24 hours and transferred into 24-well plates in order to avoid overgrowth of the cells. Medium (containing IFN-α where indicated) was changed every 24 hours. The maximum editing yield was typically observed in a time window of 12-48 hours after transfection and dropped down slowly (FIG. 2F).

    [0187] In order to assess the scope of cell lines, in which the recruitment of endogenous ADAR works efficiently, ASO v9.5 was applied to a panel of 10 immortalized human standard (cancer) cell lines (FIG. 2G). All cells were cultured in DMEM+10% FBS+P/S. 5×10.sup.4 cells/96 well of the respective cell line [HeLa cells (Cat. No.: ATCC CCL-2), U2OS-Flp-In T-REx (kind donation from Prof. Elmar Schiebel), SK-N-BE(2) (Cat. No.: ATCC CRL-2271), SK-N-BE(2) (Cat. No.: ATCC CRL-2271), U87MG (Cat. No.: ATCC HTB-14), Huh7 (CLS GmbH, Heidelberg, Cat. No.: 300156), HepG2 (DSMZ, Braunschweig, Germany Cat. No.: ACC180), AKN-1 (kind donation from the Nüssler lab), empty HEK-Flp-ln T-REx (R78007, Thermo Fisher scientific, stably transfected with empty pcDNA5 vector) and A549 (European Collection of Authenticated Cell Cultures ECACC 86012804)] were reverse transfected with the respective ASO as described above for HeLa cells without further optimization. Only SH-SY5Y (Cat. No.: ATCC CRL-2266) cells were reverse transfected differently, in a 24-well format: to 100 μL transfection mix consisting of 2.5 μL Lipofectamine2000 and 25 pmol ASO in OptiMEM, 5×10.sup.5 cells in 500 μL medium (+3000 U IFN-α) were added. In some cell lines, like e.g. A549 and Huh7, the editing yield was comparable to HeLa cells, while others showed a lower editing yield. The lowest level of editing was obtained with the “empty” 293 Flp-ln cell line (empty pcDNA5 was integrated) with <11% yield under all conditions. Prior to IFN-α treatment, editing yields of 4%-34% (average 18.5%) were achieved. Similar as described before, the yields were 2-3fold higher after IFN-α treatment ranging from 11%-73% (average 46.8%).

    [0188] In order to better assess the potential therapeutic scope of ADAR-recruiting ASOs, a panel of seven primary cells from different tissues was tested, including fibroblasts (from a Parkinson patient), and commercially acquired astrocytes, hepatocytes (several donors), epithelial cells from the retina and the bronchia, and endothelial cells from arterial and venous vessels (FIG. 2H). All primary cells were purchased from Lonza except for the primary fibroblasts, which were a kind gift from the Valente lab. Primary fibroblasts were cultured in DMEM+20% FBS. The other cell lines were cultured in their respective commercial media as indicated: Human Umbilical Vein Endothelial Cells (HUVEC, Lonza Cat. No.: CC-2517) and Human Aortic Endothelial Cells (HAEC, Lonza Cat. No.: CC-2535) in medium 200PRF (Thermo Fisher Scientific Cat. No.: M200PRF500) with Low Serum Growth Supplement (LSGS Thermo Fisher Scientific Cat. No.: S00310), Normal Human Astrocytes (NHA, Lonza Cat. No.: CC-2565) in ABM Basal Medium (Lonza Cat. No.: CC-3187) with AGM SingleQuot Kit Suppl. & Growth Factors (Lonza Cat. No.: CC-4123), Human Retinal Pigment Epithelial Cells (H-RPE, Lonza Cat. No.: 194987) in EpiLife Medium (Thermo Fisher Scientific Cat. No.: MEPI500CA) with Human Corneal Growth Supplement (Thermo Fisher Scientific Cat. No.: S0095), Normal Human Bronchial Epithelial Cells (NHBE, Lonza Cat. No.: CC-2540) in Airway Epithelial Cell Basal Medium (LGC Standard Cat. No.: ATCC-PCS-300-030) with Bronchial Epithelial Cell Growth Kit (LGC Standard Cat. No.: ATCC-PCS-300-040) and Primary Human Hepatocytes (PHH, Lonza Cat. No.: HUCPI) were thawed in Cryo HH thawing media (Lonza Cat. No.: MCHT50), seeded in Hepatocyte Plating Medium w/Supplement (Lonza Cat. No.: MP100) and 6 hours after seeding cultured in Hepatocyte Maintenance Media w/Supplement (Lonza Cat. No.: MM250). 3.5×10.sup.4 HUVEC and HAEC, 1×10.sup.5 NHA, H-RPE and NHBE and 4.5×10.sup.5 PHH were seeded 24 hours before ASO transfection in 24-well format. For PHH rat collagen I-coated 24-well plates (GreinerBioOne) were used. Shortly before transfection, medium was changed (plus 3000U IFN-α in 500 μL medium/well if indicated). For each well, 1.5 μL Lipofectamine RNAiMAX (Thermo Fisher Scientific) and 25 pmol ASO were diluted separately in a total volume of 50 μL OptiMEM, respectively. After 5 minutes of incubation, the two solutions were combined and after another 20 min of incubation, the 100 μL transfection mix was equally distributed in one well. After 24h cells were harvested for RNA isolation and sequencing. Unexpectedly, higher editing levels were detected in primary cells compared to immortalized cells, obtaining editing levels of 10%-63% (average 31.5%). Notably, in both primary hepatocyte samples and in the patient fibroblast, the editing levels were higher than in HeLa cells. Again, editing yields increased in all cells after IFN-α treatment yielding a range from 35%-77% (average 62.6%). A series of ASO dilutions (25-0.2 pmol ASO v9.5/24 well, no IFN treatment) was transfected into hepatocytes of donor #1 and #2, demonstrating a clear close-dependency (FIG. 2H).

    Example 3

    [0189] Following the characterization of ASO design 9.4 for the editing of 5′-UAG triplets in the 3′-UTR, the editing of a 5′-UAG triplet in the ORF of GAPDH in ADAR-expressing 293 cell lines was tested with an ASO based on v9.4 (see also Example 1). Comparison of the editing yields obtained with the three ADARs showed that the editing yields in the ORF followed the same trend as in the 3′-UTR before (ADAR1p150>ADAR1p110 ADAR2), albeit with generally lower editing yields (11%-55%, see FIG. 3A).

    [0190] The ASO architecture was further optimized in order to improve the on-target binding kinetics by increasing the length of specificity domain and by including LNA modifications. We identified ASO design v25, which comprises of the unaltered ADAR-recruiting domain, but contained a 40 nt specificity domain, which was partly modified by 2′-O-methylation, phosphorothioate linkage and contained three LNA modifications (FIG. 3B). After transfection into HeLa cells, ASO v25 achieved editing yields of 26±3% without IFN- and of 42.7±1.5% with IFN-. Notably, the chemical modification of the ADAR-recruiting domain was important. Without chemical modification, v25 gave no editing in absence of IFN- and only moderate editing with IFN-(13.7±3.5%, FIG. 4). The new design v25 was also tested in several primary cells for the editing of the 5′-UAG site in the ORF of GAPDH. Prior to IFN-treatment, editing levels of 12.7±2.1% (fibroblast), 9.3±0.6% (RPE), and 38% (hepatocyte, one donor) were obtained. As before, IFN-treatment improved the editing levels to 22.7±0.6% (fibroblast), 32.3±4.5% (RPE), and 45% (hepatocyte, one donor).

    Example 4

    [0191] In order to evaluate the therapeutic potential of such ASOs, the editing of two therapeutically relevant deamination sites was tested. First, the phosphorylation site in endogenous STAT1 (Tyr701) was targeted, deamination of which switches function of the protein as a transcription factor. After editing, the respective 5′-UIU codon encodes for Cys, an amino acid that is unable to mimic phosphorylated Tyr. An ASO based on the v25 design described above was used in these experiments. Editing yields of 21.0±6.2% were achieved in primary fibroblasts and up to 7% in RPE cells prior to IFN-α treatment (FIG. 3D). In presence of IFN-α, the yields increased to 32±7% (fibroblasts) and 19.7±2.5% (RPE). Similar values were obtained in HeLa cells. Overall, editing of the endogenous STAT1 transcript by recruiting endogenous ADAR was possible in moderate yields in primary cell lines.

    [0192] As a second site, the editing of the PiZZ mutation (E342K) in the SERPINA1 transcript, the most common cause of α1-antitrypsin deficiency (A1AD), was tested. Loss of antitrypsin, which regulates neutrophil elastase activity, causes severe damage of the lungs. Furthermore, mutated antitrypsin accumulates in the liver and leads to severe liver damage. First, the editing of the E342K mutation (5′-CAA triplet) was tested upon overexpression of the mutated SERPINA1 cDNA in ADAR1p150-expressing 293 cells applying an ASO build on the v9.4 design. In order to obtain SERPINA1 cDNA for cloning, total RNA was isolated from HepG2 cells and reverse transcribed. The E342K mutation was inserted into the cDNA by PCR and both SERPINA1 wild-type and the E342K mutant were each cloned on a pcDNA3.1 vector under control of the CMV promotor using HindIII and ApaI restriction. For genomic integration of SERPINA1 using the piggyBac transposon system, the wild-type and mutant cDNA was cloned on a PB-CA vector using the same restriction sites as above. 1×10.sup.6 HeLa cells were seeded in a six-well plate 24 hours before transfection. 1 μg of the piggyBac transposase vector (Transposagen Biopharmaceuticals) and 2.5 μg of the SERPINA1 PB-CA vector were co-transfected using 10.5 μL FuGENE6 (Promega) according to the manufacturer's protocol. After 24 hours, cells were selected for 2 weeks in DMEM+10% FBS medium containing 10 μg/mL puromycin. For editing, stably transfected or plasmid transfected (300 ng plasmid/0.9 μL FuGENE6 for Hela and 100 ng plasmid/0.3 μL Lipofectamine2000 for Flp-ADAR1p150 cells) cells were reverse transfected with the respective ASO as described above. After 24 hours, cell culture supernatant was collected for the A1AT-ELISA and cells were harvested for RNA isolation and sequencing. The A1AT-ELISA was performed with a commercial kit (cat. no.: ab108799, Abcam) according to the manufacturer's protocol. Samples from three biological replicates were measured in technical duplicates. The MAT protein amount was calculated from a standard curve using linear regression.

    [0193] Only in presence of the ASO, an editing yield of 29±2% was determined at the targeted site (FIG. 3E). The secretion of α1-antitrypsin (A1AT) was measured by an ELISA assay and normalized to the secretion of cells transfected with wildtype SERPINA cDNA. The secretion level was elevated from 14±1.8% prior to 27±4.3% after repair. Other than the 5′-UAG triplet, the 5′-CAA triplet contains an editable adenosine in closest proximity to the targeted A. Indeed, some minor editing was detected at the proximal site, a problem that may be solved by further chemical modification of the ASO around the target nucleotide. To test the repair of A1AD-causing mutation with endogenous ADAR, a HeLa cell line stably expressing mutated SERPINA1 was created using the piggyBac system or by plasmid-borne overexpression of SERPINA1 cDNA. By applying an ASO based on the v25 design, editing levels of 19±2% (integrated cDNA, with IFN-α) and 21±4% (transient expression of cDNA, with IFN-α) were obtained by recruitment of endogenous ADAR.

    Example 5

    [0194] In order to test the guideRNA stabilities, guideRNAs have been incubated for a defined amount of time (0 min, 5 min, 10 min, 1 h, 3 h, 6 h, 12 h or 24 h) in PBS buffer containing 10% FBS. After incubation, the guideRNAs were separated on a 15% Urea (7M)-PAGE, stained with SYBR Gold and were photographed and quantified with a Typhoon FLA biomolecular imager. The guideRNAs with the unmodified 3 nt anticodon typically had very short half-lifes in serum (minutes). The guideRNA with a 3′-UCU anticodon targeting the 5′-AAA codon, e.g. FIG. 6A), was essentially undetectable at the first incubation time point (5 min) due to degradation. However, already single backbone modification with 2′-F or 2′-O-methyl gave improved stability (FIGS. 6A and B). For the anticodon 3′-ACC, it was shown, for example, that the half-life was strongly improved from below 5 min to around 24 h (ca. 300 fold improvement) by several modification patterns that each modify all nucleotides in the anticodon. Further, the editing yield was also increased by these modifications compared to the guideRNA (BG-85) unmodified in the 3 nt anticodon (see, for example, BG-150/BG-151, FIG. 6C).

    Example 6

    [0195] In a parallel approach, guideRNAs conjugated with a coupling agent were employed for editing endogenous transcripts with tagged ADARs. For example, BG-conjugated guideRNAs were used in combination with SNAP-tagged ADARs (see FIG. 7). BG-conjugated gRNAs were synthesized and PAGE-purified from commercially acquired oligonucleotides containing a 5′-amino-C6 linker (BioSpring, Germany) as described by Hanswillemenke et al. (J. Am. Chem. Soc. 2015, 137, 15875-15881). The sequences and chemical modification of all guideRNAs are provided in Table 2.

    TABLE-US-00013 TABLE 2 guideRNAs for use with tagged ADARs target gRNA sequence editing of various endogenous transcripts: 5′-UTR 5′-UsCsAUUAAACCCCAGAGUCsCsGsGsA-3′ SNAP-ADAR (SEQ ID NO: 92) 5′-UTR 5′-UsCsUGAAUAAUCCAGGAAAsAsGsCsA-3′ GAPDH (SEQ ID NO: 93) isoform 2 ORF 5′-UsAsUAGGGGUGCCAAGCACsUsUsGsG-3′ #1 (SEQ ID GAPDH NO: 94) ORF 5′-UsAsUGGUUUUUCCACACGGsCsAsGsG-3′ #2 (SEQ ID GAPDH.sup.b) NO: 95) ORF 5′-GsGsUGCAGAUUCCAGGUGGsGsAsCsG-3′ #1 (SEQ ID GUSB NO: 96) ORF 5′-AsCsAGACUUGGCCACUGAGsGsGsGsG-3′ #2 (SEQ ID GUSB NO: 97) 3′-UTR 5′-UsAsUGUGUCGGCCACGGAAsCsAsGsG-3′ SNAP- (SEQ ID ADAR NO: 98) 3′-UTR 5′-AsAsUAAGGGGUCCACAUGGsCsAsAsC-3′ GAPDH.sup.C) (SEQ ID NO: 99) 3′-UTR 5′-UsCsGAGCAAUGCCAUCACCsUsCsCsC-3′ ACTB (SEQ ID NO: 100) 3′-UTR 5′-UsAsUUUCCCUGCCAGAAUAsGsAsUsG-3′ GUSB (SEQ ID NO: 101) KRAS 5′-GsAsUGCUCCAACCACCACAsAsGsUsU-3′ target (SEQ ID NO: 102) A/1 KRAS 5′-CsCsUCUCUUGCCCACGCCAsCsCsAsG-3′ target (SEQ ID NO: 103) 2 STAT1 5′-CsUsCUCUUGAUACAUCCAGsUsUsCsC-3′ Y701 (SEQ ID NO: 104) editing of all 16 adenosine- containing triplets in GAPDH isoform 1: 5′-GAA 5′-CsAsCAUGCGAUUCCCAUUGsAsUsGsA-3′ (SEQ ID NO: 105) 5′-GAU 5′ - UsAsUCGACCAAACCCGUUGsAsCsUsC-3′ (SEQ ID NO: 106) 5′-GAC 5′-CsAsCGUCAUGAGCCCUUCCsAsCsCsA-3′ (SEQ ID NO: 107) 5′-GAG 5′- AsAsCGAGGGAUCCCGCUCCsUsGsGsA-3′ (SEQ ID NO: 108) 5′-CAA 5′-GsAsAGAGGCUGUCGUCAUAsCsUsUsC-3′ (SEQ ID NO: 109) 5′-CAU 5′-CsAsACACGUCAACGAAGGGsGsUsCsA-3′ (SEQ ID NO: 110) 5′-CAC 5′-AsAsCGCCAGGGGCGCUAAGsCsAsGsU-3′ (SEQ ID NO: 111) 5′-CAG 5′-UsAsCGCAUCGACCGUCCUCsAsUsCsA-3′ (SEQ ID NO: 112) 5′-AAA 5′-UsAsCAUGACCCUCUUGGCUsCsCsCsC-3′ (SEQ ID NO: 113) 5′-AAU 5′-GsAsCUACCCAAACUCGUUGsUsCsAsU-3′ (SEQ ID NO: 114) 5′-AAC 5′-AsGsUCGCCACAGCUUCCCGsGsAsGsG-3′ (SEQ ID NO: 115) 5′-AAG 5′-UsCsUAUAUCCACCUUACCAsGsAsGsU-3′ (SEQ ID NO: 116) 5′-UAA 5′-AsGsGAGGGGUCUCACUCCUsUsGsGsA-3′ (SEQ ID NO: 117) 5′-UAU 5′-CsUsACGCAACAACAUCCACsUsUsUsA-3′ (SEQ ID NO: 118) 5′-UAC 5′-CsCsGAGCGCCAGCAGAGGCsAsGsGsG-3′ (SEQ ID NO: 119) 5′-UAG 5′-UsAsUGGUUUUUCCAGACGCsCsAsCsG-3′ (SEQ ID NO: 120) avoiding off-target editing of neighbouring adenosine: 5′-CAA 5′-GsAsAGAGGCUCUCGUCAUAsCsUsUsC-3′ methoxy (SEQ ID NO: 121) 5′-CAA 5′-GsAsAGAGGCUGcustom-characterCGUCAUAsCsUsUsC-3′ fluoro (SEQ ID NO: 122) 5′-AAA 5′-UsAsCAUGACCCUCUUGGCUsCsCsCsC-3′ methoxy (SEQ ID NO: 123) 5′-AAA 5′-UsAsCAUGACCcustom-characterCUUGGCUsCsCsCsC-3′ fluoro (SEQ ID NO: 124) 5′-AAC 5′-AsGsUCGCCACAGCUUCCCGsCsAsGsG-3′ methoxy (SEQ ID NO: 125) 5′-AAC 5′-AsGsUCGCCACAGCcustom-character UCCCGsCsAsGsG-3′ fluoro (SEQ ID NO: 126) 5′-UAA 5′-AsGsGAGGGGUCUCACUCCUsUsGsGsA-3′ methoxy (SEQ ID NO: 127) 5′-UAA 5′-AsGsGAGCGCUCcustom-characterCACUCCUsUsGsGsA-3′ fluoro (SEQ ID NO: 128) Legend to Table 2: Nucleotides highlighted in bold are unmodified and are placed opposite the triplet with the target adenosine in the middle. Nucleotides highlighted in italic are modified with 2′-O-methylation, 2′-fluorinated nucleotides are grayed out. The backbone contains terminal phosphorothioate linkages as indicated by “s”. The first three nucleotides at the 5′-end are not complementary to the mRNA substrate, but serve as linker sequence between gRNA and SNAP-tag.

    [0196] For this study, all NH.sub.2-guideRNAs were purchased from Biospring (Germany) as HPLC-purified ssRNAs with a 5′-C6 amino linker. As an alternative to commercial BG derivatives, our protocol can be used to introduce the BG moiety. Benzylguanine connected to a carboxylic acid linker2,3 (12 μl, 60 mM in DMSO) was in-situ activated as an OSu-ester by incubation with EDCl.HCl (12 μl, 17.4 mg/ml in DMSO) and NHS (12 μl, 17.8 mg/ml in DMSO) for 1 h at 30° C. Then, the NH.sub.2-guideRNA (25 μl, 6 μg/μl) and DIPEA (12 μl, 1:20 in DMSO) were added to the pre-activation mix and incubated (90 min, 30° C.).20 19 The crude BG-guideRNA was purified from unreacted NH.sub.2-guideRNA by 20% urea PAGE and then extracted with H.sub.2O (700 μl, overnight at 4° C.). RNA precipitation was done with sodium acetate (0.1 volumes, 3.0 M) and ethanol (3 volumes, 100%, overnight at −80° C.). The BG-guideRNA was washed with ethanol (75%) and dissolved in water (60 μl).

    [0197] Cell lines were generated that stably express SNAP-ADAR1 (SA1), SNAP-ADAR2 (SA2), 2 and their hyper-active E Q variants 10 SA1Q and SA2Q. Each respective enzyme (SA1 (wt & Q) and SA2 (wt and Q)) was integrated as a single copy under control of the dox-inducible CMV promotor at the FRT site into the genome of 293 Flip-In cells (R78007, Thermo Fisher scientific) as described before (see Wettengel, J., Reautschnig, J., Geisler, S., Kahle, P. J., Stafforst, T. Harnessing human ADAR2 for RNA repair—Recoding a PINK1 mutation rescues mitophagy. Nucl. Acids Res. 45, 2797-2808 (2017); or Cox, D. B. T., Gootenberg, J. S., Abudayyeh, O. O., Franklin, B., Kellner, M. J., Joung, J., Zhang, F. RNA editing with CRISPR-Cas13, Science, 10.1126/science.aaq0180 (2017). Enzyme expression of all four enzymes was inducible by doxycycline (10 ng/ml) to roughly comparable levels as validated by Western blot and fluorescence microscopy (data not shown). Also at the RNA level, the expression levels of SA1 (wt & Q) and SA2 (wt and Q) were roughly comparable with average FPKM values of 679 and 814 for SA1(Q) and SA2(Q), respectively. The E Q mutation did not change the protein localization. SA1(Q) is localized to cytoplasm and nucleoplasm; SA2(Q) is mainly localized to cytoplasm. In order to determine the location of the different SNAP-ADAR proteins, 1×10.sup.5 cells were seeded in 500 μl selection media with or without doxycline (10 ng/ml) on poly-D-lysine-coated cover slips in a 24-well format. After one day, BG-FITC labeling of the SNAP-tag and nuclear staining was done. To validate SNAP-ADAR protein amounts, Western blot analysis was used. For this, 3×10.sup.5 cells were seeded in 500 μl selection media with or without doxycline (10 ng/ml) in a 24-well format for one day. Then, cells were lysed with urea buffer (8 M urea in 10 mM Tris, 100 mM NaH.sub.2PO.sub.4, pH 8.0). Protein lysate (5 μg) was separated by SDS-PAGE and transferred onto a PVDF membrane (Bio-Rad Laboratories, USA) for immunoblotting with primary antibodies against the SNAP-tag (1:1000, P9310S, New England Biolabs, USA) and g-actin (1:40000, A5441, Sigma Aldrich, USA). Afterwards, the blot was incubated with HRP-conjugated secondary antibodies against rabbit (1:10000, 111-035-003, Jackson Immuno Research Laboratories, USA) and mouse (1:10000, 115-035-003, Jackson Immuno Research Laboratories, USA) and visualized by enhanced chemiluminescence.

    [0198] Editing was initiated by transfection of the short, chemically stabilized BG-guideRNA, and was analyzed for formal A-to-G conversion in cDNA at specific 5′-UAG triplets in the 3′-UTRs of the four targeted endogenous mRNAs: ACTB, GAPDH, GUSB, and SA1/2. For both wildtype enzymes (SA1/2), editing yields of 40-80% were achieved (FIG. 8a) depending on the target. Applying the hyperactive mutants (SA1Q/SA2Q) raised the yields to 65-90%. The maximum editing yield (80-90%) was obtained almost 3h post transfection (FIG. 1b), stayed constant for 3 days, and then declined slowly, probably due to dilution of the guideRNA-enzyme conjugate by cell division. The activated enzymes (SA1Q&SA2Q) were up to 12fold more potent compared to the wildtype enzymes (SA1&SA2), achieving the half-maximum editing yield already with 0.15 pmol/well compared to 1-2 pmol/well (FIG. 1c). Concurrent editing of all four transcripts was tested by cotransfection of four guideRNAs. Notably, the yields remained unchanged (FIG. 1a). Editing yields were higher in the 3′-UTR compared to ORF and 5′-UTR (FIG. 1d), probably due to interference with translation. The faster enzymes (SA1Q & SA2Q) boosted the yields in the 5′-UTR from 25-50% to 60-75% and in the ORF from 15-60% to 50-85% (FIG. 1d). Furthermore, translation inhibition with puromycin increased ORF editing in SA1/2 cells to the level of 3′-UTR editing (data not shown). To assess the codon scope, all 16 conceivable 5′-NAN triplets in the ORF of endogenous GAPDH were tested for SA1Q and SA2Q. Yields ranging from very little to almost quantitative were obtained, reflecting the known preferences of ADARs (FIG. 1e). While editing was generally difficult for 5′-GAN triplets (<30%), significant yields (>50%) were achieved for 10/16 triplets. For 7/16 triplets, excellent editing yields (>70%) were obtained for at least one enzyme.

    Example 7

    [0199] A major objective in RNA editing is the suppression of off-site editing (see FIG. 9a). It was therefore tested, whether off-site editing can be avoided by using chemically modified versions of the guideRNAs described herein. Only for adenosine-rich triplets (AAC, AAA, UAA, CAA) some off-target editing was detected, mainly with SA2Q (5-75%) and mainly for the CAA triplet (FIG. 9b, right diagram, “r”). Off-target editing was higher if three natural nucleotides were present in the guideRNA opposite the targeted adenosine (FIG. 9b, in particular right diagram, “r”). Careful inclusion of further chemical modifications (2′-methoxy, 2′-fluoro) restricted off-target editing at the CAA triplet down to 20%, and limited off-target editing at all other sites to <10% without reducing on-target editing (FIG. 9b, “M”, “F”). Notably, at least for AAA the additional modification even elevated the on-target yield from 40% to 50%.

    Example 8

    [0200] Branched linkers and multiple copies of the BG-derived recruiting moieties were tested with regard to their effect on RNA editing. To this end, various guideRNAs were tested side-by-side against the Tyr701 codon in the endogenous STAT1 transcript in 293-Flp-In cells expressing SNAP-ADAR1Q (24 h induction with 10 ng/ml doxycycline prior to guideRNA transfection, editing analysis was done 24 h post guideRNA transfection). Specifically, guideRNAs were applied that contained either a 5′-amino linker or both, a 5′- and a 3′-amino linker and coupled to one or two of the recruiting moieties, respectively. The resulting guideRNAs can potentially recruit from one to eight SNAP-ADAR1Q deaminases, as illustrated by FIG. 11. In the presence of saturating amounts of guideRNA (1 pmol/well or above) almost all of the guideRNAs achieved the same editing yields (70-80%). Only the single 1×BG guideRNAs did not achieve the maximum yield but stopped at a yield of ca. 60%. The guideRNAs that allow for recruiting more than one SNAP-ADAR1Q showed improved potency, indicating that they maintained a high editing yield, when the amount of guideRNA was reduced. For instance, in the case of single 1×BG, the editing yield dropped to 22% and below detection when reducing the guideRNA amount to 0.1 pmol/well and 0.01 pmol/well. In contrast, for the double 2×BG and for the double 4×BG guideRNAs, the editing yields remained at 58% and 65%, respectively, with 0.1 pmol/well and dropped to only 17% and 10% with 0.01 pmol/well, thus clearly improving the potency of the guideRNA.