CONJUGATES OF PATTERN RECOGNITION RECEPTOR AGONISTS
20220062273 · 2022-03-03
Assignee
Inventors
- Kennett SPROGØE (Hellerup, DK)
- Yang YANG-MALTEN (Hellerup, DK)
- Torben LESSMANN (Heidelberg, DE)
- Nicola Bisek (Heidelberg, DE)
- Samuel WEISBROD (Heidelberg, DE)
- Sebastian Stark (Heidelberg, DE)
- Tobias Voigt (Heidelberg, DE)
Cpc classification
A61K45/06
HUMAN NECESSITIES
A61K31/4745
HUMAN NECESSITIES
A61K47/6903
HUMAN NECESSITIES
A61K47/60
HUMAN NECESSITIES
International classification
A61K31/4745
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K47/60
HUMAN NECESSITIES
A61K47/69
HUMAN NECESSITIES
Abstract
The present invention relates to a conjugate or its pharmaceutically acceptable salt, wherein said conjugate is water-in-soluble and comprises a carrier moiety Z to which one or more moieties -L.sup.2-L.sup.1-D are conjugated, wherein each -L.sup.2- is individually a chemical bond or a spacer moiety; each -L.sup.1- is individually a linker moiety to which -D is reversibly and covalently conjugated; and each -D is individually a pattern recognition receptor agonist. It further relates to pharmaceutical compositions comprising such conjugate and to their use in the treatment of cell-proliferation disorders; and to related aspects.
Claims
1. A conjugate or its pharmaceutically acceptable salt, wherein said conjugate is water-insoluble and comprises a carrier moiety Z to which one or more moieties -L.sup.2-L.sup.1-D are conjugated, wherein each -L.sup.2- is individually a chemical bond or a spacer moiety; each -L.sup.1- is individually a linker moiety to which -D is reversibly and covalently conjugated; and each -D is individually a pattern recognition receptor agonist.
2. The conjugate of claim 1, wherein -D is selected from the group consisting of Toll-like receptor (TLR) agonists, NOD-like receptors (NLRs), RIG-I-like receptors, cytosolic DNA sensors, STING, and aryl hydrocarbon receptors (AhR).
3. The conjugate or its pharmaceutically acceptable salt of claim 1 or 2, wherein all moieties -D of the conjugate are identical.
4. The conjugate or its pharmaceutically acceptable salt of any one of claims 1 to 3, wherein the conjugate comprises more than one type of -D.
5. The conjugate or its pharmaceutically acceptable salt of any one of claims 1 to 4, wherein -D is a Toll-like receptor agonist.
6. The conjugate or its pharmaceutically acceptable salt of any one of claims 1 to 5, wherein -D is an agonist of TLR7/8.
7. The conjugate or its pharmaceutically acceptable salt of any one of claims 1 to 6, wherein -D is resiquimod.
8. The conjugate or its pharmaceutically acceptable salt of any one of claims 1 to 5, wherein -D is an agonist of TLR7.
9. The conjugate or its pharmaceutically acceptable salt of any one of claim 1 to 5 or 8, wherein -D is imiquimod.
10. The conjugate or its pharmaceutically acceptable salt of any one of claims 1 to 9, wherein -L.sup.1- is of formula (X) ##STR00166## wherein the dashed line indicates attachment to a nitrogen of an amine functional group of -D; ═X.sup.1 is selected from the group consisting of ═O, ═S and ═N; —X.sup.2— is selected from the group consisting of —O—, —S— and —N—; —R is C.sub.1-50 alkyl, which C.sub.1-50 alkyl is optionally interrupted by one or more groups selected from the group consisting of -T-, —C(O)O—, —O—, —C(O)—, —C(O)N(R.sup.z1)—, —S(O).sub.2N(R.sup.z1)—, —S(O)N(R.sup.z1)—, —S(O).sub.2—, —S(O)—, —N(R.sup.z1)S(O).sub.2N(R.sup.z1a)—, —S—, —N(R.sup.z1)—, —OC(OR.sup.z1)(R.sup.z1a)—, —N(R.sup.z1)C(O)N(R.sup.z1a)—, and —OC(O)N(R.sup.z1)—; and which C.sub.1-50 alkyl is optionally substituted with one or more —R.sup.z2; each T is independently selected from the group consisting of phenyl, naphthyl, indenyl, indanyl, tetralinyl, C.sub.3-10 cycloalkyl, 3- to 10-membered heterocyclyl, 8- to 11-membered heterobicyclyl, 8- to 30-membered carbopolycyclyl, and 8- to 30-membered heteropolycyclyl; wherein each T is independently optionally substituted with one or more —R.sup.z2, which are the same or different; each —R.sup.z2 is independently selected from the group consisting of halogen, —CN, oxo (═O), —COOR.sup.z3, —OR.sup.z3, —C(O)R.sup.z3, —C(O)N(R.sup.z3R.sup.z3a), —S(O).sub.2N(R.sup.z3R.sup.z3a), —S(O)N(R.sup.z3R.sup.z3a), —S(O).sub.2R.sup.z3, —S(O)R.sup.z3, —N(R.sup.z3)S(O).sub.2N(R.sup.z3aR.sup.z3b) SR.sup.z3, —N(R.sup.z3R.sup.z3a), —NO.sub.2, —OC(O)R.sup.z3, —N(R.sup.z3)C(O)R.sup.z3a, —N(R.sup.z3)S(O).sub.2R.sup.z3a, —N(R.sup.z3)S(O)R.sup.z3a, —N(R.sup.z3)C(O)OR.sup.z3a, —N(R.sup.z3)C(O)N(R.sup.z3aR.sup.z3b), —OC(O)N(R.sup.z3R.sup.z3a), and C.sub.1-6 alkyl; wherein C.sub.1-6 alkyl is optionally substituted with one or more halogen, which are the same or different; and each —R.sup.z1, —R.sup.z1a, R.sup.z3, R.sup.z3a and —R.sup.z3b is independently selected from the group consisting of —H, and C.sub.1-6 alkyl, wherein C.sub.1-6 alkyl is optionally substituted with one or more halogen, which are the same or different; wherein -L.sup.1- is substituted with at least one -L.sup.2- and wherein -L.sup.1- is optionally further substituted.
11. The conjugate or its pharmaceutically acceptable salt of claim 10, wherein ═X.sup.1 is selected from the group consisting of ═O and ═N.
12. The conjugate or its pharmaceutically acceptable salt of claim 10 or 11, wherein ═X.sup.1 is ═O.
13. The conjugate or its pharmaceutically acceptable salt of claim 10 or 11, wherein ═X.sup.1 is ═N.
14. The conjugate or its pharmaceutically acceptable salt of any one of claims 10 to 13, wherein —X.sup.2— is selected from the group consisting of —O— and —N—.
15. The conjugate or its pharmaceutically acceptable salt of any one of claims 10 to 14, wherein —X.sup.2— is —O—.
16. The conjugate or its pharmaceutically acceptable salt of any one of claims 10 to 14, wherein —X.sup.2— is —N—.
17. The conjugate or its pharmaceutically acceptable salt of any one of claims 10 to 16, wherein —R is C.sub.1-20 alkyl, which C.sub.1-20 alkyl is optionally interrupted by one or more groups selected from the group consisting of -T-, —C(O)O—, —O—, —C(O)—, —C(O)N(R.sup.z1)—, —S(O).sub.2N(R.sup.z1)—, —S(O)N(R.sup.z1)—, —S(O).sub.2—, —S(O)—, —S—, —N(R.sup.z1)—, —OC(OR.sup.z1)(R.sup.z1a)—, —N(R.sup.z1)C(O)N(R.sup.z1a)—, and —OC(O)N(R.sup.z1)—; and which C.sub.1-20 alkyl is optionally substituted with one or more —R.sup.z2; each —R.sup.z1 and —R.sup.z1a is independently selected from the group consisting of —H, and C.sub.1-6 alkyl, wherein C.sub.1-6 alkyl is optionally substituted with one or more halogen, which are the same or different; each T is independently selected from the group consisting of phenyl, naphthyl, indenyl, indanyl, tetralinyl, C.sub.3-10 cycloalkyl, 3- to 10-membered heterocyclyl, 8- to 11-membered heterobicyclyl, wherein each T is independently optionally substituted with one or more —R.sup.z2, which are the same or different; each —R.sup.z2 is independently selected from the group consisting of halogen, and C.sub.1-6 alkyl; wherein C.sub.1-6 alkyl is optionally substituted with one or more halogen, which are the same or different.
18. The conjugate or its pharmaceutically acceptable salt of any one of claims 1 to 17, wherein -L.sup.1- is of formula (X-7) ##STR00167## wherein the dashed line marked with the asterisk indicates attachment to a nitrogen of an amine functional group of -D which nitrogen together with —(C═O)— forms an amide bond; the unmarked dashed line indicates attachment to -L.sup.2-; —R.sup.1 is selected from the group consisting of —H, C.sub.1-10 alkyl, C.sub.2-10 alkenyl and C.sub.2-10 alkynyl; and n is an integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 and 25.
19. The conjugate or its pharmaceutically acceptable salt of claim 18, wherein n=1.
20. The conjugate or its pharmaceutically acceptable salt of claim 18 or 19, wherein —R.sup.1 is —H.
21. The conjugate or its pharmaceutically acceptable salt of any one of claims 1 to 20, wherein -L.sup.2- is a spacer moiety.
22. The conjugate or its pharmaceutically acceptable salt of any one of claims 1 to 21, wherein -L.sup.2- is a C.sub.1-20 alkyl chain, which is optionally interrupted by one or more groups independently selected from —O—, -T- and —C(O)N(R.sup.y1)—; and which C.sub.1-20 alkyl chain is optionally substituted with one or more groups independently selected from —OH, -T and —C(O)N(R.sup.y6R.sup.y6a); wherein —R.sup.y1, —R.sup.y6, —R.sup.y6a are independently selected from the group consisting of H and C.sub.1-4 alkyl and wherein T is selected from the group consisting of phenyl, naphthyl, indenyl, indanyl, tetralinyl, C.sub.3-10 cycloalkyl, 3- to 10-membered heterocyclyl, 8- to 11-membered heterobicyclyl, 8- to 30-membered carbopolycyclyl, and 8- to 30-membered heteropolycyclyl.
23. The conjugate or its pharmaceutically acceptable salt of any one of claims 1 to 22, wherein -L.sup.2- is of formula (A-1) ##STR00168## wherein the dashed line marked with the asterisk indicates attachment to -L.sup.1-, the unmarked dashed line indicates attachment to Z, r is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10; s is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10; t is selected from the group consisting of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10; u is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10; v is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10; and —R.sup.1 is selected from the group consisting of —H, C.sub.1-10 alkyl, C.sub.1-10 alkenyl and C.sub.1-10 alkynyl.
24. The conjugate or its pharmaceutically acceptable salt of claim 23, wherein r=1.
25. The conjugate or its pharmaceutically acceptable salt of claim 23 or 24, wherein s=2.
26. The conjugate or its pharmaceutically acceptable salt of any one of claims 23 to 25, wherein t=2.
27. The conjugate or its pharmaceutically acceptable salt of any one of claims 23 to 26, wherein u=1.
28. The conjugate or its pharmaceutically acceptable salt of any one of claims 23 to 27, wherein v=2.
29. The conjugate or its pharmaceutically acceptable salt of any one of claims 23 to 28, wherein —R.sup.1 is —H.
30. The conjugate or its pharmaceutically acceptable salt of any one of claims 1 to 29, wherein Z is a hydrogel.
31. The conjugate or its pharmaceutically acceptable salt of any one of claims 1 to 30, wherein Z is a PEG-based or hyaluronic acid-based hydrogel.
32. The conjugate or its pharmaceutically acceptable salt of any one of claims 1 to 31, wherein Z is a PEG-based hydrogel.
33. A pharmaceutical composition comprising one or more conjugates or their pharmaceutically acceptable salt of any one of claims 1 to 32 and at least one excipient.
34. The pharmaceutical composition of claim 33, wherein the pharmaceutical composition comprises one or more additional drug.
35. The pharmaceutical composition of claim 34, wherein the one or more additional drug is selected from the group consisting of cytotoxic/chemotherapeutic agents, immune checkpoint inhibitors or antagonists, immune checkpoint agonists, multi-specific drugs, antibody-drug conjugates (ADC), radionuclides or targeted radionuclide therapeutics, DNA damage repair inhibitors, tumor metabolism inhibitors, pattern recognition receptor agonists, protein kinase inhibitors, chemokine and chemoattractant receptor agonists, chemokine or chemokine receptor antagonists, cytokine receptor agonists, death receptor agonists, CD47 or SIRPα antagonists, oncolytic drugs, signal converter proteins, epigenetic modifiers, tumor peptides or tumor vaccines, heat shock protein (HSP) inhibitors, proteolytic enzymes, ubiquitin and proteasome inhibitors, adhesion molecule antagonists, and hormones including hormone peptides and synthetic hormones.
36. The conjugate or its pharmaceutically acceptable salt of any one of claims 1 to 32 or the pharmaceutical composition of any one of claims 33 to 35 for use as a medicament.
37. The conjugate or its pharmaceutically acceptable salt of any one of claims 1 to 32 or the pharmaceutical composition of any one of claims 33 to 35 for use in the treatment of a cell-proliferation disorder.
38. The conjugate or its pharmaceutically acceptable salt or the pharmaceutical composition for use of claim 37, wherein the cell-proliferation disorder is cancer.
39. The conjugate or its pharmaceutically acceptable salt or the pharmaceutical composition for use of claim 37 or 38, wherein the cancer is selected from the group consisting of liquid tumors, solid tumors and lymphomas.
40. The conjugate or its pharmaceutically acceptable salt or the pharmaceutical composition for use of claim 39, wherein the solid tumor or lymphoma is selected from the group consisting of lip and oral cavity cancer, oral cancer, liver cancer/hepatocellular cancer, primary liver cancer, lung cancer, lymphoma, malignant mesothelioma, malignant thymoma, skin cancer, intraocular melanoma, metastasic squamous neck cancer with occult primary, childhood multiple endocrine neoplasia syndrome, mycosis fungoides, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, oropharyngeal cancer, ovarian cancer, pancreatic cancer, parathyroid cancer, pheochromocytoma, pituitary tumor, adrenocortical carcinoma, AIDS-related malignancies, anal cancer, bile duct cancer, bladder cancer, brain and nervous system cancer, breast cancer, bronchial adenoma/carcinoid, gastrointestinal carcinoid tumor, carcinoma, colorectal cancer, endometrial cancer, esophageal cancer, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, gallbladder cancer, gastric (stomach) cancer, gestational trophoblastic tumor, head and neck cancer, hypopharyngeal cancer, islet cell carcinoma (endocrine pancreas), kidney cancer/renal cell cancer, laryngeal cancer, pleuropulmonary blastoma, prostate cancer, transitional cell cancer of the renal pelvis and ureter, retinoblastoma, salivary gland cancer, sarcoma, Sezary syndrome, small intestine cancer, genitourinary cancer, malignant thymoma, thyroid cancer, Wilms' tumor and cholangiocarcinoma.
41. The conjugate or its pharmaceutically acceptable salt or the pharmaceutical composition for use of any one of claims 37 to 40, wherein said conjugate or its pharmaceutically acceptable salt or the pharmaceutical composition is administered intratumorally.
42. The conjugate or its pharmaceutically acceptable salt or the pharmaceutical composition for use of any one of claims 37 to 41, wherein the treating of the cell-proliferation disorder in addition to the administration of the conjugate, its pharmacologically acceptable salt or the pharmaceutical composition includes the administration of at least one cancer therapeutic.
43. The conjugate or its pharmaceutically acceptable salt or the pharmaceutical composition for use of claim 42, wherein the at least one cancer therapeutic is selected from the group consisting of cytotoxic/chemotherapeutic agents, immune checkpoint inhibitors or antagonists, immune checkpoint agonists, multi-specific drugs, antibody-drug conjugates (ADC), radionuclides or targeted radionuclide therapeutics, DNA damage repair inhibitors, tumor metabolism inhibitors, pattern recognition receptor agonists, protein kinase inhibitors, chemokine and chemoattractant receptor agonists, chemokine or chemokine receptor antagonists, cytokine receptor agonists, death receptor agonists, CD47 or SIRPα antagonists, oncolytic drugs, signal converter proteins, epigenetic modifiers, tumor peptides or tumor vaccines, heat shock protein (HSP) inhibitors, proteolytic enzymes, ubiquitin and proteasome inhibitors, adhesion molecule antagonists, and hormones including hormone peptides and synthetic hormones.
44. A method of treating a patient suffering from a cell-proliferation disorder, comprising the step of administering an effective amount of one or more conjugates or their pharmaceutically acceptable salts of any one of claims 1 to 32 or the pharmaceutical composition of any one of claims 33 to 35 said patient.
45. The method of claim 44, wherein the cell-proliferation disorder is cancer.
46. The method of claim 45, wherein the cancer is selected from the group consisting of liquid tumors, solid tumors and lymphomas.
47. The method of claim 46, wherein the solid tumor or lymphoma is selected from the group consisting of lip and oral cavity cancer, oral cancer, liver cancer/hepatocellular cancer, primary liver cancer, lung cancer, lymphoma, malignant mesothelioma, malignant thymoma, skin cancer, intraocular melanoma, metastasic squamous neck cancer with occult primary, childhood multiple endocrine neoplasia syndrome, mycosis fungoides, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, oropharyngeal cancer, ovarian cancer, pancreatic cancer, parathyroid cancer, pheochromocytoma, pituitary tumor, adrenocortical carcinoma, AIDS-related malignancies, anal cancer, bile duct cancer, bladder cancer, brain and nervous system cancer, breast cancer, bronchial adenoma/carcinoid, gastrointestinal carcinoid tumor, carcinoma, colorectal cancer, endometrial cancer, esophageal cancer, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, gallbladder cancer, gastric (stomach) cancer, gestational trophoblastic tumor, head and neck cancer, hypopharyngeal cancer, islet cell carcinoma (endocrine pancreas), kidney cancer/renal cell cancer, laryngeal cancer, pleuropulmonary blastoma, prostate cancer, transitional cell cancer of the renal pelvis and ureter, retinoblastoma, salivary gland cancer, sarcoma, Sezary syndrome, small intestine cancer, genitourinary cancer, malignant thymoma, thyroid cancer, Wilms' tumor and cholangiocarcinoma.
48. The method of any one of claims 44 to 47, wherein the one or more conjugates or their pharmaceutically acceptable salts or the pharmaceutical composition are administered intratumorally.
Description
Example 1: Synthesis of Linker Reagent 6
Step 1
[1322] ##STR00155##
[1323] In a 250 mL round bottom flask, 3,6,9-trioxaundecanedioic acid (9.45 g; 29.79 mmol; 10.01 eq.) and glycine benzyl ester hydrochloride (600.00 mg; 2.98 mmol; 1.00 eq.) were dissolved in anhydrous dichloromethane (50.00 mL). HOSu (858.20 mg; 7.46 mmol; 2.51 eq.) and EDC (1.15 g; 5.98 mmol; 2.01 eq.) were added, resulting in a turbid mixture which became clear upon addition of DIPEA (4.16 mL; 23.80 mmol; 8.00 eq.). The solution was stirred at room temperature for 3.5 h.
[1324] The solvent was evaporated, and the residue was dissolved in acetonitrile/water 1:1 (v/v, 0.1% TFA, 10 mL). The crude product was purified by RP-LPLC using a gradient (10-35%) of acetonitrile (0.1% TFA) in water (0.1% TFA). Product fractions were pooled and lyophilized.
[1325] Yield: 1.07 g (97.36%) of a colorless oil
[1326] m/z=370.40 [M+H].sup.+
Step 2
[1327] ##STR00156##
[1328] Compound 1 (525.30 mg; 1.42 mmol; 1.00 eq.) and PyBOP (740.08 mg; 1.42 mmol; 1.00 eq.) were dissolved in anhydrous DMF (5.00 mL). β-Alanine tert.-butylester hydrochloride (258.35 mg; 1.42 mmol; 1.00 eq.) and DIPEA (496.77 μL; 2.84 mmol; 2.00 eq.) were added successively, and the solution was stirred at room temperature for 4.5 h. The reaction was quenched by addition of 1N HCl (2.2 mL). The mixture was diluted with DCM (100 mL) and washed with 0.1 N HCl (3×50 mL), aqueous saturated NaHCO.sub.3 (3×50 mL) and brine (50 mL). The organic phase was dried over Na.sub.2SO.sub.4, filtered, and the solvent was evaporated. The crude product obtained in this way was purified by flash chromatography on silica using a gradient (10-100%) of acetonitrile in DCM. Product fractions were pooled, concentrated under reduced pressure and dried in vacuo.
[1329] Yield: 495.10 mg (70.11%) of a colorless oil
[1330] m/z=497.49 [M+H].sup.+
Step 3
[1331] ##STR00157##
[1332] Compound 2 (495.10 mg; 1.00 mmol; 1.00 eq.) was dissolved in anhydrous THF (10.00 mL). Palladium on activated charcoal (10% wt, 21.22 mg; 0.20 mmol; 0.20 eq.) was added to the solution, and the reaction mixture was stirred at room temperature under an atmosphere of hydrogen for 1 h. The reaction mixture was filtered, volatiles were evaporated under reduced pressure, and the residue was dried in vacuo. 354 mg of the residue were submitted to purification by preparative RP-HPLC using a gradient (0-50%) of acetonitrile (0.1% TFA) in water (0.1% TFA). Product fractions were pooled and lyophilized.
[1333] Yield: 307.00 mg of a colorless oil
[1334] m/z=407.44 [M+H].sup.+
Step 4: Resiquimod Coupling
[1335] ##STR00158##
[1336] Resiquimod 4 (32.50 mg; 103.38 μmol; 1.00 eq.) was added to a solution of protected linker reagent 3 (76.00 mg; 186.99 μmol; 1.80 eq.) in anhydrous DMF (0.40 mL). PyBOP (98.00 mg; 188.32 μmol; 1.81 eq.) and DIPEA (160.00 μL; 918.58 μmol; 8.84 eq.) were added. After 18 h at r.t., the reaction was quenched with AcOH (160 μL) and 2 mL of 30 mM phosphate buffer (pH 8.2) which contained 20% Acetonitrile were added, resulting in ca 2.7 mL of crude product solution. The product was purified by preparative RP-HPLC using a gradient (25-45%) of acetonitrile in 30 mM sodium phosphate buffer (pH 8.2). Product fractions were pooled and transferred in a separation funnel. The aqueous phase was extracted with ethyl acetate (60 ml, 30 ml, 30 ml) and the combined organic phases were dried (MgSO.sub.4), filtered, concentrated under reduced pressure and dried in vacuo.
[1337] Yield: 61.4 mg (84%).
[1338] m/z=703.65 [M+H].sup.+
Step 5: Deprotection
[1339] ##STR00159##
[1340] Compound 5 (64.00 mg; 0.09 mmol; 1.00 eq.) was dissolved in anhydrous dichloromethane (2.00 mL) and trifluoroacetic acid (2.00 mL). After 2 h, the reaction solution was concentrated under reduced pressure. To the residue was added 1 mL of 30 mM pH 8.2 phosphate buffer containing 20% of acetonitrile. The resulting emulsion was purified by preparative RP-HPLC using a gradient (5-50%) of acetonitrile in water. Pooled fractions were lyophilized. The residue (43.7 mg, 74%) was dissolved in DMF anhydrous (2.18 mL) to result in a solution with a content of 21.8 mg/ml.
[1341] Yield: 43.7 mg (74%)
[1342] m/z=647.59 [M+H].sup.+
Example 2: Synthesis of PEG-Hydrogel Beads Containing Free Amino Groups (0.075 mmol/g)
Step 1: Synthesis of Backbone Reagent 7
[1343] Backbone reagent 7 was synthesized as HCl salt using L-lysine building blocks, analogously to an earlier described procedure (WO2013/053856, example 1, compound 1 g therein):
##STR00160##
Step 2: Polymerization
[1344] ##STR00161##
[1345] A cylindrical 250 mL reactor with bottom outlet, diameter 60 mm, equipped with baffles, was charged with an emulsion of Cithrol™ DPHS (0.4 g) in heptane (80 mL). The reactor content was stirred with a pitch-blade stirrer, diameter 45 mm, at 460 rpm, at r.t. A solution of PEG-Disuccinimidylglutarate, 1 kDa 8 (Innochemie, 4290 mg) and backbone reagent 7 (2000 mg) in DMSO (38.6 g) was added to the reactor and stirred for 10 min to form an emulsion. TMEDA (8.9 mL) was added to effect polymerization and the mixture was stirred at r.t. for 16 h. Acetic acid (13.7 mL) was added while stirring. After 10 min, a sodium chloride solution (15 wt %, 100 mL) was added under stirring. After 10 min, the stirrer was stopped, and phases were allowed to separate. After 95 min, the aqueous phase containing the PEG-hydrogel beads was drained.
[1346] For bead size fractionation, the water-hydrogel suspension was diluted with ethanol (40 mL) and wet-sieved on 125, 100, 75, 63, and 50 μm (mesh opening) stainless steel sieves, diameter 200 mm using a sieving machine for 15 min. Sieving amplitude was 1.5 mm, liquid flow was 250 mL/min. Water (4000 mL) was used as the liquid for wet-sieving. Hydrogel beads were harvested from the sieves into 50 mL Falcon tubes using 20% ethanol in water. After centrifugation at 5000 rpm for 1 min, the yield of suspension was noted (see below). Fractions were worked up. Washing by centrifugation at 5000 rpm, 1 min, was performed 3× with 0.1% AcOH, then with EtOH until no more shrinkage of the volume was observed. The fractions were transferred into individual syringes with PE filter and dried for 3 d at <1 mbar. The amine content of the hydrogel was determined from dry material.
[1347] Yields: 63 μm sieve fraction: ≈15 mL of suspension, 1493 mg after drying [1348] 75 μm sieve fraction: ≈15 mL of suspension, 1433 mg after drying
[1349] Amine content: 0.075 mmol/g
Example 3: Synthesis of PEG-Hydrogel Beads Containing Free Amino Groups (0.11-0.5 mmol/g)
[1350] ##STR00162##
[1351] Hydrogels from reagent 7 and 10 (see WO 2011/012715 A1, example 2, compound 2d) were prepared according to a procedure described in WO 2011/012715 A1, example 3.
[1352] Hydrogel 11a was synthesized from 1398 mg of reagent 7 and 4473 mg of reagent 10 in 36.2 g of DMSO. The resulting amine load was 0.151 mmol/g.
[1353] Hydrogel 11b was synthesized from 3.40 g of reagent 7 and 8.91 g of reagent 10 in 75.6 g of DMSO. The resulting amine load was 0.296 mmol/g.
Example 4: Acetylation of Hydrogels
[1354] ##STR00163##
[1355] Hydrogel 9 (3.184 g, 0.239 mmol) was filled into a 50 mL syringe equipped with a PE frit and washed 3× with a 1% (v/v) solution of DIPEA in anhydrous DMF. A solution of acetic anhydride (0.45 mL; 4.77 mmol; 20.00 eq.) and DIPEA, (0.83 mL; 4.77 mmol; 20.00 eq.) in anhydrous DMF (38.18 mL) was drawn into the syringe, the syringe was closed with a sterile cap and shaken for 1 h at 1000 rpm at r.t. The solvent was expelled, and the syringe was washed 10× with anhydrous DMF, and 10× with ethanol. The volume of the swollen hydrogel after expelling the ethanol was 11 mL. The resulting hydrogel was dried in vacuo. Under sterile conditions, hydrogel Ac-9 (2.98 g; 1.00 eq.) was transferred into a 50 ml Falcon tube. Formulation buffer (30 mL) was added, and the Falcon tube was agitated for 30 min on a shaker until a homogenous suspension had formed.
[1356] In an analogous procedure, hydrogel 11a was acetylated to yield Ac-11a, and hydrogel 11b was acetylated to yield Ac-11b.
Example 5: Loading of Compound 6 on Hydrogels
[1357] ##STR00164##
[1358] Under sterile conditions, hydrogel 9 (457.00 mg; 34.28 μmol; 1.00 eq.) was weighed into a 20 mL syringe equipped with a PE frit. The hydrogel was swollen by drawing anhydrous DMF (1% DIPEA, 10 mL) in the syringe, the syringe was shaken manually for 1 min and the solvent was expelled. This procedure was repeated three times. A solution of compound 6 in DMF (2.00 mL; 21.80 mg/mL; 67.42 μmol; 1.97 eq.) and DIPEA (35.82 μL; 205.66 μmol; 6.00 eq.) were mixed and drawn into the syringe containing the hydrogel, followed by a solution of PyBOP (35.67 mg; 68.55 μmol; 2.00 eq.) in anhydrous DMF (1.00 mL). Air was drawn into the syringe to drain cannula and frit. The syringe was shaken for 3.5 h at r.t. The solution was expelled. The hydrogel was washed with DMF (10×10 mL), sterile, pyrogene-free water (10×10 mL) and formulation-buffer (10×10 mL). After the last washing step, ca. 10 mL of buffer were drawn into the syringe. The syringe was closed with a sterile stopper and incubated at 37° C. for 1 h. The buffer was expelled, and the hydrogel was washed with formulation buffer (10×10 mL). The plunger was removed, and the suspension was transferred into a 50 mL Falcon tube. The buffer supernatant was removed, resulting in a suspension with a final volume of ca. 6 mL. The resiquimod content of the resulting hydrogel 12 was ca. 1.5 mg resiquimod eq./mL. In an analogous procedure, compound 6 was loaded on hydrogel 11a to yield hydrogel 12a with a resiquimod load of ca. 1.9 mg resiquimod eq./mL.
[1359] In an analogous procedure, compound 6 was loaded on hydrogel 11b to yield hydrogel 12b with a resiquimod load of ca. 4.9 mg resiquimod eq./mL.
[1360] In an analogous procedure, compound 6 was loaded on hydrogel 11a to yield hydrogel 12c with a resiquimod load of ca. 2.7 mg resiquimod eq./mL.
Example 6: Dose Adjustment
[1361] Under sterile conditions, hydrogel suspension Ac-9 (11.23 mL) was combined with hydrogel suspension 12 (1.52 mg Resiquimod eq./mL; 4.57 mL) in a sterile 50 mL Falcon tube. The combined hydrogel was homogenized by slowly vortexing the Falcon tube for 5 min. The content of the resulting hydrogel suspension was 0.376 mg Resiquimod eq./mL.
[1362] In an analogous procedure, the following hydrogel suspensions were prepared from their acetylated and resiquimod-loaded components.
TABLE-US-00001 Acetylated Resiquimod- Resiquimod content in Compound hydrogel hydrogel hydrogel suspension buffer 13a Ac-9 12 92 μg eq./mL PBST 13b Ac-11a 12a 119 μg eq./mL PBST 13c Ac-9 12 376 μg eq./mL PBST 13d Ac-11b 12b 103 μg eq./mL PTP 13e Ac-11b 12b 410 μg eq./mL PTP 13f Ac-11b 12b 1649 μg eq./mL PTP 13g Ac-11b 12b 4040 μg eq./mL PTP 13h Ac-11b 12b 4321 μg eq./mL PTP 13i Ac-11a 12c 226 μg eq./mL PTP
Example 7: Loading of Compound 6 on Hydrogel with Subsequent Acetylation
[1363] ##STR00165##
[1364] Hydrogel 11a (200 mg; 0.03 mmol) was weighed into a 10 mL syringe equipped with a PE frit. The hydrogel was swollen by drawing anhydrous DMF (1% DIPEA, 3 mL) in the syringe, the syringe was shaken manually for 1 min and the solvent was expelled. This procedure was repeated three times.
[1365] A solution of compound 6 (7.76 mg, 12.0 μmol, 1.0 eq), PyBOP (7.5 mg, 14.4 μmol, 1.2 eq) and DIPEA (16.8 μL; 96 μmol; 8 eq) in DMF (3 mL) was added to the hydrogel, and the suspension was shaken at r.t. overnight. After completion of the reaction the hydrogel was washed with DMF (10×5 mL).
[1366] A solution of acetic anhydride (60 μL; 0.63 mmol) and DIPEA (110 μL; 0.63 mmol) in DMF (2.83 mL) was drawn into the syringe, and the suspension was shaken at r.t. for 2 hours. The supernatant was expelled and the hydrogel was washed with DMF (10×3 mL), water (10×3 mL), EtOH (10×3 mL) and dried in vacuo.
[1367] The resiquimod content of the resulting hydrogel 14 was 17.4 mg/g.
Example 8: Release of Resiquimod from Hydrogel 14
[1368] A suspension of hydrogel 14 (0.23% wt/wt) in pH 7.4 phosphate buffer was incubated at 37° C. Over the course of 33 d, samples of the supernatant were withdrawn and the Resiquimod content was determined by UPLC against a calibration curve. Non-linear regression analysis of the obtained concentrations resulted in a release half-life of 15.3 d.
Example 9: Preparation of Biased IL-2 Mutein Polymer Prodrug
Step 1: Preparation of Cysteine Protected IL-2 Mutein 15
[1369] IL-2 variant (mutein) was custom made and sourced from an external supplier where expression of the proteins was performed from E. coli followed by standard purification strategies known to the one skilled in the art. The following proteins were prepared 15: PTSSSTKKTQ LQLEHLLLDL QMILNGINNY KNPKLTC*MLT FKFYMPKKAT ELKHLQCLEE ELKPLEEVLN LAQSKNFHLR PRDLISNINV IVLELKGSET TFMCEYADET ATIVEFLNRW ITFSQSIIST LT (SEQ ID NO:1; cysteine marked with “*” is connected to a free cysteine via a disulfide bond)
Step 2: Preparation of Biased IL-2 Mutein Polymer Prodrug 16
[1370] 23.2 mg of TCEP (Tris(2-carboxethyl)phosphine hydrochloride) were dissolved in 1.62 mL PBS (phosphate buffered saline) pH 7.4 to give a 50 mM solution. No adjustment of the pH was performed.
[1371] 45.2 mL of 15 formulated at 1.8 mg/mL in PBS, 10% glycerin, pH approx. 9, were mixed with 13.6 mL 0.5 M sodium phosphate, pH 7.4, then 710 μL of the TCEP solution were added. The sample was incubated at ambient temperature for 30 min.
[1372] Subsequently, 5.5 mL of 5 mM 5 kDa PEG maleimide (Sunbright ME-050MA, CAS 883993-35-9, NOF Europe N.V., Grobbendonk, Belgium) in PBS, pH 7.4 (5 mol. eq.) were added to the reaction solution. After incubation at ambient temperature for 10 min, the formation of conjugates was confirmed by analytical size exclusion chromatography.
[1373] The buffer of the conjugation mixture was exchanged to 100 mM borate, pH 9.0 using an Aekta system equipped with a HiPrep Desalting 26/10 column. The sample was incubated at 25° C. overnight, then concentrated to 5.3 mg/mL using Amicon Ultra-15, Ultracel 3 K centrifugation filters (Merck Millipore). 0.847 g of 40 kDa mPEG-linker reagent (as described in patent WO 2016079114 example 2) were dissolved in 9.75 mL water to give a stock solution of 2.1*10.sup.−3 mol/L. The solution was stored on ice.
[1374] 12.9 mL of the protein solution were diluted to 4 mg/mL by addition of 100 mM borate, pH 9.0, then 8.4 mL of the cooled 40 kDa mPEG-linker reagent stock solution were added (corresponding to 4 mol. eq. with respect to the protein). The conjugation mixture was placed in a water bath at 14° C. for 2 h. The pH was shifted to pH 4 by addition of 8.4 mL of water and 33.5 mL of 200 mM sodium acetate, pH 3.6 followed by an incubation at 25° C. overnight.
[1375] The conjugate with one single 40 kDa mPEG linker attached (mono-conjugate) was isolated from the reaction mixture using a HiScreen Capto MMC resin (column dimension: 0.77×10 cm) connected to an Aekta system. A flow rate of 1.2 mL/min and a linear gradient from 10 mM succinic acid, pH 5.5 to 80% of 10 mM succinic acid, 1 M NaCl, pH 5.5 in 12 column volumes was applied for all three runs. Fractions containing mainly mono-conjugate were identified by analytical size exclusion chromatography. The salt content of each fraction was adjusted to 150 mM by addition of 10 mM succinic acid, 1 M NaCl, pH 5.5, then the fractions were pooled and concentrated to 2.8 mg/mL in Amicon Ultra-15, Ultracel 10 K filters (Merck Millipore).
[1376] The concentrated solution (8.1 mL) was diluted with 0.4 mL of 10 mM succinic acid, 150 mM NaCl, 1% Tween20, pH 5.5 and 14.4 mL of 10 mM succinic acid, 150 mM NaCl, 0.05% Tween20, pH 5.5 to a final concentration of 1 mg/mL. The final sample was filtered through a 0.22 μm PVDF filter membrane.
Example 10: In Vivo PK Study
[1377] Resiquimod and resiquimod-releasing hydrogels were injected subcutaneously into rats and plasma levels of resiquimod were observed over the course of 28 d. Resiquimod 4 was dissolved in 10 mM succinate, 90.0 mg/mL trehalose dihydrate, pH 5.0 at a concentration of 104 μg/mL. Hydrogels were suspended (ca. 6% wt/v) PBST buffer at pH 7.4. Male WISTAR rats (n=3 per group) received a single subcutaneous injection of either resiquimod 4 solution or hydrogels 13a or 13b, each corresponding to a dose of 25 μg eq. of resiquimod. Blood samples were withdrawn and used for plasma generation over the course of 28 d. The resiquimod concentration in the plasma samples was quantified by LC-MS/MS. Plasma concentration profiles were generated and analyzed with Phoenix WinNonlin software (Certara, Princeton, N.J., USA).
[1378] Results:
[1379] Maximum plasma concentrations, terminal elimination half-lives and calculated AUCs are summarized below:
TABLE-US-00002 AUC.sub.Pred-∞ Compound C.sub.max [pg/mL] t.sub.1/2 [h*pg/mL] 4 23100 1.5 h and 10 h 65400 (biphasic) 13a 281 13.6 d 74700 13b 234 10.5 d 65900
Example 11: In Vivo Anti-Tumor Efficacy
[1380] The study was conducted in female BALB/C mice with an age of 6-11 weeks at the day of tumor inoculation. Mice were subcutaneously implanted with 3×10.sup.5 CT26 tumor cells in the left and right flanks. When tumors to be injected were grown to a mean tumor volume of ˜80 mm.sup.3, mice were randomized into treatment cohorts (day 0). The day following randomization, animals received a single dose of either 20 μg of resiquimod 4 (dissolved in 10 mM succinate, 90.0 mg/mL trehalose dihydrate, pH 5.0) or hydrogel 13c as a single intratumoral dose in an injection volume of 50 μL or a single intratumoral injection of 50 μL of a suspension of Ac-9. Hydrogels were administered as suspensions in PBST buffer. Following treatment initiation, anti-tumor efficacy was assessed by determination of tumor volumes at various time points from tumor size measurements with a caliper. Tumor volumes were calculated according to the formula:
Tumor volume=(L×W.sup.2)×0.5
[1381] where L is the length of the tumor and W the width (both in mm). Mice were removed from the study once tumors were greater than 1500 mm.sup.3.
[1382] Results:
[1383] Absolute tumor volumes
TABLE-US-00003 Days post-treatment Group 0 2 4 7 9 11 14 Ac-9 Mean (mm.sup.3) 89.01 125.62 151.98 449.94 792.78 1065.45 1402.37 SEM (mm.sup.3) 3.65 7.52 11.88 43.28 74.31 91.43 100.91 N 10 10 10 10 10 10 6 4 Mean (mm.sup.3) 88.82 108.44 128.42 316.07 549.72 957.90 1220.96 SEM (mm.sup.3) 3.48 5.34 8.69 49.35 56.21 125.30 137.76 N 10 10 10 10 10 10 8 13c Mean (mm.sup.3) 88.96 123.60 141.09 215.87† 305.38†, ‡ 378.04†, ‡ 609.37†, ‡ SEM (mm.sup.3) 2.15 6.78 9.55 33.39 58.73 75.61 129.13 N 15 15 15 15 15 15 11 SEM = standard error of the mean, N = sample size; †p < 0.05 vs Ac-9, ‡p < 0.05 vs 4. Significance was determined by Two-way ANOVA followed by multiple comparisons using Tukey's Honest Significant Differences (HSD) post-hoc test.
Example 12: In Vivo Cytokine Induction
[1384] The study was conducted in female BALB/C mice with an age of 6-11 weeks at the day of tumor inoculation. Mice were subcutaneously implanted with 3×10.sup.5 CT26 tumor cells in the left and right flanks. When tumors to be injected were grown to a mean tumor volume of ˜105 mm.sup.3, mice were randomized into treatment cohorts (day 0). The day following randomization, animals received a single dose of either 20 μg of resiquimod 4 (dissolved in10 mM succinate, 90.0 mg/mL trehalose dihydrate, pH 5.0) or hydrogel 13c as a single intratumoral dose in an injection volume of 50 μL or a single intratumoral injection of 50 μL of a suspension of Ac-9. Hydrogels were administered as suspensions in PBST buffer. K.sub.2 EDTA-preserved blood samples were collected by retro-orbital bleed at various time points following drug administration and plasma was isolated following centrifugation at 2000×g for 5 minutes at 4° C. and frozen. Plasma samples were stored at −80° C. Plasma was thawed and undiluted samples were assessed for cytokine levels using the 36-Plex Mouse ProcartaPlex™ Cytokine Panel 1A (ThermoFisher Scientific) following manufacturer's recommendations. Cytokines were measured on the Bio-Plex 200 (BioRad) following kit instructions. For sample values below or at the lower limit of quantitation (LLOQ) of the assay, a value of 0.01 pg/mL was instead used in determining mean cytokine concentrations.
[1385] Results:
[1386] Plasma cytokine levels
TABLE-US-00004 IFNγ Hours post-treatment Group 1 3 6 10 24 Ac-9 Mean (pg/mL) 0.01 0.01 0.01 0.01 0.01 SEM (pg/mL) 0.00 0.00 0.00 0.00 0.00 N 3 3 3 3 3 4 Mean (pg/mL) 4.04 15.49†, ‡ 40.72†, ‡ 28.19†, ‡ 2.38 SEM (pg/mL) 0.45 6.64 3.49 4.50 1.21 N 3 3 3 3 3 13c Mean (pg/mL) 0.01 0.49 2.76 4.51 2.10 SEM (pg/mL) 0.00 0.48 1.42 0.87 0.37 N 3 3 3 3 3 SEM = standard error of the mean, N = sample size; †p ≤ 0.0002 vs Ac-9, ‡p ≤ 0.0002 vs 13c. Significance was determined by Two-way ANOVA followed by multiple comparisons using Tukey's Honest Significant Differences (HSD) post-hoc test.
TABLE-US-00005 IL-6 Hours post-treatment Group 1 3 6 10 24 Ac-9 Mean 40.31 25.68 4.86 14.93 57.67 (pg/mL) SEM 12.13 15.78 4.85 4.55 12.86 (pg/mL) N 3 3 3 3 3 4 Mean 3618.87†, ‡ 1739.75†, ‡ 88.59 154.51 44.71 (pg/mL) SEM 146.11 360.03 16.66 69.39 28.80 (pg/mL) N 3 3 3 3 3 13c Mean 52.18 141.69 80.47 71.58 270.01 (pg/mL) SEM 18.14 55.52 11.99 22.72 96.47 (pg/mL) N 3 3 3 3 3 SEM = standard error of the mean, N = sample size; †p < 0.0001 vs Ac-9, ‡p < 0.0001 vs 13c. Significance was determined by Two-way ANOVA followed by multiple comparisons using Tukey's Honest Significant Differences (HSD) post-hoc test.
TABLE-US-00006 CCL2/MCP-1 Hours post-treatment Group 1 3 6 10 24 Ac-9 Mean 17.81 38.01 23.18 39.77 50.04 (pg/mL) SEM 10.94 10.74 1.02 8.97 19.42 (pg/mL) N 3 3 3 3 3 4 Mean 357.83 4230.35†, ‡ 1039.17†, ‡ 847.07† 92.58 (pg/mL) SEM 80.35 147.36 279.41 182.24 1.59 (pg/mL) N 3 3 3 3 3 13c Mean 62.28 282.21 309.21 508.54†† 237.05 (pg/mL) SEM 21.46 114.89 108.22 71.83 6.31 (pg/mL) N 3 3 3 3 3 SEM = standard error of the mean, N = sample size †p ≤ 0.0001 vs Ac-9, ‡p ≤ 0.0001 vs 13c, ††p < 0.02 vs Ac-9. Significance was determined by Two-way ANOVA followed by multiple comparisons using Tukey's Honest Significant Differences (HSD) post-hoc test.
TABLE-US-00007 TNFα Hours post-treatment Group 1 3 6 10 24 Ac-9 Mean 2.29 1.93 4.73 1.36 2.11 (pg/mL) SEM 2.28 1.92 0.25 1.35 2.10 (pg/mL) N 3 3 3 3 3 4 Mean 830.84 136.25 35.49 43.32 9.74 (pg/mL) SEM 99.38†, ‡ 17.86†, ‡ 1.05 14.06 2.14 (pg/mL) N 3 3 3 3 3 13c Mean 7.34 27.00 26.46 13.78 19.70 (pg/mL) SEM 0.80 4.31 8.56 3.21 0.99 (pg/mL) N 3 3 3 3 3 SEM = standard error of the mean, N = sample size; †p < 0.004 vs Ac-9, ‡p < 0.02 vs 13c. Significance was determined by Two-way ANOVA followed by multiple comparisons using Tukey's Honest Significant Differences (HSD) post-hoc test.
Example 13: In Vivo Dose Escalation, Tumor Cytokine and Chemokine Profiling, and Tumor Efficacy Study
[1387] The study was conducted in female BALB/C mice with an age of 6-11 weeks at the day of tumor inoculation. Mice were implanted with 3×10.sup.5 CT26 tumor cells into the right flank. When tumors were grown to a mean tumor volume of ˜115 mm.sup.3, mice were randomized into treatment cohorts (day 0). The day following randomization, animals received either 13g, 13f, 13e, or 13d as a single intratumoral dose in an injection volume of 50 μL or a single intratumoral injection of 50 μL of a suspension of Ac-11b. Hydrogels were administered as suspensions in PTP buffer. Following treatment initiation, anti-tumor efficacy was assessed by determination of tumor volumes at various time points from tumor size measurements with a caliper. Tumor volumes were calculated according to the formula:
Tumor volume=(L×W.sup.2)×0.5
where L is the length of the tumor and W the width (both in mm). On the same day as tumor measurements, mice were weighed for absolute body weight. At defined time points (6 hours, 3 days, and 7 days post-treatment initiation), 2-3 mice per group were sacrificed and tumors were harvested and frozen while plasma was prepared after blood withdrawal. Plasma was also generated for all mice which were taken out of the study when termination criteria were reached. The concentration of resiquimod in the plasma samples was quantified by LC-MS/MS. Serum PK parameters for animals that received 13e or 13d were analysed using the noncompartmental (NCA) approach using Phoenix 64 (Version 8). Frozen tumors were cut in to pieces approximately 0.3-0.8 mm in length, then mechanically homogenized via mortar and pestle while kept frozen. For tumor cytokine and chemokine protein assessment, an aliquot of homogenized tumor was lysed in 400 μL of ProcartaPlex cell lysis buffer (ThermoFisher Scientific) per every 50 mg of tissue. Samples were sonicated to facilitate tumor lysis. Lysates were centrifuged at 30,000 G for 20 minutes at 4° C., and supernatants were harvested. Protein concentrations were measured using the Bio-Rad DC Protein Assay kit (Bio-Rad) following manufacturer's recommendations. Samples were diluted with PBS to a protein concentration of 5.5 mg protein/mL. 25 μL of concentration adjusted samples were then assessed for chemokine and cytokine levels using the 36-Plex Mouse ProcartaPlex Cytokine Panel 1A (ThermoFisher Scientific) following manufacturer's recommendations. Cytokines were measured on the Bio-Plex 200 (Bio-Rad) following kit instructions. For sample values below or at the lower limit of quantitation (LLOQ) of the assay, a value of 0.01 pg/mL was instead used in determining mean cytokine concentrations. Fold changes were determined by dividing the mean cytokine concentrations of treated samples by the mean cytokine concentration of Ac-11b treated samples at each timepoint. For tumor cytokine and chemokine gene expression assessment, RNA was isolated from an aliquot of homogenized tumor using the mirVana miRNA Isolation kit (Ambion) following manufacturer's recommendations. Following the first column washing step, DNA was digested directly on the column using the RNase-free DNase Set (Qiagen) following manufacturer's recommendations. RNA was eluted with RNase-free water. RNA concentrations were measured using a NanoDrop (ThermoFisher) and then adjusted to 215-250 ng/mL with RNase-free water. RNA quality was assessed using a Bioanalyzer (Agilent). RNA integrity was confirmed to be of high quality (RIN between 6.5-10). 1 μg of RNA was reverse transcribed to cDNA using the M-MLV Reverse Transcriptase kit (ThermoFisher). Reverse transcription was performed using random primers, 10 mM dNTP mix, and RNase inhibitor (Promega). Reverse transcription was performed with the following thermal steps: 65° C. for 5 minutes, 4° C. for 5 minutes, 25° C. for 10 minutes, 4° C. for 5 minutes, 37° C. for 50 minutes, 42° C. for 10 minutes. 25 ng of cDNA was used for quantitative PCR using the KAPA SYBR FAST qPCR Master Mix (2X) kit (Kapa Biosystems) following manufacturer's recommendations. Primers used for qPCR reactions are as follows:
TABLE-US-00008 Gene Forward Sequence Reverse Sequence Ubb GTCTGAGGGGTGGCTATTAA GCTTACCATGCAACAAAACC (SEQ ID NO: 2) (SEQ ID NO: 3) Ccl2 CAGCTCTCTCTTCCTCCACC TGGGATCATCTTGCTGGTGA (SEQ ID NO: 4) (SEQ ID NO: 5) Ccl3 CCAGCCAGGTGTCATTTTCC AGGCATTCAGTTCCAGGTCA (SEQ ID NO: 6) (SEQ ID NO: 7) Ccl4 TCTGTGCTAACCCCAGTGAG CTCTCCTGAAGTGGCTCCTC (SEQ ID NO: 8) (SEQ ID NO: 9) Ccl5 TGCCAACCCAGAGAAGAAGT AGATGCCCATTTTCCCAGGA (SEQ ID NO: 10) (SEQ ID NO: 11) Csf2 CTGCGTAATGAGCCAGGAAC TCTCTCGTTTGTCTTCCGCT (SEQ ID NO: 12) (SEQ ID NO: 13) Cxcl1 TTGTATGGTCAACACGCACG ACGAGACCAGGAGAAACAGG (SEQ ID NO: 14) (SEQ ID NO: 15) Cxcl2 CTACATCCCACCCACACAGT TGTTCTACTCTCCTCGGTGC (SEQ ID NO: 16) (SEQ ID NO: 17) Cxcl10 GCCGTCATTTTCTGCCTCAT GATAGGCTCGCAGGGATGAT (SEQ ID NO: 18) (SEQ ID NO: 19) Il1b ACTCATTGTGGCTGTGGAGA TTGTTCATCTCGGAGCCTGT (SEQ ID NO: 20) (SEQ ID NO: 21) Il6 TTCTTGGGACTGATGCTGGT CAGGTCTGTTGGGAGTGGTA (SEQ ID NO: 22) (SEQ ID NO: 23) Il10 ACCTGGTAGAAGTGATGCCC AGGGTCTTCAGCTTCTCACC (SEQ ID NO: 24) (SEQ ID NO: 25) Il18 GGACACTTTCTTGCTTGCCA ACCCTCCCCACCTAACTTTG (SEQ ID NO: 26) (SEQ ID NO: 27) Tnf TGAGGTCAATCTGCCCAAGT GGGGTCAGAGTAAAGGGGTC (SEQ ID NO: 28) (SEQ ID NO: 29)
[1388] Cycle thresholds (CT) were collected using a StepOnePlus Real-Time PCR System (Applied Biosystems). Ubb was used as a housekeeping control gene. Data is reported as the average of the 2{circumflex over ( )}ΔΔCT values for each treatment. 2{circumflex over ( )}ΔΔCT values were calculated with the following formula:
2{circumflex over ( )}ΔΔCT=2{circumflex over ( )}−(ΔCT(treated)−ΔCT(untreated))
[1389] ΔCT(treated)=CT(treated)−CT(treated housekeeping) where CT(treated)=CT of the gene of interest of a sample replicate in the treatment group at a given timepoint and CT(treated housekeeping)=CT of the UBB housekeeping gene of the same sample replicate in the same treatment group at the same timepoint
[1390] ΔCT(untreated)=CT(Ac-11b)-CT(Ac-11b housekeeping) where CT(Ac-11b)=average of the CTs of the 3 Ac-11b samples at the same timepoint as the CT(treated) comparator and CT(Ac-11b housekeeping)=average of the UBB housekeeping gene CTs of the 3 Ac-11b samples of the same timepoint.
[1391] Results:
[1392] Absolute tumor volumes (mm.sup.3)
TABLE-US-00009 Days post-treatment Group 0 3 6 8 10 Ac-11b Mean 113.58 354.04 516.60 885.98 852.10 (mm.sup.3) SEM 6.66 34.52 61.18 101.23 81.08 (mm.sup.3) N 17 14 11 11 8 13d Mean 114.19 359.94 497.52 639.44† 795.98 (mm.sup.3) SEM 6.37 20.55 33.21 50.47 117.89 (mm.sup.3) N 17 14 11 11 8 13e Mean 114.03 319.01 367.39 518.55† 587.11† (mm.sup.3) SEM 6.17 29.95 48.16 68.48 79.87 (mm.sup.3) N 17 14 11 11 8 13f Mean 113.93 309.38 352.56 458.16† 585.91† (mm.sup.3) SEM 6.10 24.91 47.46 60.90 72.34 (mm.sup.3) N 17 13 9 9 7 13g Mean 114.17 240.09 287.44†, ‡ 369.03†, ‡ 411.80†, ‡ (mm.sup.3) SEM 5.67 20.63 52.27 73.29 94.97 (mm.sup.3) N 17 14 10 9 7 SEM = standard error of the mean, N = sample size; †p < 0.01 vs Ac-11b, ‡p < 0.02 vs 13d. Significance was determined by Two-way ANOVA followed by multiple comparisons using Tukey's Honest Significant Differences (HSD) post-hoc test.
[1393] Absolute body weight (g)
TABLE-US-00010 Days post-treatment Group 0 3 6 8 10 Ac-11b Mean (g) 17.86 18.25 18.76 19.28 19.10 SEM (g) 0.29 0.30 0.42 0.46 0.50 N 17 14 11 11 8 13d Mean (g) 17.82 18.08 18.73 19.29 19.41 SEM (g) 0.27 0.26 0.30 0.30 0.42 N 17 14 11 11 8 13e Mean (g) 18.23 18.14 18.59 19.06 19.11 SEM (g) 0.28 0.30 0.35 0.33 0.45 N 17 14 11 11 8 13f Mean (g) 17.97 17.85 18.23 18.39 18.57 SEM (g) 0.30 0.29 0.40 0.41 0.47 N 17 13 10 9 7 13g Mean (g) 18.04 17.39 18.34 19.02 18.96 SEM (g) 0.21 0.27 0.28 0.40 0.40 N 17 14 11 9 7
[1394] Resiquimod concentration in plasma samples
TABLE-US-00011 Time (days) 0.25 3 7 9 12 14 16 Group Resiquimod (pg/mL) 13d Mean 55.6 122 81.5 67.5 19.9 57 ND SD 8.1 59 23 NC NC 8.5 ND N 3 3 3 1 1 3 ND CV % 14.6 48.2 27.9 NC NC 14.9 ND 13e Mean 216 383 319 160 155 ND 127 SD 75 230 63 NC 39 ND NC N 3 3 3 1 2 ND 1 CV % 34.9 59.7 19.7 NC 25.5 ND NC SD = standard deviation, CV % = coefficient of variation, N = sample size, NC = not calculable, ND = not determined
[1395] Calculated PK parameters
TABLE-US-00012 Dose Mean Cmax (pg/ml) Mean AUC (ng.h/ml) MRT (hours) 13d 122 (pg/mL) 35.4 287 13e 383 (pg/ml) 120.4 280 MRT: Estimated Mean Residence Time; Estimated Area Under Plasma Concentration-Time Profile, Cmax: estimated maximum Plasma Concentration
[1396] Tumor lysate cytokine levels
TABLE-US-00013 CXCL1 / GROα / KC Hours post-treatment Group 6 72 168 Ac-11b Mean (pg/mL) 332.60 640.50 727.60 SEM (pg/mL) 66.37 162.20 185.10 Fold change over Ac-11b 1.00 1.00 1.00 N 3 3 3 13e Mean (pg/mL) 1270.00† 3624.00† 3339.00† SEM (pg/mL) 360.70 752.10 492.00 Fold change over Ac-11b 3.82 5.66 4.59 N 3 3 3 13f Mean (pg/mL) 875.40 3924.00† 4538.00† SEM (pg/mL) 145.20 968.60 751.00 Fold change over Ac-11b 2.63 6.13 6.24 N 3 3 2 13g Mean (pg/mL) ND 1419.00 2785.00 SEM (pg/mL) ND 335.40 989.40 Fold change over Ac-11b ND 2.22 3.83 N NA 3 2 SEM = standard error of the mean, N = sample size, ND = not determined, NA = not applicable; †p < 0.05 vs Ac-11b at the same timepoint. Significance was determined by One-way ANOVA followed by treatment group comparisons against Ac-11b treated controls for every time point using Dunnett's multiple comparisons post-hoc test.
TABLE-US-00014 IL-1β Hours post-treatment Group 6 72 168 Ac-11b Mean (pg/mL) 30.83 23.30 17.86 SEM (pg/mL) 1.31 0.15 1.47 Fold change over Ac-11b 1.00 1.00 1.00 N 3 3 3 13e Mean (pg/mL) 132.10 54.65 53.85† SEM (pg/mL) 35.22 10.35 3.67 Fold change over Ac-11b 4.28 2.35 3.02 N 3 3 3 13f Mean (pg/mL) 119.80 64.03† 69.12† SEM (pg/mL) 26.84 7.54 8.70 Fold change over Ac-11b 3.89 2.75 3.87 N 3 3 2 13g Mean (pg/mL) ND 56.54 59.42† SEM (pg/mL) ND 10.20 16.10 Fold change over Ac-11b ND 2.43 3.33 N NA 3 2 SEM = standard error of the mean, N = sample size, ND = not determined, NA = not applicable; †p < 0.05 vs Ac-11b at the same timepoint. Significance was determined by One-way ANOVA followed by treatment group comparisons against Ac-11b treated controls for every time point using Dunnett's multiple comparisons post-hoc test.
TABLE-US-00015 IL-6 Hours post-treatment Group 6 72 168 Ac-11b Mean (pg/mL) 59.01 86.57 100.10 SEM (pg/mL) 1.71 19.11 18.59 Fold change over 1.00 1.00 1.00 Ac-11b N 3 3 3 13e Mean (pg/mL) 755.40 270.60 286.10† SEM (pg/mL) 301.20 51.04 41.06 Fold change over 12.80 3.13 2.86 Ac-11b N 3 3 3 13f Mean (pg/mL) 744.10 523.60† 82.92 SEM (pg/mL) 136.80 159.70 17.37 Fold change over 12.61 6.05 0.83 Ac-11b N 3 3 2 13g Mean (pg/mL) ND 128.30 99.04 SEM (pg/mL) ND 31.05 13.27 Fold change over ND 1.48 0.99 Ac-11b N NA 3 2 SEM = standard error of the mean, N = sample size, ND = not determined, NA = not applicable; †p < 0.05 vs Ac-11b at the same timepoint. Significance was determined by One-way ANOVA followed by treatment group comparisons against Ac-11b treated controls for every time point using Dunnett's multiple comparisons post-hoc test.
TABLE-US-00016 CXCL10 / IP-10 Hours post-treatment Group 6 72 168 Ac-11b Mean (pg/mL) 164.10 144.40 145.40 SEM (pg/mL) 1.28 18.04 15.02 Fold change over Ac-11b 1.00 1.00 1.00 N 3 3 3 13e Mean (pg/mL) 912.10† 276.80 212.70 SEM (pg/mL) 81.34 59.89 11.13 Fold change over Ac-11b 5.56 1.92 1.46 N 3 3 3 13f Mean (pg/mL) 950.00† 390.20† 197.80 SEM (pg/mL) 104.00 86.74 10.13 Fold change over Ac-11b 5.79 2.70 1.36 N 3 3 2 13g Mean (pg/mL) ND 426.40† 225.70 SEM (pg/mL) ND 43.68 54.55 Fold change over Ac-11b ND 2.95 1.55 N NA 3 2 SEM = standard error of the mean, N = sample size, ND = not determined, NA = not applicable ; †p < 0.05 vs Ac-11b at the same timepoint. Significance was determined by One-way ANOVA followed by treatment group comparisons against Ac-11b treated controls for every time point using Dunnett's multiple comparisons post-hoc test.
TABLE-US-00017 CCL2 / MCP-1 Hours post-treatment Group 6 72 168 Ac-11b Mean (pg/mL) 1682.00 1619.00 1763.00 SEM (pg/mL) 89.34 98.08 136.10 Fold change over Ac-11b 1.00 1.00 1.00 N 3 3 3 13e Mean (pg/mL) 3470.00 2738.00† 2690.00† SEM (pg/mL) 533.60 185.80 260.40 Fold change over Ac-11b 2.06 1.69 1.53 N 3 3 3 13f Mean (pg/mL) 3746.00 2891.00† 2603.00 SEM (pg/mL) 767.80 93.48 74.97 Fold change over Ac-11b 2.23 1.79 1.48 N 3 3 2 13g Mean (pg/mL) ND 2658.00† 2457.00 SEM (pg/mL) ND 148.30 103.70 Fold change over Ac-11b ND 1.64 1.39 N NA 3 2 SEM = standard error of the mean, N = sample size, ND = not determined, NA = not applicable ; †p < 0.05 vs Ac-11b at the same timepoint. Significance was determined by One-way ANOVA followed by treatment group comparisons against Ac-11b treated controls for every time point using Dunnett's multiple comparisons post-hoc test.
TABLE-US-00018 CCL3 / MIP-lα Hours post-treatment Group 6 72 168 Ac-11b Mean (pg/mL) 475.30 525.20 518.50 SEM (pg/mL) 44.13 33.93 31.84 Fold change over Ac-11b 1.00 1.00 1.00 N 3 3 3 13e Mean (pg/mL) 1214.00 840.50 862.40 SEM (pg/mL) 214.40 111.00 45.95 Fold change over Ac-11b 2.55 1.60 1.66 N 3 3 3 13f Mean (pg/mL) 1260.00† 1209.00† 1131.00† SEM (pg/mL) 244.50 214.30 118.40 Fold change over Ac-11b 2.65 2.30 2.18 N 3 3 2 13g Mean (pg/mL) ND 1099.00† 970.80† SEM (pg/mL) ND 62.99 212.50 Fold change over Ac-11b ND 2.09 1.87 N NA 3 2 SEM = standard error of the mean, N = sample size, ND = not determined, NA = not applicable; †p < 0.05 vs Ac-11b at the same timepoint. Significance was determined by One-way ANOVA followed by treatment group comparisons against Ac-11b treated controls for every time point using Dunnett's multiple comparisons post-hoc test.
TABLE-US-00019 CCL4 / MIP-1β Hours post-treatment Group 6 72 168 Ac-11b Mean (pg/mL) 160.50 142.20 99.26 SEM (pg/mL) 10.87 24.60 13.86 Fold change over Ac-11b 1.00 1.00 1.00 N 3 3 3 13e Mean (pg/mL) 1105.00 339.00 265.80 SEM (pg/mL) 469.40 94.18 57.35 Fold change over Ac-11b 6.88 2.38 2.68 N 3 3 3 13f Mean (pg/mL) 1031.00 432.00 458.50† SEM (pg/mL) 388.30 58.90 67.76 Fold change over Ac-11b 6.42 3.04 4.62 N 3 3 2 13g Mean (pg/mL) ND 561.40† 357.10 SEM (pg/mL) ND 106.60 138.10 Fold change over Ac-11b ND 3.95 3.60 N NA 3 2 SEM = standard error of the mean, N = sample size, ND = not determined, NA = not applicable; †p < 0.05 vs Ac-11b at the same timepoint. Significance was determined by One-way ANOVA followed by treatment group comparisons against Ac-11b treated controls for every time point using Dunnett's multiple comparisons post-hoc test.
TABLE-US-00020 CXCL2 / MIP-2α Hours post-treatment Group 6 72 168 Ac-11b Mean (pg/mL) 188.00 548.30 1140.00 SEM (pg/mL) 56.39 124.40 172.90 Fold change over Ac-11b 1.00 1.00 1.00 N 3 3 3 13e Mean (pg/mL) 1122.00 1910.00 3144.00† SEM (pg/mL) 365.00 439.60 84.67 Fold change over Ac-11b 5.97 3.48 2.76 N 3 3 3 13f Mean (pg/mL) 921.00 2471.00† 2884.00† SEM (pg/mL) 299.70 564.80 285.20 Fold change over Ac-11b 4.90 4.51 2.53 N 3 3 2 13g Mean (pg/mL) ND 2570.00† 2723.00† SEM (pg/mL) ND 221.20 317.60 Fold change over Ac-11b ND 4.69 2.39 N NA 3 2 SEM = standard error of the mean, N = sample size, ND = not determined, NA = not applicable; †p < 0.05 vs Ac-11b at the same timepoint. Significance was determined by One-way ANOVA followed by treatment group comparisons against Ac-11b treated controls for every time point using Dunnett's multiple comparisons post-hoc test.
TABLE-US-00021 TNFα Hours post-treatment Group 6 72 168 Ac-11b Mean (pg/mL) 16.77 10.32 8.44 SEM (pg/mL) 2.88 0.61 0.91 Fold change over Ac-11b 1.00 1.00 1.00 N 3 3 3 13e Mean (pg/mL) 122.30 43.68 39.25 SEM (pg/mL) 17.09 3.91 4.16 Fold change over Ac-11b 7.29 4.23 4.65 N 3 3 3 13f Mean (pg/mL) 139.70† 102.60 68.57† SEM (pg/mL) 48.51 53.71 14.95 Fold change over Ac-11b 8.33 9.94 8.12 N 3 3 2 13g Mean (pg/mL) ND 57.06 33.27 SEM (pg/mL) ND 3.84 12.87 Fold change over Ac-11b ND 5.53 3.94 N NA 3 2 SEM = standard error of the mean, N = sample size, ND = not determined, NA = not applicable; †p < 0.05 vs Ac-11b at the same timepoint. Significance was determined by One-way ANOVA followed by treatment group comparisons against Ac-11b treated controls for every time point using Dunnett's multiple comparisons post-hoc test.
[1397] Tumor gene expression
TABLE-US-00022 Cc12 Hours post-treatment Group 6 72 168 Ac-11b Mean (2{circumflex over ( )}ΔΔCT) 1.02 1.00 1.01 SEM (2{circumflex over ( )}ΔΔCT) 0.13 0.04 0.10 Fold change over Ac-11b 1.00 1.00 1.00 N 3 3 3 13e Mean (2{circumflex over ( )}ΔΔCT) 4.76 1.76 1.33 SEM (2{circumflex over ( )}ΔΔCT) 2.33 0.40 0.12 Fold change over Ac-11b 4.68 1.76 1.32 N 3 3 3 13f Mean (2{circumflex over ( )}ΔΔCT) 5.12 1.43 1.44 SEM (2{circumflex over ( )}ΔΔCT) 1.61 0.25 0.57 Fold change over Ac-11b 5.04 1.43 1.42 N 3 3 2 13g Mean (2{circumflex over ( )}ΔΔCT) 7.14 2.00† 2.31† SEM (2{circumflex over ( )}ΔΔCT) 1.67 0.11 0.27 Fold change over Ac-11b 7.02 2.00 2.28 N 3 3 2 SEM = standard error of the mean, N = sample size, ND = not determined, NA = not applicable; †p < 0.05 vs Ac-11b at the same timepoint. Significance was determined by One-way ANOVA followed by treatment group comparisons against Ac-11b treated controls for every time point using Dunnett's multiple comparisons post-hoc test.
TABLE-US-00023 Ccl3 Hours post-treatment Group 6 72 168 Ac-11b Mean (2{circumflex over ( )}ΔΔCT) 1.01 1.01 1.11 SEM (2{circumflex over ( )}ΔΔCT) 0.12 0.08 0.37 Fold change over Ac-11b 1.00 1.00 1.00 N 3 3 3 13e Mean (2{circumflex over ( )}ΔΔCT) 9.81 2.78 1.17 SEM (2{circumflex over ( )}ΔΔCT) 5.42 0.95 0.24 Fold change over Ac-11b 9.68 2.76 1.05 N 3 3 3 13f Mean (2{circumflex over ( )}ΔΔCT) 7.26 12.36 5.05 SEM (2{circumflex over ( )}ΔΔCT) 2.88 10.11 1.43 Fold change over Ac-11b 7.17 12.27 4.54 N 3 3 2 13g Mean (2{circumflex over ( )}ΔΔCT) 8.64 5.15 7.74† SEM (2{circumflex over ( )}ΔΔCT) 2.19 0.76 2.25 Fold change over Ac-11b 8.53 5.11 6.95 N 3 3 2 SEM = standard error of the mean, N = sample size, ND = not determined, NA = not applicable; †p < 0.05 vs Ac-11b at the same timepoint. Significance was determined by One-way ANOVA followed by treatment group comparisons against Ac-11b treated controls for every time point using Dunnett's multiple comparisons post-hoc test.
TABLE-US-00024 Ccl4 Hours post-treatment Group 6 72 168 Ac-11b Mean (2{circumflex over ( )}ΔΔCT) 1.01 1.04 1.09 SEM (2{circumflex over ( )}ΔΔCT) 0.09 0.23 0.33 Fold change over Ac-11b 1.00 1.00 1.00 N 3 3 3 13e Mean (2{circumflex over ( )}ΔΔCT) 6.93 1.54 0.68 SEM (2{circumflex over ( )}ΔΔCT) 3.49 0.42 0.10 Fold change over Ac-11b 6.88 1.47 0.62 N 3 3 3 13f Mean (2{circumflex over ( )}ΔΔCT) 5.42 5.49 2.37 SEM (2{circumflex over ( )}ΔΔCT) 2.36 4.41 0.68 Fold change over Ac-11b 5.39 5.26 2.16 N 3 3 2 13g Mean (2{circumflex over ( )}ΔΔCT) 8.91 1.95 2.68 SEM (2{circumflex over ( )}ΔΔCT) 2.37 0.24 0.75 Fold change over Ac-11b 8.85 1.87 2.45 N 3 3 2 SEM = standard error of the mean, N = sample size, ND = not determined, NA = not applicable
TABLE-US-00025 Ccl5 Hours post-treatment Group 6 72 168 Ac-11b Mean (2{circumflex over ( )}ΔΔCT) 1.01 1.09 1.08 SEM (2{circumflex over ( )}ΔΔCT) 0.10 0.32 0.27 Fold change over Ac-11b 1.00 1.00 1.00 N 3 3 3 13e Mean (2{circumflex over ( )}ΔΔCT) 12.58 2.13 1.08 SEM (2{circumflex over ( )}ΔΔCT) 7.87 0.89 0.20 Fold change over Ac-11b 12.46 1.96 1.00 N 3 3 3 13f Mean (2{circumflex over ( )}ΔΔCT) 15.64 7.50 3.92† SEM (2{circumflex over ( )}ΔΔCT) 7.95 5.77 1.16 Fold change over Ac-11b 15.49 6.90 3.63 N 3 3 2 13g Mean (2{circumflex over ( )}ΔΔCT) 22.13 3.98 3.05 SEM (2{circumflex over ( )}ΔΔCT) 5.66 0.68 1.10 Fold change over Ac-11b 21.91 3.66 2.82 N 3 3 2 SEM = standard error of the mean, N = sample size, ND = not determined, NA = not applicable; †p < 0.05 vs Ac-11b at the same timepoint. Significance was determined by One-way ANOVA followed by treatment group comparisons against Ac-11b treated controls for every time point using Dunnett's multiple comparisons post-hoc test.
TABLE-US-00026 Csf2 Hours post-treatment Group 6 72 168 Ac-11b Mean (2{circumflex over ( )}ΔΔCT) 1.00 1.31 1.32 SEM (2{circumflex over ( )}ΔΔCT) 0.05 0.68 0.58 Fold change over Ac-11b 1.00 1.00 1.00 N 3 3 3 13e Mean (2{circumflex over ( )}ΔΔCT) 6.99 2.14 0.56 SEM (2{circumflex over ( )}ΔΔCT) 4.27 0.56 0.17 Fold change over Ac-11b 6.97 1.64 0.43 N 3 3 3 13f Mean (2{circumflex over ( )}ΔΔCT) 5.27 2.61 0.23 SEM (2{circumflex over ( )}ΔΔCT) 1.68 0.89 0.04 Fold change over Ac-11b 5.25 2.00 0.17 N 3 3 2 13g Mean (2{circumflex over ( )}ΔΔCT) 5.24 0.53 0.45 SEM (2{circumflex over ( )}ΔΔCT) 0.43 0.07 0.02 Fold change over Ac-11b 5.22 0.41 0.34 N 3 3 2 SEM = standard error of the mean, N = sample size, ND = not determined, NA = not applicable
TABLE-US-00027 Cxcl1 Hours post-treatment Group 6 72 168 Ac-11b Mean (2{circumflex over ( )}ΔΔCT) 1.00 1.33 1.47 SEM (2{circumflex over ( )}ΔΔCT) 0.03 0.71 0.64 Fold change over Ac-11b 1.00 1.00 1.00 N 3 3 3 13e Mean (2{circumflex over ( )}ΔΔCT) 2.00 5.28 1.03 SEM (2{circumflex over ( )}ΔΔCT) 1.00 1.86 0.50 Fold change over Ac-11b 2.00 3.97 0.70 N 3 3 3 13f Mean (2{circumflex over ( )}ΔΔCT) 1.23 2.08 0.42 SEM (2{circumflex over ( )}ΔΔCT) 0.30 0.96 0.02 Fold change over Ac-11b 1.23 1.57 0.28 N 3 3 2 13g Mean (2{circumflex over ( )}ΔΔCT) 3.74† 0.70 0.77 SEM (2{circumflex over ( )}ΔΔCT) 0.41 0.14 0.25 Fold change over Ac-11b 3.74 0.53 0.52 N 3 3 2 SEM = standard error of the mean, N = sample size, ND = not determined, NA = not applicable; †p < 0.05 vs Ac-11b at the same timepoint. Significance was determined by One-way ANOVA followed by treatment group comparisons against Ac-11b treated controls for every time point using Dunnett's multiple comparisons post-hoc test.
TABLE-US-00028 Cxcl2 Hours post-treatment Group 6 72 168 Ac-11b Mean (2{circumflex over ( )}ΔΔCT) 1.08 1.10 1.31 SEM (2{circumflex over ( )}ΔΔCT) 0.28 0.33 0.64 Fold change over Ac-11b 1.00 1.00 1.00 N 3 3 3 13e Mean (2{circumflex over ( )}ΔΔCT) 4.94 4.00 1.03 SEM (2{circumflex over ( )}ΔΔCT) 2.06 1.50 0.24 Fold change over Ac-11b 4.58 3.63 0.78 N 3 3 3 13f Mean (2{circumflex over ( )}ΔΔCT) 2.66 13.18 3.91 SEM (2{circumflex over ( )}ΔΔCT) 0.61 10.73 1.26 Fold change over Ac-11b 2.47 11.98 2.98 N 3 3 2 13g Mean (2{circumflex over ( )}ΔΔCT) 3.33 4.12 8.49† SEM (2{circumflex over ( )}ΔΔCT) 0.78 1.07 2.66 Fold change over Ac-11b 3.09 3.75 6.48 N 3 3 2 SEM = standard error of the mean, N = sample size, ND = not determined, NA = not applicable; †p < 0.05 vs Ac-11b at the same timepoint. Significance was determined by One-way ANOVA followed by treatment group comparisons against Ac-11b treated controls for every time point using Dunnett's multiple comparisons post-hoc test.
TABLE-US-00029 Cxcl10 Hours post-treatment Group 6 72 168 Ac-11b Mean (2{circumflex over ( )}ΔΔCT) 1.02 1.01 1.01 SEM (2{circumflex over ( )}ΔΔCT) 0.15 0.09 0.11 Fold change over Ac-11b 1.00 1.00 1.00 N 3 3 3 13e Mean (2{circumflex over ( )}ΔΔCT) 29.23 3.24 2.09 SEM (2{circumflex over ( )}ΔΔCT) 16.71 0.85 0.53 Fold change over Ac-11b 28.57 3.21 2.07 N 3 3 3 13f Mean (2{circumflex over ( )}ΔΔCT) 31.41 3.83† 1.92 SEM (2{circumflex over ( )}ΔΔCT) 13.05 1.05 0.31 Fold change over Ac-11b 30.70 3.81 1.90 N 3 3 2 13g Mean (2{circumflex over ( )}ΔΔCT) 32.96 2.15 2.29 SEM (2{circumflex over ( )}ΔΔCT) 6.33 0.29 0.43 Fold change over Ac-11b 32.22 2.14 2.27 N 3 3 2 SEM = standard error of the mean, N = sample size, ND = not determined, NA = not applicable; †p < 0.05 vs Ac-11b at the same timepoint. Significance was determined by One-way ANOVA followed by treatment group comparisons against Ac-11b treated controls for every time point using Dunnett's multiple comparisons post-hoc test.
TABLE-US-00030 Il1b Hours post-treatment Group 6 72 168 Ac-11b Mean (2{circumflex over ( )}ΔΔCT) 1.02 1.00 1.10 SEM (2{circumflex over ( )}ΔΔCT) 0.13 0.05 0.34 Fold change over Ac-11b 1.00 1.00 1.00 N 3 3 3 13e Mean (2{circumflex over ( )}ΔΔCT) 6.50 5.43 2.26 SEM (2{circumflex over ( )}ΔΔCT) 4.23 2.10 0.54 Fold change over Ac-11b 6.39 5.41 2.06 N 3 3 3 13f Mean (2{circumflex over ( )}ΔΔCT) 2.82 6.79 0.27 SEM (2{circumflex over ( )}ΔΔCT) 1.14 4.11 0.27 Fold change over Ac-11b 2.77 6.77 0.25 N 3 3 2 13g Mean (2{circumflex over ( )}ΔΔCT) 14.22† 0.65 0.46 SEM (2{circumflex over ( )}ΔΔCT) 2.71 0.26 0.11 Fold change over Ac-11b 13.98 0.65 0.41 N 3 3 2 SEM = standard error of the mean, N = sample size, ND = not determined, NA = not applicable; †p < 0.05 vs Ac-11b at the same timepoint. Significance was determined by One-way ANOVA followed by treatment group comparisons against Ac-11b treated controls for every time point using Dunnett's multiple comparisons post-hoc test.
TABLE-US-00031 Il6 Hours post-treatment Group 6 72 168 Ac-11b Mean (2{circumflex over ( )}ΔΔCT) 1.02 1.24 1.45 SEM (2{circumflex over ( )}ΔΔCT) 0.16 0.58 0.70 Fold change over Ac-11b 1.00 1.00 1.00 N 3 3 3 13e Mean (2{circumflex over ( )}ΔΔCT) 6.25 2.77 1.31 SEM (2{circumflex over ( )}ΔΔCT) 4.00 0.88 0.49 Fold change over Ac-11b 6.13 2.24 0.90 N 3 3 3 13f Mean (2{circumflex over ( )}ΔΔCT) 6.68 4.54 4.31 SEM (2{circumflex over ( )}ΔΔCT) 1.98 1.41 3.78 Fold change over Ac-11b 6.55 3.67 2.98 N 3 3 2 13g Mean (2{circumflex over ( )}ΔΔCT) 5.05 0.98 0.60 SEM (2{circumflex over ( )}ΔΔCT) 0.93 0.25 0.15 Fold change over Ac-11b 4.95 0.79 0.41 N 3 3 2 SEM = standard error of the mean, N = sample size, ND = not determined, NA = not applicable
TABLE-US-00032 Il10 Hours post-treatment Group 6 72 168 Ac-11b Mean (2{circumflex over ( )}ΔΔCT) 1.04 1.31 1.36 SEM (2{circumflex over ( )}ΔΔCT) 0.20 0.67 0.57 Fold change over Ac-11b 1.00 1.00 1.00 N 3 3 3 13e Mean (2{circumflex over ( )}ΔΔCT) 1.58 0.81 1.29 SEM (2{circumflex over ( )}ΔΔCT) 0.38 0.03 0.50 Fold change over Ac-11b 1.52 0.62 0.94 N 3 3 3 13f Mean (2{circumflex over ( )}ΔΔCT) 4.89† 4.01 1.06 SEM (2{circumflex over ( )}ΔΔCT) 0.54 1.57 0.45 Fold change over Ac-11b 4.70 3.06 0.78 N 3 3 2 13g Mean (2{circumflex over ( )}ΔΔCT) 1.69 2.06 0.72 SEM (2{circumflex over ( )}ΔΔCT) 0.21 0.74 0.35 Fold change over Ac-11b 1.63 1.57 0.53 N 3 3 2 SEM = standard error of the mean, N = sample size, ND = not determined, NA = not applicable; †p < 0.05 vs Ac-11b at the same timepoint. Significance was determined by One-way ANOVA followed by treatment group comparisons against Ac-11b treated controls for every time point using Dunnett's multiple comparisons post-hoc test.
TABLE-US-00033 Il18 Hours post-treatment Group 6 72 168 Ac-11b Mean (2{circumflex over ( )}ΔΔCT) 1.01 1.15 1.21 SEM (2{circumflex over ( )}ΔΔCT) 0.09 0.45 0.43 Fold change over Ac-11b 1.00 1.00 1.00 N 3 3 3 13e Mean (2{circumflex over ( )}ΔΔCT) 2.14 0.94 0.97 SEM (2{circumflex over ( )}ΔΔCT) 0.56 0.14 0.31 Fold change over Ac-11b 2.12 0.82 0.80 N 3 3 3 13f Mean (2{circumflex over ( )}ΔΔCT) 4.45† 3.27 0.53 SEM (2{circumflex over ( )}ΔΔCT) 0.83 1.71 0.38 Fold change over Ac-11b 4.40 2.85 0.43 N 3 3 2 13g Mean (2{circumflex over ( )}ΔΔCT) 2.58 1.78 0.72 SEM (2{circumflex over ( )}ΔΔCT) 0.47 0.92 0.19 Fold change over Ac-11b 2.56 1.55 0.59 N 3 3 2 SEM = standard error of the mean, N = sample size, ND = not determined, NA = not applicable; †p < 0.05 vs Ac-11b at the same timepoint. Significance was determined by One-way ANOVA followed by treatment group comparisons against Ac-11b treated controls for every time point using Dunnett's multiple comparisons post-hoc test.
TABLE-US-00034 Tnf Hours post-treatment Group 6 72 168 Ac-11b Mean (2{circumflex over ( )}ΔΔCT) 1.03 1.18 1.20 SEM (2{circumflex over ( )}ΔΔCT) 0.17 0.49 0.44 Fold change over Ac-11b 1.00 1.00 1.00 N 3 3 3 13e Mean (2{circumflex over ( )}ΔΔCT) 4.63 1.25 0.73 SEM (2{circumflex over ( )}ΔΔCT) 2.75 0.28 0.15 Fold change over Ac-11b 4.51 1.06 0.61 N 3 3 3 13f Mean (2{circumflex over ( )}ΔΔCT) 3.33 3.87 2.19 SEM (2{circumflex over ( )}ΔΔCT) 0.92 2.48 0.09 Fold change over Ac-11b 3.25 3.28 1.83 N 3 3 2 13g Mean (2{circumflex over ( )}ΔΔCT) 3.36 4.78 2.76 SEM (2{circumflex over ( )}ΔΔCT) 0.57 1.40 1.40 Fold change over Ac-11b 3.27 4.05 2.30 N 3 3 2 SEM = standard error of the mean, N = sample size, ND = not determined, NA = not applicable
Example 14: In Vivo WT IL-2 Combination Abscopal Tumor Efficacy and Tumor Rechallenge
[1398] The study was conducted in female BALB/C mice with an age of 6-8 weeks at the day of tumor inoculation. Mice were implanted with 5×10.sup.5 CT26 tumor cells into the left and right flanks. When right flank tumors were grown to a mean tumor volume of −101 mm.sup.3, mice were randomized into treatment cohorts (day 0). On the same day of randomization, animals received 13h as a single intratumoral dose in an injection volume of 50 μL or a single intratumoral injection of 50 μL of a suspension of Ac-11b, in the right flank tumors. Hydrogels were administered as suspension in PTP buffer. Some cohorts were further treated with 20 μg human IL-2 (Peprotech, Rocky Hill, N.J.), intraperitoneally (I.P.), twice a day for 5 days, followed by a 3-day dose holiday, then further treated with 20 ug human IL-2 I.P. once a day for 5 additional days. Following treatment initiation, anti-tumor efficacy was assessed by determination of tumor volumes at various time points from tumor size measurements with a caliper. Tumor volumes were calculated according to the formula:
Tumor volume=(L×W.sup.2)×0.5
[1399] where L is the length of the tumor and W the width (both in mm).
[1400] 3 out of 7 mice that were treated with both 13h and human IL-2 experienced complete regressions in both treated and untreated tumors and were reimplanted with 5×10.sup.5 CT26 tumor cells in their right front flank ˜60 days after initial treatment. Following reimplantation, mice were monitored for signs of tumor growth at the newly implanted site. Naïve female BALB/C mice were also implanted with the same tumor on the same day as the reimplanted mice as naïve control mice for normal tumor growth comparisons. Tumor growth was assessed by determination of tumor volumes at various time points following implantation from tumor size measurements with a caliper and calculated according to the formula:
Tumor volume=(L×W.sup.2)×0.5
[1401] where L is the length of the tumor and W the width (both in mm). No tumor growth was observed in mice that were treated with both 13h and human IL-2˜60 days earlier at the end of the study period.
[1402] Results:
[1403] Absolute tumor volumes (mm.sup.3) of injected right flank tumors
TABLE-US-00035 Days post-treatment Group 0 2 5 7 9 12 14 16 Ac-11b Mean (mm.sup.3) 101.57 222.96 390.09 676.66 975.86 1460.78 1836.12 2271.84 SEM (mm.sup.3) 2.86 14.07 36.74 84.40 88.75 106.17 122.25 101.39 N 10 10 10 10 7 7 7 7 13h Mean (mm.sup.3) 101.70 147.86 222.54 359.25† 503.92† 691.12† 864.10† 1354.10† SEM (mm.sup.3) 3.09 5.89 18.62 38.62 63.80 101.80 135.92 149.33 N 10 10 10 10 7 7 7 7 Ac11b + Mean (mm.sup.3) 101.79 144.70 210.24 311.11† 413.93† 539.45† 659.38† 856.24†, ‡ human SEM (mm.sup.3) 2.94 3.09 14.94 41.16 54.23 68.25 93.21 131.97 IL-2 N 10 10 10 10 7 7 7 7 13h + Mean (mm.sup.3) 101.79 135.21 161.22† 183.69† 228.72†, ‡ 247.55†, ‡, †† 255.14†, ‡, †† 288.10†, ‡, †† human SEM (mm.sup.3) 2.99 6.19 12.56 26.42 45.45 59.32 67.52 90.98 IL-2 SEM = standard error of the mean, N = sample size; †p < 0.03 vs Ac-11b, ‡p < 0.03 vs 13h, ††p < 0.02 vs Ac-11b + human IL-2. Significance was determined by Two-way ANOVA followed by multiple comparisons using Tukey's Honest Significant Differences (HSD) post-hoc test.
[1404] Absolute tumor volumes (mm.sup.3) of uninjected left flank tumors
TABLE-US-00036 Days post-treatment Group 0 2 5 7 9 12 14 16 Ac-11b Mean (mm.sup.3) 94.45 192.41 327.64 583.05 769.07 1192.25 1644.95 2223.11 SEM (mm.sup.3) 4.84 19.38 38.05 89.15 86.70 118.05 137.96 166.70 N 10 10 10 10 7 7 7 7 13h Mean (mm.sup.3) 98.95 144.19 220.17 432.34 631.58 948.54 1239.77† 1854.24† SEM (mm.sup.3) 4.08 5.30 21.21 43.94 63.59 97.86 136.23 187.27 N 10 10 10 10 7 7 7 7 Ac-11b + Mean (mm.sup.3) 99.01 136.38 199.08 313.92 420.65† 542.96†, ‡ 718.21†, ‡ 995.12†, ‡ human SEM (mm.sup.3) 8.07 8.19 17.95 46.42 58.92 86.36 135.03 219.23 IL-2 N 10 10 10 10 7 7 7 7 13h + Mean (mm.sup.3) 92.48 121.70 139.10 177.79† 296.62†, ‡ 347.49†, ‡ 411.71†, ‡ 484.22†, ‡, †† human SEM (mm.sup.3) 4.47 9.59 13.12 34.35 82.23 101.27 139.26 165.58 IL-2 SEM = standard error of the mean, N = sample size; †p < 0.002 vs Ac-11b, ‡p < 0.04 vs 13h, ††p < 0.0003 vs Ac-11b + human IL-2. Significance was determined by Two-way ANOVA followed by multiple comparisons using Tukey's Honest Significant Differences (HSD) post-hoc test.
TABLE-US-00037 Absolute tumor volumes (mm.sup.3) of reimplanted and newly implanted mice Days post-CT26 implantation Group 0 3 7 10 14 17 21 24 Naïve Mean (mm.sup.3) 0 0 17.94 87.77 444.76 672.99 1622.95 2024.37 control mice SEM (mm.sup.3) 0 0 4.16 7.81 26.22 59.35 127.86 129.16 N 10 10 10 10 10 10 10 10 Reimplanted: Mean (mm.sup.3) 0 13.61 0 0 0 0 0 0 13h + human SEM (mm.sup.3) 0 13.61 0 0 0 0 0 0 IL-2 N 3 3 3 3 3 3 3 3 SEM = standard error of the mean, N = sample size
Example 15: Flow Cytometric Profiling of Tumor Draining Immune Cells
[1405] The study was conducted in female BALB/C mice with an age of 6-8 weeks at the day of tumor inoculation. Mice were implanted with 5×10.sup.5 CT26 tumor cells into the left and right flanks. When right flank tumors were grown to a mean tumor volume of ˜101 mm.sup.3, mice were randomized into treatment cohorts (day 0). On the same day of randomization, animals received a single dose of either 141 μg of resiquimod 4 (dissolved in 10 mM succinate, 90.0 mg/mL trehalose dihydrate, pH 5.0), 13h as a single intratumoral dose in an injection volume of 50 μL, or a single intratumoral injection of 50 μL of a suspension of Ac-11b, in the right flank tumors. Hydrogels were administered as suspension in PTP buffer. Some cohorts were further treated with 20 μg human IL-2 (Peprotech, Rocky Hill, N.J.), intraperitoneally (I.P.), twice a day for 5 days. Mice were sacrificed 7 days after randomization (DO). Following sacrifice, tumor draining lymph nodes were isolated from both flanks and were dissociated mechanically to generate a single cell suspension at a cell concentration of 1×10.sup.6 cells per sample. Cell suspensions were centrifuged at 300 g for 5 minutes. Supernatants were discarded and cells were resuspended in FACS buffer with 1 μg/ml Fc-Block and incubated at 4° C. for 10 minutes in the dark. Surface marker antibody mixtures (antibody concentration: 10 μg/mL) in FACS buffer were added to each sample and samples were incubated in the dark at 4° C. for 30 minutes. Cells were centrifuged at 300 g for 5 minutes and supernatants were discarded. Cells were washed and then resuspended with FACS buffer before cytometer collection.
[1406] Summary of Antibodies Used for FACS Profiling
TABLE-US-00038 Markers Fluorochrome Clone isotype CD45 BUV661 30-F11 Rat IgG2b, κ CD3 BUV395 17A2 Rat IgG2b, κ CD4 BV421 GK1.5 Rat IgG2b, κ CD8 PE-eFluor610 53-6.7 Rat IgG2a, κ CD335 BV605 29A1.4 Rat IgG2a, κ I-A/I-E (MHCII) BB515 2G9 Rat IgG2a, κ Ly-6C APC HK1.4 Rat IgG2c, κ L/D eFluor780 — —
[1407] After collection, FACS data was analyzed using FlowJo Version 10.6.1. Compensation was digitally adjusted using single antibody-stained beads. Samples with less than 90% viability, as determined by LiveDead cell staining, were excluded from the analysis. Cells were defined using the following gating strategy: [1408] 1) Ly-6C.sup.+ antigen presenting cells: FSC-H/FSC-A Singlets/LiveDead.sup.−/CD45.sup.+/CD3.sup.−/CD335.sup.−/Ly-6C.sup.+ [1409] 2) Ly-6C.sup.+ MHCII.sup.+ antigen presenting cells: FSC-H/FSC-A Singlets/LiveDead.sup.−/CD45.sup.+/CD3.sup.−/CD335.sup.−/Ly-6C.sup.+/IA/IE (MHCII).sup.+ [1410] 3) CD8.sup.+ T cells: FSC-H/FSC-A Singlets/LiveDead.sup.−/CD45.sup.+/CD3.sup.+/CD8 single positive 4) Ly-6C.sup.+ CD8.sup.+ T cells: FSC-H/FSC-A Singlets/LiveDead.sup.−/CD45.sup.+/CD3.sup.+/CD8 single positive/Ly-6C.sup.+
[1411] Results:
[1412] Frequency of Ly-6C.sup.+ antigen presenting cells of non-T cells
TABLE-US-00039 Tumor Group Injected, right flank Uninjected, left flank 4 Mean (%) 2.5 7.8 SEM (%) 0.36 2.1 N 3 2 Ac-11b Mean (%) 2.27 4.21 SEM (%) 0.40 0.68 N 3 2 13h Mean (%) 15.43†, ‡ 25.23 SEM (%) 5.22 7.91 N 3 3 Ac-11b + Mean (%) 3.49†† 7.69 human SEM (%) 0.27 3.21 IL-2 N 3 2 13h + Mean (%) 48.5†, ‡, ††, ‡‡ 31 human SEM (%) 1 4.34 IL-2 N 2 3 SEM = standard error of the mean, N = sample size; Injected tumors: †p < 0.03 vs Ac-11b, ‡p < 0.04 vs 4, ††p < 0.05 vs 13h, ‡‡p < 0.0001 vs Ac-11b + human IL-2. Significance was determined by One-way ANOVA followed by multiple comparisons using Tukey's multiple comparisons post-hoc test.
[1413] Frequency of IA-IE (MHCII).sup.+ antigen presenting cells of Ly-6C.sup.+ antigen presenting cells
TABLE-US-00040 Tumor Group Injected, right flank Uninjected, left flank 4 Mean (%) 69.63 35.05 SEM (%) 4.06 6.15 N 3 2 Ac-11b Mean (%) 70.5 24.8 SEM (%) 10.91 1.4 N 3 2 13h Mean (%) 94.77 95.6 SEM (%) 4.48 3.01 N 3 3 Ac-11b + Mean (%) 66.3† 45.25 human SEM (%) 1.47 29.45 IL-2 N 3 2 13h + Mean (%) 95.75 77.4 human SEM (%) 2.75 16.69 IL-2 N 2 3 SEM = standard error of the mean, N = sample size; Injected tumors: †p = 0.049 vs 13h. Significance was determined by One-way ANOVA followed by multiple comparisons using Tukey's multiple comparisons post-hoc test.
[1414] Frequency of CD8.sup.+ T cells of CD3.sup.+ T cells
TABLE-US-00041 Tumor Injected, Uninjected, Group right flank left flank 4 Mean (%) 29.23 29 SEM (%) 1.32 0.2 N 3 2 Ac-11b Mean (%) 29 28.55 SEM (%) 1.10 2.05 N 3 2 13h Mean (%) 23.93 26.33 SEM (%) 1.43 2.04 N 3 3 Ac-11b + Mean (%) 38.83†, ‡, †† 35 human SEM (%) 2.21 1.2 IL-2 N 3 2 13h + Mean (%) 41.45†, ‡, †† 48.53†, ‡, †† human SEM (%) 2.75 3.93 IL-2 N 2 3 SEM = standard error of the mean, N = sample size; Injected tumors: †p < 0.02 vs Ac-11b, ‡p <0.02 vs 4 ††p < 0.001 vs 13h; Uninjected tumors: †p = 0.0085 vs Ac-11b, ‡p = 0.0096 vs 4, ††p = 0.0025 vs 13h. Significance was determined by One-way ANOVA followed by multiple comparisons using Tukey’s multiple comparisons post-hoc test.
[1415] Frequency of Ly-6C.sup.+ T cells of CD8.sup.+ T cells
TABLE-US-00042 Tumor Group Injected, right flank Uninjected, left flank 4 Mean (%) 53.7 48 SEM (%) 2.06 3.3 N 3 2 Ac-11b Mean (%) 45.77 35.25 SEM (%) 3.47 0.75 N 3 2 13h Mean (%) 49.1 50.4 SEM (%) 6.03 5.56 N 3 3 Ac-11b + Mean (%) 56.17 54.8 human SEM (%) 2.03 2.8 IL-2 N 3 2 13h + Mean (%) 68.35† 68.17†, ‡, †† human SEM (%) 3.75 1.57 IL-2 N 2 3 SEM = standard error of the mean, N = sample size; Injected tumors: †p = 0.024 vs Ac-11b; Uninjected tumors: †p = 0.0029 vs Ac-11b, ‡p = 0.039 vs 4, ††p = 0.042 vs 13h. Significance was determined by One-way ANOVA followed by multiple comparisons using Tukey's multiple comparisons post-hoc test.
[1416] Frequency of CD4.sup.+ T cells of CD3.sup.+ T cells
TABLE-US-00043 Tumor Injected, Uninjected, Group right flank left flank 4 Mean (%) 69.1 69.25 SEM (%) 1.31 0.05 N 3 2 Ac-11b Mean (%) 69.57 69.8 SEM (%) 1.17 2.3 N 3 2 13h Mean (%) 73.23 70.27 SEM (%) 1.09 1.45 N 3 3 Ac-11b + Mean (%) 58.9†, ‡, †† 62.45 human SEM (%) 2.16 1.15 IL-2 N 3 2 13h + Mean (%) 54.5†, ‡, †† 48.5†, ††, ‡‡, human SEM (%) 3 3.27 IL-2 N 2 3 SEM = standard error of the mean, N = sample size; Injected tumors: †p <0.009 vs Ac-11b, ‡p < 0.02 vs 4, ‡‡p < 0.002 vs 13h; Uninjected tumors: †p = 0.0021 vs Ac-11b, ‡p = 0.0025 vs 4, ‡‡p = 0.0009 vs 13h, ‡‡p = 0.022 vs Ac-11b + human IL-2. Significance was determined by One-way ANOVA followed by multiple comparisons using Tukey’s multiple comparisons post-hoc test.
Example 16: Flow Cytometric Profiling of Peripheral Blood
[1417] The study was conducted in female BALB/C mice with an age of 9-11 weeks at the day of tumor inoculation. Mice were implanted with 5×10.sup.5 CT26 tumor cells into the right rear flank. When tumors to be injected were grown to a mean tumor volume of ˜80 mm.sup.3, mice were randomized into treatment cohorts (day 0) and treated with either one intravenous dose on Day 0 and one intravenous dose on Day 6 of 200 μL of Buffer Control, one intravenous dose on Day 0 and one intravenous dose on Day 6 of 200 μL of 60 μg of 16, a single 50 μL intratumoral injection of 12c on Day 0, or the combination of one intravenous dose on Day 0 and one intravenous dose on Day 6 of 200 μL of 60 μg of 16 and a single 50 μL intratumoral injection of 12c on Day 0. Hydrogels were administered as suspensions in PTP buffer buffer. Mice were bled 4 days after randomization for in vitro stimulation and flow cytometry (FACS). Blood was stimulated with Leukocyte Activation Cocktail, with BD GolgiPlug™ (BD Biosciences) for 5 hours in a 37° C. humidified CO2 incubator then processed for FACS. Cells were washed with FACS buffer, supernatants were discarded and cells were resuspended in FACS buffer with 1 μg/ml Fc-Block and incubated at 4° C. for 10 minutes in the dark. Surface marker antibody mixtures in FACS buffer were added to each sample and samples were incubated in the dark at 4° C. for 30 minutes. Red blood cell lysis buffer (Bio-gems) was added and cells were further incubated at 4° C. for 10 minutes. Cells were washed twice with FACS buffer then fixed and permeabilized for 30 minutes at room temperature with Fix/Perm buffer (eBioscience). Cells were washed twice in Permeabilization Buffer and stained with intracellular antibodies in Permeabilization buffer for 60 minutes at room temperature. Cells were washed twice in FACS buffer and acquired in the presence of 123count Ebeads (eBioscience).
[1418] Summary of antibodies used for FACS profiling
TABLE-US-00044 Markers Fluorochrome Clone Isotype CD45 BV711 30-F11 Rat IgG2b, κ CD3 BUV395 17A2 Rat IgG2b, κ CD4 BUV737 GK1.5 Rat IgG2b, κ CD8 FITC 53-6.7 Rat IgG2a, k CD25 BV510 PC61 Rat IgG1, λ CD335 BV605 29A1.4 Rat IgG2a, k CD44 BV421 IM7 Rat IgG2b, κ Ly6C BV785 HK1.4 Rat IgG2c, k CTLA4 PE UC10-4B9 Armenian Hamster IgG FoxP3 PerCP-Cy 5.5 FJK-16S Rat IgG2a, k TNF-a APC MP6-XT22 Rat IgG1, k IFN-g PE-Cy7 XMG1.2 Rat IgG1, k GranzymeB PE-ef610 NGZB Rat IgG2a, k Live/Dead efluo780 NA NA
[1419] After collection, FACS data was analyzed using FlowJo Version 10.6.1. Compensation was digitally adjusted using single antibody-stained beads, single antibody-stained cells, and fluorescence minus one (FMO) controls. CD8.sup.+ T cells were defined using the following gating strategy: FSC-A/SSC-A Cells/FSC-H/FSC-A Singlets/LiveDead.sup.−/CD45.sup.+/CD8.sup.+. This gating scheme was used to simultaneously gate CD4+ and CD8+ T cells; additional analyses confirmed that these cells co-expressed CD3 and are T cells.
[1420] Results:
[1421] Frequency of peripheral blood CD8.sup.+ T cells within CD45+ cells:
TABLE-US-00045 Group Buffer Control 16 12c 12c +16 N 4 4 4 4 Mean 4.77 8.51 3.52 13.45 SEM 1.1 1.37 0.2691 1.664 P-Value NA .051 .484 <.001 vs Control P-Value vs 16 .051 NA .014 .014 P-Value vs 12c .484 .014 NA <.001
[1422] By this analysis, the combination of 12c+16 showed a significantly higher frequency of blood CD8.sup.+ T cells within CD45.sup.+ cells (mean: 13.45%) as compared to treatment with buffer control (mean: 4.77%) or treatment with either 16 alone (mean: 8.51%) or 12c alone (mean: 3.52%). Treatment with 16 induced an approximately 1.78 fold increase in the percentage of CD8.sup.+ T cells within total CD45.sup.+ cells compared to treatment with Buffer Control. Treatment with 12c+16 induced an approximately 2.81 fold increase in the percentage of CD8.sup.+ T cells within total CD45.sup.+ cells compared to treatment with Buffer Control. Treatment with 12c+16 induced an approximately 3.82 fold increase in the percentage of CD8.sup.+ T cells within total CD45.sup.+ cells compared to treatment with 12c alone.
Example 17: In Vivo PK Study of Plasma and Tumor Resiquimod Concentration and Pharmacodynamic Effects on Peripheral Blood Mononuclear Cell (PBMC) Gene Expression
[1423] The study was conducted in female BALB/C mice with an age of 6-8 weeks at the day of tumor inoculation. Mice were implanted with 5×10.sup.5 CT26 tumor cells into the right flank. When tumors were grown to a mean tumor volume of ˜104 mm.sup.3, mice were randomized into treatment cohorts (day 0). The day following randomization, animals received either a single intratumoral injection of 10 μg of Resiquimod 4 (dissolved in 50 μL of 10 mM succinate, 90.0 mg/mL trehalose dihydrate, pH 5.0) or hydrogel 13i as a single intratumoral dose in an injection volume of 50 μL. Hydrogels were administered as suspensions in PTP buffer. At defined time points (0 hours, 6 hours, 22 hours and 72 hours post-treatment initiation), 5 mice per group were sacrificed and either plasma was prepared after blood withdrawal, or PBMCs were isolated. Untreated tumor bearing animals were sacrificed at the 0 hour timepoint to serve as untreated controls for PBMC gene expression assessment. Tumors were excised, weighed and snap frozen. Plasma samples underwent further processing by solid-phase extraction prior to Resiquimod concentration determination by LC-MS/MS.
[1424] The excised tumor samples (weights between 150 and 300 mg) were thawed and homogenized in the presence of 1 mL of saturated KOH in ethanol/water (9/1 v/v) with a FastPrep-24 5G homogenizer (MP Biomedicals, Eschwege) using a slight modification from the manufacturer's protocol (dry ice cooling, 2 times for 40 seconds with a speed of 6 m/s). The resulting cell lysate was further incubated at 37° C. for 15 h. After incubation, the dissolved samples were vortexed and diluted 1:10,000 in plasma. These samples were processed as described above and submitted to LC-MS analysis to determine the Resiquimod concentration. The amount of Resiquimod in the tumor sample was back-calculated using the dilution factor and the determined tumor weights.
[1425] For PBMC isolations, approximately 600 μl of whole blood was collected via cardiac puncture. The collected whole blood from each individual mouse was diluted with a 1:1 ratio of pre-warmed PBS supplemented with 2% Fetal Bovine Serum (FBS). Then an equal volume of Histopaque-1083 was added to a new sterile 15 mL conical tube, where the diluted whole blood was layered over the Histopaque-1083. The mixture was then centrifuged at 400 g for 30 minutes. The top plasma layer was discarded, and the white translucent interlayer (mononuclear cells) was carefully transferred to a new sterile centrifuge tube. The mononuclear cells were then washed with PBS supplemented with 2% FBS and then were spun down at 250 g for 10 minutes. Afterwards, the cells were lysed with 2 ml of Ammonium-Chloride-Potassium (ACK) lysis buffer (Gibco) for 5 minutes at room temperature to get rid of the red blood cells following manufacturer's instruction. Subsequently, the cells were washed twice with PBS supplemented with 2% FBS and were centrifuged at 250 g for 10 minutes. Then, the supernatant was removed and the PBMC cell pellet was lysed in RLT buffer (Qiagen) and stored at −80° C. before being proceeded to RNA extraction and isolation.
[1426] Lysates from untreated control samples and 6 hour treated samples were thawed and RNA was isolated using the RNeasy Mini Kit (QIAGEN) following manufacturer's recommendations. Following the first column washing step, DNA was digested directly on the column using the RNase-free DNase Set (TIANGEN) following manufacturer's recommendations. RNA was eluted with RNase-free water. RNA concentrations were measured using a NanoDrop (ThermoFisher) and then adjusted to 200 ng/mL with RNase-free water. RNA quality was assessed using a NanoDrop (ThermoFisher). The concentrations of all the RNA samples are >100 ng/μ1 and the ratio of A.sub.260/A.sub.280 was confirmed to be close to or greater than 2, thus being suitable for downstream qPCR analysis. 2 μg of RNA was reverse transcribed to cDNA using the RT.sup.2 First Strand Kit (QIAGEN). Reverse transcription was performed using random primers, 10 mM dNTP mix, and RNase inhibitor (TIANGEN). Reverse transcription was performed with the following thermal steps: 25° C. for 10 minutes, 37° C. for 120 minutes, 55° C. for 5 minutes. 200 ng of cDNA was used for quantitative PCR using the RT.sup.2 SYBR Green ROX qPCR Master mix (2X) kit (QIAGEN) following manufacturer's recommendations. Probe sets used for qPCR reactions are as follows:
TABLE-US-00046 Gene Assay Symbol Catalog # Il1a PPM03010F Ccl3 PPM02949F Il1b PPM03109F Cxcl2 PPM02969F Ccl2 PPM03151G Ccl4 PPM02948F Il10 PPM03017C Ifna4 PPM03549E Cxcl1 PPM03058C Cxcl10 PPM02978E Tnf PPM03113G B2m PPM03562A Ubc PPM03450A Gapdh PPM02946E
[1427] Cycle thresholds (CT) were collected using a 384-well platform ABI-7900H real-time qPCR system (Applied Biosystems). B2M, Ubb and GAPDH were used as housekeeping control genes. Data is reported as the average of the 2{circumflex over ( )}-ΔΔCT values for each treatment. 2{circumflex over ( )}-ΔΔCT values were calculated with the following formula:
2{circumflex over ( )}-ΔΔCT=2{circumflex over ( )}−(ΔCT(treated)−ΔCT(untreated))
[1428] ΔCT(treated)=CT(treated)−CT (average treated housekeeping) where CT(treated)=CT of the gene of interest of a sample triplicate in the treatment group and CT (treated housekeeping)=Total average CT of the B2M, UBB and GAPDH housekeeping genes of the same sample triplicate in the same treatment group.
[1429] ΔCT(untreated)=CT (untreated)-CT (untreated housekeeping) where CT (untreated)=average of the CTs of the untreated triplicates at the same timepoint as the CT(treated) comparator and CT (untreated housekeeping)=Total average CT of the B2M, UBB and GAPDH housekeeping genes of the untreated triplicates.
[1430] For each gene, 3 technical replicates were analyzed per biological replicate. Undetermined technical replicate CT values were recorded as zero ΔCT values. 4-5 biological replicates were assessed in total.
[1431] Results:
[1432] Resiquimod concentration in plasma samples
TABLE-US-00047 Time (hours) 0 6 22 72 Group Resiquimod (pg/mL) 4 Mean 210,000 360 22 14† SD 49,000 190 7 NC N 5 5 5 5 CV % 23 52 33 NC 13i Mean 280 230 200 180 SD 130 49 46 31 N 5 5 5 5 CV % 47 22 23 17 SD = standard deviation, CV % = coefficient of variation, N = sample size, NC = not calculable, ND = not determined. † 4/5 samples < LLOQ
[1433] Resiquimod content in tumors after full release from hydrogel:
TABLE-US-00048 Time (hours) Group 0 h 72 h 13i 8.2 ± 2.3 μg (n = 5) 8.2 ± 1.5 μg (n = 5)
[1434] PBMC gene expression (6 hours post-treatment):
TABLE-US-00049 Gene 4 13i Fold change (4/13i) Il1a Mean (2{circumflex over ( )}ΔΔCT) 0.41 0.23 1.78 SEM (2{circumflex over ( )}ΔΔCT) 0.26 0.11 N 4 5 Ccl3 Mean (2{circumflex over ( )}ΔΔCT) 1.43† 0.87 1.64 SEM (2{circumflex over ( )}ΔΔCT) 0.09 0.18 N 4 5 Il1b Mean (2{circumflex over ( )}ΔΔCT) 3.71† 0.47 7.92 SEM (2{circumflex over ( )}ΔΔCT) 1.12 0.27 N 4 5 Cxcl2 Mean (2{circumflex over ( )}ΔΔCT) 35.37 5.50 6.43 SEM (2{circumflex over ( )}ΔΔCT) 17.41 5.21 N 4 5 Ccl2 Mean (2{circumflex over ( )}ΔΔCT) 6.75 2.39 2.82 SEM (2{circumflex over ( )}ΔΔCT) 2.90 0.57 N 4 5 Ccl4 Mean (2{circumflex over ( )}ΔΔCT) 1.31 0.75 1.74 SEM (2{circumflex over ( )}ΔΔCT) 0.35 0.27 N 4 5 Il10 Mean (2{circumflex over ( )}ΔΔCT) 2.77† 1.21 2.29 SEM (2{circumflex over ( )}ΔΔCT) 0.51 0.24 N 4 5 Ifna4 Mean (2{circumflex over ( )}ΔΔCT) 2.97 0.15 20.48 SEM (2{circumflex over ( )}ΔΔCT) 2.35 0.04 N 4 5 Cxcl1 Mean (2{circumflex over ( )}ΔΔCT) 7.41 0.64 11.54 SEM (2{circumflex over ( )}ΔΔCT) 6.41 0.39 N 4 5 Cxcl10 Mean (2{circumflex over ( )}ΔΔCT) 45.38 2.12 21.41 SEM (2{circumflex over ( )}ΔΔCT) 34.14 0.86 N 4 5 Tnf Mean (2{circumflex over ( )}ΔΔCT) 4.64 1.04 4.45 SEM (2{circumflex over ( )}ΔΔCT) 1.91 0.47 N 4 5 SEM = standard error of the mean, N = sample size; †two-tailed p < 0.05 vs 4. Significance was determined via unpaired non-parametric t-test.
Abbreviations
[1435] AcOH Acetic Acid
[1436] AUC Area under curve
[1437] DCM Dichloromethane
[1438] DIPEA N,N-Diisopropylethylamine
[1439] DMAP 4-(Dimethylamino)pyridine
[1440] EDC N-(3-Dimethylaminopropyl)-N′-ethylcarbodiimide Hydrochloride
[1441] eq. Equivalents
[1442] EtOH Ethanol
[1443] Fmoc Fluorenylmethyloxycarbonyl
[1444] HOBt 1-Hydroxybenzotriazole
[1445] HOSu N-hydroxysuccinimid
[1446] HPLC High-Performance Liquid Chromatography
[1447] IV intraveneous
[1448] LC-MS Mass Spectrometry Coupled Liquid Chromatography
[1449] LPLC Low Pressure Liquid Chromatography
[1450] MeCN Acetonitrile
[1451] MeOH Methanol
[1452] NHS N-Hydroxysuccinimide
[1453] NMP N-Methyl-2-pyrrolidone
[1454] PBST Phosphate buffered saline with Tween 20
[1455] PE Polyethylene
[1456] PEG Poly(ethylene glycol)
[1457] PK Pharmacokinetic/s
[1458] PMM poly(methyl methacrylate)
[1459] PTP 5 mM phosphate, 90 g/L, trehalose dihydrate, 0.2% Pluronic F-68, pH 7.4
[1460] PyBOP Benzotriazol-1-yl-oxytripyrrolidinophosphonium Hexafluorophosphate
[1461] RP-HPLC Reversed Phase High-Performance Liquid Chromatography
[1462] RP-LPLC Reversed Phase Low Pressure Liquid Chromatography
[1463] r.t. Room Temperature
[1464] SC Subcutaneous
[1465] TFA Trifluoroacetic Acid
[1466] THF Tetrahydrofurane
[1467] TMEDA N, N, N′,N′-Tetramethylethylenediamine
[1468] Tween 20Polyethylene Glycol Sorbitan Monolaurate
[1469] UHPLC Ultra High Performance Liquid Chromatography
[1470] UPLC Ultra Performance Liquid Chromatography
[1471] UPLC-MS Mass Spectrometry Coupled Ultra Performance Liquid Chromatography