HCV DETECTION
20220074004 · 2022-03-10
Inventors
Cpc classification
C12Q1/6806
CHEMISTRY; METALLURGY
C12Q1/707
CHEMISTRY; METALLURGY
International classification
Abstract
Methods for detecting Hepatitis C virus (HCV) nucleic acid are described. The methods are useful for point-of-care (POC) testing, and provide rapid tests able to detect several different HCV genotypes. Kits, primers, probes, sets of primers, sets of 5 oligonucleotides, and oligonucleotides, and their use in the methods, are also described.
Claims
1. A method for determining whether a sample includes HCV nucleic acid, which comprises amplifying nucleic acid of the sample, or amplifying nucleic acid derived from nucleic acid of the sample, by an isothermal amplification reaction using a forward nucleic acid amplification primer and a reverse nucleic acid amplification primer, wherein each nucleic acid amplification primer hybridises specifically to HCV core nucleic acid sequence, or the complement thereof, that is conserved between at least HCV genotypes 1-6.
2. A method according to claim 1, wherein the forward nucleic acid primer comprises a nucleic acid sequence of: AGACTGCTAGCCGAGTAG (SEQ ID NO:1), or a nucleic acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:1.
3. A method according to claim 1 or 2, wherein the reverse nucleic acid primer comprises a nucleic acid sequence of: GCTCATGATGCACGGTCTACGAGA (SEQ ID NO:2), or a nucleic acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:2.
4. A method according to any preceding claim, which further comprises reverse transcribing HCV RNA of the sample, and amplifying a product of the reverse transcription by an isothermal amplification reaction using the forward and reverse nucleic acid amplification primers.
5. A method according to claim 5, wherein the reverse nucleic acid primer further comprises a promoter sequence for a DNA-dependent RNA polymerase at its 5′-end, and reverse transcription is carried out using the reverse nucleic acid primer.
6. A method according to claim 4 or 5, which further comprises isolating nucleic acid of the sample before reverse transcribing HCV RNA of the sample present in the isolated nucleic acid.
7. A method according to any preceding claim, which further comprises capturing a product of the isothermal amplification reaction by hybridising nucleic acid of the product to a nucleic acid capture probe, wherein the capture probe hybridises specifically to HCV core nucleic acid sequence, or the complement thereof, that is conserved between at least HCV genotypes 1-6.
8. A method according to claim 7, wherein the capture probe comprises a nucleic acid sequence of: GCGAAAGGCCTTGTGGTACT (SEQ ID NO:3), or a nucleic acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:3, or the complement thereof.
9. A method according to any preceding claim, which further comprises detecting a product of the isothermal amplification reaction by hybridising the product to a nucleic acid detector probe, wherein the detector probe hybridises specifically to HCV core nucleic acid sequence, or the complement thereof, that is conserved between at least HCV genotypes 1-6.
10. A method according to claim 9, wherein the detector probe comprises a nucleic acid sequence of: TGATAGGGTGCTTGCGAGTG (SEQ ID NO:4), or a nucleic acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:4, or the complement thereof.
11. A method according to claim 9 or 10, wherein the detector probe is labelled with a visually detectable label.
12. A method according to any of claims 7 to 11, wherein capture and/or detection of the product of the isothermal amplification reaction is carried out by chromatographic dipstick assay.
13. A method according to any preceding claim, wherein the sample is a biological sample obtained from a subject suspected of being infected with HCV.
14. A method according to any preceding claim, wherein the sample is a blood or a plasma sample obtained from a subject suspected of being infected with HCV.
15. A method according to any preceding claim which is an in vitro method.
16. A kit for determining whether a sample includes HCV nucleic acid, which comprises: a forward nucleic acid amplification primer and a reverse nucleic acid amplification primer, for amplifying a template nucleic acid by an isothermal amplification reaction, wherein each nucleic acid amplification primer hybridises specifically to HCV core nucleic acid sequence, or the complement thereof, that is conserved between at least HCV genotypes 1-6; a nucleic acid capture probe, wherein the capture probe hybridises specifically to HCV core nucleic acid sequence, or the complement thereof, that is conserved between at least HCV genotypes 1-6; and/or a nucleic acid detector probe, wherein the detector probe hybridises specifically to HCV core nucleic acid sequence, or the complement thereof, that is conserved between at least HCV genotypes 1-6, optionally wherein the detector probe comprises a visually detectable label for labelling a product of the isothermal nucleic acid amplification.
17. A kit according to claim 16, wherein the forward nucleic acid primer comprises a nucleic acid sequence of: AGACTGCTAGCCGAGTAG (SEQ ID NO:1), or a nucleic acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:1.
18. A kit according to claim 16 or 17, wherein the reverse nucleic acid primer comprises a nucleic acid sequence of: GCTCATGATGCACGGTCTACGAGA (SEQ ID NO:2), or a nucleic acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:2.
19. A kit according to any of claims 16 to 18, wherein the capture probe comprises a nucleic acid sequence of: GCGAAAGGCCTTGTGGTACT (SEQ ID NO:3), or a nucleic acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:3, or the complement thereof.
20. A kit according to any of claims 16 to 19, wherein the detector probe comprises a nucleic acid sequence of: TGATAGGGTGCTTGCGAGTG (SEQ ID NO:4), or a nucleic acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:4, or the complement thereof.
21. A kit according to any of claims 16 to 20, which further comprises an RNA-dependent DNA polymerase, a DNA-dependent DNA polymerase, a DNA/RNA duplex-specific ribonuclease, and a DNA-dependent RNA polymerase.
22. A kit according to any of claims 16 to 21, which further comprises a lancet for obtaining a sample of whole blood from a subject by finger prick or heel prick.
23. A kit according to any of claims 16 to 22, which further comprises a blood collector for collecting a sample of blood from a subject.
24. A kit according to any of claims 16 to 23, which further comprises a chromatographic test strip for capturing and detecting a product of the isothermal nucleic acid amplification.
25. A kit according to any of claims 16 to 24, which further comprises a lysis/binding buffer, an elution buffer, and optionally a wash buffer, for extracting nucleic acid from a blood or plasma sample.
26. A set of primers for amplifying HCV nucleic acid by an isothermal nucleic acid amplification reaction, which comprises a forward nucleic acid amplification primer and a reverse nucleic acid amplification primer, wherein each nucleic acid amplification primer hybridises specifically to HCV core nucleic acid sequence, or the complement thereof, that is conserved between at least HCV genotypes 1-6.
27. A set of primers according to claim 26, wherein the forward nucleic acid primer comprises a nucleic acid sequence of: AGACTGCTAGCCGAGTAG (SEQ ID NO:1), or a nucleic acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:1.
28. A set of primers according to claim 26 or 27, wherein the reverse nucleic acid primer comprises a nucleic acid sequence of: GCTCATGATGCACGGTCTACGAGA (SEQ ID NO:2), or a nucleic acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:2.
29. A set of primers according to any of claims 26 to 28, wherein the forward and/or the reverse nucleic acid primer is up to 50 nucleotides long.
30. A set of oligonucleotides for amplifying HCV nucleic acid by an isothermal nucleic acid amplification reaction, and for capturing and/or detecting a product of the amplification reaction, which comprises: a set of primers according to any of claims 26 to 29; a nucleic acid capture probe, wherein the capture probe hybridises specifically to HCV core nucleic acid sequence, or the complement thereof, that is conserved between at least HCV genotypes 1-6; and/or a nucleic acid detector probe, wherein the detector probe hybridises specifically to HCV core nucleic acid sequence, or the complement thereof, that is conserved between at least HCV genotypes 1-6.
31. A set of oligonucleotides according to claim 30, wherein the forward nucleic acid primer comprises a nucleic acid sequence of: AGACTGCTAGCCGAGTAG (SEQ ID NO:1), or a nucleic acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:1.
32. A set of oligonucleotides according to claim 30 or 31, wherein the reverse nucleic acid primer comprises a nucleic acid sequence of: GCTCATGATGCACGGTCTACGAGA (SEQ ID NO:2), or a nucleic acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:2.
33. A set of oligonucleotides according to any of claims 30 to 32, wherein the capture probe comprises a nucleic acid sequence of: GCGAAAGGCCTTGTGGTACT (SEQ ID NO:3), or a nucleic acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:3, or the complement thereof.
34. A set of oligonucleotides according to any of claims 30 to 33, wherein the detector probe comprises a nucleic acid sequence of: TGATAGGGTGCTTGCGAGTG (SEQ ID NO:4), or a nucleic acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:4, or the complement thereof.
35. A set of oligonucleotides according to any of claims 30 to 34, wherein the capture and/or detector probe is up to 50 nucleotides long.
36. An oligonucleotide, which comprises: a nucleic acid sequence of: AGACTGCTAGCCGAGTAG (SEQ ID NO:1), or a nucleic acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:1, or the complement thereof; a nucleic acid sequence of: GCTCATGATGCACGGTCTACGAGA (SEQ ID NO:2), or a nucleic acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:2, or the complement thereof; a nucleic acid sequence of: GCGAAAGGCCTTGTGGTACT (SEQ ID NO:3), or a nucleic acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:3, or the complement thereof; or a nucleic acid sequence of: TGATAGGGTGCTTGCGAGTG (SEQ ID NO:4), or a nucleic acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity along its entire length with a nucleic acid sequence of SEQ ID NO:4, or the complement thereof.
37. An oligonucleotide according to claim 36, which is up to 25, 30, 35, 40, 45, or 50 nucleotides long.
38. A kit according to any of claims 16 to 25, which comprises a set of primers according to any of claims 26 to 29, a set of oligonucleotides according to any of claims 30 to 35, or an oligonucleotide according to claim 36 or 37.
39. Use of a set of primers according to any of claims 26 to 29, a set of oligonucleotides according to any of claims 30 to 35, or an oligonucleotide according to claim 36 or 37, in a method according to any of claims 1 to 15.
Description
[0130] Embodiments of the invention are described below, by way of example only, with reference to the accompanying drawings in which:
[0131]
[0132]
[0133]
[0189]
[0190]
EXAMPLE
[0191] Point-of-Care (POC) Nucleic Acid Test for Detecting HCV Genotypes 1-6
[0192] HCV viral RNA was extracted, reverse transcribed, and amplified by isothermal nucleic acid amplification, and the amplification products were detected by rapid visual detection with a dipstick, using a simple amplification-based assay (SAMBA) method similar to the method described in Lee et al., Journal of Infectious Diseases 2010; 201(S1):S65-S71.
[0193] Briefly, a reverse nucleic acid amplification primer comprises nucleic acid sequence complementary to a portion of HCV target RNA so that the primer can hybridise specifically to the target RNA, and a single stranded-version of a promoter sequence for a DNA-dependent RNA polymerase at its 5′-end. The reverse primer hybridizes to the RNA target. An RNA-dependent DNA polymerase extends the reverse primer to synthesise a complementary DNA (cDNA) copy of the RNA target. A DNA/RNA duplex-specific ribonuclease digests the RNA of the RNA-cDNA hybrid. A forward nucleic acid amplification primer comprises nucleic acid sequence complementary to a portion of the cDNA. The forward primer hybridizes to the cDNA downstream of the part of the cDNA formed by the reverse primer. The forward primer is extended by a DNA-dependent DNA polymerase to produce a second DNA strand which extends through the DNA-dependent RNA polymerase promoter sequence at one end (thereby forming a double stranded promoter). This promoter is used by a DNA-dependent RNA polymerase to synthesise a large number of RNAs complementary to the original target sequence. These RNA products then function as templates for a cyclic phase of the reaction, but with the primer hybridising steps reversed, i.e., the forward primer followed by the reverse primer.
[0194] The following primer sequences were used for isothermal amplification of HCV nucleic acid of genotypes 1-6:
TABLE-US-00001 HCV Primer F2 (forward primer): (SEQ ID NO: 1) AGACTGCTAGCCGAGTAG; HCV Primer REV1.2 (reverse primer)/T7 promoter: (SEQ ID NO: 7) GCTCATGATGCACGGTCTACGAGATAATACGACTCACTATAG.
[0195] Amplification product was captured and detected using the following capture and detection probes:
TABLE-US-00002 HCV Probe CP2 (capture probe): (SEQ ID NO: 3) GCGAAAGGCCUGTGGTACT; HCV Probe DP2 (detector probe): (SEQ ID NO: 4) TGATAGGGTGCTTGCGAGTG.
[0196] The HCV primers/probes were tested against at least three different samples for each of the six HCV genotypes. The results are recorded in