ANTISENSE OLIGONUCLEOIDES OF GLUTATHIONE S-TRANSFERASES FOR CANCER TREATMENT
20220073931 · 2022-03-10
Inventors
Cpc classification
G01N33/57492
PHYSICS
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present invention relates to the identification of glutathione S transferase in tumors containing the same to be treated to inhibit protein expression of GSTs proteins and induce cell death and decrease tumor volume.
Claims
1. Antisense oligonucleotides to inhibit the expression of glutathione S transferase proteins, for the manufacture of a drug adapted for the treatment of cancer, to be administrable in mammals previously diagnosed with cancer.
2. The antisense oligonucleotides according to claim 1, wherein the glutathione S transferases are GSTM3 and GSTP1.
3. The antisense oligonucleotides according to claim 1, wherein GSTM3 and GSTP1 are used as therapeutic targets and/or prognostic factors.
4. The antisense oligonucleotides according to claim 1, wherein said oligonucleotides include 15-50 nucleotides in length and bases 1-773 of GSTP1 and bases 1-4144 of GSTM3, with a similarity of 100-50% of both sequences.
5. The antisense oligonucleotides according to claim 4, wherein said oligonucleotides are 18-30 nucleotides in length.
6. The antisense oligonucleotides according to claim 4, wherein said oligonucleotides are 20-25 nucleotides in length.
7. The antisense oligonucleotides according to claims 4, 5 and 6, wherein the bases for GSTP1 are close to the start codon and for GSTM3 close to the start codon.
8. The antisense oligonucleotides according to claims 4, 5 and 6, wherein the similarity of both sequences is 100-80%.
9. The antisense oligonucleotides according to claims 4, 5 and 6, wherein the similarity of both sequences is 100-90%.
10. The antisense oligonucleotides according to claim 1, wherein the oligonucleotide is one having sugar modified bases, column or skeleton modifications, nucleobase modifications and general modifications in natural oligonucleotides.
11. The antisense oligonucleotides according to claim 1, wherein the oligonucleotides are selected from the following: ##STR00008## ##STR00009## ##STR00010## and/or have a chemical modification or a combination of the chemical modifications mentioned above.
12. The antisense oligonucleotides according to claim 11, wherein the preferred oligonucleotides have the following sequences: TABLE-US-00009 anti-GSTM3 5′-TAG ACG ACT CGC ACG ACA TGG TGA C-3′; anti-GSTP1 5′-AAT AGA CCA CGG TGT AGG GCG GCA T-3′;
13. The antisense oligonucleotides according to claim 1, wherein said oligonucleotides are directed to the messenger ribonucleic acids (mRNA) of the GSTM3 and GSTP1.
14. Antisense oligonucleotides according to any one of the preceding claims, wherein at least one or more oligonucleotides combined, are used to specifically block one protein or both proteins.
15. The antisense oligonucleotides according to claim 1, wherein the cancer is any wherein the tumor tissue contains one or both GSTM3 and GSTP1 proteins.
16. The antisense oligonucleotides according to claim 1, wherein the cancer is selected for lung cancer, breast cancer, colorectal cancer, prostate cancer, stomach cancer, liver cancer, esophageal cancer, cervical cancer, thyroid cancer, bladder cancer, non-Hodgkin lymphoma, pancreatic cancer, leukemia, kidney cancer, uterine body cancer, oropharyngeal cancer, brain and central nervous system cancer, ovarian cancer, melanoma cancer, gallbladder cancer, laryngeal cancer, multiple myeloma cancer, nasopharyngeal cancer, laryngopharyngeal cancer, Hodgkin lymphoma, testicular cancer, salivary gland cancer, vulvar cancer, Kaposi sarcoma cancer, penile cancer, mesothelioma, and vaginal cancer.
17. A kit for use in the identification of a subject to be treated with the oligonucleotides of claim 1, comprising at least one antisense oligonucleotide of glutathione S transferases, a protein extraction solution, at least two antibodies to the identification of proteins and optionally a secondary antibody, and a colorimetric developing solution for immunodetection assays such as: western staining, lateral flow membranes, ELISA or immunohistochemistry.
18. The kit according to claim 17, wherein the proteins to be identified are the GSTM3 and GSTP1 proteins.
19. A method for the identification of GSTs in vitro in samples of patients previously diagnosed with cancer comprising: a) extracting the protein from the tumor tissue, b) carrying out an analysis by immunodetection techniques and c) inhibiting the expression of the protein by use of the antisense oligonucleotide of claim 1.
20. A method for the treatment of cancer comprising a) the identification of GSTs in vitro in samples of patients previously diagnosed with cancer, b) the extraction of the protein from the tumor tissue, c) carrying out an analysis by immunodetection techniques and d) administering an antisense oligonucleotide directed to the messenger ribonucleic acids (mRNA) of the GSTM3 and GSTP1.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
DETAILED DESCRIPTION OF THE INVENTION
[0042] As indicated above, the word cancer is a generic term that designates a broad group of diseases that can affect any part of the body, such as lung cancer, breast cancer, colorectal cancer, prostate cancer, stomach cancer, liver cancer, esophageal cancer, cervical cancer, thyroid cancer, bladder cancer, non-Hodgkin lymphoma, pancreatic cancer, leukemia, kidney cancer, uterine body cancer, oropharyngeal cancer, brain and central nervous system cancer, ovarian cancer, melanoma cancer, gallbladder cancer, larynx cancer, multiple myeloma cancer, nasopharyngeal cancer, laryngopharyngeal cancer, Hodgkin lymphoma, testicular cancer, salivary gland cancer, vulvar cancer, Kaposi sarcoma, penile cancer, mesothelioma, and vaginal cancer, among others, so it should be understood that a person skilled in the art will appreciate that the invention described below is susceptible to variations and modifications different from those specifically described and therefore, the present invention includes all such variations and modifications as well as all the stages, features, compositions and compounds referred to or indicated therein, whether in individual or collective and any of all combinations or any of two or more of the stages or features.
[0043] Furthermore, it should also be understood that the present invention is not limited in scope to the specific embodiments described therein, which are proposed for exemplification purposes only. Functionally equivalent products, compositions, combinations and methods as well as their application in mammals are clearly within the scope of the invention, as described.
[0044] Tumor progression (hereinafter also referred to as PT) involves changes in the deregulation of metabolic and cellular processes. The study of tumor proteome dynamics represents the protein changes of this deregulation mechanism during PT. Therefore, the study of proteome dynamics for example in cervical cancer (hereinafter also referred to as CC) will provide relevant information to understand PT and the disease to be treated.
[0045] Protein overexpression of the glutathione S transferase GSTM3 and GSTP1 genotypes during tumor progression (PT) plays a regulatory role through interaction with proteins, for example TRAF2/6 and therefore an evasion of transduction of signals of apoptosis activation, favoring cell survival and PT. In addition, GST expression is involved in the modulation of detoxification processes in cancer cells and, therefore, participates in the survival response to conventional chemotherapy in patients with CC and other types of cancer.
[0046] The present invention relates to antisense oligonucleotides of glutathione S transferase (GSTs) such as GSTM3 and GSTP1, as novel candidates for use as therapeutic targets and/or prognostic factors for patients (mammals) who have been diagnosed with CC and other types of cancer.
[0047] The identification of candidate subjects for the treatment of cancers and their treatment is carried out by identifying the protein expression of glutathione S transferase proteins (GSTs). Treatment includes the use of antisense oligonucleotides targeting the messenger ribonucleic acids (mRNA) of the GSTM3 and GSTP1, which give tumor cells greater resistance to chemotherapies.
[0048] The antisense oligonucleotide (OAS) is preferably any antisense oligonucleotide, which reduces the expression levels of the GSTMs and thus increases the sensitivity of the cell, tissue and/or organ to the chemotherapeutic agent in vitro, ex vivo, or in vivo.
[0049] In a first embodiment, the antisense oligonucleotide is an oligonucleotide composed of subunits called “nucleotides”, wherein each nucleotide is made up of three parts: a sugar or a functional analogue thereof, a nitrogen base and a functional group that serves as an internucleotide bond (usually a phosphate group) between the subunits that make up the oligonucleotide. Each of these components may contain the following modifications:
##STR00001##
[0050] wherein
[0051] X means a sugar, ribose in the case of RNA or deoxyribose in the case of DNA or the functional analog thereof in the nucleotide.
[0052] B means the nitrogenous base bound to sugar or a functional analogue thereof, and R means the functional group in carbon 2′ of sugar when it is ribose.
[0053] In a second embodiment, modifications to ribose sugar, without being limiting, are:
[0054] Modifications in the 2′ position of ribose sugar that include the replacement of the OH group by different groups among which are (2′-O-methyl (2′OMe), 2′-O-methoxyethyl (2′-OMOE), 2′fluor (2′-F) and 2′-chiral fluor (2′-F))
##STR00002##
[0055] wherein base refers to the nitrogenous base of the nucleotide.
[0056] In a third embodiment, modifications in ribose include the use of an analogue of bicyclic ribose, wherein the ribose structure contains an additional ring, for example, ribose with 2′-O, 4′-C-methylene (LNA-blocked nucleic acid), 2′-O, 4′-C-oxymethylene, 2′-O, 4′-C-methylene-β-D-ribofuranosil rings, among others.
[0057] Additionally, the substitution of ribose sugar can be carried out by analogous functional groups with similar function, for example, the substitution of the ribose by another sugar such as arabinose, morpholino, or by ribose analogs with a spirocyclic ring in different positions of the sugar ring, without being such limiting examples.
[0058] The following are examples of some of the different modifications to the sugary part of the oligonucleotide.
##STR00003##
[0059] In a fourth embodiment, modifications to the nucleobases or nitrogenous bases include, but are not limited to, adenine, cytosine, guanine, thymine, as well as their modifications 5-methylcytosine, 2-aminopurine, 2-amino-6-chloropurine, 2-diaminopurine, hypoxatin, 5-propynyl uracil, 2-thio thymine, N3-thioethyl thymine, 3-deaza adenine, 8-azido adenine and 7-deaza guanine, or the use of universal bases such as 3-nitropyrrole, imidazole-4-carboxamide, 5-nitroindole.
[0060] The following are examples of some structures of different types of modified nucleobases and nucleobase analogs.
##STR00004##
[0061] In a fifth embodiment, the modifications in the column or skeleton of the internucleoside groups, which bind them, can be but are not limited to:
##STR00005##
[0062] 5′-N-carbamate, methylene-methylimine, amide, phosphorodithioate, thioether, thioformacetal and mercaptoacetamide. The substitution of the phosphodiester or phosphorothioate group can be carried out by phosphorodiamidate groups with piperazine and morpholino residues (PMOs).
[0063] For a person skilled in the art of the present invention it will be obvious that, within the scope, the chimeras resulting from the mixture of 2 or more chemical modifications mentioned above are also included, for example without being limiting, the replacement of the ribose by a morpholino ring and replacement of the phosphodiester group with phosphorodiamidate groups without charge (PMOs), the replacement of ribose and the phosphodiester bond is replaced by pseudopeptide N-(2 aminoethyl) glycine and the nucleobase is linked to the oligonucleotide column through of an ethyl enecarbonyl bond (PNA), a chimera where the ribose contains an alkyl substituent at the 2′ position and the phosphodiester bond is replaced by a phosphotiester bond, a chimera wherein the ribose is replaced by a ribose analogue with 2′-O,4′-C-methylene (LNA) rings and the phosphodiester bond is substituted by a phosphotiester bond, among others.
[0064] Examples of chimeras resulting from the combination of the different components of a nucleotide are by way of example:
##STR00006## ##STR00007##
DESCRIPTION OF THE PREFERRED EMBODIMENT
Tumor Progression Model
[0065] In order to create a suitable model to study tumor progression (PT), cervical cancer cell lines (SiHa and HeLa), triple negative breast (MDA-231-MB) and colon (COLO 205) were used to generate grafted tumors in mice. Cancer cells were cultured at 70% confluence and 10.sup.7 cells were inoculated into female mice of the Nu/Nu strain for 4 to 6 weeks. The tumor volume was measured according to the equation of the volume of an ellipsoid described as: Vtm=η/6 (L*W*H), where L: length, W: width and H: height, and were taken in seven different moments of PT, for example, a kinetics of HeLa and SiHa tumors was taken at 5, 10, 15, 20, 30, 45 and 50 days after inoculation. The first four measurement times showed a low progression of tumor growth. However, at the endpoints of kinetics, tumor volume grew exponentially for HeLa cell tumors. From day 30 to 45 the average tumor volume doubled and by day 50 the average volume was 3 times more than the previous measurement. For SiHa cells, tumor growth rates were lower than HeLa; from 30 to 45 days, SiHa tumors grew 1.6 times more, while, in the last five days, tumors grew on average 1.6 times larger (see
[0066] Analysis of 2D-PAGE Gels and Protein Identification.
[0067] Tumors of the two types of cancer cells (HeLa and SiHa) were collected and total proteins were extracted for analysis by means of two-dimensional electrophoresis gels (2D-PAGE). The analysis of the 2D-PAGE images of each repetition for each time studied and for each type of cell was carried out using the PDQuest software. An average of 866 electrophoretic entities (spots or “stains”) were detected for samples of HeLa tumors at each repetition. For SiHa tumors, the average of spots or “stains” detected in 2D-PAGE images was 766. The correlation coefficient between repetitions for each tumor time and cell type was determined from the 2D-PAGE maps.
[0068] Table 1 below shows that the correlation coefficient in all tumors was greater than 0.7 in both types of cells. The proteomic profile was obtained each time and then compared to find differentiated proteins during PT.
TABLE-US-00001 TABLE 1 HeLa SiHa Time (days) Stains/CCf* Stains/CCf* 30 824/0.710 765/0.731 45 763/0.723 768/0.836 50 1012/0.724 766/0.756 *CCf = correlation coefficient.
[0069] In addition, 601 points were detected in HeLa tumors in the three times of PT, while in SiHa tumors the number of common points was 716 (see
[0070] Table 2 below shows that 46 different proteins were identified from HeLa tumors, including 34 with constant expression through PT, 7 proteins showed a negative regulation along PT, 3 proteins increased their abundance during tumor growth, and 2 were found with an oscillating pattern.
TABLE-US-00002 TABLE 2 Total proteins expressed in HeLa tumors (days 30, 45 and 50) HeLa ID Swissprot * MASCOT Score** Constant ENOA_HUMAN 92 ANXA1_HUMAN 134 ANXA3_HUMAN 148 ANXA5_HUMAN 65 ATPB_HUMAN 126 BGH3_HUMAN 135 CH60_HUMAN 74 CLIC1_HUMAN 80 CP21A_HUMAN 67 DHE3_HUMAN 150 EF2_HUMAN 178 EIF3I_HUMAN 81 FSCN1_HUMAN 126 GDIB_HUMAN 83 GRDN_HUMAN 73 GRP78_HUMAN 189 GSTO1_HUMAN 89 HSP71A_HUMAN 78 HSPB1_HUMAN 136 K1C17_HUMAN 102 K2C8_HUMAN 98 PDIA3_HUMAN 165 PGAM1_HUMAN 73 PHB_HUMAN 136 PKHA2_HUMAN 66 PRDX2_HUMAN 75 PRDX4_HUMAN 107 PSA1_HUMAN 73 PSA5_HUMAN 81 PSB4_HUMAN 85 RAN_HUMAN 73 RUVB1_HUMAN 85 TCPZ_HUMAN 109 TPIS_HUMAN 102 Downregulated ACTS_HUMAN 172 ANXA2_HUMAN 68 DDX3X_HUMAN 104 IF4A1_HUMAN 134 TPM3_HUMAN 65 TPM4_HUMAN 106 VIME_HUMAN 171 Overexpressed G3P_HUMAN 79 GSTM3_HUMAN 81 LDHB_HUMAN 106 Oscillation HSP7C_HUMAN 134 TPM2_HUMAN 71 * Swiss-Prot database. **MASCOT Score database
[0071] Table 3 below shows that a total of 44 proteins were identified from the SiHa cells. The identified proteins were distributed according to their expression pattern, 20 were found without differences in the three tumor ages evaluated, 8 decreased their abundance during PT, while 16 showed an increasing pattern. When analyzing all the proteins identified in tumors of both types of cells (Hela and SiHa), it was found that 34 proteins were shared between the two types of tumors, including 14 that show the same pattern of expression.
TABLE-US-00003 TABLE 3 Total proteins expressed in SiHa tumors (days 30, 45 and 50) SiHa ID Swissprot MASCOT Score Constant ACTS_HUMAN 122 ACTG_HUMAN 107 ANXA1_HUMAN 132 ANXA5_HUMAN 102 BGH3_HUMAN 83 CH60_HUMAN 122 DHE3_HUMAN 80 EF2_HUMAN 184 FSCN1_HUMAN 108 HNRH3_HUMAN 153 HSP71_HUMAN 183 HSP7C_HUMAN 134 K1C17_HUMAN 192 LDHB_HUMAN 111 PCNA_HUMAN 114 PDIA3_HUMAN 135 PHB_HUMAN 131 PRDX4_HUMAN 80 PSB4_HUMAN 75 PSA1_HUMAN 90 downregulated ATPB_HUMAN 174 DDX3X_HUMAN 134 GRP75_HUMAN 75 K1C17_HUMAN 176 RUVB1_HUMAN 137 TPM4_HUMAN 106 TCPZ_HUMAN 158 VIME_HUMAN 147 Overexpressed ACTB_HUMAN 101 ANXA3_HUMAN 168 CLIC1_HUMAN 83 EIF3I_HUMAN 99 ENOA_HUMAN 81 ENOA_HUMAN* 114 GSTP1_HUMAN 74 GRP78_HUMAN 154 HSPB1_HUMAN 108 K1C17_HUMAN 154 K2C8_HUMAN 172 PGAM1_HUMAN 135 PRDX2_HUMAN 121 PSA5_HUMAN 96 RAN_HUMAN 113 TPIS_HUMAN 81 *Swiss-Prot database. **MASCOT Score database
[0072] Among the proteins with levels of overexpression, two family members were identified Glutathione S-transferase (GSTM3 and GSTP1). GSTM3 was identified in HeLa tumors and GSTP1 in SiHa tumors (see
[0073] Bioinformatic Analysis
[0074] Subsequently, the proteins identified in both tumors were used to perform a functional enrichment analysis based on the biological processes of gene ontologies (Gene Ontology: GO.
[0075] The proteins were grouped according to their expression levels and subjected to an enrichment analysis. The results indicated that proteins that increase their levels during PT are mainly involved in anti-apoptotic, cell division, glycolysis, angiogenesis, viral reproduction and regulation of apoptotic processes (see Checa-Rojas A., et al. GSTM3 and GSTP1: novel players driving tumor progression in cervical cancer, Oncotarget. 2018; 9: 21696-21714). In addition, including all identified proteins, the results suggest that during PT the overrepresented pathways are related to the cellular response to stress, the MAPK6/MAPK4 and NIK/NF-kappaB signaling pathways.
[0076] On the other hand, data mining analysis revealed that GSTM3 and GSTP1 interact with the proteins of factors associated with the tumor necrosis factor receptor (TRAF). However, said analysis can be extended to other proteins. Specifically, the interaction of GSTP1 with TRAF2 previously validated in HeLa cells (Wu, Y., Fan, Y., Xue, B., Luo, L., Shen, J., Zhang, S., . . . Yin, 2. (2006). Human glutathione S-transferase P1-1 interacts with TRAF2 and regulates TRAF2—ASK1 signals. Oncogene, 25, 5787-5800), and GSTM3 was reported as an interactor of TRAF6 (tumor necrosis factor receptor associated with factor 6) (Rouillard, A D, Gundersen, G W, Fernandez, N F, Wang, Z., Monteiro, C D, McDermott, M G, & Ma'ayan, A. (2016). The harmonizome: a collection of processed datasets gathered to serve and mine knowledge about genes and proteins. Database, 2016, baw100.) (see
[0077] To demonstrate that this interaction occurs under physiological conditions, TRAF6 expression was observed in both CC tumors (see
[0078] Modulation of MAPK Signaling During PT
[0079] Given the importance of TRAF proteins on the downstream activation of the mitogen-activated protein kinase (MAPK) cascade, the phosphorylated version of NF-κB p65 (ser529), ERK, JNK and p38 by Western spotted (blot) of the PT proteins. The results showed that the phosphorylation of p38 and JNK was reduced over time in both CC tumors, but not in pNF-κB and pERK (see
[0080] Endogenous Secreted TLR4 Receptor Activators in the CC
[0081] On the other hand, it is known that the activation of the TLR4 pathway is driven by the presence of lipopolysaccharides (LPS) from bacterial infections, but also by endogenous activators such as HSP60 and HSP70 thermal shock proteins. To demonstrate that CC cell lines can express endogenous activators of the Toll type receptor 4 (TLR4), an in vitro analysis of the secreted proteins was performed using the HeLa and SiHa cell lines (see
[0082] Secreted proteins were analyzed by LC-MS/MS and a total of 432 HeLa and 447 SiHa proteins were identified, of which 264 were common between both cell lines (see
[0083] Proteomic mass spectrometry data has been deposited in ProteomeXchange Consortium via the deposit of its associated PRoteomics IDEntifications (PRIDE) with the data set identifier PXD005466.
TABLE-US-00004 TABLE 4 Proteins secreted in HeLa cells Matching ID Name Mass Score peptides P62258 14-3-3 epsilon protein 29155 321 8 P61981 14-3-3 gamma protein 28285 149 3 P63104 14-3-3 zeta/delta protein 27728 337 3 Q9NQ66 1-phosphatidylinositol-4,5- 0 51 4 bisphosphate phosphodiesterase beta-1 Q4KWH8 1-phosphatidylinositol-4,5- 0 40 4 bisphosphate phosphodiesterase eta-1 O75038 1-phosphatidylinositol-4,5- 0 37 4 bisphosphate phosphodiesterase eta-2 P62081 40S ribosomal protein S7 22113 125 3 P08865 40S Ribosomal Protein SA 32833 38 2 P32754 4-hydroxyphenylpyruvate 44906 181 6 dioxygenase P10809 60 KDa thermal shock protein, 61016 409 10 mitochondrial P05388 60S P0 ribosomal acidic 34252 118 3 protein P62899 60S ribosomal protein L31 14454 54 2 Q02878 60S ribosomal protein L6 32708 59 2 P52209 6-phosphogluconate 53106 245 2 dehydrogenase, decarboxylation P11021 Glucose-regulated 78 kDa 72288 751 1 protein Q8IZT6 Microcephaly-associated 409540 52 6 protein similar to an abnormal spindle Q9BWD1 Acetyl-CoA 41324 77 1 acetyltransferase, cytosolic P68032 Actin, alpha 1 heart muscle 41992 480 2 P68133 Actin, alpha skeletal muscle 42024 480 2 P62736 Actin, aortic smooth muscle 41982 93 2 P60709 Actin, cytoplasmic 1 41710 640 1 P63261 Actin, cytoplasmic 2 41766 640 1 P25054 Adenomatous polyposis coli 311455 47 6 protein O00468 Agrina 214706 43 7 Q2M3C7 SPHKAP A-kinase anchor 186339 33 4 protein P12814 alpha-actinin-1 102993 579 13 P35609 alpha-actinin-2 103788 34 2 O43707 alpha-actinin-4 104788 1436 6 P06733 alpha-enolase 47139 1172 6 Q96L96 alpha-protein kinase 3 201148 39 5 Q8TCU4 Alstrom 1 syndrome protein 0 47 7 Q01484 Anquirin-2 429990 35 5 Q12955 Anquirin-3 480113 36 6 P04083 Annex A1 38690 49 1 P07355 Annex A2 38580 471 10 P08758 Annex A5 35914 251 5 P46013 KI-67 antigen 358474 57 5 O00203 AP-3 beta-1 subunit complex 0 34 3 P04114 Apolipoprotein B-100 515283 64 5 O43150 Arf-GAP with SH3 domain, ANK 0 36 2 repeat and protein 2 containing the PH domain P00966 Argininosuccinate synthase 46501 277 9 P17174 Aspartate aminotransferase, 46219 388 8 cytoplasmic Q7Z591 Transcription factor 155044 36 3 containing AT connection Q5T9A4 3B protein containing AAA 0 46 4 domain of the ATPase family Q96QE3 Protein 5 containing the AAA 0 38 4 domain of the ATPase family Q9BZC7 Member 2 of subfamily A of 269701 36 6 the cassette linking ATP Q8IZY2 Member 7 of subfamily A of 234201 37 3 the cassette linking ATP P53396 ATP-citrate synthase 120762 585 7 98160 Heparan basement membrane 468532 43 4 proteoglycan sulfate core protein Q562R1 Protein 2 similar to beta- 0 256 1 actin P25098 1 beta-adrenergic kinase 0 34 3 receptor P13929 Beta-enolase 46902 216 2 Q96T60 polynucleotide 0 32 4 phosphatase/bifunctional kinase Q8NFC6 Biorientation of chromosomes 0 42 6 in protein 1 of cell-similar division O14514 Brain specific angiogenesis 0 40 4 inhibitor 1 O60241 Brain specific angiogenesis 0 33 3 inhibitor 2 O60242 Guanine nucleotide exchange 201909 32 4 protein 2 inhibited Brefeldin A O60243 Brevican core protein 99056 43 2 O60244 Protein 1 containing WD and 0 64 4 Bromodomain repetition O60245 Carbamoyl phosphate synthase 164835 133 3 [ammonia], mitochondrial O60246 Cathepsin D 44524 220 6 O60247 Cathepsin Z 33846 167 4 O60248 ABL1 and CDK5 enzyme substrate 0 41 1 O60249 Protein 2 associated with CDK5 0 35 3 regulation subunit O60250 Centlein 161504 47 3 O60251 F centromer protein 367537 54 6 O60252 Protein E associated with 0 54 5 centromer O60253 Protein 350 associated with 350716 45 5 centrosome O60254 Chlorine intracellular channel 26906 128 2 protein 1 O60255 O-Acetyltransferase coline 82483 33 4 O60256 CLIP association protein 1 0 66 4 O60257 Clusterin 52461 205 3 O60258 Cofilin-1 18491 195 3 O60259 Protein 17 containing double 0 37 2 helix domain O60260 Protein 78 containing double 0 42 3 helix domain O60261 Protein 87 that contains 0 44 4 double helix domain O60262 Protein 93 containing double 0 39 4 helix domain O60263 Alpha-1 (III) collagen chain 138479 33 4 O60264 Alpha-1 (VII) collagen chain 295041 57 7 O60265 Alpha-1 (XII) collagen chain 332941 1361 31 O60266 Alpha-1 (XIV) collagen chain 0 47 1 O60267 Collagen alpha-1 (XXVII) chain 0 45 7 O60268 Alpha-2 (XI) collagen chain 171670 61 10 O60269 Alpha-3 (VI) collagen chain 0 37 2 O60270 Cortactin Binding Protein 2 0 60 3 O60271 Protein 1 containing domain 388621 40 3 CUB and Sushi O60272 Cubilin 398480 47 5 O60273 Dissociated protein 1 from 136289 174 1 NEDD8 associated with Cullin O60274 Cystatin-C 15789 54 1 O60275 Heavy chain 1 of dynein 1 532072 54 6 cytoplasmic O60276 Protein Cytokinesis Dedicator 0 50 3 6 O60277 Dermcidin 11277 66 1 O60278 Desmoplakin 331569 49 4 O60279 Dihydrolipoyl dehydrogenase, 54143 177 6 mitochondrial O60280 Homologous B of protein 2 0 32 3 that interacts with Disco O60281 DNA polymerase theta 197474 35 4 O60282 Catalytic subunit of DNA 0 43 5 polymerase zeta O60283 DNA-dependent protein kinase 468788 65 9 catalytic subunit O60284 Member 13 of DnaJ homolog 0 49 4 subfamily O60285 Coupling protein 6 0 36 2 O60286 Heavy chain 10 of dieine, 514512 46 6 axonemal O60287 11 dyneine heavy chain, 520711 55 6 axonemal O60288 2 dyneine heavy chain, 0 35 4 axonemal O60289 Heavy chain 3 of dynein, 470468 46 5 axonemal 060290 5 dyneine heavy chain, 528684 47 5 axonemal O60291 6 dyneine heavy chain, 475679 35 7 axonemal O60292 8 dyneine heavy chain, 514335 84 5 axonemal O60293 Protein 1 containing dyneine 0 42 5 heavy chain domain O60294 Distonin 0 50 4 O60295 Distroglycan 97381 74 1 O60296 Dystrophin 0 34 3 O60297 P400 protein that binds E1A 343276 35 7 O60298 E3 SUMO-protein ligase RanBP2 357974 68 5 O60299 E3 ubiquitin-protein ligase 526895 55 5 HERC2 O60300 E3 ubiquitin-protein ligase 0 46 4 HUWE1 O60301 E3 ubiquitin-protein ligase 0 52 2 UBR4 O60302 Protein similar to 6 0 37 4 associated with Echinoderm microtubule O60303 Elongation factor-alpha 1 50109 285 4 O60304 Gamma elongation factor 1 50087 185 1 O60305 Elongation phantom 2 95277 498 4 O60306 Eukaryotic initiation 46125 58 1 spectrum 4A-I O60307 Eukaryotic initiation factor 46373 58 1 4A-II O60308 ERF-3B subunit linking 0 32 1 eukaryotic peptide chain GTP factor O60309 Exophilin-5 0 40 6 O60310 FRAS1 extracellular matrix 442646 36 6 protein O60311 Ezrin 69370 804 6 O60312 Anemia of Fanconi group I 149229 40 4 protein O60313 Farnesyl pyrophosphate 48245 256 2 synthase O60314 Fascin 54496 253 7 O60315 Fatty acid synthase 273254 853 23 O60316 Protein 1 containing type III 0 43 7 fibronectin domain O60317 Protein 2 that interacts with 780119 44 6 fibrous sheath O60318 Filagrine 434922 45 10 O60319 Filamine-B 277990 90 5 O60320 Fructose bisphosphate 39395 813 18 aldolase A O60321 Fructose Bisphosphate 39431 190 4 Aldolase C O60322 Galectin-1 14706 44 1 O60323 Protein that binds galectin-3 65289 628 17 O60324 Gamma-enolase 47239 221 2 O60325 Girdin 0 37 3 O60326 Glial fibrillary acidic 49850 81 2 protein O60327 Glucokinase 0 36 3 O60328 Glucose-6-phosphate isomerase 63107 892 6 O60329 Glutamate receptor 3A subunit 125385 48 4 [NMDA] O60330 Glutathione S-transferase 27548 76 2 omega-1 O60331 Glyceraldehyde-3-phosphate 36030 572 2 dehydrogenase O60332 Alpha chain glycoprotein 13066 47 2 hormones O60333 98 G-protein coupled receptor 0 37 4 O60334 GTP-binding nuclear Ran 24408 179 4 protein O60335 Subunit of beta-2 protein 35055 32 2 similar to 1 nucleotide binding of Guanine O60336 70 kDa 1A/1B protein from 70009 639 2 thermal shock O60337 Protein 1 of 70 kDa of 70331 345 1 similar thermal shock O60338 Protein 6 of 70 kDa of 70984 253 2 thermal shock O60339 71 kDa protein with thermal 70854 661 1 shock O60340 Beta-1 thermal shock protein 22768 79 4 O60341 HSP 90-alpha thermal shock 84607 874 12 protein O60342 HSP 90-beta thermal shock 83212 1010 10 protein O60343 Hemicentin-1 613001 42 6 O60344 Hemicentin-2 542265 47 5 O60345 Hemoglobin alpha subunit 15248 56 2 O60346 Beta subunit of hemoglobin 15988 38 1 O60347 Hepatoma-derived growth 26772 63 2 factor O60348 heterogenic nuclear 0 46 1 ribonucleoprotein A0 O60349 heterologous nuclear A1 38723 113 1 ribonucleoprotein O60350 ribonucleoprotein A1-similar 34204 94 1 to 2 nuclear heterogeneous O60351 heterogeneous nuclear 39571 57 1 ribonucleoprotein A3 O60352 heterogeneous nuclear D0 38410 114 3 ribonucleoprotein O60353 heterogeneous nuclear A2/B1 37407 217 3 ribonucleoproteins O60354 Histone H2A type 1 14083 134 1 O60355 Histone H2A type 1-B/E 14127 134 1 O60356 Histone H2A type 1-C 14097 134 1 O60357 Histone H2A type 1-D 14099 134 1 O60358 Histone H2A type 1-H 13898 134 1 O60359 Histone H2A type 1-J 13928 134 1 O60360 Histone H2A type 2-A 14087 134 1 O60361 Histone H2A type 2-B 13987 58 1 O60362 Histone H2A type 2-C 13980 134 1 O60363 Histone H2A type 3 14113 134 1 O60364 Histone H2A.J 14011 134 1 O60365 Histone H2A.x 15135 58 1 O60366 Histone H2B type 1-H 13884 100 4 O60367 Histone H2B type 2-F 13912 100 4 O60368 Histone H3.1 15394 158 6 O60369 Histone H3.1t 15499 155 6 O60370 Histone H3.2 15379 158 6 O60371 Histone H3.3 15318 160 6 O60372 Histone H3.3C 15204 44 1 O60373 Histone H4 11360 178 7 O60374 Histone-lysine n- 593017 49 6 methyltransferase MLL2 O60375 Histone-lysine N- 0 42 6 methyltransferase MLL3 O60376 Histone-lysine N- 0 39 4 methyltransferase SETD1A O60377 Histone-lysine N- 0 42 5 methyltransferase, H3 lysine- 36 and H4 lysine-20 specific O60378 Cutting protein-similar to 1 0 38 3 homeosequence O60379 Protein homolog that induces 0 60 4 hydrocephalus O60380 Protein that binds IgGFc 571639 40 3 O60381 Above that degrades insulin 0 36 3 O60382 Integrin alpha-10 0 32 4 O60383 Factor 3 linking interleukin 95279 48 3 enhancer O60384 Intraflagelar transport 0 43 4 protein 81 counterpart O60385 Keratin, type I cuticular Ha5 0 34 2 O60386 Keratin, type I cytoskeletal 58792 962 11 10 O60387 Keratin, type I cytoskeletal 53478 75 2 12 O60388 Keratin, type I cytoskeletal 49557 91 3 13 O60389 Keratin, type I cytoskeletal 51529 252 4 14 O60390 Keratin, type I cytoskeletal 49181 114 3 15 O60391 Keratin, type I cytoskeletal 51236 184 4 16 O60392 Keratin, type I cytoskeletal 48076 123 4 17 O60393 Keratin, type I cytoskeletal 48029 103 3 18 O60394 Keratin, type I cytoskeletal 44079 70 2 19 O60395 Keratin, type I cytoskeletal 49287 73 3 25 O60396 Keratin, type I cytoskeletal 49792 68 3 27 O60397 Keratin, type I cytoskeletal 50536 149 4 28 O60398 Keratin, type I cytoskeletal 62027 1295 12 9 O60399 Keratin, type II cuticular 64801 85 3 Hb4 O60400 Keratin, type II cytoskeletal 65999 1475 16 1 O60401 Keratin, type II cytoskeletal 61864 217 3 1b O60402 Keratin, type II epidermal 65393 1547 13 cytoskeletal 2 O60403 Keratin, type II oral 65800 185 4 cytoskeletal 2 O60404 Keratin, type II cytoskeletal 64378 177 3 3 O60405 Keratin, type II cytoskeletal 57250 195 4 4 O60406 Keratin, type II cytoskeletal 62340 352 6 5 O60407 Keratin, type II cytoskeletal 60008 300 5 6A O60408 Keratin, type II cytoskeletal 60030 330 4 6B O60409 Keratin, type II cytoskeletal 51354 124 3 7 O60410 Keratin, type II cytoskeletal 57256 101 4 71 O60411 Keratin, type II cytoskeletal 55842 97 3 72 O60412 Keratin, type II cytoskeletal 58887 157 4 73 O60413 Keratin, type II cytoskeletal 57830 118 4 74 O60414 Keratin, type II cytoskeletal 59524 140 3 75 O60415 Keratin, type II cytoskeletal 0 42 3 78 O60416 Keratin, type II cytoskeletal 57800 181 4 79 O60417 Keratin, type II cytoskeletal 53671 131 4 8 O60418 Keratin, type II cytoskeletal 50494 78 2 80 O60419 Close relationship of IRRE- 0 46 3 similar to protein 2 O60420 Kinesin-like protein KIF17 0 34 2 O60421 Kinesin-like protein KIF18B 0 35 4 O60422 Kinesin-like protein KIF20B 0 58 2 O60423 Kinesin-like protein KIF26A 194468 47 2 O60424 Laminin alpha-1 subunit 336867 34 5 O60425 Laminin alpha-5 subunit 0 32 5 O60426 Laminin gamma-1 subunit 177489 35 2 O60427 Lethal malignant brain tumor 0 38 4 (3)-similar to protein 3 O60428 Protein kinase 2 0 48 3 serine/threonine rich in leucine repetition O60429 16A protein containing 151462 44 5 leucine-rich repeats O60430 Receptive lipopolysaccharide 0 34 5 and anchor protein similar to beige O60431 L-lactate dehydrogenase A 36665 534 4 chain O60432 L-lactate dehydrogenase A- 36484 55 2 similar to 6A O60433 L-lactate dehydrogenase A- 41916 120 4 similar to 6B O60434 L-lactate dehydrogenase B 36615 552 3 chain O60435 1B protein related to low 515159 45 7 density lipoprotein receptor O60436 Protein 4 related to low 0 38 5 density lipoprotein receptor O60437 Protein 6 related to low 180314 39 3 density lipoprotein receptor O60438 Lysine specific demethylase 175545 37 3 5B O60439 Lysine specific histone 92039 37 5 demethylase 1B O60440 Malate dehydrogenase, 36403 351 5 cytoplasmic O60441 Malate dehydrogenase, 35481 113 3 mitochondrial O60442 Protein associated with gene 0 47 6 MAX O60443 Metalloproteinase Inhibitor 1 23156 90 2 O60444 Methylcytosine dioxygenase 0 49 4 TET1 O60445 Factor 1 reticulating 669721 50 7 microtubule, isoform 4 O60446 Microtubule-actin 0 44 5 crosslinking factor 1, 1/2/3/5 isoforms O60447 Microtubule-associated 143049 49 5 serine/threonine protein kinase 3 O60448 Suppressor tumor candidate 2 0 53 5 associated with microtubule O60449 Midasin 0 62 10 O60450 Moesin 67778 719 6 O60451 Mucin-16 0 59 5 O60452 Mucin-19 597790 37 4 O60453 Multiple epidermal growth 161072 38 5 factor-similar to protein 6 domains O60454 Protein 2 associated with 29394 36 3 multiple myeloma tumor O60455 Miosin-14 227863 38 2 O60456 Miosin-3 223766 39 4 O60457 Miosin-7B 221251 41 6 O60458 Miosin-XV 395044 41 6 O60459 Nck associated protein 5 208409 41 6 O60460 Nebulin 0 44 5 O60461 Nesprin-1 1010398 39 8 O60462 Neurobeachin-similar to 0 39 4 protein 2 O60463 AHNAK protein associated with 628699 76 9 neuroblast differentiation O60464 Neurofibromin 0 37 4 O60465 Notch protein 3 counterpart 0 37 4 of neurogenic site O60466 Neuron browser 1 0 43 4 O60467 Pentraxin-1 neuronal 47093 240 10 O60468 Protein 1 of nuclear mitotic 238115 81 6 apparatus O60469 Nucleoside diphosphate kinase 17138 348 9 A O60470 Nucleoside diphosphate kinase 17287 284 7 B O60471 BPTF subunit factor 338054 36 5 remodeling nucleosome O60472 Obg-similar to ATPase 1 44715 118 1 O60473 Obscurin 867940 45 6 O60474 Defective partition 6 gamma 0 33 3 homologue O60475 Peptidyl-prolyl cis-trans 18001 285 3 isomerase A O60476 Peptidyl-prolyl cis-trans 51772 278 7 isomerase FKBP4 O60477 Pericentrin 0 39 6 O60478 Peroxidasin Homolog 0 34 4 O60479 Peroxiredoxin-1 22096 317 2 O60480 Peroxiredoxin-2 21878 378 8 O60481 Peroxiredoxin-4 30521 205 5 O60482 Peroxiredoxin-6 25019 237 5 O60483 Protein 1 that binds 21044 252 4 phosphatidylethanolamine O60484 Beta subunit containing 0 40 3 phosphatidylinositol-4- phosphate 3-kinase C2 domain O60485 Phosphoglucomutase-1 61411 240 6 O60486 Phosphoglycerate kinase 1 44586 668 1 O60487 Phosphoglycerate mutase 1 28786 135 5 O60488 Phosphoserine 40397 128 3 aminotransferase O60489 Member 2 of family G containing 147877 39 4 Pleckstrin homology domain O60490 Plectin 531466 93 5 O60491 Plexin-A1 210933 44 4 O60492 1-similar protein to 1 of 0 55 4 polycystic kidney disease O60493 Polycystin-1 0 53 5 O60494 Polyubiquitin-B 25746 158 3 O60495 Polyubiquitin-C 76982 148 3 O60496 Family member E of domain 121286 444 4 POTE anchirine O60497 Prelamin-A/C 74095 123 2 O60498 Likely ATP DDX41-dependent 0 35 3 RNA helicase O60499 Likely ATP-dependent DDX60- 0 35 2 similar RNA helicase O60500 Likely ubiquitin-similar E3 0 37 3 HERC1 ligase protein O60501 Likely MYCBP2 protein ligase 509759 60 5 from E3 ubiquitin O60502 Likely terminal hydrolase 0 33 4 FAF-Y of terminal ubiquitin carboxyl O60503 Profilin-1 15045 179 4 O60504 Protein 1 related to density 504276 46 9 tested lipoprotein receptor O60505 Proprotein convertase 74239 340 5 subtilisin/kexin type 9 O60506 Proteasome subunit alpha 29537 188 7 type-1 O60507 Proteasome subunit alpha 25882 178 6 type-2 O60508 Proteasome subunit alpha 28415 196 5 type-3 O60509 Proteasome subunit alpha 27382 303 8 type-6 O60510 Proteasome subunit alpha 27870 464 9 type-7 O60511 Proteasome beta subunit type- 26472 125 3 1 O60512 Proteasome subunit beta type- 22933 150 5 3 O60513 Proteasome beta subunit type- 29185 93 3 4 O60514 Proteasome subunit beta type- 28462 355 7 5 O60515 Proteasome subunit beta type- 25341 155 3 6 O60516 AHNAK2 protein 0 38 5 O60517 Arginine N-methyltransferase 0 59 1 3 protein O60518 Bassoon protein 416214 46 3 O60519 Daple protein 228091 37 5 O60520 Disulfide isomerase protein 57081 98 5 O60521 Disulfide-isomerase A3 56747 635 13 protein O60522 A6 disulfide isomerase protein 48091 172 3 O60523 FAM179A protein 111084 33 3 O60524 Protein counterpart “bassoon” 0 34 6 O60525 Irregular protein-2 133277 42 2 O60526 “Flutin” protein 566309 44 4 O60527 Shroom2 protein 176302 34 6 O60528 Shroom3 protein 216724 45 1 O60529 Companion protein-1 0 34 3 O60530 SZT2 protein 0 38 6 O60531 TANC1 protein 0 46 5 O60532 Protein-arginine deiminase 74618 42 1 type-1 O60533 Protocadherina Fat 1 0 33 6 O60534 Protocadherina Fat 3 505209 35 4 O60535 Purine nucleoside 32097 127 4 phosphorylase O60536 Putative beta-actin-like 41989 230 5 protein 3 O60537 Putative elongation factor 1- 50153 285 4 alpha-similar to 3 O60538 HSP 90-beta 2 protein from 44321 237 3 putative thermal shock O60539 Putative heterogeneous 34202 113 1 nuclear A1 ribonucleoprotein- similar to 3 O60540 ASXL3 protein from the 241767 37 4 putative Polycomb group O60541 Putative tubulin similar to 27534 39 2 alpha-4B protein O60542 Isozymes M1/M2 pyruvate 57900 661 1 kinase isozymes M1/M2 O60543 Rab GDP alpha dissociation 50550 44 2 inhibitor O60544 Rab GDP dissociation beta inhibitor 50631 549 3 O60545 Radixin 68521 524 3 O60546 Ras-related Rab-28 protein 0 37 1 O60547 Tyrosine-protein phosphatase 224161 35 3 beta receptor-type O60548 Regulation of protein 1 of 188956 38 6 synaptic exocytosis O60549 Retinitis pigmentosa 1- 0 43 3 similar to protein 1 O60550 Protein 23 that activates Rho 0 37 6 GTPase O60551 Factor 2 homolog of Ribosome 35560 41 4 production O60552 Ribosome binding protein 1 0 47 6 O60553 Rootletin 228388 49 7 O60554 Ryanodine receptor 2 564206 52 7 O60555 Sacsin 0 48 7 O60556 Splicing factor 1 rich in 27728 47 2 serine/arginine O60557 Serine/threonine-protein 143903 34 3 kinase 36 O60558 Serine/threonine-protein 0 35 4 kinase ATR O60559 Serine/threonine-protein 0 44 5 kinase SMG1 O60560 Serine/threonine-protein 0 50 4 kinase WNK2 O60561 Serpin B6 42594 160 4 O60562 Serpin H1 46411 145 5 O60563 Serum albumin 69321 267 4 O60564 SH3 and multiple protein 0 43 3 domain 2 repeat ankyrins O60565 SH3 and multiple protein 3 0 44 6 domain repeat ankyrins O60566 Signal transducer and 0 46 3 transcription activator 2 O60567 Spectrin alpha chain, brain 284364 343 4 O60568 Spectrin beta chain, brain 3 0 125 3 O60569 Spectrin beta chain, brain 4 0 39 5 O60570 Spliceosoma RNA helicase BAT1 48960 51 2 O60571 Stabilin-1 275300 36 5 O60572 Protein 1 containing - domain- 0 55 2 like - Sushi, nidogen and EGF. O60573 Protein 1 containing Sushi, 0 39 5 von Willebrand factor type A, EGF and pentraxin domain O60574 Protein targeting Xklp2 0 33 2 O60575 Component 1 of telomerase 290307 36 4 protein O60576 Tenascin-X 0 36 6 O60577 Tensin-1 185586 69 2 O60578 Thioredoxin 11730 187 1 O60579 Thioredoxin reductase 1, 70711 392 10 cytoplasmic O60580 Titin 3813810 124 24 O60581 Toll-similar to receptor 10 0 40 2 O60582 C10orf93 protein containing 0 34 4 TPR repeat O60583 Transcription factor TFIIIB 293705 35 7 component B “homologous O60584 Transferrin receptor protein 1 84818 896 4 O60585 Protein associated with 437318 52 7 domain transformation/transcription O60586 Protein 2 containing acidic 309237 36 6 double helix transformation O60587 ATPase transitional 89266 338 1 endoplasmic reticulum O60588 Transketolase 67835 965 5 O60589 Treacle protein 0 42 5 O60590 Triosephosphate isomerase 26653 703 16 O60591 Triple functional domain 0 51 4 protein O60592 Alpha-1B tubulin chain 50120 715 15 O60593 Alpha-1C tubulin chain 49863 715 15 O60594 Alpha-4A tubulin chain 49892 39 2 O60595 Alpha-8 tubulin chain 50062 39 2 O60596 Beta tubulin chain 49639 442 9 O60597 Beta-3 tubulin chain 50400 245 5 O60598 Beta-8 tubulin chain 49744 102 3 O60599 Ribosomal ubiquitin-40S S27a 17953 167 3 protein O60600 L40 protein from ribosomal 14719 167 3 ubiquitin-60S O60601 Uncharacterized C4orf37 50628 32 3 protein O60602 KIAA0802 protein without 0 50 6 characterization O60603 KIAA1109 protein without 0 59 6 characterization O60604 KIAA1614 protein without 0 40 6 characterization O60605 UPF0556 C19orf10 protein 18783 218 7 O60606 Urotensin-2 0 34 1 O60607 Utrophin 394220 38 4 O60608 13D protein associated with 491535 44 4 vacuolar protein O60609 Vinculin 123722 358 9 O60610 Von Willebrand factor 309058 38 5 O60611 Protein 3 containing WD 0 38 5 repeat and FYVE domain O60612 Protein 35 containing WD 0 36 2 repeating O60613 KIAA1875 protein containing 180192 38 4 WD repeat O60614 Protein 2 containing Xin 0 36 5 Actin binding repeater O60615 Protein 13 containing CCCH 0 44 6 zinc finger domain O60616 Zinc finger protein 142 187758 34 3 O60617 Zinc finger 469 protein 409949 44 5
TABLE-US-00005 TABLE 5 Proteins secreted in SiHa cells. Matching ID Name Mass Score peptides P31946 14-3-3 beta/alpha protein 28307 78 3 P62258 14-3-3 epsilon protein 29486 287 5 P27348 14-3-3 theta protein 28128 75 3 P63104 14-3-3 zeta/delta protein 28011 142 4 Q9NQ66 1-phosphatidylinositol-4,5- 0 44 3 bisphosphate phosphodiesterase beta-1 Q4KWH8 1-phosphatictylinositol-4,5- 0 39 2 bisphosphate phosphodiesterase eta-1 P43686 26B Protease Regulatory 6B 47644 96 3 Subunit P62269 S18 40S ribosomal protein 17740 73 3 P62847 S24 40S ribosomal protein 15509 61 1 P62081 S7 40S ribosomal protein 22145 119 4 P08865 SA 40S ribosomal protein 0 37 4 P32754 4-hydroxyphenylpyruvate 45256 313 7 dioxygenase P10809 60 kDa thermal shock 61478 288 8 protein, mitochondrial P05388 P0 60S acidic ribosomal 34567 229 5 protein P62913 L11 60S ribosomal protein 20516 114 2 P30050 L12 60S ribosomal protein 18011 51 1 P83731 L24 60S ribosomal protein 17930 46 1 P52209 6-phosphogluconate 53852 257 4 dehydrogenase, decarboxylation P11021 78 kDa regulated glucose 72580 410 9 protein Q8TE58 A disintegrine and 106076 37 1 metalloproteinase with thrombospondin motifs 15 Q8IZT6 Associated protein-similar 414501 44 6 to abnormal microcephaly- spindle Q9BWD1 Acetyl-CoA 42030 70 2 acetyltransferase, cytosolic P68032 Actin, heart muscle 1 alpha 42596 280 12 P68133 Actin, alpha skeletal muscle 42644 280 12 P62736 Actin, aortic smooth muscle 42644 108 2 P60709 Actin, cytoplasmic 1 42330 721 19 P63261 Actin, cytoplasmic 2 42386 721 19 P53999 Transcriptional p15 co- 14466 41 1 activator of activated RNA polymerase P23526 Adenosylhomocysteinase 48521 188 5 P00568 Adenylate kinase isoenzyme 1 21815 69 2 Q01518 Protein 1 associated with 52493 62 2 adenylyl cyclase P84077 ADP ribosylation factor 1 20838 48 2 P61204 ADP-ribosylation factor 3 20742 48 2 P84085 ADP-ribosylation factor 5 20727 48 1 P12814 alpha-actinin-1 104005 340 12 O43707 alpha-actinin-4 105636 483 15 P06733 alpha-enolase 47631 885 10 Q8TCU4 Alstrom syndrome protein 1 463685 50 5 Q9BXX3 Protein 30A containing 161035 43 5 Ankyrin repeat domain Q53LP3 Protein 57 containing repeat 56003 36 3 domain of Ankyrin Q12955 Ankyrin-3 483809 43 6 P07355 Annex A2 38952 330 6 P08758 Annex A5 36099 145 3 P46013 KI-67 antigen 361481 62 5 P04114 Apolipoprotein B-100 517939 64 6 O43150 Arf-GAP with SH3 domain, 0 40 3 protein 2 containing PH domain and ANK repeat P00966 Argininosuccinate synthase 46935 310 10 P54136 Arginyl-tRNA synthetase, cytoplasmic 76415 33 3 P15848 Arilsulfatase B 0 36 2 P17174 Aspartate aminotransferase, 46543 111 4 cytoplasmic Q7Z591 Transcription factor 156176 56 4 containing AT hitch Q5T9A4 3B protein containing AAA 0 41 5 domain of the ATPase family Q96QE3 Protein 5 containing AAA 209929 35 3 domain of the ATPase family Q86UQ4 Member 13 of cassette 582507 46 4 subfamily A linking ATP Q8IZY2 Member 7 of cassette 236929 40 3 subfamily A linking ATP P53396 ATP-citrate synthase 122234 657 3 Q03989 5A protein containing 0 39 2 interactive domain rich in AT P98160 Base heparan sulfate 479940 37 3 proteoglycan basement membrane specific protein Q5H9F3 Co-repressor BCL-6-similar 0 33 4 to protein 1 Q13884 Beta-1-Sintrophin 0 35 3 Q562R1 Beta-actin-like protein 2 42596 156 4 P13929 Beta-enolase 47394 192 3 Q8NFC6 Biorientation of chromosomes 0 35 4 in protein 1 of cell-similar division O60241 Brain specific angiogenesis 0 52 7 inhibitor 2 Q9NYQ6 Receiver 1 type G seven 335176 71 5 steps of EGF LAG chain Q9NYQ7 Receiver 3 type G seven 363521 32 4 steps of EGF LAG chain Q9H251 Caderin-23 0 39 6 Q8N3K9 Protein 5 associated with 451703 43 4 cardiomyopathy Q8WXD9 Caskin-1 0 33 4 Q9UBR2 Cathepsin Z 34610 136 3 Q14004 Protein kinase 13 cell 0 38 3 division Q9HC77 Centromer J protein 0 34 4 Q02224 Centromere associated 0 36 3 protein E Q5VT06 350 protein associated with 0 37 4 centrosome O00299 Chloride intracellular 27280 136 3 channel protein 1 Q12873 Chromodomain-helicase-DNA 0 37 6 binding protein 3 Q00610 1 heavy clatrin chain 193946 143 10 Q7Z460 CLIP association protein 1 0 35 4 P10909 Clusterin 53287 115 2 Q9UBF2 Coatomer subunit gamma-2 0 32 4 P23528 Cofilin-1 18783 245 4 Q02388 Alpha-1 collagen chain (VII) 296298 46 4 Q99715 Alpha-1 collagen chain (XII) 334878 493 26 P39060 Alpha-1 collagen chain 0 42 5 (XVIII) P08123 Alpha-2 collagen chain (I) 129917 34 4 P13942 Alpha-2 collagen chain (XI) 0 60 4 P12111 Alpha-3 collagen chain (VI) 345759 42 6 Q8WZ74 Cortosterin Binding Protein 183844 37 3 P12277 Creatine kinase type B 43083 39 2 Q86VP6 Dissociated protein 1 from 138525 51 2 NEDD8 associated with cullin P01034 Cystatin-C 16081 128 2 Q14204 Heavy chain 1 of 536760 48 6 cytoplasmic dinneine 1 Q96HP0 Protein Cytokinesis 0 40 4 Dedicator 6 O43598 Deoxyribonucleoside 5′-N- 19259 65 1 glycosidase monophosphate O14531 Protein 4 related to 0 41 4 dihydropyrimidinase Q14689 Protein 2 homologue A 172887 41 5 that interacts with Disco O60673 DNA polymerase zeta 0 32 3 catalytic subunit Q02880 Topoisomerase 2-beta DNA 184682 33 3 P27695 (apurinic or apirimidinic 35979 50 2 site) DNA lyase O14802 RPC1 subunit of RNA polymerase 0 36 2 III directed at DNA O75165 Member 13 of DnaJ homolog 0 35 3 subfamily Q6PKX4 Coupling protein 6 0 42 5 Q8IVF4 10 dyneine heavy chain, 0 48 4 axonemal Q96DT5 11 dyneine heavy chain, 0 38 7 axonemal Q9UFH2 Heavy chain 17 of dynein, 517327 42 5 axonemal Q9P225 2 dyneine heavy chain, 0 37 6 axonemal Q8TD57 Heavy chain 3 dynein, 476111 48 5 axonemal Q8TE73 5 dyneine heavy chain, 0 42 5 axonemal Q96M86 Protein 1 containing 540950 44 4 dinein heavy chain domain Q03001 Dystonia 867875 62 10 Q7Z6Z7 E3 ubiquitin-protein 0 51 4 ligase HUWE1 Q6ZT12 E3 ubiquitin-protein 0 33 2 ligase UBR3 Q8IUD2 CAST family member 0 37 3 1/interacting with ELKS/Rab6 P68104 Elongation factor-alpha 1 50649 450 1 Q05639 Elongation factor-alpha 2 50962 173 1 P29692 1-delta elongation factor 31281 88 3 1 P26641 Gamma elongation factor 1 50525 201 1 P13639 Elongation Phantom 2 96711 350 5 O15083 ERC protein 2 0 44 4 P60842 Eukaryotic initiation 46628 152 6 factor 4A-I P63241 Eukaryotic translation 17145 89 1 initiation factor 5A-I Q86XX4 FRAS1 extracellular 454911 48 7 matrix protein P15311 Ezrin 69726 450 13 P14324 Farnesyl pyrophosphate 48886 72 2 synthase Q16658 Fascin 55198 348 7 P49327 Fatty acid synthase 276610 500 21 A0AVI2 Fer-1-similar to protein 0 36 3 5 Q4ZHG4 Protein 1 containing 206145 40 5 fibronectin type III domain O75369 Filamin-B 280749 41 4 Q68DA7 Formin-1 159015 46 5 Q5SZK8 FRAS1-related 0 33 5 extracellular matrix protein 2 P04075 Fructose bisphosphate 39915 507 13 aldolase A P09972 Fructose Bisphosphate 39894 181 3 Aldolase C Q9UKJ3 Protein 8 containing 165218 39 4 patch domain G P09382 Galectin-1 15080 43 2 Q08380 Galectin-3 binding 66361 154 5 protein P09104 Gamma-enolase 47715 245 3 Q92820 Gamma-glutamyl hydrolase 36452 49 2 Q3V6T2 Girdin 0 49 2 P14136 Glial fibrillar acidic 50099 88 2 protein P11413 Glucose-6-phosphate 1- 59907 68 3 dehydrogenase P06744 Glucose-6-phosphate 63579 660 2 isomerase Q8TCU5 Glutamate receptor 3A 127005 32 6 subunit [NMDA] P78417 Glutathione S-transferase 27945 68 3 omega-1 P04406 Glyceraldehyde-3-phosphate 36361 619 3 dehydrogenase P62826 GTP-binding nuclear Ran 24643 227 6 protein Q8NDA8 Protein 7A containing HEAT 0 34 3 repeat P0DMV8/ 70 kDa 1A/1B protein from 70443 410 9 P0DMV9 thermal shock P34931 Protein 1 of 70 kDa thermal 70913 381 8 shock-similar P34932 Protein 4 of 70 kDa from 95525 76 3 thermal shock P17066 Protein 6 of 70 kDa from 71608 320 5 thermal shock P11142 71 kDa cognate thermal 71294 704 12 shock protein Q12931 75 kDa protein from thermal 80654 108 2 shock, mitochondrial P04792 Beta-1 thermal shock 22858 95 2 protein P07900 HSP 90-alpha thermal shock 85333 367 11 protein P08238 HSP 90-beta thermal shock 0 518 3 protein P54652 70 kDa protein related 70428 398 7 thermal shock Q96RW7 Hemicentin-1 624433 47 6 Q8NDA2 Hemicentin-2 550521 53 4 P09651 Heterogeneous nuclear 38933 117 3 ribonucleoprotein A1 Q32P51 Heterogeneous nuclear- 34471 117 3 similar A1 ribonucleoprotein 2 P61978 Heterogeneous nuclear 51426 117 3 ribonucleoprotein K P22626 Heterogeneous nuclear 37576 122 4 A2/B1 ribonucleoproteins Q9UQL6 Histone deacetylase 5 0 50 2 P0C0S8 Histone H2A type 1 14099 103 1 P04908 Histone H2A type 1-B/E 14143 103 1 Q93077 Histone H2A type 1-C 14113 103 1 P20671 Histone H2A type 1-D 14115 103 1 Q96KK5 Histone H2A type 1-H 13914 103 1 Q99878 Histone H2A type 1-J 13944 103 1 Q6FI13 Histone H2A type 2-A 14119 103 1 Q16777 Histone H2A type 2-C 14012 103 1 Q7L7L0 Histone H2A type 3 14129 103 1 Q9BTM1 Histone H2A.J 14027 103 1 Q71UI9 Histone H2A.V 13517 55 1 P0C0S5 Histone H2A.Z 13561 55 1 Q96A08 Histone H2B type 1-A 14207 41 2 P33778 Histone H2B type 1-B 13990 110 2 P62807 Histone H2B type 1- 13946 148 2 C/E/F/G/I P58876 Histone H2B type 1-D 13976 148 2 Q93079 Histone H2B type 1-H 13932 148 2 P06899 Histone H2B type 1-J 13944 110 2 O60814 Histone H2B type 1-K 13930 148 2 Q99880 Histone H2B type 1-L 13992 148 2 Q99879 Histone H2B type 1-M 14029 148 2 Q99877 Histone H2B type 1-N 13962 148 2 P23527 Histone H2B type 1-O 13946 110 2 Q16778 Histone H2B type 2-E 13960 110 2 Q5QNW6 Histone H2B type 2-F 13960 148 2 Q8N257 Histone H2B type 3-B 13948 156 2 P57053 Histone H2B type F-S 13984 148 2 P68431 Histone H3.1 15557 64 3 Q16695 Histone H3.1t 15677 64 3 Q71DI3 Histone H3.2 15484 64 3 P84243 Histone H3.3 15408 66 3 Q6NXT2 Histone H3.3C 15350 66 3 P62805 Histone H4 11392 155 4 O14686 Histone-lysine N- 601158 69 6 methyltransferase MLL2 Q96L73 Histone-lysine N- 0 33 5 methyltransferase, H3 lysine-36 and H4 lysine-20 specific Q4G0P3 Protein homolog that 582477 48 3 induces hydrocephalus P00492 Hypoxanthine-guanine 24904 49 1 phosphoribosyltransferase Q14974 Importin beta-1 subunit 98826 68 4 O00410 Importin-5 125730 34 2 Q14573 Inositol 1,4,5-trisphosphate 0 35 6 receptor type 3 P13645 Keratin, type I 59120 1084 11 cytoskeletal 10 Q99456 Keratin, type I 53832 101 3 cytoskeletal 12 P13646 Keratin, type I 50113 119 4 cytoskeletal 13 P02533 Keratin, type I 52117 113 3 cytoskeletal 14 P19012 Keratin, type I 49653 99 3 cytoskeletal 15 P08779 Keratin, type I 51754 261 3 cytoskeletal 16 Q04695 Keratin, type I 48521 83 3 cytoskeletal 17 P08727 Keratin, type I 44223 74 2 cytoskeletal 19 Q2M2I5 Keratin, type I 55751 58 3 cytoskeletal 24 Q7Z3Z0 Keratin, type I 49970 42 2 cytoskeletal 25 Q7Z3Y8 Keratin, type I 50515 65 3 cytoskeletal 27 Q7Z3Y7 Keratin, type I 51318 45 2 cytoskeletal 28 P35527 Keratin, type I 62435 1034 14 cytoskeletal 9 Q9NSB2 Keratin, type II cuticular 66102 71 2 Hb4 P04264 Keratin, type II 66301 1422 21 cytoskeletal 1 Q7Z794 Keratin, type II 62329 155 7 cytoskeletal 1b P35908 Keratin, type II epidermal 65795 941 14 cytoskeletal 2 Q01546 Keratin, type II oral 66588 109 3 cytoskeletal 2 P12035 Keratin, type II 64741 101 3 cytoskeletal 3 P19013 Keratin, type II 57816 177 3 cytoskeletal 4 P13647 Keratin, type II 62776 258 3 cytoskeletal 5 P02538 Keratin, type II 60421 348 6 cytoskeletal 6A P04259 Keratin, type II 60448 346 8 cytoskeletal 6B P48668 Keratin, type II 60401 341 8 cytoskeletal 6C P08729 Keratin, type II 51572 118 3 cytoskeletal 7 Q3SY84 Keratin, type II 0 89 3 cytoskeletal 71 Q14CN4 Keratin, type II 56640 72 3 cytoskeletal 72 Q86Y46 Keratin, type II 59611 151 5 cytoskeletal 73 Q7RTS7 Keratin, type II 0 83 3 cytoskeletal 74 O95678 Keratin, type II 59942 185 5 cytoskeletal 75 Q8N1N4 Keratin, type II 0 38 2 cytoskeletal 78 Q5XKE5 Keratin, type II 58229 97 4 cytoskeletal 79 P05787 Keratin, type II 53927 159 4 cytoskeletal 8 Q02241 Kinesin-like protein KIF23 0 32 3 Q9ULI4 Kinesin-like protein 0 47 5 KIF26A Q63ZY3 Protein 2 containing 0 42 2 repeat motif of KN motif and anchyrine Q03252 Lamin-B2 67985 33 2 P25391 Laminin alpha-1 subunit 0 35 5 P24043 Laminin alpha-2 subunit 353874 34 5 P48634 BAT2 protein rich in long 229564 48 4 proline Q96JM7 Lethal malign brain tumor 89921 37 3 (3) - similar to protein 3 Q5S007 Repeating serine rich in 290688 49 4 leucine/threonine-protein kinase 2 Q5VZK9 16A protein containing 153228 36 3 leucine-rich repetition Q9UIQ6 Leucyl-cystinyl 0 31 2 aminopeptidase Q8N3X6 Co-repressor of protein- 0 37 2 similar ligand-dependent nuclear receptor P00338 L-lactate dehydrogenase A 0 537 2 chain Q9BYZ2 L-lactate dehydrogenase A- 42508 147 2 similar to 6B P07195 L-lactate dehydrogenase B 37065 673 1 chain Q9NZR2 1B protein related to low 536259 34 4 density lipoprotein receptor O75096 Protein 4 related to low 217797 50 6 density lipoprotein receptor Q12912 Lymphoid restricted 0 35 2 membrane protein P10619 Lysosomal Protein 55145 41 1 P40925 Malate dehydrogenase, 36775 168 2 cytoplasmic Q8IWI9 Gene MAX associated 0 41 3 protein Q15648 RNA polymerase II 0 46 3 transcription subunit mediator 1 Q96JG8 Melanoma associated D4 81843 41 2 antigen Q13421 Mesothelin 69770 41 2 P01033 Metalloproteinase 23904 61 2 inhibitor Q96PK2 Factor 1 crosslinking 675712 58 9 microtubule-actin, isoform 4 Q9UPN3 Microtubule-actin 0 42 6 crosslinking factor 1, 1/2/3/5 isoforms P78559 Protein 1A associated with 0 35 4 microtubule P11137 Microtubule associated 0 37 4 protein 2 O60307 Serine associated with 144213 44 3 microtubule/threonine- protein kinase 3 Q5JR59 Candidate 2 tumor 151203 33 2 suppressor associated with microtubule Q9NU22 Midasin 640088 42 7 Q8N4C8 Deformation-similar to 150873 45 2 kinase 1 Q99797 Mitochondrial peptidase 81817 34 5 intermediary O95819 Protein kinase 4 activated 0 37 2 by mitogen P26038 Moesin 68198 466 12 Q8WXI7 Mucin-16 2366624 80 9 Q7Z5P9 Mucin-19 0 37 4 Q15746 Myosin light chain kinase, 213816 44 3 smooth muscle P35749 Miosin-11 0 42 3 Q7Z406 Miosin-14 229353 33 4 A7E2Y1 Miosin-7B 0 41 5 P13535 Miosin-8 224298 33 4 P35579 Miosin-9 228467 51 3 Q9UKN7 Miosin-XV 398694 35 3 Q92614 Miosin-XVIIIa 234920 55 6 Q6T4R5 Nance-Horan syndrome 178183 33 4 protein Q86VF7 Nebulin-related anchor 198688 43 3 protein Q8WXH0 Nesprin-2 0 48 6 Q6ZNJ1 Neurobeachin-similar to 306093 44 3 protein 2 Q09666 AHNAK protein associated with 633316 77 7 neuroblast differentiation P21359 Neurofibromin 0 33 5 Q8NEY1 Neuron Browser 1 203760 90 7 Q15818 Neural Pentraxin-1 47727 119 4 Q99574 Neuroserpin 46717 103 1 Q86XR2 Niban-like protein 2 0 39 4 P29474 Nitric oxide synthase, 135130 36 4 endothelial Q15233 Octamer binding protein 0 51 1 containing non-POU domain Q8IVI9 Nostrin 0 42 3 Q92621 Complex pore nuclear Nup25 0 38 3 protein P15531 Nucleoside diphosphate 17389 354 2 kinase A P22392 Nucleoside diphosphate 17481 273 8 kinase B Q9NTK5 Obg-similar to ATPase 1 45059 100 1 Q5VST9 Obscurin 881261 56 5 Q504Q3 PAB-dependent poly (A) 137244 37 3 specific ribonuclease subunit 2 Q9BYG4 Gamma counterpart of 41150 34 2 defective partition 6 P62937 Peptidyl-prolyl cis-trans 18309 225 3 isomerase A P23284 Peptidyl-prolyl cis-trans 23865 319 6 isomerase B Q06830 Peroxiredoxin-1 22372 332 4 P32119 Peroxiredoxin-2 22065 296 6 Q13162 Peroxiredoxin-4 30765 202 5 P30041 Peroxiredoxin-6 25197 379 13 P30086 Phosphatidylethanolamine 21190 73 1 binding protein 1 P36871 Phosphoglucomutase-1 61892 230 8 P00558 Phosphoglycerate kinase 1 45216 710 18 P07205 Phosphoglycerate kinase 2 45413 181 7 P18669 Phosphoglycerate mutase 1 28996 331 7 P13797 Plastin-3 71560 83 3 Q15149 Plectin 534517 58 8 P11940 Polyadenylate Binding 71306 51 5 Protein 1 Q8TDX9 Polycystic liver disease 0 44 4 protein-similar to 1 P98161 Polycystin-1 468373 87 7 Q6S8J3 Member E of the Anarchine 123582 307 12 POTE domain family A5A3E0 F member of anchyrine POTE 123692 35 3 domain family P0CG38 Member I of the Anchirine 123530 70 4 POTE family O60809 Member 10 of the PRAME family 0 37 4 P02545 Prelamin-A/C 74540 81 3 P07602 proactivator polypeptide 60202 63 1 Q9HD20 ATPase 13A1 carrying 0 47 1 likely cation Q9Y4D8 Likely E3 ubiquitin- 446102 48 4 protein ligase C12orf51 O75592 Likely E3 ubiquitin- 519504 48 4 protein ligase MYCBP2 Q9NR48 Likely histone-lysine N- 0 33 4 methyltransferase ASH1L Q02809 Procollagen-lysine, 2- 84285 68 4 oxoglutarate 5-dioxygenase 1 P07737 Profilin-1 15296 306 6 P12004 Nuclear Cellular Antigen 29252 97 2 and Proliferation Q9UQ80 2G4 protein associated 44299 144 1 with proliferation Q8NBP7 Proprotein convertase 75866 423 2 subtilisin/kexin type 9 P25786 Alpha subunit type -1 of 29950 54 3 proteasome P25787 Alpha subunit type -2 26076 140 4 proteasome P25788 Proteasome type-3 alpha 28787 43 3 subunit P25789 Proteasome type-4 alpha 29846 36 1 subunit P60900 Alpha subunit type -6 27934 133 4 proteasome O14818 Proteasome type-7 alpha 28089 130 5 subunit P20618 Proteasome type-1 beta 26844 70 2 subunit P28070 Proteasome type-4 beta 29450 94 4 subunit P28074 Proteasome type-5 beta 28761 249 6 subunit P28072 Proteasome type-6 beta 25713 143 4 subunit Q8IVF2 AHNAK2 protein 620521 66 4 Q9UPA5 Bassoon protein 0 52 6 P07237 Nucleoside diphosphate 57567 177 7 kinase B P30101 Obg-similar to ATPase 1 57281 269 10 Q15084 A6 disulfide isomerase 48577 161 4 protein Q9Y6V0 Piccolo protein 0 36 6 Q14160 Protein counterpart to 175955 36 4 write O95785 Wiz protein 180520 44 6 Q9NYQ8 Protocadherina Fat 2 483217 45 6 Q6V0I7 Protocadherina Fat 4 0 44 5 Q96JQ0 Protocadherin-16 0 34 4 P00491 Purine nucleoside 32517 210 7 phosphorylase Q5VTE0 Putative elongation factor 50709 450 1 1-alpha-similar to 3 Q58FF8 HSP 90-beta 2 protein from 44671 83 5 putative thermal shock P0C7M2 Putative heterogeneous 34469 117 3 nuclear A1-like ribonucleoprotein-3 B8ZZ34 Putative shisa-8 protein 52202 48 4 P46087 Putative ribosomal RNA 0 44 3 NOP2 methyltransferase Q9H853 Putative tubulin-similar 27915 77 1 to alpha-4B protein P14618 M1/M2 isozymes of pyruvate 58736 742 2 kinase P50395 Rab GDP beta dissociation 51287 318 7 inhibitor Q13671 Ras and Rab Interactor 0 37 3 P51157 Ras-related Rab-28 protein 0 50 2 P10586 Tyrosine-protein 214774 35 5 phosphatase F receptor- type Q9P227 Rho GTPase activation 163666 38 2 protein 23 P60891 Ribose phosphate 35469 34 1 pyrophosphokinase 1 Q9H7B2 Homolog of factor 2 of 35907 47 3 ribosome production Q9P2E9 Ribosome binding protein 1 153020 64 3 Q8N1G1 RNA exonuclease 1 homolog 132891 53 3 Q5TZA2 Rootletin 229066 53 5 Q92736 Rhinodine receptor 2 571865 36 7 Q15413 Ryanodine receptor 3 560001 40 3 Q9UQ35 Serine/arginine repetitive 300720 67 4 matrix protein 2 Q9Y3S1 Serine/threonine-protein 244868 47 3 kinase WNK2 P62140 Catalytic subunit of 38073 59 3 serine/threonine-protein phosphatase PP1-beta Q13315 ATM serine protein kinase 356828 37 5 P02787 Serotransferrin 79494 35 2 Q8IW75 Serpin A12 0 35 5 P35237 Serpin B6 43256 112 4 P50454 Serpin H1 46751 115 4 P02768 Serum albumin 71464 231 3 Q9UPX8 Protein 2 of SH3 and 0 59 3 multiple ankyrine repeat domains Q9BYB0 Protein 3 of SH3 and 0 57 4 multiple ankyrine repeat domains Q9H2Y9 Member 5A1 of solute 0 35 3 family carrier of organic anion carrier Q9H3E2 Classifying nexin-25 0 35 3 Q9UBP0 Spastin 67721 38 4 Q13813 Spectrin alpha chain, 285976 51 4 brain Q9H254 Spectrin beta chain, brain 290693 86 4 3 Q9NRC6 Spectrin beta chain, brain 0 45 6 4 P11277 Spectrin beta chain, 0 46 4 erythrocyte Q9P0W8 Protein 7 associated with 68430 64 3 spermatogenesis Q13838 Spliceosome RNA helicase 49664 66 1 BAT1 Q12770 Sterol regulatory element 141819 48 2 binding protein cleavage activation protein Q15772 Striated muscle 357376 40 4 preferentially expressed by protein kinase O60279 Protein 5 containing Sushi 68953 37 1 domain Q8TER0 Protein 1 containing 158397 53 5 domain similar to Sushi, nidogen and EGF Q9Y490 Talin-1 272726 40 4 Q9Y4G6 Talin-2 274829 56 4 Q5TCY1 Tau-tubulin kinase 1 0 33 1 P78371 Beta subunit of protein 1 58040 35 1 T complex P50991 Delta subunit of protein 1 58650 77 2 T complex P48643 Epsilon subunit of protein 60481 93 3 1 complex T Q99832 Eta subunit of complex T 60107 71 1 protein P49368 Gamma subunit of protein 1 61427 231 5 T complex P50990 Theta subunit of protein 1 60450 70 5 T complex P40227 Zeta subunit of protein 1 58676 141 5 T complex Q99973 Component 1 of telomerase 0 41 4 protein Q9UKZ4 Teneurin-1 0 36 6 Q9HBL0 Tensin-1 187026 52 3 Q5SRH9 39A tetratricpeptide 0 32 3 repeat protein P10599 Thioredoxin 12063 40 2 Q16881 Thioredoxin reductase 1, 71841 36 4 cytoplasmic P07202 Thyroid peroxidase 104851 65 6 Q8WZ42 Titin 3849990 140 36 P31629 HIVEP2 transcription 0 44 5 factor P02786 Protein 1 transferrin 85506 115 4 receptor Q15582 Ig-h3 protein 75496 52 1 transformation induced by beta growth factor P55072 Transitional endoplasmic 90282 449 11 ATPase reticulum P29401 Transketolase 68739 742 1 P60174 Isomerase triosephosphate 26986 441 3 P07477 Tripsin-1 27159 44 2 P68363 Alpha-1B tubulin chain 50964 432 1 Q9BQE3 Alpha-1C tubulin chain 50708 430 1 P68366 Alpha-4A tubulin chain 50810 238 1 Q9NY65 Alpha-8 tubulin chain 50906 138 1 P07437 Beta tubulin chain 50375 400 1 Q9H4B7 Beta-1 tubulin chain 51147 103 2 P68371 Beta-2C tubulin chain 50551 54 1 P42684 Tyrosine protein kinase 129675 54 5 ABL2 P22314 Enzyme that activates 119260 163 10 ubiquitin-like modifier Q5TEA3 C20orf194 protein without 134101 44 4 characterization Q9Y4B5 KIAA0802 protein without 0 37 4 characterization Q9Y2F5 KIAA0947 protein without 0 49 5 characterization Q2LD37 KIAA1109 protein without 561392 47 6 characterization Q5VZ46 KIAA1614 protein without 127754 35 3 characterization O75445 Userin 587541 47 5 P46939 Utrophin 0 37 7 Q709C8 13C protein associated 0 62 4 with vacuolar protein classification Q96QK1 Protein 35 associated with 92765 88 2 classification of vacuolar protein P18206 Vinculin 0 56 3 O43497 Alpha-1G subunit of 266470 34 5 voltage-dependent type T calcium channel O75191 Xylulose kinase 0 34 4 Q96JG9 Zinc finger 469 protein 414696 43 7 Q9Y493 Zonadhesin 0 36 3
[0084] STM3 Interacts with HPV18 E7
[0085] Because in Mileo, A. M., Abbruzzese, C., Mattarocci, S., Bellacchio, E., Pisano, P., Federico, A., . . . Paggi, M. G. (2009). Human Papillomavirus-16 E7 Interacts with Glutathione S-Transferase P1 and Enhances Its Role in Cell Survival. PLoS ONE, 4 (10) is shown that GSTP1 protein interacts with HPV16 E7 protein and this interaction improves cell survival, to know if GSTM3 can interact with HPV 18 E7, an alignment was performed of structural overlap between the GSTP1 and GSTM3 proteins and the E7 proteins of HPV 16 and 18 using the MAMMOTH program, followed by the Swiss PDB Viewer (Deep View) v4.1 software to visualize the results (see
[0086] To demonstrate this interaction, a vector construct was generated to express a GSTM3 recombinant human protein with a histidine tag added at the N-terminal (N-6× His-tag) in S. cerevisiae (see
TABLE-US-00006 TABLE 6 List of primers used to generate recombinant GSTM3 protein. Name Sequence 5′ > 3′ M3-1 ATGTCGTGCGAGTCGTCTATGGTTCTCGGGTACTGGGATATTC GTGGGCTGGCGCACGCCATCCGCCTGCTCCTGG M3-2 CATAGTCAGGAGCTTCCCCGCACGTGTACCGTTTCTCCTCATA AGAGGTATCCGTGAACTCCAGGAGCAGGCGGATGG M3-3 GGAAGCTCCTGACTATGATCGAAGCCAATGGCTGGATGTGAAA TTCAAGCTAGACCTGGACTTTCCTAATCTGCCCTACC M3-4 GCTTGCGAGCGATGTAGCGCAAGATGGCATTGCTCTGGGTGAT CTTGTTCTTCCCATCCAGGAGGTAGGGCAGATTAGG M3-5 GCTACATCGCTCGCAAGCACAACATGTGTGGTGAGACTGAAGA AGAAAAGATTCGAGTGGACATCATAGAGAACC M3-6 CAGTTTTTCGTGGTCAGAGCTGTAACAGAGCCTTATCAGTTGT GTGCGGAAATCCATTACTTGGTTCTCTATGATGTCC M3-7 GCTCTGACCACGAAAAACTGAAGCCTCAGTACTTGGAAGAGCT ACCTGGACAACTGAAACAATTCTCCATGTTTCTGG M3-8 GGTGAGAAAATCCACAAAGGTGAGCTTTTCCCCGGCAAACCAT GAGAATTTCCCCAGAAACATGGAGAATTG M3-9 CCTTTGTGGATTTTCTCACCTATGATATCTTGGATCAGAACCG TATATTTGACCCCAAGTGCCTGGATGAGTTCC M3-10 CCAAGTGCCTGGATGAGTTCCCAAACCTGAAGGCTTTCATGTG CCGTTTTGAGGCTTTGGAGAAAATCGCTGCC M3-11 CCACTGGGCCATCTTGTTGTTGATGGGCATCTTGCAGAACTGA TCAGACTGTAAGTAGGCAGCGATTTTCTCCAAAGC M3-12 CCATCAACAACAAGATGGCCCAGTGGGGCAACAAGCCTATATG CTGA GSTM3- ATAGAC AAGCTT AACAAAATGTCTGGGTCGTCG HindIII CACCATCACCACCATCAT TCGTGCGAGTCGTCTATGG GSTM3- ATACAA GGATCC TCAGCATATAGGCTTGTTGC BamHI
[0087] GSTM3-HindIII. This oligonucleotide contains the HindIII restriction site (in bold), yeast consensus sequence at the translational start site and codons for 6 histidines (bold and underlined).
[0088] GSTM3-BamHI. This oligonucleotide contains the BamHI restriction site (bold).
[0089] Primers used for amplification and cloning of the HPV18 E7 gene
TABLE-US-00007 E718-1 ATG CAT GGA CCT AAG GCA ACC ATT E718-2* CTG CTG GGA TGC ACA CCA E7-18-Hind III ATA CAA AAG CTT ATG CAT GGA CCT AA E7HPV18-his* GAT GGT GAT GAT G CT GCT GG Univ His-Tag BamH I* TAC GTG GAT CCT AGT GGT GAT GGT G
[0090] E7-18-Hind III. This oligo contains the Hind III restriction site (bold) and initial HPV 18 sequence (bold).
[0091] E7HPV18-his. This oligo contains a fragment of 6× histidine sequence (bold).
[0092] Univ His-Tag BamHI. This oligo contains the BamHI restriction site (bold) and 6× histidine sequence fragment (bold and underlined).
[0093] Once the interaction of the GSTM3 protein with the HPV18 E7 protein was demonstrated, the relevance of this interaction in cell survival was evaluated. For this purpose, a stress sensitivity test with UV was developed in a breast cancer cell line MDA-MB-231 which is negative for HPV, and the expression of GSTM3 and GSTP1 proteins (see
[0094] “Inhibition of Genes” (Knock-Down) GST In Vitro and In Vivo Using Antisense Oligonucleotides
[0095] As an example, without being limiting, the antisense oligonucleotides of vivo-morpholinos were designed to inhibit the therapeutic targets of the GSTs starting from the 5′UTR region of the messenger RNAs of the GSTM3 and GSTP1 and the ATG start codon and include 25 nucleotides, but this region is not limiting being able to use a range of 15-50 nucleotides, preferably from 18 to 30, more preferably from to 25, and bases 1-773, preferably close to the start codon, of the GSTP1 gene and for GSTM3 from base 1-4144, preferably close to the start codon, with a similarity of 100-50% of both sequences.
[0096] It is obvious that a skilled person in the art can employ any chemical modification of the RNA or DNA sequences to inhibit GSTs, for example: 2′MOE, 2′MO, PNA, LNA, Phosphorothioate, 2′-F, etc. They are commercially available. The preferred GSTs in the present invention, without being limiting thereof, are GSTM3 and GSTP1 with the sequence of antisense oligonucleotide (OAS) 5′-TAGACGACTCGCACGACATGGTGAC-3′ (56% CG−) and 5′-AATAGACCACGGTGTAGGGCG-3G′ (56% CG), respectively.
[0097] For both in vitro and in vivo tests both antisense oligonucleotides were dissolved in sterile PBS saline phosphate buffer at pH 7.5.
[0098] In order to evaluate the effect of GSTM3 and GSTP1 on CC cell lines, the expression of both proteins was inhibited by means of antisense oligonucleotides (OAS) and a random sequence was used as a control. To evaluate the inhibition of GSTs, eight doses were evaluated for each antisense oligonucleotide (OAS) in culture with two cell lines, HeLa and HaCaT (negative control). The concentrations used were between the range of 10 to 1,280 ng/mL and were incorporated into the culture medium. Subsequently, cell proliferation was evaluated at three different times at 24, 48 and 72 hours. It was observed that HaCaT cells were not affected by treatment with any antisense oligonucleotide during the analysis period. However, a slight loss of survival was noted with the highest dose (1,280 ng/mL). In HeLa cells, viability losses were observed after 48 hours of treatment in all doses of OAS-GSTM3 (see
[0099] To evaluate the cellular response in other cell lines, the dose of 640 ng/mL was selected, because this is the highest dose that did not affect the HaCaT cell line. In addition, treatment was performed with 640 ng/mL in the SiHa CC cell line (see
[0100] For in vivo assays, 15 days after tumor inoculation in mice, six doses of 400 ng/500 μL were injected intratumorally, every third day. On day 30, tumors were collected for later analysis. A randomized antisense oligonucleotide was used as a control in both in vitro and in vivo assays. The sequences of the antisense oligonucleotides used in
[0101] Loss of GST Inhibits Tumor Progression in Cervical Cancer
[0102] To demonstrate the importance of GST during tumor progression (PT), the effects of treatments with antisense oligonucleotides in a murine model were examined (see
[0103] In CaLo tumors, both proteins expressed as GSTM3 and GSTP1 were found (see
[0104] In addition, the response to the treatment of tumors of two cell lines of different origins, MDA-MB-231 of breast cancer and COLO of colon cancer, was also studied. Both tumors exhibited low GSTP1 expression compared to CC tumors (see
[0105] GSTM3 and GSTP1 Regulate the MAP Kinase Proteins pJNK and pp38.
[0106] The effects of the deactivation of GSTM3 and GSTP1 on the activation of pJNK and pp38 and the phosphorylation of p65 and pERK (from the NF-κB pathway) during CC PT were analyzed (see
[0107] GSTM3 and GSTP1 Regulate Cell Survival by Inactivating NF-κB and pERK
[0108] The inactivation of the ERK protein and p65 NF-κB was examined (see
[0109] In CaLo tumors, only pERK was inactivated after treatment with any of the antisense oligonucleotides for GST (see
[0110] GST Expression Analysis in Tissue Samples from CC Patients
[0111] A follow-up study of 13 patients with CC who had undergone chemotherapy was performed (see
TABLE-US-00008 TABLE 7 ROI of GST proteins of patients with CC Mean sum Total Mean sum Total Mean sum without Area Mean Mean sum without Area Mean of stain stain Cell area of stain stain Cell area (Area) (Area) Area fraction Classifi- (Area) (Area) Area fraction Classifi- Protein ID (μm.sup.2) (μm.sup.2) (μm.sup.2) ROI % cation Protein (μm.sup.2) (μm.sup.2) (μm.sup.2) ROI % cation GSTM3 502 311,243.79 735,599.42 1,046,843.21 29.73 High GSTP1 814,269.62 442,021.41 1,256,291.03 64.8 High 300 36,571.91 527,141.79 563,713.70 6.49 Weak 536,105.53 566,210.48 1,102,316.01 48.6 Moder- ate 698 67,007.39 177,911.74 244,919.13 27.36 High 511,678.95 488,372.19 1,000,051.14 51.2 High 324 113,134.55 580,128.64 693,263.20 16.32 Moder- 895,090.00 448,948.52 1,344,038.52 66.6 High ate 345 450,109.91 838,099.43 1,288,209.34 34.94 High 577,972.52 686,381.85 1,264,354.38 45.7 Moder- ate 944 126,711.35 655,983.41 782,694.77 16.19 Moder- 516,617.31 696,180.99 1,212,798.30 42.6 Moder- ate ate 535 253,528.44 564,860.42 818,388.86 30.98 High 869,484.57 380,402.05 1,249,886.62 69.6 High 241 236,100.04 639,148.15 875,248.19 26.98 High 232,216.69 761,975.89 994,192.58 23.4 Moder- ate 209 22,949.68 484,613.05 507,562.73 4.52 Weak 265,209.56 355,823.84 621,033.40 42.7 Moder- ate 592 39,824.78 830,366.61 870,191.39 4.58 Weak 221,299.66 490,337.19 711,636.84 31.1 Moder- ate 440 200,506.09 985,348.59 1,185,854.68 16.91 Moder- 877,113.35 420,341.69 1,297,455.04 67.6 High ate 552 113,462.72 617,323.87 730,786.59 15.53 Moder- 240,094.59 345,836.90 585,931.49 41.0 Moder- ate ate 537 72,269.62 680,970.07 753,239.69 9.59 Weak 37,216.89 708,046.98 745,263.87 5.0 Weak
[0112] The results obtained indicate that patients with cervical cancer expressed the GSTM3 and GSTP1 proteins, and that the expression of the tissue samples is related to survival. Therefore, it is concluded that the increase of these proteins is involved with the prognosis of the patient being unfavorable is overexpression.
[0113] The present invention provides evidence for the identification and inhibition of the expression of GSTM3 and GSTP1. In the results of the cultures, the cervical cancer cells were drastically affected by the blockade of both GST, while the HaCaT (non-cancerous) control cells were not affected by the inhibition of these proteins, whereby the GSTM3 and GSTP1 are crucial for the survival and proliferation of cancer cells in culture. In inoculated tumors, it was observed that in those CC cell lines expressing at least one of these proteins, the tumor volume decreased dramatically after treatment with antisense oligonucleotides.
[0114] The present invention demonstrates that inhibition of GSTM3 or GSTP1 activates the signaling of JNK and p38, which leads the cells to apoptosis and, therefore, decreases the tumor volume. On the other hand, it was observed that the inactivation of NF-κB and/or ERK after GST inhibition inhibits cell survival.
[0115] The present invention shows that there is a strong association of the overexpression of GSTM3 and GSTP1 proteins and the survival of patients. The results obtained in vitro and in vivo are consistent with the clinical data, since the survival of patients with CC was associated with high levels of GST protein (see
EXAMPLES
[0116] The following examples will allow us to understand the present invention even more, as well as to show the best method of carrying it out. It should be understood that said examples are illustrative of the present invention and not in any way limiting the scope thereof. References cited herein should be construed as being expressly incorporated therein.
[0117] It should also be understood that the methods and techniques of protein extraction, and immunodetection, as well as the protocols for sample preparation, preparative two-dimensional gel electrophoresis, image analysis and protein identification through MALDI mass spectrometry, which are not specifically described in the examples, are reported in the aforementioned literature and are known to those skilled in the art. For example, phenolic protein extraction is described in Hurkman, W. J., & Tanaka, C. K. (1986).
[0118] Solubilization of plant membrane proteins for analysis by two-dimensional gel electrophoresis. Plant physiology, 81(3), 802-806; Encarnación, S., Guzmán, Y., Dunn, M. F., Hernández, M., Vargas, M. del C., & Mora, J. (2003). Proteome analysis of aerobic and fermentative metabolism in Rhizobium etli CE3. In Proteomics (Vol 3, bll 1077-1085), Klose, J., & Kobalz, U. (1995). Two-dimensional electrophoresis of proteins: an updated protocol and implications for a functional analysis of the genome. Electrophoresis, 16(6), 1034-1059.
[0119] Tumor Generation
[0120] Female athymic nude mice 4-6 weeks old (BALB/c Nu/Nu) were used and subcutaneously injected with 10′ tumor cells in 500 μL of RPMI 1640 medium without FBS and collected in 30, 45 and 50 days. The tumors were measured using a Vernier caliper, and the tumor volume was obtained by calculating the volume of an ellipsoid as π/6 (L*W*H), wherein L: length, W: width and H.
[0121] Tumor Protein Extraction, Proteomic Analysis and Mass Spectrometry.
[0122] Tumor tissue samples were extracted by macerating them in liquid nitrogen and a cocktail of protease inhibitor and phosphatases, followed by sonication on ice, to then carry out the extraction of phenolic proteins by extraction with RIPA buffer. Subsequently, the protein expression analysis is performed using anti-GSTM3 and anti-GSTP1 antibodies and then visualized by immunodetection techniques such as: western staining (western blot), immunohistochemistry, ELISA, etc.
[0123] Extracellular Protein Extraction In Vitro and Ex Vivo.
[0124] Cell lines were cultured with RPMI 1640 advanced serum free up to 70-80% confluence. The medium was removed and rinsed three times with sterile saline: 0.9% NaCl (w/v). After washing, FBS-free RPMI 1640 medium without fresh red phenol (Gibco) was added and incubated for 20 h. Later, the medium was recovered and centrifuged at 2,000 g for 5 minutes. The supernatant was passed through a 0.22 μm pore size PVDF membrane (Millex, Millipore) and stored at −70° C. until later use. For extracellular proteins from xenograft tumors, HeLa and SiHa tumors were inoculated with 10.sup.7 cells. After 30, 45 and 50 days after inoculation, the tumors were collected and washed 3 times with saline. The procedure followed to extract secreted proteins from tumors was performed as previously described for the cells in culture and the supernatant was stored at −70° C. until later use.
[0125] Identification of Secreted Proteins Through LC-MS/NS
[0126] The identification of secreted proteins in cell lines was separated in SDS-PAGE. The generated peptides were analyzed in a nanoLC-MS/MS system (Q-TOF Synapt G2 MS; Waters), the identification of the peptides and proteins was done through the MASCOT Distiller interface (Matrix Science), and the database Swiss-Prot and NCBI.
[0127] Signal Peptide Analysis
[0128] For the analysis of the signal peptide a bioinformatic program called SignalP 4.1 was used, which predicts the presence and location of signal peptide sites in amino acid sequences. The method predicts and identifies the export sites of the signal peptide based on physicochemical features and a combination of neural networks (NN) and hidden Markov models (HMM).
[0129] Coimmunoprecipitation and Immunostaining (Immunoblot)
[0130] The HeLa tumor was collected at 50 days and stored at 80° C. until use. After the tumor sample, they were macerated in liquid nitrogen and lysed with 500 μL RIPA buffer (10 mM Tris, 1 mM EDTA, 1% NP40, 0.1% sodium deoxycholate, 140 mM NaCl) and supplemented with inhibitors of protease and phosphatase (10 mM β-glycerophosphate, 10 mM Na.sub.3VO.sub.4, 10 mM sodium fluoride). Total cell lysates were centrifuged at 13,000 g for 5 min to settle the insoluble material. The lysates are incubated 2 hours with sepharose protein A, normalized for the total protein concentration (10 μg protein) using SDS-PAGE. Protein candidate antibodies (GSTM3 and TRAF6) were immunoprecipitated by incubating lysates with 6 μL antibody conjugated sepharose overnight at 4° C. The beads were washed 3 times with 500 μL lysis buffer. Co-immunoprecipitant proteins were resolved in 12% SDS-PAGE. GSTM3 and TRAF6 levels were detected by immunoblotting using previously described anti-antibodies.
[0131] Commercial antibodies to analyze Western staining (western blot) proteins were selected from anti-GSTM3 (Abcam, ab67530, 1:10,000), anti-GSTP1 (Abcam, ab53943, 1:10,000), anti-TLR4 (Biolegen, 312804, 1:10,000), anti-TRAF6 (Abcam, ab13853, 1:10,000), anti-NF-Kb P65 (SC-378, 1:1,000), anti IKB-α (SC-371, 1:1,000), anti-JNK (sc-1648, 1:1,000), antiERK (sc-94, 1:1,000), anti p38 (sc-535, 1:1,000), anti-NF-κB phospho p65 (sc-101752, 1:1,000), anti-phospho-JNK (sc-6254, 1:1,000), anti-phospho-ERK (sc-7383, 1:1,000), phospho-p38 (sc-7973, 1:1,000), anti-phospho-IKB-α (Cell signaling, 1:1,000), anti-HSP70 and HSP60 (Biolegen, 648005 and 681502, 1:10,000), HPV18 E7 (Abcam, ab38743, 1:1,000), anti-His tag antibody (Invitrogen, 372900, 1:5,000). The cells are lysed in a buffer containing 100 mM Tris (pH 8.6); 4% SDS; 100 mM DTT; a protease inhibitor cocktail. To ensure lysis, pulses are given with a sonicator for 1 second for DNA fragmentation. The proteins are electrophoresed in SDS-PAGE from 12% to 15% and transferred to nitrocellulose membranes using a semi-dry system. The already transferred membranes are blocked with 5% skim milk or bovine serum albumin in a Tris saline buffer containing Tween 20 (TBST) for 15 minutes at 4° C., washed three times in TBST. Subsequently, albumin or skim milk is removed and washed 3 times with TBST, then the membrane is incubated with the primary antibody (anti-GSTM3 or anti-GSTP1) at 4° C. overnight and tested with primary antibody diluted and incubated at 4° C. overnight. After removing the primary antibody the membranes were incubated with a secondary antibody conjugated to peroxidase for 2 h and then the membrane was revealed with a solution of Carbazol (27.2% Carbazol Stock, 72.6% acetate buffer, 0.2% H2O2), Carbazol Stock: N,N-Dimethylformamide≥98% and 3-Amino-9-ethylcarbazole (Sigma-Aldrich) in a 1:8 (w/v) ratio to generate a red/brown. Relative quantifications were performed with ImageJ software.
[0132] To analyze tissue samples by immunohistochemistry (IHC), the percentage of the region of interest (ROI) that is the region that gives positive expression of GSTs is analyzed. The medical records were reviewed, taking into account the patient's previous medical history. All cases were subjected to an immunohistochemical analysis using anti-GSTM3 (Abcam, ab67530, 1:1,000) and, anti-GSTP1 (Abcam, ab53943, 1:1,000). The paraffin blocks were sampled at a tissue thickness of 5 μm and produced in duplicate for each slide. The analysis was performed in an automated immunocontainer (Ventana Medical Systems). Three parts of the tumor were evaluated separately in each sample, as was the presence of staining in the tumor cells. In this study, we analyzed the percentage of the region of interest (ROI) stained by the antibodies, as estimated using the CellSens (Olympus) software. The samples were divided into two groups to assess the association of protein expression and patient survival: (W-M) consisting of a weak ROI for GSTM3 and moderate ROI for GSTP1; and (MH-H) which groups a moderate/high ROI for GSTM3 and high ROI for GSTP1. Kaplan-Meier survival curves were used for this analysis using XLSTAT, with the Greenwood IC and a significance level of 95%.
[0133] In order to assess the effect of GSTM3 and GSTP1 on CC cells, the expression of both proteins was inhibited by the use of antisense oligonucleotides (OAS). Three OAS were designed, two to specifically block proteins and one with a random sequence as a negative control (OAS-GSTM3, OAS-GSTP1 and OAS-Control). First, eight doses were evaluated for each OAS in culture with two cell lines, HeLa (cervical cancer) and HaCaT (negative cancer control). The doses used were from 10 to 1,280 ng/mL total incorporated into the culture medium. And subsequently, we evaluate cell proliferation at three different times at 24, 48 and 72 hours. In this experiment, it was observed that HaCaT cells were not affected by treatment with OAS-GSTM3 during the analysis period. Only a slight loss of survival was noted with the highest dose (1,280 ng/mL). In HeLa cells, viability losses were noted after 48 hours of treatment in all doses of OAS-GSTM3 (see
[0134] Once the protein expression of the GSTM3 and/or GSTP1 in the tumor tissue is identified, the specific antisense oligonucleotides are administered (for example: 2′O-Me, 2′O-MOE, vivo-Morpholino, Morpholinos, LNA, PNA, among others) to perform the silencing of GSTs proteins, which will induce tumor cell death.
[0135] Although the present invention has been described with particularity in accordance with certain of the preferred embodiments, the examples should be interpreted only as illustrative of the invention and not for the purpose of limiting it. References cited herein are expressly incorporated for reference.
BIBLIOGRAPHY
[0136] Adler, V., Yin, Z., Fuchs, S. Y., Benezra, M., Rosario, L., Tew, K. D., . . . Ronai, Z. (1999). [0137] Regulation of JNK signaling by GSTp. The EMBO journal, 18(5), 1321-1334. [0138] Akira, S., & Takeda, K. (2004). Toll-like receptor signalling. Nature reviews. Immunology, 4(7), 499-511. [0139] Asea, A., Rehli, M., Kabingu, E., Boch, J. A., Baré, O., Auron, P. E., . . . Calderwood, S. K. (2002). Novel signal transduction pathway utilized by extracellular HSP70. Role of toll-like receptor (TLR) and TLR4. Journal of Biological Chemistry, 277(17), 15028-15034. [0140] Atkinson, A. J., Colburn, W. A., DeGruttola, V. G., DeMets, D. L., Downing, G. J., Hoth, D. F., . . . Zeger, S. L. (2001). Biomarkers and surrogate endpoints: Preferred definitions and conceptual framework. Clinical Pharmacology and Therapeutics. https://doi.org/10.1067/mcp.2001.113989 Beavis, A. L., Gravitt, P. E., & Rositch, A. F. (2017). Hysterectomy-corrected cervical cancer mortality rates reveal a larger racial disparity in the United States. Cancer, 123(6), 1044-1050. [0141] Bild, A. H., Potti, A., & Nevins, J. R. (2006). Linking oncogenic pathways with therapeutic opportunities. Nature Reviews Cancer. [0142] Bosch, F. X., Lorincz, a, Munoz, N., Meijer, C. J. L. M., & Shah, K. V. (2002). The causal relation between human papillomavirus and cervical cancer. Journal of Clinical Pathology, 55(4), 244-265. [0143] Brekke, O. H., & Sandlie, I. (2003). Therapeutic antibodies for human diseases at the dawn of the twenty-first century. Nature Reviews Drug Discovery. [0144] Brewer, C. A., Setterdahl, J. J., Li, M. J., Johnston, J. M., Mann, J. L., & McAsey, M. E. (2000). Endoglin expression as a measure of microvessel density in cervical cancer. Obstetrics and Gynecology, 96(2), 224-228. [0145] Burk, R. D., Chen, Z., Saller, C., Tarvin, K., Carvalho, A. L., Scapulatempo-Neto, C., . . . Mutch, D. (2017). Integrated genomic and molecular characterization of cervical cancer. Nature, 543(7645), 378-384. [0146] Cabelguenne, A., Loriot, M. A., Stucker, I., Blons, H., Koum-Besson, E., Brasnu, D., . . . De Waziers, I. (2001). Glutathione-associated enzymes in head and neck squamous cell carcinoma and response to cisplatin-based neoadjuvant chemotherapy. International Journal of Cancer, 93(5), 725-730. [0147] Cekanova, M., & Rathore, K. (2014). Animal models and therapeutic molecular targets of cancer: Utility and limitations. Drug Design, Development and Therapy. https://doi.org/10.2147/DDDT.S49584 [0148] Chang, J., Jung, H. H., Yang, J. Y., Lee, S., Choi, J., Im, G. J., & Chae, S. W. (2014). Protective effect of metformin against cisplatin-induced ototoxicity in an auditory cell line. JARO—Journal of the Association for Research in Otolaryngology, 15(2), 149-158. [0149] Cho, W. C. S. (2007). Contribution of oncoproteomics to cancer biomarker discovery. Molecular Cancer. [0150] Dasari, S., Wudayagiri, R., & Valluru, L. (2015). Cervical cancer: Biomarkers for diagnosis and treatment. Clinica Chimica Acta. [0151] Denny, L. E. (2008). Prevention of cervical cancer. Reproductive health matters, 16(32), 18-31. [0152] Dueñas-Gonzalez, A., Lizano, M., Candelaria, M., Cetina, L., Arce, C., & Cervera, E. (2005). Epigenetics of cervical cancer. An overview and therapeutic perspectives. Mol Cancer, 4, 38. https://doi.org/1476-4598-4-38[pii]\n10.1186/1476-4598-4-38 [0153] Encarnación, S., Guzmán, Y., Dunn, M. F., Hernández, M., Vargas, M. del C., & Mora, J. (2003). [0154] Proteome analysis of aerobic and fermentative metabolism in Rhizobium etli CE3. In Proteomics (Vol 3, bll 1077-1085). [0155] Gillet, E., Meys, J. F. A., Verstraelen, H., Verhelst, R., De Sutter, P., Temmerman, M., & Broeck, D. Vanden. (2012). Association between Bacterial Vaginosis and Cervical Intraepithelial Neoplasia: Systematic Review and Meta-Analysis. PLoS ONE, 7(10), e45201. [0156] Green, J. A., Kirwan, J. M., Tierney, J. F., Symonds, P., Fresco, L., Collingwood, M., & Williams, C. J. (2001). Survival and recurrence after concomitant chemotherapy and radiotherapy for cancer of the uterine cervix: a systematic review and meta-analysis. Lancet, 358(9284), 781-786. [0157] Hamburg, M. A., & Collins, F. S. (2010). The Path to Personalized Medicine—Perspective. The New England Journal of Medicine, 363(4), 301-304. https://doi.org/10.1056/NEJMp1006304 Hanahan, D., & Weinberg, R. A. (2000). The hallmarks of cancer. Cell, 100(1), 57-70. [0158] Hanash, S. M., Pitteri, S. J., & Faca, V. M. (2008). Mining the plasma proteome for cancer biomarkers. Nature. [0159] Hanash, S., & Taguchi, A. (2010). The grand challenge to decipher the cancer proteome. Nat Rev Cancer, 10(9), 652-660. [0160] Hayden, M. S., & Ghosh, S. (2012). NF-kB, the first quarter-century: Remarkable progress and outstanding questions. Genes and Development, 26(3), 203-234. [0161] Hayes, J. D., Flanagan, J. U., & Jowsey, I. R. (2005). Glutathione transferases. Annu Rev Pharmacol Toxicol, 45, 51-88. [0162] Holohan, C., Van Schaeybroeck, S., Longley, D. B., & Johnston, P. G. (2013). Cancer drug resistance: an evolving paradigm. Nature Reviews Cancer, 13(10), 714-726. [0163] Hu, Z., Zhu, D., Wang, W., Li, W., Jia, W., Zeng, X., . . . Ma, D. (2015). Genome-wide profiling of HPV integration in cervical cancer identifies clustered genomic hot spots and a potential microhomology-mediated integration mechanism. Nature Genetics, 47(2), 158-163. [0164] Huang, J., Tan, P.-H., Thiyagarajan, J., & Bay, B.-H. (2003). Prognostic significance of glutathione Stransferase-pi in invasive breast cancer. Modern pathology: an official journal of the United States and Canadian Academy of Pathology, Inc, 16(6), 558-565. [0165] Hurkman, W. J., & Tanaka, C. K. (1986). Solubilization of plant membrane proteins for analysis by two-dimensional gel electrophoresis. Plant physiology, 81(3), 802-806. [0166] IARC. (2016). Globocan 2012. Http://Www-Dep.Iarc.Fr/, GLOBOCAN, 2012-2013. [0167] Jankova, L., Robertson, G., Chan, C., Tan, K. L., Kohonen-Corish, M., Fung, C. L.-S., . . . Clarke, S. [0168] J. (2012). Glutathione S-transferase Pi expression predicts response to adjuvant chemotherapy for stage C colon cancer: a matched historical control study. BMC cancer, 12(1), 196. [0169] Josic, D., Clifton, J. G., Kovac, S., & Hixson, D. C. (2008). Membrane proteins as diagnostic biomarkers and targets for new therapies. Current Opinion In Molecular Therapeutics, 10(2), 116-123. Opgehaal van. [0170] Junod, S. W. (2013). FDA and Clinical Drug assays: A Short History. Opgehaal van. [0171] Kawano, M., Mabuchi, S., Matsumoto, Y., Sasano, T., Takahashi, R., Kuroda, H., . . . Kimura, T. (2015). The significance of G-CSF expression and myeloid-derived suppressor cells in the chemoresistance of cervical cancer. Scientific Reports, 5(April), 1-13. [0172] Klose, J., & Kobalz, U. (1995). Two-dimensional electrophoresis of proteins: an updated protocol and implications for a functional analysis of the genome. Electrophoresis, 16(6), 1034-1059. [0173] Kogo, R., How, C., Chaudary, N., Bruce, J., Shi, W., Hill, R. P., . . . Liu, F.-F. (2014). The microRNA-218-Survivin axis regulates migration, invasion, and lymph node metastasis in cervical cancer. Oncotarget, 6(2), 1090-1100. [0174] Kueng, W., Silber, E., & Eppenberger, U. (1989). Quantification of cells cultured on 96-well plates. [0175] Analytical Biochemistry, 182(1), 16-19. [0176] Laborde, E. (2010). Glutathione transferases as mediators of signaling pathways involved in cell proliferation and cell death. Cell Death and Differentiation. [0177] Loktionov, a, Watson, M. a, Gunter, M., Stebbings, W. S., Speakman, C. T., & Bingham, S. a. (2001). Glutathione-S-transferase gene polymorphisms in colorectal cancer patients: interaction between GSTM1 and GSTM3 allele variants as a risk-modulating factor. Carcinogenesis, 22(7), 1053-1060. [0178] Louie, S. M., Grossman, E. A., Crawford, L. A., Ding, L., Camarda, R., Huffman, T. R., . . . Nomura, D. K. (2016). GSTP1 Is a Driver of Triple-Negative Breast Cancer Cell Metabolism and Pathogenicity. Cell Chemical Biology, 23(5), 567-578. [0179] Makridakis, M., & Vlahou, A. (2010). Secretome proteomics for discovery of cancer biomarkers. Journal of Proteomics. [0180] Mao, C., Hughes, J. P., Kiviat, N., Kuypers, J., Lee, S. K., Adam, D. E., & Koutsky, L. A. (2003). Clinical findings among young women with genital human papillomavirus infection. American Journal of Obstetrics and Gynecology, 188(3), 677-684. [0181] Matsuzawa, A., Saegusa, K., Noguchi, T., Sadamitsu, C., Nishitoh, H., Nagai, S., . . . Ichijo, H. (2005). [0182] ROS-dependent activation of the TRAF6-ASK1-p38 pathway is selectively required for TLR4-mediated innate immunity. Nature immunology, 6(6), 587-592. [0183] Medeiros, R., Vasconcelos, A., Costa, S. Lopes, C. (2004). Metabolic Susceptibility Genes and Prostate Cancer Risk in a Southern European Population: The Role of Glutathione S-Transferases GSTM1, GSTM3, and GSTT1 Genetic Polymorphisms. Prostate, 58(4), 414-420. [0184] Meding, S., Balluff, B., Elsner, M., Schöne, C., Rauser, S., Nitsche, U., . . . Walch, A. (2012). Tissuebased proteomics reveals FXYD3, S100A11 and GSTM3 as novel markers for regional lymph node metastasis in colon cancer. Journal of Pathology, 228(4), 459-470. [0185] Mileo, A. M., Abbruzzese, C., Mattarocci, S., Bellacchio, E., Pisano, P., Federico, A., . . . Paggi, M. G. (2009). Human Papillomavirus-16 E7 Interacts with Glutathione S-Transferase P1 and Enhances Its Role in Cell Survival. PLoS ONE, 4(10). [0186] Mitra, A., MacIntyre, D. A., Marchesi, J. R., Lee, Y. S., Bennett, P. R., & Kyrgiou, M. (2016). The vaginal microbiota, human papillomavirus infection and cervical intraepithelial neoplasia: What do we know and where are we going next? Microbiome. https://doi.org/10.1186/s40168-016-0203-0 [0187] Mitra, A. P., Pagliarulo, V., Yang, D., Waldman, F. M., Datar, R. H., Skinner, D. G., . . . Cote, R. J. (2009). Generation of a concise gene panel for outcome prediction in urinary bladder cancer. Journal of Clinical Oncology, 27(24), 3929-3937. [0188] Monaci, P., Luzzago, A., Santini, C., De Pra, A., Arcuri, M., Magistri, F., . . . Cortese, R. (2008). [0189] Differential screening of phage-Ab libraries by oligonucleotide microarray technology. PLoS ONE, 3(1). [0190] Moyer, V. A. (2012). Screening for Cervical Cancer: U.S. preventive services task force recommendation statement. Annals of Internal Medicine. [0191] Mueller-Klieser, W. (1997). Three-dimensional cell cultures: from molecular mechanisms to clinical applications. Am J Physiol, 273(4 Pt 1), C1109-23. [0192] Nishitoh, H., Saitoh, M., Mochida, Y., Takeda, K., Nakano, H., Rothe, M., . . . Ichijo, H. (1998). ASK1 is essential for JNK/SAPK activation by TRAF2. Molecular cell, 2(3), 389-395. [0193] Offit, K. (2011). Personalized medicine: New genomics, old lessons. Human Genetics. [0194] Ortiz, A. R., Strauss, C. E. M., & Olmea, O. (2002). MAMMOTH (matching molecular models obtained from theory): an automated method for model comparison. Protein science: a publication of the Protein Society, 11(11), 2606-2621. [0195] Owen, L. A., Uehara, H., Cahoon, J., Huang, W., Simonis, J., & Ambati, B. K. (2012). Morpholino-mediated increase in soluble fit-1 expression results in decreased ocular and tumor neovascularization. PLoS ONE, 7(3). [0196] Pavlou, M. P., & Diamandis, E. P. (2010). The cancer cell secretome: A good source for discovering biomarkers? Journal of Proteomics. [0197] Pectasides, D., Kamposioras, K., Papaxoinis, G., & Pectasides, E. (2008). Chemotherapy for recurrent cervical cancer. Cancer Treatment Reviews. [0198] Peralta-Zaragoza, O., Bermúdez-Morales, V. H., Pérez-Plasencia, C., Salazar-León, J., Gómez-Cerón, C., & Madrid-Marina, V. (2012). Targeted treatments for cervical cancer: A review. OncoTargets and Therapy. [0199] Posadas, E. M., Simpkins, F., Liotta, L. a, MacDonald, C., & Kohn, E. C. (2005). Proteomic analysis for the early detection and rational treatment of cancer—realistic hope? Annals of oncology: official journal of the European Society for Medical Oncology/ESMO, 16(1), 16-22. [0200] Price, J. C., Guan, S., Burlingame, A., Prusiner, S. B., & Ghaemmaghami, S. (2010). Analysis of proteome dynamics in the mouse brain. Proceedings of the National Academy of Sciences of the United States of America, 107(32), 14508-14513. [0201] Quail, D. F., & Joyce, J. A. (2013). Microenvironmental regulation of tumor progression and metastasis. Nat Med, 19(11), 1423-1437. [0202] Rose, P. G., Bundy, B. N., Watkins, E. B., Thigpen, J. T., Deppe, G., Maiman, M. A., . . . Insalaco, S. (1999). Concurrent cisplatin-based radiotherapy and chemotherapy for locally advanced cervical cancer. N Engl J Med, 340(15), 1144-1153. [0203] Rouillard, A. D., Gundersen, G. W., Fernandez, N. F., Wang, Z., Monteiro, C. D., McDermott, M. G., & Ma'ayan, A. (2016). The harmonizome: a collection of processed datasets gathered to serve and mine knowledge about genes and proteins. Database, 2016, baw100. [0204] Scarinci, I. C., Garcia, F. a R., Kobetz, E., Partridge, E. E., Brandt, H. M., Bell, M. C., . . . Castle, P. E. (2010). Cervical cancer prevention: New tools and old barriers. Cancer, 116(11), 2531-2542. [0205] Scherf, U., Ross, D. T., Waltham, M., Smith, L. H., Lee, J. K., Tanabe, L., . . . Weinstein, J. N. (2000). A gene expression database for the molecular pharmacology of cancer. Nature genetics, 24(3), 236-244. [0206] Scholle, F., Bendt, K. M., & Raab-Traub, N. (2000). Epstein-Barr Virus LMP2A Transforms Epithelial Cells, Inhibits Cell Differentiation, and Activates Akt. Journal of virology, 74 (22), 10681-10689. [0207] Schwede, T., Kopp, J., Guex, N., & Peitsch, M. C. (2003). SWISS-MODEL: An automated protein homology-modeling server. Nucleic Acids Research, 31(13), 3381-3385. [0208] Shannon, P., Markiel, A., Ozier, O., Baliga, N. S., Wang, J. T., Ramage, D., . . . Ideker, T. (2003). Cytoscape: A software Environment for integrated models of biomolecular interaction networks. Genome Research, 13(11), 2498-2504. [0209] Siddik, Z. H. (2003). Cisplatin: mode of cytotoxic action and molecular basis of resistance. [0210] Oncogene, 22(47), 7265-7279. [0211] Sima, N., Wang, S., Wang, W., Kong, D., Xu, Q., Tian, X., . . . Ma, D. (2007). Antisense targeting human papillomavirus type 16 E6 and E7 genes contributes to apoptosis and senescence in SiHa cervical carcinoma cells. Gynecologic Oncology, 106(2), 299-304. [0212] Simpson, R. J., Connolly, L. M., Eddes, J. S., Pereira, J. J., Moritz, R. L., & Reid, G. E. (2000). Proteomic analysis of the human colon carcinoma cell line (LIM 1215): development of a membrane protein database. Electrophoresis, 21, 1707-1732. [0213] Tabas-Madrid, D., Nogales-Cadenas, R., & Pascual-Montano, A. (2012). GeneCodis3: A non-redundant and modular enrichment analysis tool for functional genomics. Nucleic Acids Research, 40(W1). [0214] Tew, K. D., & Townsend, D. M. (2011). Regulatory functions of glutathione S-transferase P1-1 unrelated to detoxification. Drug metabolism reviews, 43(2), 179-193. [0215] Tomayko, M. M., & Reynolds, C. P. (1989). Determination of subcutaneous tumor size in athymic (nude) mice. Cancer Chemotherapy and Pharmacology, 24(3), 148-154. [0216] Townsend, D. M., & Tew, K. D. (2003). The role of glutathione-S-transferase in anti-cancer drug resistance. Oncogene, 22(47), 7369-7375. [0217] Twombly, R. (2002). New Pap Test Terminology, Management Guidelines Published. Journal of the National Cancer Institute, 94(12), 878-880. [0218] Vabulas, R. M., Ahmad-Nejad, P., da Costa, C., Miethke, T., Kirschning, C. J., Hacker, H., & Wagner, H. (2001). Endocytosed HSP60s use TLR2 and TLR4 to activate the TIR signaling pathway in innate immune cells. The Journal of biological chemistry, 276(33), 31332-31339. [0219] Valdespino, V. M., & Valdespino, V. E. (2006). Cervical cancer screening: state of the art. Current opinion in obstetrics & gynecology, 18(1), 35-40. [0220] Villa, L. L. (2008). Assessment of new technologies for cervical cancer screening. The Lancet Oncology. [0221] Vizcaíno, J. A., Csordas, A., Del-Toro, N., Dianes, J. A., Griss, J., Lavidas, I., . . . Hermjakob, H. (2016). 2016 update of the PRIDE database and its related tools. Nucleic Acids Research, 44(D1), D447-D456. [0222] Waggoner, S. E. (2003). Cervical cancer. In Lancet (Vol 361, bll 2217-2225). [0223] Waldmann, T. A. (2003). Immunotherapy: Past, present and future. Nature Medicine. [0224] Walsh, M. C., Kim, G. K., Maurizio, P. L., Molnar, E. E., & Choi, Y. (2008). TRAF6 autoubiquitination-independent activation of the NF-kB and MAPK pathways in response to IL-1 and RANKL. PLoS ONE, 3(12). [0225] Waterston, R. H., Lindblad-Toh, K., Birney, E., Rogers, J., Abril, J. F., Agarwal, P., . . . Mouse Genome Sequencing, C. (2002). Initial sequencing and comparative analysis of the mouse genome. Nature, 420(6915), 520-562. [0226] Wu, Y., Fan, Y., Xue, B., Luo, L., Shen, J., Zhang, S., . . . Yin, Z. (2006). Human glutathione S-transferase P1-1 interacts with TRAF2 and regulates TRAF2-ASK1 signals. Oncogene, 25, 5787-5800. [0227] Wulfkuhle, J. D., Liotta, L. A., & Petricoin, E. F. (2003). Early detection: Proteomic applications for the early detection of cancer. Nat Rev. Cancer, 3(4), 267-275. [0228] Ye, Z., Song, H., Higgins, J. P. T., Pharoah, P., & Danesh, J. (2006). Five glutathione S-transferase gene variants in 23,452 cases of lung cancer and 30,397 controls: Meta-analysis of 130 studies. PLoS Medicine, 3(4), 524-534. [0229] Yokota, J. (2000). Tumor progression and metastasis. Carcinogenesis, 21(3), 497-503. [0230] Zagouri, F., Sergentanis, T. N., Chrysikos, D., Filipits, M., & Bartsch, R. (2012). Molecularly targeted therapies in cervical cancer. a systematic review. Gynecologic Oncology. [0231] Zuris, J. A., Thompson, D. B., Shu, Y., Guilinger, J. P., Bessen, J. L., Hu, J. H., Liu, D. R. (2014). Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo. Nature biotechnology, 33(1), 73-80.