APTAMER AND USE OF THE APTAMER IN THE DIAGNOSIS AND TREATMENT OF CANCER

20220073921 · 2022-03-10

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to an aptamer comprising a nucleotide sequence SEQ ID NO: 1 or a fragment thereof of at least 20 contiguous nucleotides of the nucleotide sequence SEQ ID NO: 2, wherein the aptamer comprises a polyethylene glycol (PEG) moiety conjugated to the 5′ or the 3′ end. The invention further relates to a composition comprising the aptamer, and the use of the aptamer in the diagnosis and treatment of cancer, particularly hormone refractory prostate tumours.

Claims

1. An aptamer, wherein the aptamer comprises a nucleotide sequence as given as follows: 5′-GCTGTGTGACTCCTGCAAGGAAAGAGCACGGCCAAGTCAGGGGGAATCGACTACGTCGGGG GGAGACAAGATACAGCTGC-3′ (SEQ ID NO: 1) or a fragment thereof of at least 20 contiguous nucleotides of the nucleotide sequence as given as follows: 5′-GGAAAGAGCACGGCCAAGTCAGGGGGAATCGACTACGTCGGGG-3′ (SEQ ID NO: 2), wherein the aptamer comprises a polyethylene glycol moiety conjugated to the 5′ or the 3′ end.

2. The aptamer according to claim 1, wherein the polyethylene glycol moiety has a molecular weight in a range of ≥0.1 kDa to ≤90 kDa, preferably in a range of ≥2 kDa to ≤20 kDa, particularly in a range of ≥2 kDa to ≤11 kDa.

3. A medicament or diagnostic reagent comprising an aptamer having a polyethylene glycol moiety conjugated to the 5′ or the 3′ end, wherein the aptamer comprises a nucleotide sequence as given as follows: 5′-GCTGTGTGACTCCTGCAAGGAAAGAGCACGGCCAAGTCAGGGGGAATCGACTACGT CGGGGGGAGACAAGATACAGCTGC-3′ (SEQ ID NO: 1) or a fragment thereof of at least 20 contiguous nucleotides of the nucleotide sequence as given as follows: 5′-GGAAAGAGCACGGCCAAGTCAGGGGGAATCGACTACGTCGGGG-3′ (SEQ ID NO: 2.

4. A method of detecting, diagnosing or treating cancer comprising administering an aptamer to a subject, wherein the aptamer comprises a nucleotide sequence as given as follows: 5′-GCTGTGTGACTCCTGCAAGGAAAGAGCACGGCCAAGTCAGGGGGAATCGACTACGT CGGGGGGAGACAAGATACAGCTGC-3′ (SEQ ID NO: 1) or a fragment thereof of at least 20 contiguous nucleotides of the nucleotide sequence as given as follows: 5′-GGAAAGAGCACGGCCAAGTCAGGGGGAATCGACTACGTCGGGG-3′ (SEQ ID NO: 2), wherein the aptamer comprises a polyethylene glycol moiety conjugated to the 5′ or the 3′ end.

5. The method of claim 4, wherein the cancer is selected from lung cancer and prostate cancer.

6. The medicament or diagnostic agent of claim 3, wherein the polyethylene glycol (PEG) moiety has a molecular weight in a range of ≥0.1 kDa to ≤90 kDa, preferably in a range of ≥2 kDa to ≤20 kDa, particularly in a range of ≥2 kDa to ≤11 kDa.

7. A composition comprising an aptamer according to claim 1.

8. A pharmaceutical composition comprising as an active ingredient an aptamer according to claim 1.

9. A method of detecting, diagnosing or treating a cancer, comprising administering the composition according to claim 7 to a subject, wherein the cancer is particularly hormone refractory prostate cancer.

10. A cancer-specific drug delivery composition comprising an aptamer according to claim 1, and an anti-cancer agent such as a toxin, an anti-cancer growth inhibitor gene, an antagomir, siRNA, or combinations thereof.

11. A method of detecting, diagnosing or treating cancer, comprising administering the medicament or diagnostic agent of claim 3 to a subject for the detection or diagnosis or treatment of cancer.

12. An in vitro method of detecting or diagnosing cancer, the method comprising the step of detecting the binding of an aptamer according to claim 1 to a cell, tissue, or sample obtained from a subject.

13. A method of treating cancer, the method comprising the step of administering to a subject a therapeutically effective amount of an aptamer according to claim 1.

14. A method for selecting aptamers specific for a target sample, the method comprising the steps: providing a library comprising putative disease-specific aptamers; incubating the library with a target sample; washing the target sample to remove aptamers that are not bound; eluting the aptamers bound to the target sample, amplifying the eluted aptamers using polymerase chain reaction to generate an enriched pool of aptamers; repeating the incubating, washing, eluting and amplification steps a plurality of additional times to generate a pool of enriched aptamers that are specific for the target sample, and sequencing the pool of enriched aptamers to determine their sequence and relative frequency within the pool, wherein the aptamers of the library comprise a conjugated polyethylene glycol moiety.

15. The method according to claim 14, wherein method is an in vivo method, preferably performed in a murine orthotopic xenograft model.

16. A method of treating cancer, the method comprising the step of administering to a subject a therapeutically effective amount of an aptamer according to claim 2.

17. A method of treating cancer, the method comprising the step of administering to a subject a therapeutically effective amount of a pharmaceutical composition according to claim 8.

18. A method of treating cancer, the method comprising the step of administering to a subject a therapeutically effective amount of a cancer-specific drug delivery composition according to claim 10.

19. The method of claim 11, wherein the cancer is hormone refractory prostate cancer.

20. The method of claim 5, wherein the cancer is hormone refractory prostate cancer.

Description

[0051] The figures show:

[0052] FIG. 1 The in vivo selection scheme for the aptamer of SEQ NO: 1.

[0053] FIG. 2 Analysis of the number of unique sequences within the obtained libraries from the in vivo selection using D3 (squares) and D3P (dots).

[0054] FIG. 3 The validation of aptamers evolved from the DNA library D3P by planar imaging.

[0055] FIG. 4 Quantification of tumour binding of the aptamer of SEQ NO: 1 (D3P-21) in vitro. The FIG. 4a shows the relative amount of the aptamer and native library (D3P-lib) used as control of tumours from subcutaneous mouse models, FIG. 4b the relative amount of aptamer from both orthotopic and subcutaneous tumours, both quantified via qPCR.

[0056] FIG. 5 The stability of the pegylated (FIG. 5a) and non-pegylated (FIG. 5b) aptamer of SEQ NO: 1 (D3P-21) in human serum compared to DPBS with Ca.sup.2+/Mg.sup.2+ incubated in human serum (quadrants) or buffer (cycles).

[0057] FIG. 6 The flow cytometry analysis of the interaction of the aptamer of SEQ NO: 1 (D3P-21) with various cancer cell lines.

[0058] FIG. 7 The flow cytometry analysis of the impact of the PEG moiety of the aptamer of SEQ NO: 1 (D3P-21) on its interaction properties.

[0059] FIG. 8 Impact of potassium ions on the interaction of the aptamer of SEQ NO: 1 with PC-3 cells.

[0060] FIG. 9 CD spectroscopy analysis of the aptamer of SEQ NO: 1 (D3P-21).

[0061] FIG. 10 The evaluation of aptamer immunogenicity.

[0062] FIG. 11 The effect of the molecular weight of the PEG moiety on binding.

MATERIAL AND METHODS

Orthotopic PC-3 Tumour Model:

[0063] On Day 0, 3×10.sup.6 PC-3 tumour cells expressing luciferase in 15 μl PBS were implanted orthotopically into 20 male NMRI nude mice. To prevent pain, Meloxicam (Metacam, 1 mg/kg, s.c.) was applied 1 h prior to surgery and 24 h post implantation. Male NMRI nude mice were anesthetised in a separate box using 1.5-2 Vol % Isoflurane with an oxygen flow of 0.61/min. The mice were positioned on a heated operating table with the left side upwards. The skin was cleaned, shaved and sterilised. An incision of approx. 1 cm was made in order to display the seminal vesicle and the prostate. A cell suspension of 3×10.sup.6 PC-3Luc cells in 15 μl PBS was injected orthotopically into the prostate using a 29 G needle syringe. The seminal vesicle and the prostate were carefully pushed back into the visceral cavity and the abdominal wall closed by saturation. Thereafter the mouse was warmed in a separate box while recovering from anaesthesia. In the following, animal weights were measured three times weekly (Monday, Wednesday and Friday).

Subcutaneous PC-3 Tumour Model:

[0064] For in vivo screening experiments, mice were subcutaneously injected between shoulder blades with 3×10.sup.6 PC-3 cells in a volume of 200 ml of Matrigel (BD Bioscience, Le Pont de Claix, France) and phosphate-buffered saline (PBS) (50:50). Tumours were then allowed to grow for 3-5 weeks until a size around 300 mm3 before in vivo imaging experiments. During each injection and imaging experiments, mice were anesthetised with isoflurane-1.25% in a 1:3 mixture of O.sub.2 and air. Subcutaneous injection were performed 3 weeks after orthotopical implantation as previously described or in mice without orthotopic implantation.

In Vivo Bioluminescence Imaging:

[0065] During the course of the study, tumour growth was monitored in vivo using bioluminescence imaging. For this purpose, 150 mg/kg D-Luciferin was injected intraperitoneally (i.p.) into the mice 7 min before anesthetisation. Light emission was measured 10 min post injection with a CCD-camera for 5 min using a NightOWL LB 981 bioluminescence imaging system (Berthold Technologies, Germany).

In Vivo SELEX:

[0066] All oligonucleotides, including DNA libraries and primers, were synthesised by Ella Biotech GmbH (Munich, Germany). Two separate 80-nt single-stranded DNA libraries, D3 and D3P, were used consisting in a 43-nt random region. The D3P library contained an 11 kDa polyethylene glycol (PEG) moiety on the 5′-end. The D3 library did not contain a PEG moiety. Both libraries were amplified by PCR using the following primers: forward primer (Fw) 5′-GCTGTGTGACTCCTGCAA-3′ (SEQ ID NO: 3), with 5′-11 kDa PEG moiety in the case of D3P library, and reverse primer (Rv-Pho) 5′-Phosphate-GGAGACAAGATACAGCTGC-3′ (SEQ ID NO: 4). PCR reaction was performed by using GoTaq® G2 Flexi DNA Polymerase (Promega) and 1 μM of both Fw and Rv-Pho primers with the following cycling program (2 min 95° C.; 30 sec 95° C., 30 sec 64° C., 45 sec 72° C.; hold 10° C.) in a Veriti 96 well thermal cycler (Applied Biosystems).

[0067] In vivo selection was done using tumour-bearing animals. Mice were either treated intravenously with one of two aptamer libraries (D3 or D3P) or left untreated. Five nmol of libraries were injected in round 1 and the amount was reduced to 2, 1 and 0.5 nmol for rounds 2, 3 and 4 respectively. From round 5 to 10, 0.1 pmol of the libraries were injected. Prior injection, libraries were prepared in 110 μL of Dulbecco's phosphate-buffered saline (DPBS) containing Ca.sup.++ and Mg.sup.++ (Gibco), denatured at 80° C. for 3 min and slowly cooled down to RT for proper folding. After 20 min, animals were perfused with DPBS, killed by cervical dislocation and tumours and kidney were collected. Tumours and kidney were snap-frozen in liquid nitrogen and stored at −80° C. before recovering the nucleic acids from the tissues. Weight of the tumours and kidneys used during in vivo SELEX was determined. Extraction of the nucleic acids from 3 tumours and 3 kidneys from injected mice was performed by first homogenising the organs with a 7 mL dounce tissue grinder with large and small clearance pistils (Landgraf Laborsysteme HLL GmbH). To lysate the cells, TE-SDS Lysis buffer (0.1 M Tris-HCl pH 8, 1 mM EDTA pH 8, 0.5% SDS) supplemented with 0.5 μg/μL of Proteinase K (Roth) was used for D3 injected tumours or kidney, followed by 10 min incubation at 95° C.

[0068] For D3P library, buffers A1, A2 and A3 from NucleoSpin® Plasmid kit (Macherey-Nagel) were used for lysis of the cells followed by 10 min centrifugation at 4000 rcf to remove cellular debris. Purification of extracted oligonucleotides was performed by means of phenol/chloroform extraction and ethanol precipitation for D3 library, and by silica columns (DNA Clean & Concentrator™-500 (Zymo Research)) in the case of D3P library. A negative control was always included with tumours extracted from control mice (injected with DPBS) following the same procedure described above. Purified oligonucleotides were then re-dissolved in milliQ water and a first PCR amplification was performed. RNA digestion was performed before PCR amplification by using a 1:1 mixture of RNase T (Roche) and RNAse A (Macharey-Nagel). Agarose gel (4%) purification was then performed in order to separate the library band from genomic DNA and primers with the NucleoSpin® Clean-Up kit. Further PCR amplification was then performed to reach the required amount of library the next round. All tissue homogenisations and PCR preparations were performed in two different PCR workstations (Peqlab) in order to avoid contaminations. Single strand displacement of the purified PCR product was carried out by λ-exonuclease digestion in 1×λ-exonuclease reaction buffer and 5000 U/mL of λ-exonuclease (Thermo Scientific). After 30 min incubation at 37° C., λ-exonuclease was inactivated at 80° C. for 10 min. Subsequently the samples were purified with the NucleoSpin® Clean-Up kit using the NTC buffer and resulting DNA libraries were freeze dried and frozen prior usage for next selection round.

Next Generation Sequencing:

[0069] After 10 selection rounds, samples from all rounds for both tumour and kidney of the two DNA libraries were prepared for next generation sequencing (NGS) analysis on Illumina HiSeq1500 platform following the protocol from Tolle et al. in Nucleic Acid Aptamers: Selection, Characterization, and Application, G. Mayer, Editor. 2016, Springer New York: New York, N.Y. p. 77-84. Shortly, a first PCR with index containing primers was performed. Those indexes allow the analysis of 12 different samples on the same round. After purification of the PCR product as described above, up to 12 different samples with different indexes were mixed with equal amounts of DNA, to a final amount of 2 μg DNA. Then, addition of adapter sequences by enzymatic ligation was performed according to the manufacturer by using TruSeq DNA PCR-Free Sample Preparation Kit LT (Illumina), following the steps “End Repair”, “Adenylation” and “Adapter Ligation”. Samples were then purified via agarose gel (2%) and silica based spin-columns, and eluted in resuspension buffer. Quantitative PCR was performed for library validation with the KAPA library quantification kit (Sigma-Aldrich) prior sequencing. Seventy-five base pair single end sequencing was carried out. Raw NGS data was analysed using the COMPAS (COMmonPAtternS) software.

In Vivo Planar NIR Fluorescence Imaging of Candidate Aptamers:

[0070] Mice were housed under standard conditions with food and water ad libitum but using chlorophyll free diet 15 days before imaging in order to reduce autofluorescence signal of the animals. Imaging experiments and analysis were performed using a fluorescence Diffuse Optical Tomography (fDOT) imaging system. Basically, the acquisition of Fluorescence reflectance imaging (FRI) is based on the excitation of fluorophores by the LEDs (emitting light between 650 and 670 nm) placed above the animal and on the reception of the fluorescence signal using the CCD camera and a band-pass filter (730±15 nm). The CCD camera was focused at the top surface of the animal. Prior to intravenous injection and imaging of the aptamers, solutions of all sequences containing 2 nmol were prepared in DPBS with calcium and magnesium. All sequences were then heated for 3 minutes at 80° C., spin down, let to cool in ice for 3 minutes and store at room temperature. Prior to imaging, mice were anesthetised with 4% isoflurane gas. Afterwards the level of isoflurane concentration was lowered down to 2-2.5%. The natural auto-fluorescence of the mice was recorded just before injection and was further subtracted in order to obtain the accurate fluorescence signal from the injected fluorescent probes. Then, the fluorescent aptamers were injected in the tail vein using a 29 G (insulin-type) syringe in a volume of 100 μL. Fluorescence images of dorsal side view were acquired 5 min, 90 min and 180 min post injection. From experience, good contrast is obtained after exposition times of a few milli-seconds. Since aptamers are rapidly eliminated by the urinary pathway, the biodistribution of aptamers in prostate tumours could not be measured by in vivo imaging. Therefore, animals were euthanized 3 h after injection and organ resection permitted ex vivo fluorescence analysis of tumours and muscles.

Planar Image Analysis:

[0071] For the semi-quantitative analysis of fluorescence planar images, the ImageJ software (http://rsbweb.nih.gov/ij/) was used. The first step was to subtract the intrinsic background noise of the camera from each image acquired. Second step was to normalise the images to the same exposure time. An ROI was manually drawn, to delineate the tumour, based on the white images (photographs) that are always acquired before initialising the experiments. The mean of intensity in this region was subtracted from the mean of intensity in the same area before injection, which corresponds to the auto-fluorescence of the animal at time to. Using normalised images as well, a ROI was manually drawn for each time to delineate a reference healthy area close to the tumour tissue. The tumour targeting of aptamers was evaluated by dividing the mean fluorescence from the tumour by the mean fluorescence from the healthy zone. For ex vivo analysis, the same protocol was used and the tumour/muscle ratios were calculated.

qPCR of Tissue:

[0072] Orthotopic and xenograft tumours from mouse injected with Alexa Fluor 680 labeled D3P-21 and control sequences D3P-library, D3P-4 and D3P-16 from the in vivo screening were homogenised and purified as described above for D3P library. The amount of extracted DNA was quantified with NanoDrop 2000C (Thermo Scientific) and for qPCR quantification samples were normalised to a same OD. Two μL sample of the extracted DNA were added to 18 μL of a PCR master mix, containing 1×GoTaq colorless buffer, 2 mM MgCl.sub.2, 0.2 mM dNTPs, 300 nM of non-modified reverse and forward primers, 1×SYBR Green I (Sigma Aldrich) and 2.5 U GoTaq polymerase. Thermal conditions were optimised to 10 min 95° C. followed by 40 cycles of 30 s at 95° C., 30 s at 64° C. and 45 s at 72° C. Thermal cycling was performed in an iCycler Thermal Cycler upgraded with the iQ5 real-time PCR detection system (Bio-Rad, Germany). DNA standards were included; 20-0.002 Pmol in 1 to 10 dilution. Each sample and standard were run in duplicates.

Cell Culture:

[0073] For the in vitro evaluation of D3P-21 aptamer, different cell lines were used. The tumour cell line PC-3 was obtained from ProQinase, Ramos (Burkitt's lymphoma), A549 (human non-small cell lung cancer) and H460 (large cell lung cancer) were obtained from ATCC (American Type Culture Collection). MCF7 cells (breast cancer) were purchased from CLS (Cell lines service). Splenocytes and PMBC's were obtained from the spleen and the blood, respectively, of C57/BL6J mouse strain (kindly provided by Dr. Sven Burgdorf from the LIMES Institute in Bonn). Ramos, MCF7, H460 and LNCaP cells were cultured in RPMI 1640 medium while PC-3 and A549 cells were cultured in DMEM, high glucose, GlutaMAX™ supplemented (ThermoFisher) both with 10% fetal bovine serum (Sigma) at 37° C. in humidified air containing 5% CO.sub.2, and maintained by routine passage every 2-3 days. Prior usage, cells were counted with a hemacytometer. Suspension cells were centrifuged 5 min at 200 rcf and the pellet was suspended in fresh medium to obtain a cell suspension with the desired densities. For adherent cells, 100000 cells/well in appropriate medium were seeded in 24 well plates 24 hours prior the assay and proper amount of LNCaP cells were seeded in T12.5 cell culture flasks 48 hours prior the assay.

Binding Assays:

[0074] Flow cytometry assays were performed in a BD FACSCanto cytometer and qPCR assays with an iCycler Thermal Cycler upgraded with the iQ5 real-time PCR detection system (Bio-Rad, Germany).

Flow Cytometry:

[0075] For studying the interaction of D3P-21 aptamer to different cancer cell lines, 3′-Alexa Fluor 680 labeled D3P-21 and control library D3P-library were used whereas 3′-Atto647N labeled oligonucleotides were used to study the 11-kDa PEG moiety influence in the aptamer binding and the interaction of D3P-21 aptamer to both prostate cancer cell lines PC-3 and LNCaP. Cells were incubated with 100 or 200 nM of D3P-21 aptamer or D3P-library control in 200 μL of binding buffer or 750 μL for LNCaP cells (DPBS with 0.49 mM MgCl.sub.2, 0.9 mM CaCl.sub.2 and 0.5 mg/mL salmon sperm) for 30 minutes at 37° C. and 5% CO.sub.2. Then, cells were washed 3 times with washing buffer (DPBS with 0.49 mM MgCl.sub.2, 0.9 mM CaCl.sub.2) via centrifugation at 200 g for 5 minutes at room temperature for suspension cells, and with scraping of the adherent cells in the last washing step followed by centrifugation for volume reduction. For LNCaP cells, CaCl.sub.2 was removed from the last washing step in order to prevent clumping of the cells. For each measurement, 10000 cells were analysed in the flow cytometer. The data was analysed using FlowJo software.

qPCR:

[0076] The same incubation protocol as used for flow cytometry analysis for the individual sequences/library was followed. After 3 washing steps, cold ddH.sub.2O was added and cells were incubated at 4° C. for 30 min. Cells were then recovered from the well plate, heated at 95° C. for 5 min, and diluted to 5 cells/4 for analysis via qPCR. qPCR protocol was identical to the one described above (qPCR of tissue section).

CD Spectroscopy Studies:

[0077] CD spectra were recorded at 20° C. with a Jasco J-810 spectrophotometer. The measurements were performed with 8 μM of DNA oligos in water, PBS without potassium (130 mM NaCl, 7 mM Na.sub.2HPO.sub.4.H.sub.2O and 3 mM NaH.sub.2PO.sub.4.2H.sub.2O, pH 7.4), and increasing concentrations of KCl (0.1, 1, 4 and 10 mM). The spectra were recorded with 100 nm min-1 scanning speed and 4 accumulations.

TNF-α Homogeneous Time-Resolved Fluorescence (HTRF) Assay:

[0078] The TNF-α HTRF assay was performed in accordance with the manufacturer guidelines (Cisbio). Briefly, immortalised murine embryonic stem cell-derived macrophages in 96-well plates were treated with increasing concentrations of D3P-library and aptamers D3P-21 and D3P-20, both containing or lacking of the 5′-11 kDa PEG moiety, for 24 hours. CpG oligonucleotide and LPS were used as positive controls. The cell supernatants were collected and stained with anti-TNF-α antibodies conjugated to FRET molecules. Changes in the fluorescence emission spectrum were proportional to the TNF-α concentration.

Example 1

Selection Method for the Aptamer of SEQ ID NO: 1

[0079] The general outline of the in vivo selection scheme using orthotopic xenograft prostate tumour models is shown in FIG. 1. As depicted in FIG. 1, the prostate cancer cell line PC-3 was implanted into the prostate of male NMRI nude mice and tumour growth was monitored by bioluminescence imaging during 5 weeks until complete growth of the tumours, before 10 selection rounds were performed. PC-3 is a human hormone insensitive prostate tumour cell line, which represents a well-accepted tumour model for castration resistant prostate cancer with respect to its sensitivity to current treatments. The used cell line bears an intrinsic luciferase reporter protein enabling post-surgery monitoring of the tumour growth.

[0080] Approx. five weeks after implantation, the respective DNA library or phosphate buffered saline (PBS) was injected into the mice's tail vein and 10 selection rounds were performed. Two in vivo selection protocols using the DNA library D3 were established. The first selection protocol employed D3 in its naïve variant, whereas the second protocol made use of a 5′-polyethylene glycol (PEG, 11 kDa) modified version, named D3P. Besides the nature of the DNA library used, both protocols differed in the work up procedure of the DNA molecules after tumour and kidney resection and homogenisation as described in the methods section above. Prior to injection, the DNA libraries were prepared as a solution in PBS. After 20 minutes of circulation, the mice were perfused with PBS and sacrificed by cervical dislocation. Subsequently, the prostate tumour was removed, snap frozen, and stored at −80° C. until further processing. After thawing, the tissue was homogenised and the nucleic acid library recovered either by silica column purification (D3P) or phenol/chloroform extraction followed by ethanol precipitation (D3). After recovery, the library was amplified by PCR, subjected to single-strand generation and used for the next selection cycle. In each selection cycle, the DNA molecules associated with the kidneys were also recovered and subjected to PCR, which allowed to control the general workflow as the kidneys represent the major clearance pathway of DNA aptamers in vivo. As further control, tumours from mice injected with PBS only were prepared and subjected to the same recovery procedure and PCR protocol. The weight of the resected tumours and kidneys from each selection cycle was determined. The conditions of the ten in vivo selection cycles are summarised in Table 1 below.

TABLE-US-00001 TABLE 1 conditions of in vivo selection cycles PCR amplification cycle Library D3 tumour D3 kidney D3P tumour D3P kidney SELEX inlected (15 mg/ (15 mg/ (6.25 mg/ (6.25 mg/ cycle (nmol) PCR) PCR) PCR) PCR) 1 5 22 22 22 22 1 0.1 16 20 20 18 2 2 14 14 18 16 3 1 12 12 18 14 4 0.5 10 10 19 18 5 0.1 12 12 16 14 6 0.1 10 10 18 16 7 0.1  12*  10* 14 14 8 0.1 not not 14 14 determined determined 9 0.1  12*  12* 14 12 10 0.1  12*  12* 16 14 *6.25 mg/PCR

[0081] After ten in vivo selection cycles, each of the obtained DNA libraries was analysed by next-generation sequencing (NGS) as described above. Between 1.5.Math.10.sup.5 and 1.2.Math.10.sup.7 sequences per selection cycle were analysed from both selection procedures. The FIG. 2 shows the analysis of the number of unique sequences within the obtained libraries from the in vivo selection using D3 and D3P. As can be taken from the FIG. 2, the number of unique sequences was found to be significantly decreased, indicating both libraries being enriched. The PEG-modified DNA library D3P showed a steady decrease of unique sequences over the monitored DNA populations obtained from the different selection cycles. In contrast, the number of unique sequences in the naïve DNA library D3 was strongly decreased from the selection cycle 7 to 8. This behaviour was also eminent from the distribution of the four nucleotides (dA, dG, dT, and dC) throughout the initial random region, which was similar up to selection cycle 4 and 7 of the libraries D3P or D3, respectively. In turn, the nucleotide distribution was clearly altered when analysing the DNA populations obtained after ten selection cycles, which already became evident in selection cycles 6 (D3P) and 8 (D3).

[0082] In the following and if not otherwise stated, the results refer to the DNA populations of both libraries obtained after 10 selection cycles. In a following step, individual sequences were chosen for further testing based on their enrichment profiles. In particular, collection was defined by i) copy number, i.e. the frequency of an individual sequence in a DNA population and ii) amplification fold, i.e. change of copy numbers from one selection cycle to another. Based on these criteria 46 sequences (22 from D3 and 24 from D3P) were selected for further assessment, among them 17 sequences with low copy numbers, i.e. frequency <0.5% but enrichment profiles similar to those found for the most abundant sequences. The 46 sequences were subjected to an initial in vivo screening procedure using variants of the sequences bearing a near-infrared fluorescent dye (Alexa Fluor 680) at their 3′-ends. Sequences obtained from the library D3P were additionally equipped with a 5′-11 kDa PEG moiety. The sequences were evaluated using fluorescence reflectance imaging (FRI) of mice that bear orthotopic and subcutaneous xenograft tumours. The individual sequences were injected in the tail vein of anesthetised mice and whole-body FRI of the dorsal side view was performed before, 5, 60, and 180 minutes post injection. Subsequently, all animals were euthanized and several organs, including the orthotopic and the subcutaneous tumours, were harvested and analysed by ex vivo FRI. An initial screening using a single mouse per individual sequence was performed. Each sequence was evaluated for tumour targeting comparing the mean fluorescence inside the subcutaneous tumour to the mean fluorescence measured in a healthy zone adjacent to the tumour. None of the sequences derived from the library D3 were found to target efficiently the subcutaneous tumours.

[0083] Orthotopic tumour targeting was also assessed by ex vivo fluorescence measurements comparing the fluorescence of prostatic tumours vs. muscle. The fluorescence ratio between prostate tumour and muscle were higher than 2 for two sequences denoted D3P-10 (SEQ ID NO: 6) and D3P-21 (SEQ ID NO: 1). These two sequences and a third sequence denoted D3P-20 (SEQ ID NO: 7) revealed superior subcutaneous tumour targeting. Further testing of these sequences using additional subcutaneous mouse model samples revealed a reproducible tumour targeting when compared to the starting library and all other analysed sequences.

[0084] The FIG. 3 shows the validation of aptamers evolved from the DNA library D3P by planar imaging. As can be seen in the FIG. 3, the ratio of subcutaneous fluorescence signal obtained from the tumour tissue compared to surrounding tissue of all indicated sequences 180 min post injection. The values obtained from the starting library (D3P-lib) (n=3), and the aptamers D3P-10 (n=5), D3P-20 (n=6), as well as D3P-21 (n=5) were compared to all other sequences tested and pooled as “others” (n=31). The aptamers D3P-21, D3P-P20 and D3P-P10 have a statistically significantly higher tumour to healthy tissue ratios (2.76±0.09, 2.75±0.49, and 2.48±0.34, respectively) compared to the mice injected with the other aptamers (1.75±0.09). In contrast, the difference obtained with the naïve library (D3P-lib) (2.400±0.55) was not significant. Statistical significance was calculated using Graphpad Prism 6 using an unpaired t test model assuming that all data have the same standard deviation (SD). **P<0.01 and ***P<0.001.

[0085] Among them, the aptamer of SEQ ID NO: 1, which was denoted D3P-21, was found to be the most promising sequence as it showed an average fluorescence ratio of tumour to healthy tissue of 2.76±0.09, which is significantly higher and reproducible compared to the average ratio obtained by all other sequences (1.75±0.09).

Example 2

Quantification of Aptamer Localised to Tumour Tissue

[0086] For further validation, the amount of aptamer localised to the tumour tissue was quantified by quantitative PCR (qPCR). Both, orthotopic and subcutaneous tumours from mice treated with D3P-21 or the D3P-library were homogenised and the DNA extracted. The obtained DNA was then subjected to qPCR as described above.

[0087] The FIG. 4 shows the quantification of tumour binding of the aptamer of SEQ NO: 1, denoted D3P-21, in vitro in targeting subcutaneous or orthotopic PC-3 tumours extracted from mice used in the in vivo screening. The FIG. 4a shows the relative amount of the aptamer and native library (D3P-lib) used as control of tumours from only subcutaneous mouse models. The FIG. 4b shows the relative amount of aptamer D3P-21 from both orthotopic and subcutaneous tumours, both quantified via qPCR. Data was normalised to the OD of the sample and is represented as the mean value between tumours injected with the same oligonucleotide (n=4, 2 independent experiments).

[0088] This analysis revealed a higher amount of D3P-21 recovered from subcutaneous tumours compared to the D3P-library. qPCR data also revealed that more copies of D3P-21 could be recovered from the orthotopic compared to the subcutaneous prostate tumour tissue. The heterogeneity of the recovered DNA amounts might be explained by the fact that the samples of the test set were non-perfused (in contrast to the samples directly obtained from the selection procedures), resulting in residual amounts of blood remaining in the tissue that interfere in the analysis.

Example 3

Determination of the Stability of the Aptamer of SEQ NO: 1

[0089] A pre-requisite for the potential therapeutic application of aptamers in vivo is their long-term stability in mammalian serum. As the aptamer of SEQ NO: 1, denoted D3P-21, was selected in vivo, this inherently indicates that the sequence has certain nuclease resistance. To further explore its stability, its degradation in serum and in Dulbeccos's phosphate buffer saline (DPBS) as a control were tested.

[0090] For testing the stability of the sequence, 2 μM D3P-21 aptamer either bearing or lacking the 11-kDa PEG moiety in the 5′-end were incubated in human serum and DPBS containing calcium and magnesium at 37° C. Samples were collected at different time points (0, 1, 3 and 18 hours) and intact DNA was quantified with qPCR as described above. Human serum was kindly provided by Dr. Jens Müller from the University Hospital Bonn.

[0091] The FIG. 5 shows the stability of D3P-21 aptamer in human serum compared to DPBS with Ca.sup.2+/Mg.sup.2+ incubated in human serum (quadrants) or buffer (cycles). The FIG. 5a shows the stability of the pegylated aptamer, FIG. 5b shows the stability of the non-pegylated aptamer. As can be seen in FIG. 5, after 1 h of incubation at 37° C. 92.8% of the pegylated aptamer remained full length in serum, which is ˜20% more compared to its non-pegylated variant (73.1%). This difference becomes less significant after 3 hours of incubation, after which 61.1% (D3P-21) and 50.8% (non-pegylated D3P-21) of the respective full-length aptamers were detected. These data are in line with the qPCR results that also project towards a good stability of D3P-21 in vivo. While the PEG moiety seems to increase the endurance of D3P-21 towards nucleases up to 3 h, extended incubation times revealed even more degradation of the pegylated variant compared to the non-pegylated aptamer. When incubated in DPBS, no degradation of the aptamer variants was observed.

Example 4

Determination of the Binding Properties of the Aptamer of SEQ NO: 1 In Vitro

[0092] The aptamer's characteristics and properties in vitro were analysed. To characterise the binding properties of the aptamer of SEQ NO: 1, denoted D3P-21, in vitro, flow cytometry studies were performed using PC-3 cells as described above. Further, the interaction of D3P-21 with other cancer cell lines, i.e. A459, H460, MCF-7, Ramos, and the androgen-dependent prostate cancer cell line LNCaP was tested. Furthermore, peripheral blood mononuclear cell (PMBC) and splenocytes from mice were also investigated. For technical reasons oligonucleotides (ODN, aptamer and controls) labelled with Atto647N fluorophore were used in the flow cytometry assay with LNCaP cells, while ODNs (aptamer and controls) labelled with Alexa Fluor 680 were employed for the other cell lines.

[0093] FIG. 6 shows the results of the flow cytometry analysis of the interaction of aptamer of SEQ NO: 1 (D3P-21) and the DNA library D3P (D3P-lib) with prostate cancer PC-3 cells, murine splenocytes, and murine peripheral blood mononuclear cells (PBMC) and other cancer cell lines (MCF7, H460, A549, and Ramos). FIG. 6a shows the ratio of binding of D3P-21 compared to the D3P-library and FIG. 6b the total percentage of cells bound by D3P-21. As can be seen from the FIGS. 6a and 6b, the aptamer D3P-21 revealed a two-fold increase in binding to cultured PC-3 cells compared to the naïve D3P library. FIG. 6c shows the results of the flow cytometry analysis of the interaction of D3P-21 and D3P-lib with the prostate cancer PC-3 and LNCaP cells, wherein FIG. 6c shows the ratio of binding of D3P-21 compared to D3P-lib and FIG. 6d the total percentage of cells bound by D3P-21.

[0094] These experiments revealed that the aptamer of SEQ NO: 1, denoted D3P-21, interacts with the lung cancer cell lines A549 and H460 (lung carcinoma), while no binding to splenocytes, PMBCs, Ramos (Burkitt's lymphoma), and MCF7 (breast cancer) cells was observed. Notably, binding to androgen-dependent prostate cancer LNCaP cells was also not observed.

[0095] The FIG. 6e shows the results of the flow cytometry analysis of the interaction of aptamer of SEQ NO: 1 (D3P-21) compared to the aptamer candidates denoted D3P-10 and D3P-20 of example 1. As can be seen, the other aptamer candidates tested showed no binding to PC-3 cells in vitro. This experiment shows that the aptamer of SEQ NO: 1, denoted D3P-21, is the only aptamer interacting with cancer cell lines.

Example 5

Determination of the Pegylation on the Binding Properties of the Aptamer of SEQ NO: 1

[0096] The impact of the PEG moiety on the binding characteristics of D3P-21 was analysed. Therefore, PC-3 cells were incubated with pegylated (D3P-21), non-pegylated D3P-21 (D3P-21non-PEG), or the non-pegylated D3P-library (D3P-lib non-PEG) labelled with Atto647N at the 3′-end and the interaction of pegylated or non-pegylated D3P-21 with PC-3 cells was measured by flow cytometry and qPCR as described above and compared to the D3 and D3P libraries, respectively.

[0097] FIG. 7a shows the results of the flow cytometry analysis of the impact of the PEG moiety of D3P-21 on its interaction properties. FIG. 7b shows the analysis of the impact of the PEG moiety on D3P-21 on PC-3 cell interaction using non-labelled DNA and qPCR for quantification. Shown is the ratio of recovered (moles of the indicated oligodeoxynucleotide compared to D3P-lib. Represented as mean±SD (n=4).

[0098] These experiments demonstrated a loss of binding performance of D3P-21 in the absence of the PEG moiety. Conversely, the binding of the D3 library to PC-3 cells was found to be independent of its pegylation status.

Example 6

Determination of the Folding of the Aptamer of SEQ NO: 1

[0099] The sequence of the aptamer of SEQ NO: 1 is a G-rich sequence (33.75%) and, thus, might be capable of folding into G-quadruplex structures. Although the aptamer does not share intersected runs of consecutive G residues, typically associated with G-quadruplex formation the dependence of cell binding of the aptamer on the presence of potassium ions were analyzed by flow cytometrie as these are key to G-quadruplex structure stabilisation. The cells were incubated with 100 nM of the aptamer labelled with Atto647N at the 3′-end as described above.

[0100] The FIG. 8 shows the flow cytometry analysis monitoring the influence of potassium in the binding of the aptamer of the aptamer of SEQ NO: 1, denoted D3P-21, to PC-3 cells. Shown is the ratio of binding of D3P-21 compared to D3P-lib in FIG. 8a and the total percent of cells bound by D3P-21 in FIG. 8b, represented as mean±SD (n=4). The FIG. 8 shows that the interaction of D3-P21 with PC-3 cells depends on the presence of potassium ions in the binding buffer.

[0101] In order to elucidate whether D3P-21 forms a G-quadruplex structure and to analyse the impact of the PEG moiety on the conformation of D3P-21, circular dichroism (CD) spectroscopy experiments were performed as described above. The FIG. 9 shows the CD spectroscopy analysis of D3P-21. CD spectra of D3P-21 in FIG. 9a, non-pegylated D3P-21 (D3P-21 non-PEG) in FIG. 9b, and C10.36 in FIG. 9c under different conditions, i.e. H.sub.2O, PBS w/o potassium ions (pH 7.4), and PBS with increasing concentrations of potassium ions as indicated. Comparison of the obtained CD spectra of different aptamers and variants at a concentration of 4 mM potassium ions in FIG. 9d.

[0102] As can be seen in the FIG. 9, the CD spectra of the aptamer were characterised by a positive peak at 273 nm (D3P-21) and 270 nm (non-pegylated D3P-21) and a negative peak at 244 nm. These typical CD profiles indicate that D3P-21 most likely contains a B-form conformation. Notably, the absence or presence of potassium ions did not have an impact on the CD spectra, indicating that the conformation of D3P-21 is K.sup.+-independent. In contrast, the CD spectra of C10.36, a previously described parallel G-quadruplex containing aptamer, were found to be strongly affected by the absence or presence of K. Minor differences were observed in the CD spectra of the pegylated vs. the non-pegylated aptamer revealing that the 11 kDa PEG moiety has little or no effect on the aptamer's conformation.

[0103] These data also indicate, that the aptamer of SEQ NO: 1 most likely does not fold into a common G-quadruplex structure.

Example 7

Determination of a Possible Activate the Innate Immune System by the Aptamer of SEQ NO: 1

[0104] The impact of D3P-21 on the innate immune system was evaluated since it was suggest that DNA aptamers activate the immune system, mainly mediated by the Toll-like receptor (TLR) superfamily. To determine D3P-21's potential in this regard the secretion of TNFα by immortalised murine embryonic stem cell-derived macrophages upon aptamer treatment was measured. Increasing concentrations of D3P-library, D3P-21, D3P-21 non-pegylated, CpG ODN 1826 type B and LPS were incubated with immortalized murine embryonic stem cell-derived macrophages for 24 h and concentration of TNF-alpha in the supernatant was determined by HTRF assay as described above.

[0105] The FIG. 10 shows the evaluation of aptamer immunogenicity. The FIG. 10a shows concentration of TNF-alpha in the supernatant vs. the concentrations of D3P-library (grey squares), D3P-21 (dots, below), non-pegylated D3P-21 (black squares), CpG ODN 1826 type B (dots, above) and LPS (x). The results of the D3P-library (grey squares), the aptamer D3P-21 (dots), and non-pegylated D3P-21 (black squares) are depicted in FIG. 10b without controls. The results are represented as mean±SEM (n=5).

[0106] As can be taken from the FIG. 10, the results demonstrated a very low immunogenicity by D3P-21 and its non-pegylated variant at concentrations up to 3 μM. In contrast, the D3P-library induced TNFα secretion at concentrations above 0.375 μM. This finding is not surprising as the initial library contains ˜10.sup.15 sequences, some of which most likely sharing structural motifs capable of TLR recognition. However, the activation of the innate immune response by the DNA library was found to be >3 orders of magnitude less pronounced compared to the controls, i.e. CpG and LPS.

[0107] These data indicate that the aptamer of SEQ NO: 1 does not activate the innate immune system. This provides a major advantage, as the lack of stimulating the innate immune system overcomes a major drawback linked to DNA aptamers.

Example 8

Determination of the Influence of the Molecular Weight of the Polyethylene Glycol (PEG) Moiety on Binding

[0108] The dependence of cell binding of the aptamer on the weight of the polyethylene glycol (PEG) moiety was analyzed by flow cytometrie. The aptamer D3P-21 as selected in example 1 contained an 11 kDa polyethylene glycol (PEG) moiety on the 5′-end. For comparison of (PEG) moieties, the aptamer sequence SEQ NO: 1 conjugated to an 2 kDa and an 21 kDa polyethylene glycol (PEG) moiety on the 5′-end, respectively, was used. PC-3 cells were incubated with 100 nM of the aptamers of SEQ NO: 1 with 2 kDa, 11 kDa and 21 kDa PEG moieties labelled with Atto647N at the 3′-end as described above.

[0109] A non binding 32nt sequence having a 11 kDa PEG moiety (denoted D3P-21.32 11 kDa, SEQ NO: 5) was used as control.

[0110] The FIG. 11 shows the results of the flow cytometry analysis monitoring the influence of the weight of the PEG moiety on the binding of the aptamer of SEQ NO: 1 to PC-3 cells. The aptamers of SEQ NO: 1 with 2 kDa, 11 kDa and 21 kDa PEG moieties are denoted D3P-21 2 kDa, D3P-21 11 kDa, D3P-21 22 kDa, respectively. Shown is the ratio of binding compared to the starting library as “specific control” in FIG. 11a and the total percent of cells bound in FIG. 11b, represented as mean±SD (n=4). The FIG. 11 shows that the binding of the aptamer of SEQ NO: 1 to PC-3 cells decreased with increasing molecular weight of the polyethylene glycol (PEG) moiety.

[0111] In summary, these results show that the aptamer of SEQ ID NO: 1 comprising a polyethylene glycol moiety conjugated to the 5′-end is a tumour targeting aptamer with good specificity, particularly to hormone refractory prostate cancer. The aptamer was able to interact with cultured PC-3 cells in vitro, and demonstrated the capacity to recognise a target that is present on the tumour cells in culture and in the tumour microenvironment in vivo. The aptamer also recognised lung cancer cell lines.

[0112] The work leading to this invention has received funding from BMBF under grant agreement n° 13N12249.