FULLY AUTOMATED BIOCHIP WORKSTATION AND DETECTION METHOD USING SAME
20220072538 · 2022-03-10
Inventors
Cpc classification
G01N21/6452
PHYSICS
B01L7/00
PERFORMING OPERATIONS; TRANSPORTING
G01N35/10
PHYSICS
B01L3/502738
PERFORMING OPERATIONS; TRANSPORTING
B01L3/50273
PERFORMING OPERATIONS; TRANSPORTING
B01L2300/1805
PERFORMING OPERATIONS; TRANSPORTING
B01L3/502715
PERFORMING OPERATIONS; TRANSPORTING
International classification
B01L3/00
PERFORMING OPERATIONS; TRANSPORTING
B01L7/00
PERFORMING OPERATIONS; TRANSPORTING
Abstract
The present application relates to the field of biochip detection apparatus, and in particular to a fully automated biochip workstation and a detection method using same. Biochip detection apparatus comprises a cavity for carrying a test tube vial, the test tube vial being used for accommodating a sample to be detected and a biochip, the cavity having a temperature control function; a liquid storage device for storing liquid; a pumping device for pumping the liquid in the liquid storage device to the test tube vial, the pumping device being in fluid communication with a separation needle for injecting a mixed liquid into the test tube vial; an imaging device for monitoring the chip state in the test tube vial; and a data processing device configured to acquire hybridization results on the basis of information about a biochip state acquired by the imaging device. The biochip workstation provided in the present application implements the integration of biochip reactions and the output of detection results, improves the processing efficiency of samples, saves manpower, and has more stable and reliable results.
Claims
1. A biochip detection apparatus, comprising a cavity configured to carry a test tube vial, wherein the test tube vial is configured to accommodate a sample to be detected and a biochip, and the cavity has a temperature control function; a liquid storage device, configured to store a liquid; a pumping device, configured to pump the liquid in the liquid storage device to the test tube vial, wherein the pumping device is in fluid communication with a liquid separating needle for injecting a mixed liquid into the test tube vial; an imaging device, configured to monitor a chip state in the test tube vial; and a data processing device, configured to acquire a hybridization result based on information of a state of the biochip acquired by the imaging device.
2. The biochip detection apparatus according to claim 1, wherein a plurality of test tube vials are provided, the cavity is divided into a plurality of spaces for carrying different test tube vials, and a top surface of each of the spaces is provided with a receptacle to be inserted by a corresponding test tube vial.
3. The biochip detection apparatus according to claim 1, wherein one side of the cavity has a hollowed portion, and the imaging device captures information of the biochip in a vial body of the test tube vial through the hollowed portion; and the vial body of the test tube vial is a flat structure, and/or the vial body is made of a transparent material.
4. The biochip detection apparatus according to any one of claims 1 to 3, wherein the cavity is provided to be adapted to a structure of the vial body of the test tube vial; and/or a top portion of the cavity is provided with a groove for receiving a cap of the test tube vial.
5. The biochip detection apparatus according to any one of claims 1 to 4, further comprising a bracket for supporting the liquid separating needle, wherein the bracket is provided above the cavity and is movable up and down; and the bracket is provided with a liquid separating pinhole for the liquid separating needle to pass therethrough.
6. The biochip detection apparatus according to claim 5, wherein the cap of the test tube vial is provided corresponding to the liquid separating needle; and optionally, the liquid separating needle is inserted in the cap corresponding to the test tube vial, and is inserted into the test tube vial.
7. The biochip detection apparatus according to claim 5 or 6, wherein the biochip detection apparatus is further provided with a liquid discharging needle for discharging the liquid in the test tube vial, wherein the liquid discharging needle is in fluid communication with a liquid discharging device.
8. The biochip detection apparatus according to claim 7, wherein the bracket is configured to support the liquid discharging needle, and optionally, the bracket is provided with a liquid discharging pinhole for the liquid discharging needle to pass therethrough.
9. The biochip detection apparatus according to claim 7 or 8, wherein the liquid discharging needle is provided adjacent to the liquid separating needle, and the cap of the test tube vial is correspondingly provided with one liquid separating needle and one liquid discharging needle.
10. The biochip detection apparatus according to any one of claims 5-9, wherein two ends of the cavity are each provided with a guide rail in a vertical direction, and two ends of the bracket are slidably connected to corresponding guide rails through guide blocks, respectively.
11. The biochip detection apparatus according to claim 1, wherein a heating and cooling sheet provided at a bottom of the cavity, so as to realize temperature control of the cavity through cold and heat conduction; and optionally, the heating and cooling sheet is a thermoelectric cooling sheet, wherein the thermoelectric cooling sheet realizes conversion of cooling and heating functions thereof by means of a control electrode.
12. The biochip detection apparatus according to claim 11, wherein a heat dissipation device is further provided below the heating and cooling sheet; and optionally, the heat dissipation device comprises at least one of a cooling fin and a fan.
13. The biochip detection apparatus according to claim 1, wherein the liquid storage device comprises a plurality of liquid storage bottles, wherein the plurality of liquid storage bottles control mixing and outflow of different solutions through a liquid separating valve; and optionally, the liquid separating valve comprises any one of an eight-way valve, a four-way valve and a three-way valve, or a combination of more therefrom.
14. The biochip detection apparatus according to any one of claims 8-10, wherein a cover plate for fastening the test tube vial is further provided between the bracket and the cavity; and optionally, the cover plate is provided with holes corresponding to the liquid separating needle and the liquid discharging needle.
15. The biochip detection apparatus according to claim 1, further comprising a platform, wherein the cavity, the liquid storage device, the pumping device, the bracket, and the imaging device are all mounted on the platform.
16. The biochip detection apparatus according to claim 15, wherein the cavity is mounted on one side of the platform, the bracket is mounted above the cavity, a mounting plate is vertically fixed on the other side of the platform close to the cavity, the plurality of liquid storage bottles of the liquid storage device are fixed on a side surface of the mounting plate facing away from the cavity, a pumping device is located between the cavity and the mounting plate, and the imaging device is mounted on one side of the cavity in parallel.
17. The biochip detection apparatus according to any one of claims 1-16, wherein the imaging device is movably disposed.
18. The biochip detection apparatus according to claim 17, wherein a hollowed side of the cavity is provided with a rail along a direction parallel to the cavity, and the imaging device is slidably connected to the rail through a sliding block.
19. A method for detecting a biochip, wherein the method is performed using the biochip detection apparatus according to any one of claims 1-18, wherein the method has following steps: placing a biochip, a sample to be detected, and a primer into the test tube vial, wherein the test tube vial is fixed in the cavity; controlling inflow and outflow of the liquid in the test tube vial and a temperature, so as to realize amplification of the sample to be detected and hybridization of an amplification product with the biochip; and performing corresponding treatment using different detection manners, acquiring, by an imaging device, information of the biochip having undergone hybridization, and processing a hybridization result by a data processing device to obtain a result, wherein further, the biochip is a gene chip, the amplification of the sample to be detected and the hybridization of the amplification product with the gene chip are performed simultaneously, and a buffer solution used is a PCR amplification buffer solution; further, a temperature control procedure comprises: denaturation, annealing, and extension, for multiple cycles; further, the temperature control is performed as: 94±1° C. for 10±2 s, 55±1° C. for 20±2 s, and 72±2° C. for 20±2 s, for 35-40 cycles; and further, the detection manner comprises a chemiluminescence method, a fluorescence method, and a visualization method.
20. The method for detecting a biochip according to claim 19, wherein the liquid in the liquid storage device is pumped by the pumping device into the test tube vial through the liquid separating needle, and the liquid in the test tube vial is pumped out to the liquid discharging device through the liquid discharging needle.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0059] In order to more clearly illustrate technical solutions in specific embodiments of the present disclosure or the prior art, accompanying drawings which need to be used for description of the specific embodiments or the prior art will be introduced briefly below. Apparently, the accompanying drawings in the description below merely show some embodiments of the present disclosure, and those ordinarily skilled in the art still could obtain other accompanying drawings in light of these accompanying drawings, without using any creative efforts.
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
REFERENCE SIGNS
[0069] 1—cavity; 2—liquid storage bottle; 3—pumping device; 4—bracket; 5—imaging device; 6—liquid separating valve; 7—space; 8—receptacle; 9—hollowed portion; 10—groove; 11—liquid separating pinhole; 12—liquid discharging pinhole; 13—guide block; 14—guide rail; 15—platform; 16—mounting plate; 17—PCB board.
DETAILED DESCRIPTION OF EMBODIMENTS
[0070] Technical solutions of the present disclosure will be described clearly and completely below in combination with the accompanying drawings and specific embodiments, while a person skilled in the art would understand that the following embodiments described are some but not all embodiments of the present disclosure, and they are merely used for illustrating the present disclosure, but should not be considered as limiting the scope of the present disclosure. All of other embodiments obtained by those ordinarily skilled in the art based on the embodiments in the present disclosure without using creative efforts shall fall within the scope of protection of the present disclosure. If no specific conditions are specified in the embodiments, they are carried out under normal conditions or conditions recommended by manufacturers. If manufacturers of reagents or apparatuses used are not specified, they are conventional products commercially available.
[0071] In the description of the present disclosure, it should be indicated that orientation or positional relations indicated by terms “center”, “upper”, “lower”, “left”, “right”, “vertical”, “horizontal”, “inner”, “outer” and so on are based on orientation or positional relations as shown in the accompanying drawings, merely for facilitating the description of the present disclosure and simplifying the description, rather than indicating or implying that related devices or elements have to be in the specific orientation or configured and operated in a specific orientation, therefore, they should not be construed as limiting the present disclosure. Besides, terms “first”, “second”, and “third” are merely for descriptive purpose, but should not be construed as indicating or implying importance in the relativity.
[0072] In the description of the present disclosure, it should be noted that unless otherwise specified and defined explicitly, terms “mount”, “join”, “connect” should be construed in a broad sense. For example, it may be fixed connection, detachable connection, or integral connection; it may be mechanical connection, and also may be electrical connection; it may be direct connection, indirect connection via an intermediate medium, or inner communication between two elements. For those ordinarily skilled in the art, specific meanings of the above-mentioned terms in the present disclosure could be understood according to specific circumstances.
[0073] As shown in
[0074] a liquid storage device configured to store a liquid;
[0075] a pumping device 3 configured to pump the liquid in the liquid storage device to the test tube vial, wherein the pumping device 3 is in fluid communication with a liquid separating needle for injecting a mixed liquid into the test tube vial;
[0076] an imaging device 5 configured to monitor a chip state in the test tube vial; and
[0077] a data processing device, configured to acquire a hybridization result on the basis of information of the biochip state acquired by the imaging device 5.
[0078] It should be noted that the existing process of the biochip hybridization and the hybridization result detection is as follows:
[0079] preparing a biochip with different probes: different probe buffer solutions are spotted on a substrate with a gene chip sample applicator, and dried for subsequent use;
[0080] preparing a PCR product for hybridization: performing PCR amplification on an object to be detected; and
[0081] performing hybridization on the biochip and the PCR product: the PCR amplification product is denatured (98° C.), immediately subjected to cold bath, and then mixed with a hybridization buffer solution, wherein the mixed liquid is added to a sample application area of the chip, the chip is placed into a hybridization box, and subjected to hybridization in an oven in a light-tight condition; and after being washed in a light-tight condition, the resultant is scanned and analyzed.
[0082] For the biochip detection apparatus provided in the present disclosure, the sample to be detected and the biochip are directly added to the test tube vial, the temperature is controlled by the temperature control function of the cavity 1, the pumping device 3 enables corresponding solution in the liquid storage device to flow into the test tube vial or control the liquid in the test tube vial to flow out, the sample to be detected is hybridized with the biochip while being subjected to the PCR amplification, then by adding a corresponding washing liquid, different detection manners are adopted for treatment, the imaging device 5 acquires the information of the biochip having undergone the hybridization, and the result is obtained after the hybridization result is processed by the data processing device.
[0083] It should be noted that the biochip in the present disclosure not only includes the gene chip, but also includes a protein chip, that is, the biochip detection apparatus provided in the present disclosure not only can be used for gene detection, but also can be used for protein immunodetection, for example.
[0084] The present disclosure realizes the automated operation of the whole process of biochip detection, thus improving the detection efficiency, with a stable and reliable detection result.
[0085] In the present disclosure, the cavity 1 is configured to carry the test tube vial, and the cavity 1 may be completely surrounded by a side wall, and may also be configured as a frame. In order to realize analysis of multiple biological samples one time, there may be a plurality of test tube vials, and referring to what is shown in
[0086] In order to facilitate photographing and temperature control, in some embodiments, one side of the cavity 1 has a hollowed portion 9 (
[0087] Optionally, a camera of the imaging device 5 is provided directly opposite to the part of the hollowed portion 9, so as to facilitate the image capturing.
[0088] In some embodiments, the vial body of the test tube vial is a flat structure. As the vial body is used for holding the biochip and the sample to be detected, the biochip is generally a quadrangular sheet, and the sample to be detected is a liquid, the shape of the vial body needs to be set similar to the biochip; furthermore, the volume shape of the vial body is slightly bigger than that of the biochip, the flat structure facilitates easy placement of the biochip, and by providing a plane of the flat structure towards the imaging device 5, the imaging device 5 also conveniently captures information of the biochip.
[0089] In some embodiments, the vial body is made of a transparent material, so as to ensure the sharpness of the image in the vial, and facilitate the imaging device 5 in capturing the information of the biochip.
[0090] In some embodiments, the cavity 1 is provided to be adapted to the vial body structure, and specifically, the size of each space 7 is set to be adapted to the size of the corresponding test tube vial. As the cavity 1 is temperature-controlled, and the temperature of the test tube vial is generally controlled by the heat conduction of the cavity 1, the cavity 1 is provided to be structurally adapted to the vial body structure, and the stability of the placement of the test tube vial may also be enhanced. Optionally, as an example, with reference to
[0091] In some embodiments, the biochip detection apparatus further includes a bracket 4 for supporting the liquid separating needle, wherein the bracket 4 is provided above the cavity 1 and is movable up and down.
[0092] The liquid separating needle is provided above the test tube vial, and located on the bracket 4, and the liquid separating needle is inserted into or pulled out of the test tube vial through the movement of the bracket 4. As an example, with reference to
[0093] In some embodiments, the cap of the test tube vial is provided corresponding to the liquid separating needle, that is, one space 7 carries one test tube vial, and the cap of one test tube vial is correspondingly inserted with one liquid separating needle; and optionally, the liquid separating needle is inserted into the cap of the corresponding test tube vial, and inserted into the test tube vial.
[0094] In different stages of the hybridization process, different solutions are required for treatment, and the automated operation of liquid change is realized through the inflow and the discharge of the liquid.
[0095] In some embodiments, a liquid discharging needle for discharging the liquid in the test tube vial is further provided, and the liquid discharging needle is in fluid communication with the liquid discharging device. The liquid discharging needle discharges the liquid to the liquid discharging device, such as a waste bottle.
[0096] In some embodiments, the bracket 4 is further configured to support the liquid discharging needle, and optionally, with reference to
[0097] In some embodiments, referring to
[0098] In some embodiments, two ends of the cavity 1 are each provided with a guide rail 14 along a vertical direction, and two ends of the bracket 4 are slidably connected to the corresponding guide rails 14 through guide blocks 13, respectively. By controlling the movement of the bracket 4 along the guide rails 14, the up and down movement of the bracket 4 is realized, so that the bracket drives the liquid separating needle and the liquid discharging needle to move up and down, and to be inserted into or pulled out from the cap of the test tube vial.
[0099] In some embodiments, the cavity 1 is provided with a heating and cooling sheet at the bottom, to realize temperature control of the cavity 1 by cold and heat conduction.
[0100] In some embodiments, the heating and cooling sheet is a thermoelectric cooling sheet, and the thermoelectric cooling sheet realizes the conversion of its cooling and heating functions by means of a control electrode.
[0101] In some embodiments, a heat dissipation device is further provided below the heating and cooling sheet, and optionally, the heat dissipation device includes at least one of a cooling fin, a fan and so on.
[0102] Temperature control in the test tube vial is realized by the heating device and the heat dissipation device.
[0103] In some embodiments, the liquid storage device includes a plurality of liquid storage bottles 2, and the plurality of liquid storage bottles 2 control mixing and outflow of different solutions through a liquid separating valve 6. The liquid storage bottles 2 are in fluid communication with the liquid separating needle, and specifically, the liquid storage bottles 2 are in fluid communication with the pumping device 3, and the pumping device 3 is in fluid communication with the liquid separating needle.
[0104] In some embodiments, the liquid separating valve 6 includes any one or a combination of an eight-way valve, a four-way valve, and a three-way valve.
[0105] In some embodiments, a cover plate for fastening the test tube vial is further provided between the bracket 4 and the cavity 1, and the cover plate is provided with holes corresponding to the liquid separating needle and the liquid discharging needle.
[0106] By providing the cover plate, the test tube vial is placed more fixedly.
[0107] In some embodiments, a platform 15 is further included, wherein the cavity 1, the liquid storage device, the pumping device 3, the bracket 4, and the imaging device 5 are all mounted on the platform 15, and all units are grouped together by the platform 15 to form an integral body. In addition, the cover plate is elastically connected to the platform 15.
[0108] In some embodiments, the cavity 1 is mounted on one side of the platform 15, the bracket 4 is mounted above the cavity 1, a mounting plate 16 is vertically fixed on the other side of the platform 15 close to the cavity, the liquid storage bottles 2 of the liquid storage device are fixed on a side surface of the mounting plate 16 facing away from the cavity, the pumping device 3 is located between the cavity 1 and the mounting plate 16, and the imaging device 5 is mounted on one side of the cavity 1 in parallel, then vertical arrangement of a plurality of liquid storage bottles 2 is realized through the mounting plate 16. A PCB board 17 is vertically mounted on a side of the platform 15 opposite to the cavity 1, and the liquid separating valve is located between the PCB board 17 and the cavity 1.
[0109] In some embodiments, the imaging device 5 is movably provided.
[0110] In some embodiments, the side of the cavity 1 having the hollowed portion 9 is provided with a rail along a direction parallel to the cavity 1, and the imaging device 5 is slidably connected to the rail through a sliding block.
[0111] In practical operation, the position of the imaging device 5 is controlled according to test tube vials at different positions, so as to acquire the information of the biochips in different test tube vials.
[0112] For the biochip detection apparatus provided in the present disclosure, the flow of liquid, the movement of the bracket 4, and so on are completed by a control system, and the control system and a data processing system are provided on a same operation page.
[0113] The control system includes a PCB board 17 and the like, for example, a microprocessor chip, a temperature control module, a driving module, a touch liquid crystal screen module, a USB module, a JTAG module, an alarm module and the like are mounted on the PCB board 17, and the microprocessor chip is connected to various modules, respectively, and controls various modules, so as to realize accurate operation of the whole operation.
[0114] The present disclosure further provides a method for detecting a biochip, performed using the above biochip detection apparatus, and the steps are as follows:
[0115] placing a biochip, a sample to be detected, and a primer into a test tube vial fixed in a cavity 1;
[0116] controlling inflow and outflow of the liquid in the test tube vial and the temperature, thereby realizing amplification of the sample to be detected and hybridization of an amplification product with the biochip; and
[0117] performing corresponding treatment using different detection manners, acquiring, by an imaging device 5, information of the biochip having undergone the hybridization, and processing a hybridization result by a data processing device to obtain a result.
[0118] In some embodiments, the liquid in the liquid storage bottle 2 is pumped by the pumping device 3 into the test tube vial through a liquid separating valve 6 and a liquid separating needle, and the liquid in the test tube vial is pumped out to the liquid discharging device through the liquid discharging needle, to realize inflow and outflow of the liquid in the test tube vial.
[0119] In some embodiments, by sliding on the rail to be opposite to the hollowed portion 9 of a space 7 where a target test tube vial is located, the imaging device 5 acquires information of the biochip in the test tube vial.
[0120] It should be noted that the biochip detection apparatus provided in the present disclosure is not installed with various pipes or the like, and may be used only when corresponding installation is performed.
[0121] Specific example is as follows:
[0122] Influenza A, influenza B, RSV, and adenovirus of samples were detected, and primers and probes of these several detected objects were designed according to a conventional method, which are specifically as shown in Table 1.
[0123] These sequences are also provided in the accompanying sequence listing, titled “sequence_listing,” created Jul. 30, 2021, with a size of 2,512 bytes, the disclosure of which is incorporated herein in its entirety by reference.
TABLE-US-00001 TABLE 1 Specific Sequences Target Name Sequence (5′-3′) Virus HRSV-F TTAACCAGCAAAGTGTTAGA respiratory HRSV-R Bio-TTTGTTATAG syncytia GCATATCATTG RSVP-A1 CCAACAAAAGAACAA CAGACTACTAGAGAT AQF1 GCCCCAGCGGTCT respiratory AACATGCACATC adenovirus AQR1 Bio-GCCACGGTG GGTTTTCTTTACTT AdvP1 TGCACCAGACCC GGGCTCAGGTAC Influenza AAAGCGAATTTCAGTGTGAT influenza A As Influenza Bio-GAAGGCAATGGTGAGATTT A as INFA AGGGCTTTCACCGAAGAGGG Influenza GTCCATCAAGCTCCAGTTTT influenza B Bs Influenza Bio-TCTTCTTAC B as AGCTTGCTTGC INFB AACGAAGTAGGTGGAGACGGAGG
[0124] The nucleic acid probe sample application: the biochip was a self-produced aldehyde slide, the concentration of probe sample application was 10 μM, and the samples were stored at room temperature in a dry condition, as shown in
[0125] PCR amplification: a nucleic acid sample (object to be detected), a biochip, and a PCR mix reagent (including a primer and a buffer solution) were mixed, and added to the test tube vial of instrument. The cycling parameters of the semiconductor heating and cooling sheet of the instrument are: 94° C. for 10 s, 55° C. for 20 s, 72° C. for 20 s, for 40 cycles, to realize amplification and hybridization simultaneously. The washing liquid was then pumped in through an injection pump and a solenoid valve to clean the chip.
[0126] Subsequently, three detection manners, namely, chemiluminescence, quantum dot fluorescence, and visualization were realized using three types of instrument and reagents, respectively.
[0127] Chemiluminescence method detection: 100 μL of horseradish enzyme-labeled avidin solution was automatically pumped into each reaction bottle, and reacted at 37° C. for 30 min. A PBST washing liquid was pumped in for cleaning. Then 100 μL of chemiluminescence substrate solution (Millipore hypersensitive chemiluminescent substrate solution, liquid A: liquid B=1:1) was pumped in. The high-sensitivity CCD imaging element (Model JAI CM-030-GE) moved to be directly in front of each chip on the guide rail, and collected chemiluminescent biochip images, wherein exposure time of each chip was 10 s, and there were 8 chips in total. Results are as shown in
[0128] Fluorescence method detection, 100 μL 25 nM avidin-labeled red quantum dot SA-QDs 625 solution (Wuhan Jiayuan) was automatically pumped into each reaction bottle, and reacted at 37° C. for 30 min. The PBST washing liquid was pumped in for cleaning. 5 W UV LED light source with wavelength of 365 nm was turned on to excite QDs to emit fluorescence, the fluorescence was filtered by a filter (624/40 nm, model Edmund Optical 67-021), the high-sensitivity CCD imaging element moved on the guide rail to be directly in front of each chip to collect a quantum dot fluorescence biochip image, wherein the exposure time of each chip was 10 s, and there were 8 chips in total. Results are as shown in
[0129] Visualization detection: 100 μL 25 nM avidin-labeled red quantum dot SA-QDs 625 solution (Wuhan Jiayuan) was automatically pumped into each reaction bottle, and reacted at 37° C. for 30 min. The PBST washing liquid was pumped in for cleaning. Then 100 μL of silver-stained substrate solution was pumped in, followed by reaction for 5 min, and the resultant was washed with deionized water. A white light LED light source was turned, a CCD imaging element moved on the guide rail to be directly in front of each chip to collect a quantum dot fluorescence biochip image, wherein there were 8 chips in total. Results are as shown in
[0130] For the biochip detection apparatus provided in the present disclosure, the sample to be detected and the biochip are directly added to the test tube vial, by controlling the temperature and the inflow and outflow of corresponding solutions, the reaction product of the sample PCR amplification is detected with the biochip while the amplification is being performed, then by adding corresponding washing liquid, the chip is photographed to obtain the information, and the final hybridization result may be obtained. It realizes integration of the hybridization process of the gene biochip and output of result, improves the processing efficiency of the sample, and saves the manpower, with a more stable and more reliable result.
[0131] Finally, it should be indicated that the various embodiments above are merely used for illustrating the technical solutions of the present disclosure, rather than limiting the present disclosure; while the detailed description is made to the present disclosure with reference to the various preceding embodiments, those ordinarily skilled in the art should understand that they still could modify the technical solutions recited in the various preceding embodiments, or make equivalent substitutions to some or all of the technical features therein; and these modifications or substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the various embodiments of the present disclosure.
INDUSTRIAL APPLICABILITY
[0132] The present disclosure provides a biochip detection apparatus and a biochip detection method, which realize integration of biochip reaction with detection result output, and automated operation of the whole detection process, thus improving the processing efficiency of the samples, and saving the manpower, with a stable and reliable result.