GENE EXPRESSION ELEMENTS AND SYSTEMS AND USE THEREOF
20220064656 · 2022-03-03
Inventors
Cpc classification
C12N15/8245
CHEMISTRY; METALLURGY
C12N15/8257
CHEMISTRY; METALLURGY
Y02A40/146
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N15/827
CHEMISTRY; METALLURGY
C12N15/8209
CHEMISTRY; METALLURGY
C12N15/8213
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to an expression control element and expression system comprising same, particularly to an expression control element regulated by a polyamine or polyamine analogue, host cells and eukaryotic organisms comprising same and methods of use thereof.
Claims
1-64. (canceled)
65. An isolated expression control element (ECE), comprising a polyamine or polyamine analog responsive nucleic acid sequence flanked by splice sites or variants thereof.
66. The isolated ECE of claim 65, wherein the polyamine or polyamine analog responsive nucleic acid sequence comprises at least one stop codon.
67. The isolated ECE of claim 65, wherein the polyamine or polyamine analog responsive nucleic acid sequence is derived from a gene encoding Spermidine/spermine N1-acetyltransferase (SSAT), comprising a nucleic acid sequence having at least 85% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 1.
68. The isolated ECE of claim 65, wherein the polyamine or polyamine analog responsive nucleic acid sequence comprises a nucleic acid sequence selected from the group consisting of a nucleic acid sequence having at least 95% identity to the nucleic acid sequence set forth in SEQ ID NO: 2 and a nucleic acid sequence having the nucleic acid sequence set forth in SEQ ID NO: 3.
69. The isolated ECE of claim 65, wherein the flanking splice sites comprise a nucleic acid sequence of a splice acceptor site located 5′ to the polyamine or polyamine analog responsive nucleic acid sequence and a nucleic acid sequence of a splice donor site located 3′ to the polyamine or polyamine analog responsive nucleic acid sequence.
70. The isolated ECE of claim 69, wherein the ECE splice acceptor site comprises a consecutive nucleotide sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 15, SEQ ID NO: 32 and functional variants thereof.
71. The isolated ECE of claim 70, wherein the functional variant is selected from the group consisting of a functional variant that reduces the splicing frequency at the ECE splice acceptor site; a functional variant that enhances the splicing frequency at the ECE splice acceptor site; a functional variant that reduces the splicing frequency at the ECE splice donor site; a functional variant that enhances the splicing frequency at the ECE splice donor site.
72. The isolated ECE of claims 65, said isolated ECE further comprises at least one intron sequence.
73. The isolated ECE of claim 72, wherein the at least one intron sequence is flanking each of the splice sites or the variants thereof.
74. The isolated ECE of claim 65, said isolated ECE comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 51, and SEQ ID NO: 58.
75. The isolated ECE of claim 72, wherein the at least one intron comprises a chimeric combination of intron nucleic acid sequences selected from the group consisting of: a. the nucleic acid sequence set forth in SEQ ID NO: 22 flanked by the nucleic acid sequence set forth in SEQ ID NO: 23. b. the nucleic acid sequence set forth in SEQ ID NO: 24 flanked by the nucleic acid sequence set forth in SEQ ID NO: 25; c. the nucleic acid sequence set forth in SEQ ID NO: 22 flanked by the nucleic acid sequence set forth in SEQ ID NO: 30; d. the nucleic acid sequence set forth in SEQ ID NO: 24 flanked by the nucleic acid sequence set forth in SEQ ID NO: 31.
76. The isolated ECE of claim 72, wherein the intron sequence is located 5′ to the splice acceptor site.
77. The isolated ECE of claim 76, wherein the intron sequence comprises a branch point comprising the consecutive nucleotide sequence set forth in SEQ ID NO: 11 or a functional variant thereof.
78. A eukaryotic host cell or an organism comprising same, wherein the eukaryotic host cell comprises a splicing system comprising the isolated ECE of claim 65.
79. The eukaryotic host cell or the organism comprising same of claim 78, wherein the isolated ECE is located within an intron of a transcribable polynucleotide of said host cell.
80. An isolated polynucleotide expression system comprising at least one promoter operably linked to at least one transcribable polynucleotide to be expressed in a host cell, wherein the transcribable polynucleotide comprises the expression control element (ECE) of claim 65.
81. The isolated polynucleotide expression system of claim 80, wherein the expression control element is located at a position selected from the group consisting of a position between two exons of the transcribable polynucleotide; a position within an intron of the transcribable polynucleotide; a position within an exon of the transcribable polynucleotide; and a position between the promoter and the coding sequence of the transcribable polynucleotide; and a position between the coding sequence of the transcribable polynucleotide and a terminator sequence.
82. A eukaryotic host cell having a splicing system or a eukaryotic organism comprising same, wherein the host cell comprises the isolated polynucleotide expression system of claim 81, and wherein said eukaryotic host cell is selected from the group consisting of a plant cell, an algal cell, a fungal cell a mammalian cell and a fish cell.
83. The eukaryotic organism of claim 82, wherein said eukaryotic organism is a plant and wherein the transcribable polynucleotide encodes a product conferring resistance to at least one of herbicides, pesticides, and fungicides.
84. A method for regulating the expression of a transcribable polynucleotide within a host cell, the method comprises transforming into the host cell at least one polynucleotide comprising the expression control element (ECE) of claim 65 or a polynucleotide expression system comprising same; and regulating the amount of polyamine or analog thereof to which the host cell is exposed.
85. The method of claim 84, wherein said method comprises exposing the cell to an effective amount of polyamine or analog thereof, thereby inducing exclusion of the polyamine or polyamine analog-responsive nucleic acid sequence from the transcript of the transcribable polynucleotide.
86. The method of claim 85, wherein exclusion of the polyamine or polyamine analog-responsive nucleic acid sequence results in one of a functional transcript of the transcribable polynucleotide or a non-functional transcript of the transcribable polynucleotide.
87. The method of claim 86, wherein exclusion of the polyamine or polyamine analog-responsive nucleic acid sequence results in a functional transcript of the transcribable polynucleotide, wherein the host cell forms part of a plant, and wherein said transcribable polynucleotide encodes a product conferring resistance to the plant to at least one of a herbicide, a pesticide, or a fungicide.
88. The method of any claim 87, wherein said method further comprises applying to the plant an effective amount of the at least one of a herbicide, a fungicide, or a pesticide.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
DETAILED DESCRIPTION OF THE INVENTION
[0114] The present invention provides a platform system for controlling gene expression in a variety of eukaryotic cell types capable of mediating alternative slicing. The system of the present invention provides versatile options of use, which can be adapted to the cell type or organism in which it is expressed, the desired expressed product and the desired degree of expression control. The present invention further provides host cells comprising the systems of the present invention as well as intact plants, algae or fungi comprising same.
Definitions
[0115] The terms “comprise”, “comprising”, “includes”, “including”, “having” and their conjugates mean “including but not limited to”.
[0116] As used herein, the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a compound” or “at least one compound” may include a plurality of compounds, including mixtures thereof.
[0117] When reference is made to particular sequence or sequence ID NO., such reference is to be understood to also encompass sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.
[0118] As used herein, the terms “Spermidine/spermine N.sup.1-acetyltransferase” and “SSAT” refer to an enzyme mediating the N.sup.1-acetylation of spermidine or spermine. The SSAT enzyme sequence is highly conserved in a variety of species (
[0119] As used herein, the terms “sequence identity” or “identity” in the context of two nucleic acid or polypeptide sequences includes reference to the residues in the two sequences which are the same when aligned. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g. charge or hydrophobicity) and therefore do not change the functional properties of the molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences which differ by such conservative substitutions are considered to have “sequence similarity” or “similarity”.
[0120] Identity can be determined using any homology comparison software, including for example, the BlastN software of the National Center of Biotechnology Information (NCBI) such as by using default parameters.
[0121] According to some embodiments of the invention, the identity is a global identity, i.e., an identity over the entire nucleic acid sequences or the amino acid sequences.
[0122] According to some embodiments of the invention, the term “homology” or “homologous” refers to identity of two or more nucleic acid sequences; or identity of two or more amino acid sequences; or the identity of an amino acid sequence to one or more nucleic acid sequence.
[0123] According to some embodiments of the invention, the homology is a global homology, i.e., a homology over the entire nucleic acid or amino acid sequences.
[0124] The degree of homology or identity between two or more sequences can be determined using various known sequence comparison tools.
[0125] The terms “splice donor site” and “5′ splice site” are used herein interchangeably and refer to the splicing recognition site at the 5′ end of an intron. The terms “splice acceptor site” and “3′ splice site” are used herein interchangeably and refer to the splicing recognition site at the 3′ end of an intron.
[0126] The term “derived” as used herein with regard to a gene refers to a sequence having homology to a part of that gene. According to certain exemplary embodiments, the polyamine or polyamine analogue-responsive nucleic acid sequence forming part of the expression control element of the present invention is derived from a gene encoding murine SSAT or a homolog thereof.
[0127] The term “coding sequence” as used herein refers to a sequence of Deoxyribonucleic acid (DNA) bases necessary for the production of RNA. According to certain exemplary embodiments of the present invention the coding sequence comprises at least one intron. The end product of the coding sequence according to the teachings of the present invention can be RNA or a protein. The RNA can be a functional transcript, including, but not limited to, RNA inhibitory molecule (e.g. dsRNA, antisense), protein encoding RNA, and viral RNA; or a non-functional transcript. The production of functional or non-functional transcript depends on splicing of the pre-RNA transcribed from the coding sequence, which in turn depends on the amount of polyamine or analog thereof reaching the expression system comprising the coding sequence.
[0128] The terms “expression system” and “polynucleotide expression system” are used herein interchangeably and refer to an artificially assembled or isolated nucleic acid molecule which includes the coding sequence encoding the product of interest and is assembled such that the product can be expressed. The system may further include a marker gene which in some cases can encode a protein of interest. The expression system further comprising appropriate regulatory sequences operably linked to the coding sequence. It should be appreciated that the inclusion of regulatory sequences in the system of the invention is optional, for example, such sequences may not be required in situations where the regulatory sequences of a host cell are to be used and the expression system is introduced into the host cell genome to be operable by the regulatory elements of the host cell.
[0129] The term “operably linked” refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is regulated by the other. For example, a promoter is operably linked with a coding sequence when it is capable of regulating the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in a sense or antisense orientation.
[0130] The term “cell” is defined herein as to comprise any type of eukaryotic cell capable of RNA splicing, isolated or not, cultured or not, differentiated or not, and comprising also higher-level organizations of cells such as tissues, organs, calli, organisms or parts thereof. Exemplary cells include, but are not limited to: plant cells, algal cell, fungal cells and mammalian cells, including human cells and animal cells.
[0131] The terms “polyamine-responsive nucleic acid sequence”, “polyamine or polyamine analogue responsive nucleic acid sequence”, “polyamine or polyamine analogue responsive sequence” and “polyamine or polyamine analogue responsive exon” are used herein interchangeably and refer to any sequence that is spliced in (i.e. retain) when polyamine levels in the cell are below a threshold and spliced out when polyamine levels are above a predetermined threshold. Examples of such sequences include the 110 bp exon derived from Spermidine/spermine N.sup.1-acetyltransferase (SSAT) and homologues thereof as well as sequences capable of binding a polyamine and/or forming one secondary structure in the presence of a polyamine and another in the absence of the polyamine.
[0132] Polyamines, spermidine and spermine and their precursor putrescine, are small ubiquitous organic cations that are essential for cell growth and proliferation and for the synthesis of proteins and nucleic acids. Due to their positive charge, polyamines interact with different polyanionic macromolecules such as DNA and RNA. Spermidine/spermine N.sup.1-acetyltransferase (SSAT) is a eukaryotic rate-controlling enzyme in the inter-conversion of polyamines. The enzyme acetylates spermidine and spermine, which are then either excreted out from the cell or converted back to putrescine or spermidine, respectively, by polyamine oxidase. SSAT pre-mRNA has been recently found to undergo alternative splicing to yield, along with normal SSAT mRNA, a longer variant (SSAT-X) by insertion of an additional 110-bp exon between exons 3 and 4. The exon inclusion introduces three in-frame premature termination codons (PTC). It has been shown that alterations in the intracellular polyamine level results in a change in the relative abundance of SSAT transcripts. Addition of polyamines or their N-diethylated analogs reduced the amount of the variant transcript, whereas polyamine depletion enhanced the exon inclusion. It was further shown that the variant transcript was degraded by nonsense-mediated mRNA decay (NMD) (Hyvonen M T et al., 2006. RNA 12: 1569-1582).
[0133] Experiments conducted by the present inventor have shown for the first time that the 110 bp exon isolated from Spermidine/spermine N.sup.1-acetyltransferase (SSAT) maintains its polyamine-responsive splicing behavior when inserted into introns of heterologous genes (see Examples section) and that this activity can be induced in organisms that lack SSAT such as plants.
[0134] Thus, according to one aspect, the present invention provides an isolated polynucleotide that functions as an expression control element (ECE). The ECE comprises a polyamine/polyamine analogue-responsive nucleic acid sequence (also referred to herein as “polyamine or polyamine analogue responsive exon”) flanked by splice sites.
[0135] According to certain embodiments, the polyamine or polyamine analogue responsive nucleic acid sequence comprises at least one stop codon.
[0136] According to certain embodiments, the polyamine or polyamine analogue responsive nucleic acid sequence is derived from a gene encoding SSAT.
[0137] According to certain embodiments, the polyamine or polyamine analogue responsive nucleic acid sequence is derived from a gene encoding mouse SSAT or a homolog thereof. According to certain embodiments, the SSAT encoding gene comprises a nucleic acid sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 89%, at least 90% ,at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to the nucleic acid sequence set forth in SEQ ID NO:1. According to certain exemplary embodiments, the SSAT encoding gene comprises the nucleic acid sequence set forth in SEQ ID NO:1.
[0138] According to certain embodiments, the polyamine or polyamine analogue responsive nucleic acid sequence has at least 95% sequence identity to the nucleic acid sequence set forth in SEQ ID NO:2. According to certain embodiments, the polyamine or polyamine analogue responsive nucleic acid sequence has at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the nucleic acids sequence set forth in SEQ ID NO:2. According to some embodiments, the polyamine or polyamine analogue responsive nucleic acid sequence consists of SEQ ID NO:2.
[0139] According to certain exemplary embodiments, the polyamine or polyamine analogue responsive nucleic acid sequence comprises the nucleic acid sequence set forth in SEQ ID NO:3. According to some embodiments, the polyamine or polyamine analogue responsive nucleic acid sequence consists of SEQ ID NO:3.
[0140] According to certain embodiments, the flanking splice sites comprise a nuclei acid sequence of a splice acceptor site located 5′ to the polyamine or polyamine analogue responsive nucleic acid sequence and a nuclei acid sequence of a splice donor site located 3′ to the polyamine or polyamine analogue responsive nucleic acid sequence.
[0141] According to certain embodiments, the isolated ECE further comprises at least one intron sequence. According to certain embodiments, the intron sequence comprises at least 10 nucleotides. According to some embodiments, the intron sequence comprises at least 20, at least 30, at least 40, at least 50 or at least 60 nucleotides. According to certain exemplary embodiments, the intron sequence comprises from about 40 nucleotides to about 150 nucleotides.
[0142] According to certain exemplary embodiments, the isolated polynucleotide of the present invention comprises in a 5′ to 3′ direction: a first splice donor site; a first flanking intron sequence comprising at least 10 bases; a first splice acceptor site; a polyamine or polyamine analogue responsive exon; a second splice donor site; a second flanking intron comprising at least 10 bases; and a second splice acceptor site.
[0143] Without wishing to be bound by any specific theory or mechanism of action, the polyamine/polyamine analog induced splicing regulation is associated with the formation of a stem loop structure of the ECE (
[0144] According to additional aspect, the present invention provides a polynucleotide expression system comprising at least one promoter operably linked to at least one transcribable polynucleotide to be expressed in a host cell, the transcribable polynucleotide comprising an expression control element, wherein the expression control element an expression control element, wherein the expression control element comprises a polyamine or polyamine analogue responsive nucleic acid sequence flanked by splice sites or variants thereof.
[0145] The polyamine or polyamine analogue responsive nucleic acid sequence and the splice sites and variants thereof are as described hereinabove.
[0146] According to certain embodiments, the ECE further comprises at least one intron sequence as described hereinabove.
[0147] According to yet another aspect, the present invention provides a host cell comprising the heterologous ECE or the expression system comprising same according to the teachings of the present invention. The host cell is selected from the group consisting of a plant cell, an algal cell, a fungal cell, and a mammalian cell. Each possibility represents a separate embodiment of the present invention.
[0148] The present invention also encompasses a plant, an alga or a fungus comprising at least one cell comprising the heterologous ECE or the expression system comprising same according to the teachings of the present invention.
[0149] According to another aspect, the present invention provides a method for regulating the expression of a transcribable polynucleotide within a host cell, comprising transforming into the host cell at least one polynucleotide comprising the ECE or the expression system of the present invention and regulating the amount of polyamine or analogue thereof to which the host cell is exposed.
[0150] The ECE or expression system of the present invention can be transformed to any eukaryotic cell in which splicing can take place. Recombinant expression is usefully accomplished using a vector, such as a plasmid. As used herein, vector refers to any carrier containing exogenous DNA. Thus, vectors are agents that transport the exogenous nucleic acid into a cell without degradation yielding expression of the nucleic acid in the cells into which it is delivered. Vectors include but are not limited to plasmids, viral nucleic acids, viruses, phage nucleic acids, phages, cosminds, and artificial chromosomes. The vectors can be used, for example, in a variety of in vivo and in vitro situation. For example PZP or pSAT plasmids can be used as described in Tzfira et al (Tzfira T et al Plant Mol Biol. 2005. 57(4):503-16). The vector can include a promoter operably linked to the desired coding sequence.
[0151] The terms “promoter element,” “promoter,” or “promoter sequence” as used herein, refer to a DNA sequence that is located upstream to the 5′ end (i.e. proceeds) the coding sequence. The location of most promoters known in nature precedes the transcribed region. The promoter functions as a switch, activating the expression of a coding sequence. If the coding sequence is activated, it is said to be transcribed, or participating in transcription. Transcription involves the synthesis of pre-RNA and RNA from the encoding sequence. The promoter, therefore, serves as a transcriptional regulatory element and also provides a site for initiation of transcription of the coding sequence into RNA. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a coding sequence in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of some variation may have identical promoter activity. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters”.
[0152] According to the teachings of the present invention, the promoter can be an organism native promoter or a heterologous promoter, which may be a constitutive promoter, an induced promoter or a tissue specific promoter. According to some embodiments, when the organism is a plant, the promoter can be a tissue specific promoter.
[0153] The expression system or a vector comprising same can comprise additional regulatory elements including, for example, an enhancer, a terminator, and a transcriptional activator.
[0154] “Enhancer” generally refers to a sequence of DNA that functions at no fixed distance from the transcription start site and can be either 5′ or 3′ to the transcription unit. Furthermore, enhancers can be within an intron as well as within the coding sequence itself. Enhancers are usually between 10 and 300 bp in length, and they function in cis. Enhancers function to increase transcription from nearby promoters. Enhancers, like promoters, also often contain response elements that mediate the regulation of transcription. Enhancers often determine the regulation of expression. Enhancers can be in trans and away from the control sequence.
[0155] Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant, animal, human or nucleated cells) can also contain sequences necessary for the termination of transcription which can affect mRNA expression. These regions are transcribed as polyadenylated segments in the untranslated portion of the mRNA encoding tissue factor protein. The 3′ untranslated regions also include transcription termination sites. It is preferred that the transcription unit also contains a polyadenylation region. One benefit of this region is that it increases the likelihood that the transcribed unit will be processed and transported like mRNA. The identification and use of polyadenylation signals in expression constructs is well established. It is preferred that homologous polyadenylation signals be used in the transgene constructs.
[0156] The vector can include nucleic acid sequence encoding a marker product. This marker product can be used to determine if the expression system has been delivered to the cell and once delivered is being expressed. Exemplary marker genes are the E. coli lacZ gene which encodes β-galactosidase, green fluorescent protein, and the GUS reporter system.
[0157] In some embodiments the marker can be a selectable marker. When such selectable markers are successfully transferred into a host cell, the transformed host cell can survive if placed under selective pressure. There are two widely used distinct categories of selective regimes. The first category is based on a cell's metabolism and the use of a mutant cell line which lacks the ability to grow independent of a supplemented media. The second category is dominant selection which refers to a selection scheme used in any cell type and does not require the use of a mutant cell line. These schemes typically use a drug to arrest growth of a host cell. Those cells which have a novel gene would express a protein conveying drug resistance and would survive the selection. Examples of such dominant selection include the drugs neomycin, mycophenolic acid, hygromycin or kanamycin.
[0158] It is to be explicitly understood that while the expression system and/or a vector comprising same may include a promoter and/or additional regulatory elements, the presence of such regulatory elements is not obligatory. The ECE or expression system of the present invention or the vector comprising same may be so designed to be inserted into the target cell genome as to be operably linked to the cell's endogenous regulatory elements.
[0159] Transforming the ECE, expression system of a vector comprising same into at least one host cell can be performed by any method as is known to a person skilled in the art. The terms “transformation” and “transfection” are used herein interchangeably and refer to the introduction of a polynucleotide into a living cell.
[0160] Transformation of a cell may be stable or transient. The term “transient transformation” or “transiently transformed” refers to the introduction of one or more heterologous (or exogenous) polynucleotides into a cell in the absence of integration of the exogenous polynucleotide into the host cell's genome. Transient transformation may be detected by, for example, enzyme-linked immunosorbent assay (ELISA), which detects the presence of a polypeptide encoded by one or more of the transcribable polynucleotides or by nucleotide-based (NAT)-assays such as polymerase chain reaction (PCR) using proper primers. Alternatively, transient transformation may be detected by detecting the activity of a marker protein (e.g. a-glucuronidase) encoded by the exogenous polynucleotide.
[0161] In contrast, the term “stable transformation” or “stably transformed” refers to the introduction and integration of one or more heterologous (or exogenous) polynucleotides into the genome of a cell. Stable transformation of a cell may be detected by Southern blot hybridization of genomic DNA of the cell with nucleic acid sequences which are capable of binding to one or more of the exogenous polynucleotides. Alternatively, stable transformation of a cell may also be detected by enzyme activity of an integrated gene in growing tissue or by PCR of genomic DNA of the cell to amplify exogenous polynucleotide sequences. The term “stable transformant” refers to a cell which has stably integrated one or more exogenous polynucleotides into the genomic or organellar DNA.
[0162] The terms “transformants” or “transformed cells” include the primary transformed cell and cultures derived from that cell regardless to the number of transfers. All progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Mutant progeny that have the same functionality as screened for in the originally transformed cell are included in the definition of transformants.
[0163] According to certain exemplary embodiments, the cell comprising the ECE or expression system of the present invention is a plant cell. The plant cell can form part of a cell culture, tissue culture, a plant part or an intact plant. According to other exemplary embodiments, the cell comprising the ECE or expression system of the present invention is an alga cell. The alga cell can form part of a cell culture, tissue culture, an alga part or an intact alga. It is to be explicitly understood that intact plant, alga or fungus comprises at least one cell comprising the ECE or the expression system of the present invention are encompassed within the scope of the present invention.
[0164] Among the most commonly used promoters used for the expression of heterologous sequences in plants are the nopaline synthase (NOS) promoter (Ebert et at, 1987 Proc. Natl. Acad. Sci. U.S.A. 84:5745-5749), the octapine synthase (OCS) promoter, caulimovirus promoters such as the cauliflower mosaic virus (CaMV) 19S promoter (Lawton et al., 1987 Plant Mol Biol. 9:315-324), the CaMV 35S promoter (Odell et al., 1985 Nature 313:810-812), and the figwort mosaic virus 35S promoter, the light inducible promoter from the small subunit of rubisco, the ADH promoter (Walker et al., 1987 Proc Natl Aca. Sci U.S.A. 84:6624-66280, the sucrose synthase promoter (Yang et al., 1990 Proc. Natl. Acad. Sci. U.S.A. 87:4144-4148), the R gene complex promoter (Chandler et al., 1989. Plant Cell 1:1175-1183), the chlorophyll a/b binding protein gene promoter, etc. Other commonly used promoters are, the promoters for the potato tuber ADPGPP genes, the sucrose synthase promoter, the granule bound starch synthase promoter, the glutelin gene promoter, the maize waxy promoter, Brittle gene promoter, and Shrunken 2 promoter, the acid chitinase gene promoter, and the zein gene promoters (15 kD, 16 kD, 19 kD, 22 kD, and 27 kD; Perdersen et al. 1982 Cell 29:1015-1026). A plethora of promoters is described in International Patent Application Publication No. WO 00/18963.
[0165] Promoters useful to direct expression in algae are also well known in the art, and include inducible promoter and constitutive promoters. In some embodiments, the algal-specific promoter is a constitutive promoter or a light-induced promoter such as the RUBISCO rbcS promoter (e.g. U.S. Application Publication No. 2010/0081177). Additional promoters that can be used include, for example without limitation, a NIT1 promoter, an AMT1 promoter, an AMT2 promoter, an AMT4 promoter, an RH1 promoter, a cauliflower mosaic virus 35S promoter, a tobacco mosaic virus promoter, a simian virus 40 promoter, a ubiquitin promoter, a PBCV-I VP54 promoter, or functional fragments thereof, or any other suitable promoter sequence known to those skilled in the art.
[0166] There are various methods of introducing foreign genes into both monocotyledonous and dicotyledonous plants (for example, Potrykus I. 1991. Annu Rev Plant Physiol Plant Mol Biol 42:205-225; Shimamoto K. et at, 1989. Nature 338:274-276).
[0167] The principal methods of the stable integration of exogenous DNA into plant genomic DNA includes two main approaches: Agrobacterium-mediated gene transfer and Direct DNA uptake, the latter being applicable for transforming algal cells as well.
[0168] Agrobacterium-mediated gene transfer: The Agrobacterium-mediated system includes the use of plasmid vectors that contain defined DNA segments which integrate into the plant genomic DNA. Methods of inoculation of the plant tissue vary depending upon the plant species and the Agrobacterium delivery system. A widely used approach is the leaf-disc procedure, which can be performed with any tissue explant that provides a good source for initiation of whole-plant differentiation (Horsch et al., 1988. Plant Molecular Biology Manual A5, 1-9, Kluwer Academic Publishers, Dordrecht). A supplementary approach employs the Agrobacterium delivery system in combination with vacuum infiltration. The Agrobacterium system is especially useful in the generation of transgenic dicotyledonous plants.
[0169] Direct DNA uptake: There are various methods of direct DNA transfer into plant cells. In electroporation, the protoplasts are briefly exposed to a strong electric field, opening up mini-pores to allow DNA to enter. In microinjection, the DNA is mechanically injected directly into the cells using micropipettes. In microparticle bombardment, the DNA is adsorbed on microprojectiles such as magnesium sulfate crystals or tungsten particles, and the microprojectiles are physically accelerated into cells or plant tissues.
[0170] Alternative method for introducing the expression system into the genome of a host cell is by genome editing. Genome editing is a reverse genetics method which uses artificially engineered nucleases to cut and create specific double-stranded breaks at a desired location(s) in the genome, which are then repaired by cellular endogenous processes such as, homology directed repair (HDR) and non-homologous end-joining (NHEJ). NHEJ directly joins the DNA ends in a double-stranded break, while HDR utilizes a homologous sequence as a template for regenerating the missing DNA sequence at the break point. In order to introduce specific nucleotide modifications to the genomic DNA, a DNA repair template containing the desired sequence must be present during HDR. Genome editing cannot be performed using traditional restriction endonucleases since most restriction enzymes recognize a few base pairs on the DNA as their target and the probability is very high that the recognized base pair combination will be found in many locations across the genome resulting in multiple cuts not limited to a desired location. To overcome this challenge and create site-specific single- or double-stranded breaks, several distinct classes of nucleases have been discovered and bioengineered to date. These include the meganucleases, Zinc finger nucleases (ZFNs), transcription-activator like effector nucleases (TALENs) and CRISPR/Cas system.
[0171] The splicing pattern controlling the expression of the coding sequence is determined by the amounts of polyamines/polyamines analogs sensed by the cell comprising the ECE or expression system of the invention and/or other chemicals or molecules that increase or alter polyamines levels within the cell or its immediate environment. Increase in the polyamines/analogs levels results in reduction or prevention of the polyamine or polyamine analogue responsive exon inclusion within the RNA transcript. According to certain embodiments, the absence of the exon yields a functional RNA transcript. Reduced polyamines/analog levels result in increase of the polyamine or polyamine analogue responsive exon inclusion. According to certain embodiments, the presence of the exon results in the formation of non-functional RNA transcript. According to certain exemplary embodiments, inclusion of the exon within the transcribed RNA results in the insertion of premature stop codon into the transcribed RNA.
[0172] Mutations in the ECE sequence and/or introns flanking same may alter its structure and/or function and affect the splicing frequency and/or the ECE responsiveness to the polyamine or analogue thereof. As described hereinabove, the mutations can result in ether enhancing or reducing the splicing frequency/polyamine responsiveness. Moreover, the ECE can be combined with other regulatory elements, such as promoters, to strengthen the promoter control on expression. Inducible promoters known in the Art, for example heat shock responsive promoter, may provide for about 95% control of the expression (i.e. about 5% “leakiness”, that is background expression regardless of heat). Combining the ECE and expression systems comprising same of the invention can reduce this background expression to less than 5% (under no polyamine/no heat conditions) and elevate the expression to near 100% under heat and polyamine induction. In this case, the expression control is close to off/on regulation.
[0173] Regardless of organism or construct type, the present invention can be used in an open loop manner by applying/administering a polyamine or analog or a chemical or factor that can modulate internal polyamine levels or in a closed loop manner in which the polyamine levels are internally controlled by an inducer.
[0174] The level of endogenous polyamines can be manipulated by various reagents or molecules. According to some embodiments, depletion of polyamines can be induced by chemicals affecting the activity of enzymes in the polyamine biosynthesis, for example difluoromethylornithine (DFMO), an irreversible inhibitor of ornithine decarboxylase (ODC), the rate-controlling enzyme in the biosynthesis of putrescine and spermidine. MG-132 inhibits proteasomal degradation of the spermine/spermidine actyl transferase (SSAT) and thus increases the amount of SSAT enzyme protein and reduces polyamines levels. Alternatively, or in addition, regulating expression of genes involved in the polyamine biosynthesis pathway can be used to alter the endogenous polyamine level and change the splicing pattern of ECE harboring genes. Coupling the expression of these polyamine-altering genes with developmental genes (under the same promotor) may result in a developmentally-dependent splicing pattern of other ECE harboring genes. For example, the promoter of a gene that induces flowering in plants such as CO (SEQ ID NO:46) can be used to control the gene encoding spermine synthase (SEQ ID NO:47). In such a scenario, the spermine synthase will be expressed at flowering which in turn will result in increased spermine levels and silencing of ECE harboring genes. In another example, a gene encoding insect resistance in plants (e.g., HM107006 Synthetic construct delta-endotoxin (Cry1C) gene, SEQ ID NO:62) can be modified with the ECE sequence of the present invention and used with the above-described flowering-expressed spermine synthase in order to prevent expression of the insecticide during flowering.
[0175] Advantageously, preliminary experiments (see Example 3 hereinbelow) have shown that the endogenous level of polyamine within a plant cell transformed with an exemplary construct comprising the ECE of the present invention had no significant effect on the splicing pattern of the system. Accordingly, mediating splicing that would result in expression of the desired coding sequence requires exposure of the cells to an effective amount of polyamine or polyamine analog, which is significantly easier to control and manipulate compared to controlling the endogenous level of polyamine
[0176] The ability to limit the expression of resistance genes (e.g., gene conferring resistance to herbicide or pesticide) to when needed has many advantageous. It is not only metabolically more efficient; it might also have a major role in protecting the environment from the deleterious effects of such gene products. For example, shutting down expression of an insecticide gene during flowering can be used to protect insects pollinating the crops.
[0177] The splicing pattern controlling the expression of the coding sequence is determined by the amounts of polyamines/polyamines analogs sensed by the cell comprising the expression system of the invention. Particular amounts will depend on the type and form of the host cell (e.g. cell culture, tissue culture or an intact organism) and can be determined by a person skilled in the Art.
[0178] As described hereinabove, the use of the expression control system of the present invention is not confined to specific type of host cells nor to particular transcribable polynucleotide, and thus provide for broad and versatile optional uses. The expression of a desired transcript, being based on polyamine or polyamine responsive alternative splicing, enables controlling the timing of the expression.
[0179] For example, algae, particularly microalgae are thought to offer great potential as expression system for various industrial, therapeutic and diagnostic recombinant proteins. Cultures of plant cells have also been developed for the same purposes. Microalgae and plant cell cultures combine high growth rates with all benefits of eukaryotic expression systems, and, moreover, are photosynthetic organisms hence the energy required for protein expression is based on natural CO.sub.2 and involves only low production costs. However, a constitutive expression of exogenous RNA or protein product within the alga or plant host cell may interfere with the cell normal growth and establishment of a cell culture required for producing desired amounts of the expressed product. Using the system of the invention, the expression can be easily regulated to only after the cell culture has reached an optimal density by controlling the amount of polyamine or polyamine analogs to which the cells in the culture are exposed.
[0180] Additional example in which the use of the system of the present invention may be beneficial is in controlling developmental or other specific processes in the growth cycle of a host cell or a eukaryotic organism, particularly plant. The production of hybrid plants in agriculture, the hybrids known to be superior over each of the parental lines is highly depended on the ability to produce male sterile plants, such that self-pollination is avoided. However, crossing male sterile plants with fertile female plant typically results in the production of large fraction of sterile seeds, which, when sown, would produce sterile plants. This is a significant disadvantage when the crop is seeds (such as in wheat, rice and the like). Using the expression control elements of the present invention enables reversible expression of polynucleotides conferring male sterility, such that such trait is observed only when desired.
[0181] Genome editing is a powerful tool to impact target traits by modifications of the target plant genome sequence. It is a reverse genetics method which uses artificially engineered (endo) nucleases to cut and create specific double-stranded breaks at a desired location(s) in the genome, which are then repaired by cellular endogenous processes such as, homology directed repair (HDR) and non-homologous end-joining (NHEJ). Yet, nuclease expression may cause DNA damage to the targeted host cell due to non-specific DNA binding and digestion by such enzymes. For example, various methods have been developed to control zinc finger nucleases in living plant cells, yet none has been reported to enable tight control on zinc finger nucleases expression in specific cells and tissues. The system of the present invention enables controlling the timing of the nuclease expression. Such control may improve the preciseness of the enzyme activity and the genome editing.
[0182] Viral vectors are useful tools for transient gene expression in plant cells, organs and tissues. Upon local infection, viral genomes can multiply and move systematically into non-infected tissues, rendering the plant into a factory of protein production. In most cases, expression of the foreign genes coincides with viral spread. Engineering viral vectors to produce functional target proteins upon application of the foreign inducer, will allow more robust gene expression in infected plants as it will allow expression of the target genes only after efficient spread of the viral vector.
[0183] In more general terms, the expression control element of the present invention may be used to control the expression of any exogenous polynucleotide transformed to a host cell. The expression dependency on the presence and amount of polyamine and/or polyamine analogs significantly reduces or even prevents the risk of uncontrolled expression and contamination of the environment with genetically modified host cells and organisms. For example, the commercial use of transgenic plants is currently limited in many trees, grasses and various monocots with close wide type related species due to the risk of transgene flow into the environment and close relative species. Several methods have been developed to cause pollen or oval abolition in transgenic plants by spatial, tissue or cell specific expression of toxic genes. While such methods may abolish gene transfer into the wild, they also hinder our ability to further manipulate the transgenic plants in controlled environment for breeding and other purposes. Engineering these toxic genes in a way that their expression will be abolished by application of polyamine or polyamine analogues will allow for bypassing pollen or oval abolition under controlled environment.
[0184] According to some embodiments, the functional transcript or protein product encoded by same is a regulatory element According to certain embodiments, the regulatory element is selected from the group consisting of transcription control factor, translation control factor and the like. The regulatory element can have a positive or negative regulatory effect on a gene comprising said regulatory sequence recognition sequence. Each possibility represents a separate embodiment of the present invention.
[0185] An example is the GAL4-UAS system: The ECE can be embedded into the GAL4 gene to control its expression. The GAL4 gene encodes the yeast transcription activator protein GAL4. Therefore, the expression of genes that have UAS (upstream activation sequence-enhancer to which GAL4 specifically binds to activate gene transcription) is under the splicing regulation of the ECE of the invention.
[0186] Additional example describes the use of the ECE element of the invention to control viral expression: the sequence encoding a transcription factor (as above) or any other viral regulatory protein can be cloned into a sequence that code for a virus such as the TRV (tobacco tattle virus). The ECE embedded in such a construct controls the expression of genes with recognition site for the transcription factor or the virus in cells, tissues, organs or organism infected by the virus.
[0187] The following examples are presented in order to more fully illustrate some embodiments of the invention. They should, in no way be construed, however, as limiting the broad scope of the invention. One skilled in the art can readily devise many variations and modifications of the principles disclosed herein without departing from the scope of the invention.
EXAMPLES
Material and Methods
[0188] Plasmids used for transforming the expression control element or a system comprising same to plants are presented in Table 1 hereinbelow
TABLE-US-00001 TABLE 1 Plasmids for transforming plant cells Designated Regulatory sequence name/number Plasmid based on Promoter inserted syz24-1.2 Psat3A-5061 NOS GUS intron + wild type (wt) SSAT derived ECE syz24-2.2 Psat3A-5061 NOS GUS intron + Mutated SSAT derived ECE (GTC-to-AGT) syz24-1.1 Psat6A-5013/5304 35S GUS intron + WT SSAT derived ECE syz24-2.1 Psat6A 35S GUS 5013/5304 intron + Mutated SSAT derived ECE (GTC-to-AGT) Pzp4508/ Ppzp based on Psat3 NOS GUS syz24-1.2 intron + wt SSAT derived ECE Pzp 1503/ Ppzp based on Psat3 NOS GUS syz24-1.2 intron + Mutated SSAT derived ECE (GTC-to-AGT) To be Ppzp based on Psat6 35S GUS designated intron + WT SSAT derived ECE To be Ppzp based on Psat6 35S GUS designated intron + Mutated SSAT derived ECE (GTC-to-AGT) 5060 mpr; plant expression vector, 35S 35Sprom-TL-GUS-35SpolyA (TL is from pTL-7SN; GUS is from pRAJ275) J. 7653 35Spromoter-GUS plus NPTII resistance GUS intron (Kan) in plants 5488 Tetracycline repressor (TetR) controlled GUS gene expression; binary vector expressing intron + Hygro GUS + intron from 35Sprom. w/triple X operators (see MGG 220, 245-250 for GUS + intron description) and 35S polyA; Kan.sup.r in E. coli and Hygr.sup.r in plants; see Veinmann P et al., Plant J. 5, 559-569 (1994) 5237 plant stable transformation vector with GUS constitutive expression cassette of the hpt intron + Hygro gene as selection marker and heat shock (hsp) induced expression cassette of GUS; expression of hpt controlled by octopine synthase promoter-activator (ocsAocsP) and terminator (ocsT); expression of GUS controlled by heat sock inducible (hspP) promoter and 35S terminator (35ST); made by cloning the hspP.GUS expression cassette from pSAT4.hspP.GUS (TT3087) as an I-SceI fragment into the same sites of pRCS2.ocs-hyg(b) (TT2287); RB-PI-Tlil-PI-PspI-I-CeuI-ISceI-(hsp-GUS expression cassette)-I-SceI-IPacI-IPpoI- AscI-(hyg expression cassette)-AscI-LB; Specr/Strepr (20/50 μg/ml in E. coli and 300/200 μg/ml in Agro). Pzp4508/ GUS syz24-1.2Hygro intron + WT SSAT derived ECE + Hygro Pzp 1503/ GUS syz24-1.2Hygro intron + MUT SSAT derived ECE + Hygro 5061 Ampr; plant expression vector, NOS GUS intron (Psat3A) 35Sprom-TL-GUS-35SpolyA (TL is from pTL-7SN; GUS is from pRAJ275) 5304 Plant transient gene expression vector 35S GUS intron (Psat6A) with MCS; MCS + 35SpolyA cloned as NcoI-NotI PCR frag. w/pSAT6-EGFP-C1 (E1454) as template into the same sites of pAUX3133-35S-TL [=pAUX3133 (E1309) w/added 2x35Sprom. and TL translational enhancer from pRTL2-GUS (E088); PIPspI-AgeI-2x35Sprom.-TL- NcoI- MCS-XbaI-35SpolyA-NotI-PIPspI; MCS: BspEI(not unique, 35Sprom. has BspEI)-BglII-XhoI-SacI-HindIII-EcoRI- PstI-SalI-AccI-KpnI-SacII-XmaI-ApaI- SmaI-BamHI-XbaI; 3,884 bp; clone 13 Ampr
Plasmid Preparation
[0189] Preparation of plasmid syz24-1.2, syz24-2.2, syz24-1.1, syz24-2.1, Pzp4508/syz24-1.2, Pzp 1503/syz24-1.2 was as follows:
[0190] Two fragments were synthesized (by Syntezza Bioscience Ltd.): SSAT derived ECE (including SSAT derived polyamine responsive polynucleotide flanked by SSAT derived first (upper) and second (lower) introns); and its mutated form+GUS derived introns and exon. The fragments were enzymatically digested by KpnI and BamHI and cloned (Syntezza Bioscience Ltd.) into 5061 (pSAT3) and 5304 (pSAT6) that were enzymatically digested by the same enzymes essentially as described in Tzfira et al., (2005, ibid). Plasmids were kindly given by Targetgene Biotechnologies Ltd. Four plasmids were generated (syz24-1.2, syz24-2.2, syz24-1.1, syz24-2.1). The SAT-ECE was located within the GUS intron. Gus intron split the GUS sequence to the AUG start codon and the rest of GUS sequence. Plasmids syz24-1.2 and syz24-2.2 were enzymatically digested by ppoI and clone into two pzp plasmids: 4508, 1503 (kindly given by Targetgene Biotechnologies Ltd.) to generate Pzp4508/syz24-1.2 and Pzp 1503/syz24-1.2.
[0191] Preparation of Pzp4508/syz24-1.2Hygro and Pzp 1503/syz24-1.2Hygro plasmids:
[0192] Plasmid 5237 was enzymatically digested by ascI. The fragment code for the hygromycin selection was extracted from gel.
[0193] Plasmids Pzp4508/syz24-1.2 and Pzp 1503/syz24-1.2 were digested by AscI and underwent dephosphorylation. The digested plasmids underwent ligation with the extracted fragment (hygromycin) to produce Pzp4508/syz24-1.2Hygro and Pzp 1503/syz24-1.2Hygro plasmids.
Example 1: Use of the Expression System of the Invention for Controlling GUS Expression in Arabidopsis thaliana Protoplasts
[0194] The GUS reporter system (GUS: β-glucuronidase) was used to demonstrate the features of the expression system of the invention.
[0195] Arabidopsis protoplasts were prepared as previously described (Wu F-H et al. 2009. Plant methods 5:16 doi:10.1186/1746-4811-5-16).
[0196] Plasmids syz24-2.1 and a control plasmid 5060 (constitutive GUS expression) were transformed (in the presence or without 10 μM BENZ (BZ-CAS 121749-39-1-BZ) into protoplasts (Wu et al., supra). Transfected protoplasts were washed and cultured in W5 solution with or without BENZ (BZ) in 1% bovine serum albumin-coated 15 ml tubes for 16 h at 28° C. to allow expression of the transfected DNA.
[0197] The GUS expression system enables detection of a functional β-glucuronidase when protoplasts expressing the gene are incubated with the enzyme substrate 5-bromo-4-chloro-3-indolyl glucuronide (X-Glu), where the product of the reaction is a clear blue color. As described hereinabove, the expression system of the invention was introduced into an intron within the GUS encoding gene. The polyamine analog N.sup.1,N.sup.11-Diethylnorspermine tetrahydrochloride (BENZ, CAS 121749-39-1) was used to mediate splicing.
[0198] The following assays were designed:
[0199] 1. Non transformed protoplasts
[0200] 2. Non transformed protoplasts exposed to 10 μM BENZ
[0201] 3. Non transformed protoplasts exposed to 100 μM BENZ
[0202] 4. Protoplast transformed with plasmid syz24-2.1 without exposure to BENZ
[0203] 5. Protoplast transformed with plasmid syz24-2.1 exposed to 10 μM BENZ
[0204] 6. Protoplast transformed with plasmid syz24-2.1 exposed to 100 μM BENZ
[0205] 7. Protoplast transformed with plasmid 5060 without exposure to BENZ
[0206] 8. Protoplast transformed with plasmid 5060 exposed to 10 μM BENZ
[0207] 9. Protoplast transformed with plasmid 5060 exposed to 100 μM BENZ
[0208] In all assays in which the transformed protoplasts were exposed to BENZ, the transformation and subsequent washes were performed in the presence of the corresponding BENZ concentration (10 or 100 μM). After the last wash, the protoplasts were suspended in W5 buffer containing 10 μM or 100 μM BENZ and placed at 28° C. for 48 h. Thereafter the protoplasts were collected (by spinning at 100 g×3 minutes). Protoplasts were resuspended in 0.5 ml 0.5M monitol+0.5 mg X-glucuronide (sigma B5285) and incubated at 37° C. 24 h.
[0209]
[0210] Non-transformed protoplasts were incubated with W5 medium (1); with 10 μM BENZ (2) or with 100 μM BENZ (3). β-glucuronidase activity (blue color) was not observed in any of the non-transfected samples (1-3). Protoplast transformed with syz24-2.1 plasmid comprising the ECE within the GUS intron, incubated in W5 buffer (4); supplemented with 10 μM (5) or 100 μM (6) BENZ showed β-glucuronidase activity only when cells were incubated with W5 supplemented with 100 μM BENZ. Protoplast transformed with the control 5060-constitute GUS intron expression plasmid, incubated in W5 buffer (7) supplemented with 10 μM (8) or 100 μM (9) resulted in β-glucuronidase activity irrespective of the presence of BENZ. These results indicate that the intronic splice control sequence (ECE) is spliced out (mediated splicing out of the SSAT-derived premature termination codons) and allow transcription and translation of the GUS gene under BENZ supplementation.
Example 2: Use of the Expression System of the Invention for Controlling GUS Expression in Tobacco Leaf Discs
Protocol
[0211] 5 ml Agrobacterium starter (transfected with the relevant plasmids) were grown with the selection antibiotics at 28° C. with agitation of 350 rpm overnight. Thereafter, the solution was centrifuged for 5 min. at 4500 g. The pellet was resuspended in 10 ml Induction Medium supplemented with the relevant antibiotic and 100 μM Acetosyringone, incubated for 5-6 hours at 28° C., 250 rpm and then centrifuged for 5 min at 4500 g. The bacteria were resuspended in 10 ml Infiltration Medium supplemented with 20004 Acetosyringone (1M in DMSO). The bacteria density is measured at 660 nm to obtain OD660=1.
[0212] The Induction Medium and Infiltration Medium are described hereinbelow.
Induction Medium; (1 L) pH5.6 with 32% HCl
[0213]
TABLE-US-00002 amount K.sub.2HPO.sub.4 (Dibasic potassium phosphate) 10.5 gr KH.sub.2PO.sub.4 (Potassium dihydrogen phosphate) 4.5 gr (NH.sub.4).sub.2SO.sub.4 (Ammonium Sulfate) 1 gr NaCitrate (Sodium citrate) 0.5 gr Glucose (Dextrose) 1 gr Fructose 1 gr Glycerol 4 ml MgSO4 (Magnesium Sulfate) 0.12 gr MES 1.95 gr
[0214] All the ingredients are autoclaved, or alternatively, glucose, fructose, and glycerol can be sterilized and mixed with the basal medium before use.
TABLE-US-00003 Infiltration medium: (1 L) pH 5.6 with KOH final amount MgSO.sub.4 (Magnesium sulfate) 10 mM 1.2 gr MES 10 mM 1.95 gr
[0215] All the ingredients are autoclaved.
[0216] Leaf discs were cut from Nicotiana Benthamiana plants and put in 24 wells with 400 μl of the relevant Agrobacterium with or without 50 μM BENZ. Vacuum was applied for 8 min and then slowly released, followed by additional vacuum cycle of 1 min and slow release and incubation for 10 min. The leaf discs were then separated from the Agrobacterium suspension and resuspended with MS buffer with or without 50 μM BENZ and incubated at 24° C. for three days. At the end of the incubation, the leaf discs were subjected to β-glucuronidase (GUS) assay.
β-Glucuronidase (GUS) Assay
[0217] 1. Immerse leaf discs in staining solution (NaPO4 pH7 0.1M; EDTA 100 mM Triton X-100 0.1%; K.sub.3Fe(CN).sub.6 1 mM; x-gluc 2 mM [0218] 2. Incubate leaf discs overnight at 37° C. [0219] 3. Remove staining solution and wash several times with 70% ethanol
[0220] Plasmid transformed into the leaf discs: plasmid Pzp 1503/syz24-1.2 or the control Plasmid 7653 (constitutive GUS expression). Transformation took place in the presence of or absence of 50 μM BENZ.
[0221]
[0222] Leaf discs transformed with the control 7652 plasmid (constitutive GUS expression) expressed β-glucuronidase activity (blue color) when incubated in MS buffer (
Example 3: Generating Tobacco Plants that Comprise the Expression System as Part of GUS Intron in Their Genome
[0223] Transfecting of Nicotiana Benthamiana plants was carried out as previously described (Maldonado-Mendoza IE et al. 1996. Transformation of tobacco and carrot using Agrobacterium tumefaciens and expression of the β-glucuronidase (GUS) reporter gene. Chapter 30, pp 261-274. In: Plant Tissue Culture Concepts and Laboratory Exercises. (Eds. R. N. Trigano and D. J. Gray). CRC Press, Boca Raton, USA).
[0224] Plasmids transfected:
[0225] 1. Pzp4508/syz24-1.2Hygro
[0226] 2. Pzp 1503/syz24-1.2Hygro
[0227] The regeneration and growth process include the steps of selection of transformed cells based on antibiotic resistance, culturing those cells through the typical stages of embryonic development through the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots were thereafter planted in hydroponic plant growth medium. Transgenic plants regenerated from transformed cells were grown to maturity and the presence of the inserted construct was verified by PCR. Positive transgenic plants (T0 plants) were self-pollinated and seeds were collected. Selected seeds were used for producing T1 plants. T1 plants confirmed to harbor the transformed construct by PCR were used in the experiments.
Polyamines were assembled into polyethylenimine (PEI) complexes based on the following equation:
m,PEI=15gr.fwdarw.V,epoxide=14137μl(calculation from synthesis).fwdarw.V,EtOH=863μl
[0228] 8230 μl of 100% Ethanol were add to 4 gr PEI (CAS Number: 25987-06-8), then 3770 μl C14 Epoxide were added, and the mixture was shaken at 500 rpm for two hours. PEI final concentration was about 0.0284-0.046 gr per ml.
[0229] T1 Small Nicotiana Benthamiana plants (
[0230] As is demonstrated in
Example 4: Controlling Expression of Exogenous Therapeutic Proteins in Tobacco or Carrot Cell Cultures
[0231] The use of plant viral vectors for the transient expression of heterologous proteins offers a useful tool for the large-scale production of proteins of industrial importance, such as antibodies and vaccine antigens. In recent years, advances have been made both in the development of first-generation vectors (that employ the ‘full virus’) and second-generation (‘deconstructed virus’) vectors (Gleba Y et al., 2007. Curr Opin Biotechnol. 2007 18(2):134-41). The system of the present invention can be used to provide an additional level of control of the expression of a desired protein encoded by the viral vector. The encoded protein can be the desired end-product protein or a transcription or translation factor that will activate the transcription and translation of various desired proteins.
Example 5: Control of Flowering Using the Expression System of the Invention
[0232] The initiation of flowering is a critical stage in a plant life cycle and is controlled by both environmental cues and endogenous pathways. Environmental cues include changes in temperature and daylight. Endogenous pathways function independently of environmental signals and are related to the developmental state of the plant, and thus are sometimes referred to as “autonomous” to indicate the lack of environmental influence. To prevent or delay flowering we targeted, for the first time, three pathways, by controlling the expression of (1) FLC (SEQ ID NO:38)—flowering inhibitor (autonomous pathway); (2) DELLA GI dominant negative mutation (SEQ ID NO:39) repressing flowering (hormonal pathway); and (3) CO constant protein—a key protein in the photoperiod pathway. The first two genes were constantly expressed while the expression of CO constant protein is inhibited by the expression of dsRNA (having SEQ ID NO:40) targeted to this gene. The modulated expression delays/prevents flowering by constitutive expression of flowering inhibitors genes (FLC, GI DELLA dominant negative) and inhibition of CO constant protein by constitutive expression of siRNA targeted to the encoding gene. Flowering is induced by repressing the tetracycline (TET) operator located upstream to the promoter of these transgenic genes in an inducer-depended manner controlled by the “expression control element.” Two options examined as described hereinbelow and in
[0233] 1. The first system includes the “expression control element” embedded in the TET repressor sequence. In the absence of inducer, the TET repressor does not express and therefore the flowering inhibition genes, controlled by TET operator, are expressed continuously, resulting in no flowering/delayed flowering time. Once the inducer is supplemented/added, the TET repressor gene is expressed and inhibits the TET operator, reducing the expression of the flowering inhibiting genes; resulting in flowering induction.
[0234] 2. The second system includes the “expression control element” embedded in GAL4pv16 sequence (a transcription factor that activates genes downstream to UAS promoter sequence). UAS promoter sequence located upstream to the TET repressor sequence. The aim of using GAL4PV16 expression system is to increase the expression level of the repressor under inducer supplementation condition. At the absent of inducer, GAL4PV16 does not express and TET repressor, controlled by the UAS promoter, does not express. Therefore, the flowering inhibition genes (controlled by the TET operator) are continuously expressed and inhibit flowering. In the presence of inducer, the GAL4PV16 transcription factor is expressed and activates the UAS promoter, located upstream to the TET repressor gene, which results in TET repressor transcription and inhibition of the TET operator located upstream to the flowering inhibition genes, leading to flowering.
[0235] Five fragments (SEQ ID NOs:41-45) were synthesized and cloned into pPZP (T-DNA) plasmid by Gibson assembly. The constructs are described in Example 6 hereinbelow.
[0236] The plasmid is transferred into tobacco plants using Agrobacteria (as described hereinabove), and transgenic tobacco plants are generated. T1 plants are grown, and the level of the proteins FLC, DELLA G, and CO constants are examined in leaf samples. Assay plants are then exposed to the inducer or to water (by, for example, growing the plants in a medium containing the inducer/water or spaying the plants leaves with the inducer/water). The effect of the inducer on flowering is examined by comparing the level of FLC, DELLA G, and CO constants protein to the base level. The effect of the inducer is further examined phenotypically, i.e., the plants are left to grow until flowering occurs, and time of flower appearance is measured.
Example 6: Plasmid Generation
[0237] The fragments assembled by Gibson assembly to generate the four long fragments cloned into Ppzp-RCS2 plasmid by pIPSPI restriction enzyme digestion are as follows:
Plasmid A: Assembly of Sequences: 41+43+44
[0238] SEQ ID NO:41: pIPSPI site for cloning into Ppzp-RCS2 left+Gal4vp16+“expression control element”+35S T(terminator)+UAS (promoter)+nlsTETrep (repressor)+35S T
[0239] SEQ ID NO:43: Short homolog sequence to SEQ ID NO:41+nosP (promoter)+TET operator+siRNA CO+nos T (terminator)
[0240] SEQ ID NO:44: Short homolog sequence to SEQ ID NO:43+ost P (promoter)+FLC+ost T (terminator)+pIPSPI site for cloning in to Ppzp-RCS2 right
Plasmid B: Assembly of Sequences: 41+43+44+45
[0241] SEQ ID NO:41: pIPSPI site for cloning in to Ppzp-RCS2 left+Gal4vp16+“expression control element”+35S T(terminator)+UAS (promoter)+nlsTETrep (repressor)+35S T
[0242] SEQ ID NO:43: Short homolog sequence to SEQ ID NO:41+nosP (promoter)+TET operator+siRNA CO+nos T (terminator)
[0243] SEQ ID NO:44: Short homolog sequence to SEQ ID NO:43+ost P (promoter)+FLC+ost T (terminator)+pIPSPI site for cloning in to Ppzp-RCS2 right
[0244] SEQ ID NO:45: Short homologous sequence to SEQ ID NO:44+C1 Robisco P (promoter)+DELLA mutant+Robisco T (terminator)+pIPSPI site for cloning into Ppzp-RCS2 right
Plasmid C: Assembly of Sequences: 42+43+44
[0245] SEQ ID NO:42: pIPSPI site for cloning into Ppzp-RCS2 left+35S P (promoter)+TET repressor (with the “expression control element” embedded).
[0246] SEQ ID NO:43: Short homolog sequence to SEQ ID NO:41+nosP (promoter)+TET operator+siRNA CO+nos T (terminator)
[0247] SEQ ID NO:44: Short homolog sequence to SEQ ID NO:43+ost P (promoter)+FLC+ost T (terminator)+pIPSPI site for cloning in to Ppzp-RCS2 right
Plasmid D: Assembly of Sequences: 42+43+44+45
[0248] SEQ ID NO:42: pIPSPI site for cloning into Ppzp-RCS2 left+35S P (promoter)+TET repressor (with the “expression control element” embedded)
[0249] SEQ ID NO:43: Short homolog sequence to SEQ ID NO:42+nosP (promoter)+TET operator+siRNA CO+nos T (terminator)
[0250] SEQ ID NO:44: Short homolog sequence to SEQ ID NO:43+ost P (promoter)+FLC+ost T (terminator)+pIPSPI site for cloning into Ppzp-RCS2 right
[0251] SEQ ID NO:45: Short homologous sequence to SEQ ID NO:44+Cl Robisco P (promoter)+DELLA mutant+Robisco T (terminator)+pIPSPI site for cloning in to Ppzp-RCS2 right
[0252] Different mutations embedded to the “expression control element” and their effect on the control of genes expression and flowering apparent is examined
[0253] “Expression control element”=the regulatory element at the base of the invention describe herby.
Example 7: Use of the ECE Element for Controlling the Expression of Different Resistance Genes in Plants
DNA Constructs
[0254] A cassette is designed to serve as a template to control genes expression (SEQ ID NO:54). The cassette assembled into pPZP (T-DN) plasmid by Gibson assembly, nucleotide 2625 serving as the site for insertion of any gene desired to be regulated.
[0255] The cassette includes (SEQ ID NO:54):
[0256] pIPSPI site pPZP-RCS2 Right,
[0257] Gal4VP16(+SAT-PTC regulatory element)+35St
[0258] UAS promotor+the gene to be regulated (such as herbicide Gens)-35T
[0259] pIPSPI site pPZP-RCS2 Left
[0260] An example of the gene to be regulated is Enolpyruvylshikimate 3-phosphate synthase (EPSPS) enzyme, the target of the herbicide glyphosate.
[0261] The sequence of the herbicide tolerant enolpyruvylshikimate 3-phosphate synthase (EPSPS) enzyme (SEQ ID NO:49) can be synthesized and cloned into ECE-cassette using Gibson assembly (SEQ ID NO:56).
[0262] Transformed tobacco plants (Nicotiana benthamiana) are produced and grown as described hereinabove.
[0263] Tobacco plants are tested for glyphosate resistance. Tobacco leaf fragments from plants containing vector alone (PZP-T-DNA) or the PZP-T-DNA+ECE cassette+EPSPS gene are incubated on callus medium containing 0.5 mM glyphosate with or without PEI (final concentration was about 0.0284-0.046gr per ml). After 10 days, callus growth is examined. Callus growth of leaf fragments of control tobacco and tobacco transfected with the ECE-EPSPS gene, grown on a callus medium containing 0.5 mM glyphosate are expected to be inhibited. Leaf fragments from plants transfected with the ECE-EPSPS gene grown on a callus medium containing 0.5 mM glyphosate with PEI are expected to show glyphosate resistance.
[0264] In addition tobacco plants transfected with PZP-T-DNA plasmid with the ECE+the resistance mutant 4-Hydroxyphenylpyruvate dioxygenase gene (SEQ ID NO:52) to form an expression cassette (SEQ ID NO:55) are expected to show resistance to mesotrione herbicides only when grown in a medium with PEI. Plants are visually selected on the basis of a color difference between the transformed plants when subjected to the said herbicide. When grown in MS medium the plant may become and stay white when subjected to the selection procedure, whereas the transformed plants may become white but later turn green, or may remain green when grown in MS+PEI medium.
Example 8: Use of the ECE Element to Manipulate Genome Editing Level
[0265] In one example, the ECE regulatory element of the present invention can be used to determine the expression level of the CRISPR-CAS9 complex (Gene Bank Accession
[0266] No. KF264451) allowing timely editing of the genome. The viral (P×330) CRISPER CAS system can be acquired from “addgene” (plasmid #117919). The ECE regulatory element is synthesized with the sequence of the BseRI restriction site to produce an expression system of the invention having SEQ ID NO:51, and then to be inserted into the 117919 plasmid (SEQ ID NO:57). The ECE sequence is located within the artificial hybrid intron, known to increase transcription levels.
[0267] Plasmid was transfected in to F293 cells by Lipofectamine 3000 (L3000015 ThermoFisher) according to the manufacturer instructions Immediately following transfection cells were incubated with either DMEM or DMEM supplemented with BENZ for 48 hours.
[0268] The sgRNA is designed to target the cyclin Dl gene (Accession BC023620) at the Bpu 101 restriction site (sgRNA=agtatttgcataaccctgag, SEQ ID NO:60). The efficiency of the CRISPER assay is determined by extracting the DNA, digesting it with BpulOI and measuring, by bioanalyser, the ratio between the cut and uncut fragments, uncut indicates an efficient CAS activity.
[0269] An increase in CAS activity in cells transfected with the designed ECE-CAS9 plasmid is expected only when the cells are grown in a DMEM medium supplemented with 10 μM BENZ, as indicated by an increase of the uncut fragments.
[0270] In additional example, The ECE regulatory element is introduced to gene by CRISPER CAS to determine the targeted gene expression level.
[0271] The ECE regulatory element is synthesized with 200nt flacking sequences, homolog to the CCRS receptor sequence (Accession No. AH005786), within CCRS intron, forming SEQ ID NO:61
[0272] In addition, the sequence of the Pm1I restriction site is included. ECE element and the CRISPR/Cas plasmid (addgene” plasmid #117919) are cut with Pm1I and ligated together. Plasmid is transfected in to PBMC cells using standard protocol (lipofectamine) and selected for ECE insertion using NGS analyses. Cells are incubated in CTSTM OpTmizerTM (ThermoFisher A3705001) with or without 50 μM spermin. Cells are then stained with CCR5 antibody (BioLegend 359105) and passed through flow cytometry column to detect the level of CCR5 expression. CCR5 expression is expected to increase in ECE included cells incubated with 50 μMspermin, indicating increase in CRISPER CAS efficiency.
Example 9: Use of the ECE Element for Controlling the Expression of Genes Conferring Insect-Resistance
[0273] The ECE regulatory element can be used to regulate the expression of genes that encode proteins conferring insecticidal resistance. For example, the Bt (Bacillus thuringiensis bacterium) gene that naturally produces crystal-like proteins (Cry proteins), selectively eliminate the harmful moth European corn borer. The Bt gene (Accession No. HM107006) is synthesize with the ECE regulatory element embedded within artificial intron (SEQ ID NO:58) and cloned into the pSB1 plasmid adjacent to the stop codon of the Bt gene, using Gibson assembly (SEQ ID NO:59). Maize cells are transfected as described before to yield transgenic corn plants (U.S. Pat. No. 5,384,253A). The plants are sprayed twice (24 h apart) either with Triton 0.1% or Triton 0.1%+PEI and the expression of Cry protein is measured using Western blot analysis using anti Cry antibody (sigma SAB1401086).
[0274] The survival rate of the European corn borer is examined by feeding the moth with corn leaves from plants engineered to include the ECE regulatory element sprayed with Triton 0.1% or Triton 0.1%+PEI. The corn life time is measured.
Example 10: Controlling Lignin Content in Poplar
[0275] Lignin polymers are composed of monolignols. Monolignols synthesis occurs in the phenylpropanoid and monolignol biosynthetic pathways. Cinnamoyl-CoA reductase (CCR) is key to monolignol biosynthesis. Down regulation of CCR in poplar has been shown to lead to significant reduction in lignin content in young and mature trees (Boerian W et al., Plant Cell. 2007 November; 19(11): 3669-3691). Yet, while lower lignin connect is desired in mature trees, it may hinder tree development and resistance to insects and diseases during early stages of development and growth.
[0276] Populus trichocarpa cv. Trichobel CCR cDNA (Accession No. AJ224986) is cloned in to pTA vector using standard PCR reaction. ECE assembled by Gibson in to the middle CCR gene by introducing artificial intron. The resulted sequence is cloned under a tandem repeat of the CaMV 35S constitutive promoter and is transferred into the binary vector pBIG-HYG conferring resistance to hygromycin. Binary vector is transferred into Agrobacterium strain LB4404.
[0277] Poplar (Populus tremula×Populus alba) plants are transformed by Agrobacterium as described (Leplé et al. 1992, Plant Cell Rep. 11:137-141.) Transformants are selected by hygromycin resistance. Transformation is confirmed by molecular analysis of the insertions.
[0278] Four-to-five-month old greenhouse-grown trees are sprayed daily with 100 μM BENZ during a period of 6 months. Control, untreated trees and control non-transformed trees are grown without the application of BENZ. At the end of the growth period, all trees are transferred to fresh pots and continue to grow for another 12 months without the application of BENZ.
[0279] RT-PCR analysis of CCR is performed at different stages of the growth and development of the trees. Samples of xylem are collected from branches and twigs of selected trees. Total RNA is extracted from tree tissues and RT reactions is performed using the SuperScript II kit (Invitrogen). Quantification of cDNA molecules is performed in five replicates by qPCR machine.
[0280] Lignin content is analyzed in samples from different stages of the growth and development of the trees according to Dence, 1992 (Lignin determination. In: Dence C, Lin S, editors. Methods in Lignin Chemistry. Berlin: Springer-Verlag; 1992. pp. 33-61). Lignin is extracted in a thioacidolysis reagent (a mixture of BF.sub.3 etherate (Sigma); ethane thiol EtSH (Sigma); and dioxane). Thioacidolysis is performed at 100° C. for 4 hours. The cool mixture is then diluted with water and pH is adjusted to 4.0 with NaHCO.sub.3. Lignin is then extracted with CH.sub.2Cl.sub.2, dried over Na.sub.2SO.sub.4, evaporated under reduced pressure at 40° C., re-dissolved in 1 mL of CH.sub.2Cl.sub.2 and analyzed by GC-MS
[0281] The levels of lignin in transgenic trees which are BENZ-treated are expected to be comparable to wild type plants during early stages of growth and development. Lignin levels in transgenic trees, upon completion of BENZ treatment cycle, are expected to be comparable to transgenic plants, and lower than wild type plants.
Example 11: Altering Amylose Content in Rice seeds
[0282] High levels of the starch branching IIb gene in rice (SBEIIb, GQ150904.1) are typically linked to lower amylose content. Downregulating the activity of SBEIIb can lead to rice seeds with higher amylose content. The SBEIIb coding sequence is cloned from Nipponbare cDNA into pTA vector using the standard PCR reaction. The resulted clone is manipulated to carry the ECE regulatory element. The resulted altered fragment is closed into rice-transformation vector containing the wHMWG promoter and NOS terminator. The vector also contains the hygromycin resistance gene under the control of the CaMV 35S promoter. The vector is transferred into Agrobacterium tumefaciens AGL1.
[0283] Nipponbare genetic transformation is carried using hygromycin for selection using a standard transformation protocol (e.g. Upadhyaya et al. Australian Journal of Plant Physiology. 2000; 27:201-210). Transgenic plants are kept in pots and grown to maturity and allowed to set seeds. 1-2 days after flowers emerge, selected transgenic lines are treated with various concentrations of BENZ by spraying rice flowers during anthesis.
[0284] RNA is extracted from rice grains, 10 days post anthesis. cDNA is synthesized from 5 μg of total RNA using cDNA syntheses kit. Quantitative real-time PCR is conducted on 100 ng of cDNA using the SBEIIb primers. The expression of SBEIIb in transgenic plants is expected to increase under BENZ treatment.
[0285] Protein analysis is conducted on soluble native proteins extracted from rice grains obtained 10 days post anthesis. Proteins are separated on non-denaturation gel and subjected to Western blot analysis using anti-wheat SBEIIb rabbit polyclonal antibodies and goat anti-rabbit immunoglobulins conjugated to HRP. Signals are recorded by automatic film processor. An increase in SBEIIb in transgenic plants activated by BENZ is expected.
[0286] Mature panicles are analyzed for their starch content. Fully developed and mature seeds are collected, weighed, dried and ground and total starch is determined using Total Starch HK Assay (Megazyme) and resistant starch is determined using Resistant Starch Assay Kit (Megazyme). The starch content in BENZ-induced transgenic plants is expected to be higher than in non-induced plants.
Example 12: Conditional Expression of Selection Genes
[0287] Expression of selection genes is required only during early stages of plant transformation. Following the establishment of a transgenic plant, expression of the selection gene is not required. The hpt gene, conferring resistance to hygromycin, is generated by standard PCR reaction on the pBIGHYG plasmid (binary plasmid) and cloned into pTA vector. The ECE regulatory element is inserted into the hpt gene just after the its ATG start codon by standard Gibson assembly. In addition, the reporting gene GUS: β-glucuronidase is cloned into the pTA vector downstream to the hpt gene under the 35S promoter.
[0288] The vector is transferred into Agrobacterium tumefaciens EHAP105.
[0289] Tobacco genetic transformation is carried using hygromycin as for selection using a standard transformation protocol. 20 μM BENZ is added to the regeneration and selection medium to facilitate the expression of the selection gene. Established transgenic plants are analyzed for GUS expression and selected lines with superior GUS expression are allowed to set seeds. Seeds of heterozygous plants with single insert are selected. Seeds from selected lines cultured on MS-based media supplemented with hygromycin and 10 uM BENZ are expected to develop and survive, while seedlings cultures on medium supplemented with hygromycin alone are expected to fail to develop properly due to inhibition of the hygromycin resistance gene by the ECE element.
[0290] Ten days following planting plants transformed to either MS-based media or remained on MS+ 20 uM BENZ media. Seven day after, RNA is extracted from transgenic plants. cDNA is synthesized from 20 μg of total RNA using cDNA syntheses kit. Quantitative real-time PCR is conducted on 100 ng of cDNA using the hygromycin-encoding gene primers. The expression of hygromycin-encoding gene reduced in the transgenic seedlings when grown on MS media compared to seedling that grow on MS+ 20 uM BENZ.
[0291] Transgene stability and expression of GUS gene is conducted by GUS expression as described above.
[0292] The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without undue experimentation and without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. The means, materials, and steps for carrying out various disclosed functions may take a variety of alternative forms without departing from the invention.