A NOVEL CD16+ NATURAL KILLER CELL AND A METHOD OF CULTURING CD16+ NATURAL KILLER CELL
20220073878 · 2022-03-10
Assignee
Inventors
- ZIH-FEI CHENG (New Taipei City, TW)
- CHIA-YUN LEE (New Taipei City, TW)
- HAO-KANG LI (New Taipei City, TW)
- YAN-LIANG LIN (New Taipei City, TW)
- CHING-WEN HSIAO (Castro Valley, CA, US)
- YAN-DA LAI (New Taipei City, TW)
- Yu-Pei Cheng (New Taipei City, TW)
- HSIU-PING YANG (New Taipei City, TW)
- SHIH-CHIA HSIAO (New Taipei City, TW)
Cpc classification
A61K39/395
HUMAN NECESSITIES
A61K35/17
HUMAN NECESSITIES
C07K2317/24
CHEMISTRY; METALLURGY
C07K16/283
CHEMISTRY; METALLURGY
C07K14/70535
CHEMISTRY; METALLURGY
A61K2300/00
HUMAN NECESSITIES
A61K39/395
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
C12N2501/599
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention provides a human CD16.sup.+ natural killer cell line. This human CD16.sup.+ natural killer cell line does not include synthetic, genetically modified or deliberately delivered polynucleotide encoding the CD16 receptor and is a non-tumorigenic cell line. Therefore, this human CD16.sup.+ natural killer cell line might provide considerable long-term safety for disease treatment.
Claims
1-82. (canceled)
83. A human natural killer cell which is derived from a subject with a cancer and has the following characteristics: i) expressing a CD16 receptor; ii) retaining its capability to proliferate after subculture for at least 3 months; and iii) x) not including synthetic, genetically modified and/or deliberately delivered polynucleotide encoding the CD16 receptor, or y) by using ddPCR system to analyze the genomic DNA of the cell, the ratio of CD16 F176F probe-detectable DNA molecule to CD16 F176V probe-detectable DNA molecule is equal to or higher than 1, wherein the sequence of the CD16 F176F probe is SEQ ID NO: 11 and the sequence of the CD16 F176V probe is SEQ ID NO: 12.
84. The cell according to claim 83, wherein the CD16 receptor is a CD16a receptor or a CD16b receptor.
85. The cell according to claim 83, wherein an expressed polynucleotide encoding the CD16 receptor is located on q arm of chromosome 1 at position 1q23.3.
86. The cell according to claim 83, the cell is non-tumorigenic in an immune compromised mouse.
87. The cell according to claim 83, wherein, after being irradiated with γ-ray, the cell is non-tumorigenic in an allogeneic subject.
88. The cell according to claim 83, wherein a polynucleotide encoding the CD16 receptor comprising a nucleotide sequence of SEQ NO:1, SEQ ID NO:2, or SEQ ID NO:19.
89. The cell according to claim 83, wherein the CD16 receptor comprising an amino acid sequence of SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:20.
90. The cell according to claim 83, the cell further comprises an inactive tumor suppressor gene or a mutated and highly expressed oncogene.
91. The cell according to claim 83, wherein the cell is capable of mediating an antibody-dependent cell cytotoxicity (ADCC) response, and the cell is a male cell.
92. The cell according to claim 83, wherein the cell further comprises at least an exogenous targeting unit complexed to the cell, wherein the exogenous targeting unit comprises a targeting moiety that is characterized in that: (a) it exhibits specific binding to a biological marker on a target cell; (b) it is not a nucleic acid; and (c) it is not produced by the cell.
93. The cell according to claim 92, wherein the exogenous targeting unit is complexed to the cell via an interaction between a first linker conjugated to the targeting moiety and a second linker conjugated to the cell.
94. The cell of claim 93, wherein the first linker is a first polynucleotide, or the second linker is a second polynucleotide.
95. The cell of claim 92, wherein the targeting moiety comprises an antigen-binding unit.
96. The cell of claim 94, wherein the first polynucleotide comprises a single-stranded region.
97. The cell of claim 93, wherein the first linker is a first polynucleotide, and the second linker is a second polynucleotide.
98. The cell of claim 93, wherein the first linker and the second linker are selected from the group consisting of: a DNA binding domain and a target DNA; a leucine zipper and a target DNA; biotin and avidin; biotin and streptavidin; calmodulin binding protein and calmodulin; a hormone and a hormone receptor; lectin and a carbohydrate; a cell membrane receptor and a receptor ligand; an enzyme and a substrate; an antigen and an antibody; an agonist and an antagonist; polynucleotide hybridizing sequences; an aptamer and a target; and a zinc finger and a target DNA.
99. The cell of claim 93, wherein the first linker comprises a first reactive group, and the second linker comprises a second reactive group, and wherein the cell is complexed to the targeting moiety via a covalent bond formed by a reaction between the second reactive group and the first reactive group.
100. The cell of claim 97, wherein the targeting moiety comprises an antigen-binding unit.
101. The cell of claim 93, wherein the second linker comprises a PEG region.
102. The cell of claim 92, wherein the targeting moiety and the cell are separated by a length of 1 nm to 400 nm.
103. The cell of claim 92, wherein the exogenous targeting unit comprises an antigen-binding unit, and the antigen-binding unit binds to a cancer antigen, glycolipid, glycoprotein, cluster of differentiation antigen present on cells of a hematopoietic lineage, gamma-glutamyltranspeptidase, adhesion protein, hormone, growth factor, cytokine, ligand receptor, ion channel, membrane-bound form of an immunoglobulin μ. chain, alfa-fetoprotein, C-reactive protein, chromogranin A, epithelial mucin antigen, human epithelium specific antigen, Lewis(a) antigen, multidrug resistance related protein, Neu oncogene protein, neuron specific enolase, P-glycoprotein, multidrug-resistance-related antigen, p170, multi drug-resistance-related antigen, prostate specific antigen, NCAM, ganglioside molecule, MART-1, heat shock protein, sialylTn, tyrosinase, MUC-1, HER-2/neu, KSA, PSMA, p53, RAS, EGF-R, VEGF, or MAGE.
104. The cell of claim 103, wherein the antigen-binding unit is an antibody against a cancer antigen selected from HER2/neu (ERBB2), HER3 (ERBB3), EGFR, VEGF, VEGFR2, GD2, CTLA4, CD19, CD20, CD22, CD30, CD33 (Siglec-3), CD52 (CAMPATH-1 antigen), CD326 (EpCAM), CA-125 (MUC16), MMP9, DLL3, CD274 (PD-L1), CEA, MSLN (mesothelin), CA19-9, CD73, CD205 (DEC205), CD51, c-MET, TRAIL-R2, IGF-1R, CD3, MIF, folate receptor alpha (FOLR1), CSF1, OX-40, CD137, TfR, MUC1, CD25 (IL-2R), CD115 (CSF1R), CD105 (Endoglin), SIR, CD47, CEA, IL-17A, DLL4, CD51, angiopoietin 2, neuropilin-1, CD37, CD223 (LAG-3), CD40, (SLC39A6), CD27 (TNFRSF7), CD276 (B7-H3), Trop2, Claudin1 (CLDN1), PSMA, TIM-1 (HAVcr-1), CEACAM5, CD70, LY6E, BCMA, CD135 (FLT3), APRIL, TF(F3), nectin-4, FAP, GPC3, FGFR3, a killer-cell immunoglobulin-like receptors (KIRs), a TNT receptor protein, an immunoglobulin protein, a cytokine receptor, an integrin, activating NK cell receptors, and combinations thereof.
105. The cell of claim 94, wherein the targeting moiety is conjugated to the first polynucleotide using a coupling group, wherein the coupling group is an NHS ester, other activated ester, an alkyl or acyl halide, a bifunctional crosslinker, or maleimide group.
106. The cell of claim 94, wherein the firm polynucleotide or second polynucleotide comprise a sequence selected from 20-mer poly-CA, 20-mer poly-GGTT, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ II) NO: 25, SEQ II) NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, 23-mer SEQ ID NO: 7. and SEQ 1D NO:10.
107. The cell of claim 92, the binding affinity of the targeting moiety for the biological marker is less than 250 nM.
108. The cell of claim 94, the length of the first polynucleotide or the length of the second polynucleotide are 4 nt to 500 nt.
109. The cell of claim 93, the binding affinity between the first linker and the second linker is less than 250 nM.
110. The cell of claim 93, the first linker or the second linker is conjugated to a native functional group of the targeting unit or a surface of the cell, wherein the native functional group is an amino acid, a sugar, or an amine.
111. The cell of the claim 92, the targeting moiety is a peptide, protein, or aptamer.
112. A composition substantially enriched in human CD16.sup.+ natural killer cells, wherein the number of the human CD16.sup.+ natural killer cells in the composition is at least 5×10.sup.5 and the human CD16.sup.+ natural killer cells are in an amount equal to or more than 5% by number, based on the total number of the cells in the composition as 100%; the human CD16.sup.+ natural killer cell is derived from a subject with a cancer and has the following characteristics: i) expressing a CD16 receptor, ii) retaining its capability to proliferate after subculture for at least 3 months, and iii) x) not including synthetic, genetically modified and/or deliberately delivered polynucleotide encoding the CD16 receptor, or y) by using ddPCR system to analyze the genomic DNA of the cell, the ratio of CD16 F176F probe-detectable DNA molecule to CD16 F176V probe-detectable DNA molecule is equal to or higher than 1, wherein the sequence of the CD16 F176F probe is SEQ ID NO: 11 and the sequence of the CD16 F176V probe is SEQ ID NO: 12.
113. The composition according to claim 112, wherein the CD16 receptor is a CD16a receptor or a CD16b receptor.
114. The composition according to claim 112, wherein a polynucleotide encoding the CD16 receptor is located on q arm of chromosome 1 at position 1q23.3.
115. The composition according to claim 112, wherein the human CD16.sup.+ natural killer cells are non-tumorigenic in an immune compromised mouse.
116. The composition according to claim 112, wherein, after being irradiated with γ-ray, the human CD16.sup.+ natural killer cells are non-tumorigenic in an allogeneic subject.
117. The composition according to claim 112, wherein a polynucleotide encoding the CD16 receptor comprises a nucleotide sequence of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:19.
118. The composition according to claim 112, wherein the CD16 receptor comprising an amino acid sequence of SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:20.
119. The composition according to claim 112, wherein the human CD16.sup.+ natural killer cell further comprises an inactive tumor suppressor gene or a mutated and highly expressed oncogene.
120. The composition according to claim 112, wherein the human CD16.sup.+ natural killer cell is capable of mediating an antibody-dependent cell cytotoxicity (ADCC) response, and the cell is a male cell.
121. The composition according to claim 112, wherein the human CD16.sup.+ natural killer cell further comprises at least an exogenous targeting unit complexed to the human CD16.sup.+ natural killer cell, wherein the exogenous targeting unit comprises a targeting moiety that is characterized in that: (a) it exhibits specific binding to a biological marker on a target cell; (b) it is not a nucleic acid; and (c) it is not produced by the human CD16.sup.+ natural killer cell.
122. The composition according to claim 121, wherein the exogenous targeting unit is complexed to the human CD16.sup.+ natural killer via an interaction between a first linker conjugated to the targeting moiety and a second linker conjugated to the human CD16.sup.+ natural killer cell.
123. The composition of claim 122, wherein the first linker is a first polynucleotide, or the second linker is a second polynucleotide.
124. The composition of claim 121, wherein the targeting moiety comprises an antigen-binding unit.
125. The composition of claim 123, wherein the first polynucleotide comprises a single-stranded region.
126. The composition of claim 122, wherein the first linker is a first polynucleotide, and the second linker is a second polynucleotide.
127. The composition of claim 122, wherein the first linker and the second linker are selected from the group consisting of: a DNA binding domain and a target DNA; a leucine zipper and a target DNA; biotin and avidin; biotin and streptavidin; calmodulin binding protein and calmodulin; a hormone and a hormone receptor; lectin and a carbohydrate; a cell membrane receptor and a receptor ligand; an enzyme and a substrate; an antigen and an antibody; an agonist and an antagonist; polynucleotide hybridizing sequences; an aptamer and a target; and a zinc finger and a target DNA.
128. The composition of claim 122, wherein the first linker comprises a first reactive group, and the second linker comprises a second reactive group, and wherein the human CD16.sup.+ natural killer cell is complexed to the targeting moiety via a covalent bond formed by a reaction between the second reactive group and the first reactive group.
129. The composition of claim 126, wherein the targeting moiety comprises an antigen-binding unit.
130. The composition of claim 122, wherein the second linker comprises a PEG region.
131. The composition of claim 121, wherein the targeting moiety and the human CD16.sup.+ natural killer cell is separated by a length of 1 nm to 400 nm.
132. The composition of claim 121, wherein the exogenous targeting unit comprises an antigen-binding unit, and the antigen-binding unit binds to a cancer antigen, glycolipid, glycoprotein, cluster of differentiation antigen present on cells of a hematopoietic lineage, gamma-glutamyltranspeptidase, adhesion protein, hormone, growth factor, cytokine, ligand receptor, ion channel, membrane-bound form of an immunoglobulin μ. chain, alfa-fetoprotein, C-reactive protein, chromogranin A, epithelial mucin antigen, human epithelium specific antigen, Lewis(a) antigen, multidrug resistance related protein, Neu oncogene protein, neuron specific enolase, P-glycoprotein, multidrug-resistance-related antigen, p170, multidrug-resistance-related antigen, prostate specific antigen, NCAM, ganglioside molecule, MART-1, heat shock protein, sialylTn, tyrosinase, MUC-1, HER-2/neu, KSA, PSMA, p53, RAS, EGF-R, VEGF, or MAGE.
133. The composition of claim 132, wherein the antigen-binding unit is an antibody against a cancer antigen selected from HER2/neu (ERBB2), HER3 (ERBB3), EGFR, VEGF, VEGFR2, GD2, CTLA4, CD19, CD20, CD22, CD30, CD33 (Siglec-3), CD52 (CAMPATH-1 antigen), CD326 (EpCAM), CA-125 (MUC16), MMP9, DLL3, CD274 (PD-L1), CEA, MSLN (mesothelin), CA19-9, CD73, CD205 (DEC205), CD51, c-MET, TRAIL-R2, IGF-1R, CD3, MIF, folate receptor alpha (FOLR1), CSF1, OX-40, CD137, TfR, MUC1, CD25 (IL-2R), CD115 (CSF1R), IL1B, CD105 (Endoglin), KIR, CD47, CEA, IL-17A, DLL4, CD51, angiopoietin 2, neuropilin-1, CD37, CD223 (LAG-3), CD40, LIV-1 (SLC39A6), CD27 (TNFRSF7), CD276 (B7-H3), Trop2, Claudin1 (CLDN1), PSMA, TIM-1 (HAVcr-1), CEACAM5, CD70, LY6E, BCMA, CD135 (FLT3), APRIL, TF(F3), nectin-4, FAP, GPC3, FGFR3, a killer-cell immunoglobulin-like receptors (KIRs), a TNF receptor protein, an immunoglobulin protein, a cytokine receptor, an integrin, activating NK cell receptors, and combinations thereof.
134. The composition of claim 123, wherein the targeting moiety is conjugated to the first polynucleotide using a coupling group, wherein the coupling group is an NHS ester, other activated ester, an alkyl or acyl halide, a bifunctional crosslinker, or maleimide group.
135. The composition of claim 123, wherein the first polynucleotide or second polynucleotide comprise a sequence selected from 20-mer poly-CA, 20-mer SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, 23-mer SEQ ID NO: 7, and SEQ ID NO:10.
136. The composition of claim 121, the binding affinity of the targeting moiety for the biological marker is less than 250 nM.
137. The composition of claim 123, the length of the first polynucleotide or the length of the second polynucleotide are 4 nt to 500 nt.
138. The composition of claim 122, the binding affinity between the first linker and the second linker is less than 250 nM.
139. The composition of claim 122, the first linker or the second linker is conjugated to a native functional group of the targeting unit or a surface of the human CD16.sup.+ natural killer cell, wherein the native functional group is an amino acid, a sugar, or an amine.
140. The composition of the claim 121, the targeting moiety is a peptide, protein, or aptamer.
141. A method of obtaining a composition substantially enriched in human CD16.sup.+ natural killer cells; the method comprising: (a) obtaining a population of human peripheral blood natural killer cells having the deposit number ATCC CRL-2407; (b) contacting the population of human peripheral blood natural killer cells with an antibody specific for a CD16 receptor; and (c) separating cells that are specifically bound by the antibody thereby obtaining the composition substantially enriched in human CD16.sup.+ natural killer cells; wherein the human CD16.sup.+ natural killer cell is: (A) deposited at NPMD having the deposit number NIT EE BP-03017; or (B) having the following characteristics: i) expressing a CD16 receptor, and ii) x) not including synthetic, genetically modified and/or deliberately delivered polynucleotide encoding the CD16 receptor, or y) by using ddPCR system to analyze the genomic DNA of the cell, the ratio of CD16 F176F probe-detectable DNA molecule to CD16 F176V probe-detectable DNA molecule is equal to or higher than 1, wherein the sequence of the CD16 F176F probe is SEQ ID NO: 11 and the sequence of the CD16 F176V probe is SEQ ID NO: 12.
142. The method according to claim 141, wherein the step (c) comprises substeps: (c1) separating cells that are specifically bound by the antibody; (c2) in a container, contacting the cells that are specifically bound by the antibody with a culture medium comprising human platelet lysate and IL-2; and (c3) culturing the cells for multiple days thereby obtaining the composition substantially enriched in human CD16.sup.+ natural killer cells.
143. The method according to claim 142, wherein the container comprises a bottom for seeding cells, and the bottom is air-permeable and water-impermeable.
144. The method according to claim 142, wherein the concentration of the dissolved glucose in the culture medium is 1500-5000 mg/L.
145. The method according to claim 142, the number of the human CD16.sup.+ natural killer cells in the composition is at least 5×10.sup.5, and the human CD16.sup.+ natural killer cells are in an amount equal to or more than 5% by number, based on the total number of the cells in the composition as 100%.
146. A method of culturing and expanding human CD16.sup.+ natural killer cells; the method comprising (x) in a container, contacting the human CD16.sup.+ natural killer cells with a culture medium comprising 0.5-10 vol % human platelet lysate and 100-3000 IU/mLIL-2; and (y) culturing the cells for multiple days.
147. The method according to claim 146, wherein the container comprises a bottom for seeding cells, and the bottom is air-permeable and water-impermeable.
148. The method according to claim 146, wherein the step (y) comprises substeps: (y1) culturing the cells for at least one day; and (y2) sub-culturing the cells for at least 1 months.
149. The method according to claim 146, wherein the human CD16.sup.+ natural killer cells are capable of retaining their capability to proliferate after subculture for at least 3 months.
150. The method according to claim 146, wherein the human CD16.sup.+ natural killer cell is: (A) deposited at NPMD having the deposit number NITE BP-03017; or (B) having the following characteristics: i) expressing a CD16 receptor, and ii) x) not including synthetic, genetically modified and/or deliberately delivered polynucleotide encoding the CD16 receptor, or y) by using ddPCR system to analyze the genomic DNA of the cell, the ratio of CD16 F176F probe-detectable DNA molecule to CD16 F176V probe-detectable DNA molecule is equal to or higher than 1, wherein the sequence of the CD16 F176F probe is SEQ ID NO: 11 and the sequence of the CD16 F176V probe is SEQ ID NO: 12.
151. A method of treating cancer, autoimmune disease, neuronal disease, human immunodeficiency virus (HIV) infection, hematopoietic cell-related diseases, metabolic syndrome, pathogenic disease, viral infection, or bacterial infection, comprising administering a composition comprising an effective amount of the human natural killer cell of claim 83 to a subject in need thereof.
152. The method according to claim 151, wherein the exogenous targeting unit is complexed to the human natural killer cell via an interaction between a first linker conjugated to the targeting moiety and a second linker conjugated to the human natural killer cell.
153. The method of claim 151, wherein the exogenous targeting unit comprises an antigen-binding unit.
154. The method of claim 152, wherein the antigen-binding unit is an antibody against a cancer antigen.
155. The method of the claim 151, the targeting moiety is a peptide, protein, or aptamer.
156. The method according to claim 151, wherein the human natural killer cell is capable of mediating an antibody-dependent cell cytotoxicity (ADCC) response, and the human natural killer cell is a male cell.
157. The method according to claim 151, wherein the method is for treating cancer.
158. The cell according to claim 83, wherein the cell further comprising a synthetic, genetically modified and/or deliberately delivered polynucleotide encoding a target-binding single-chain variable fragment (scFv) against an antigen.
159. The cell according to claim 157, wherein the cell is capable of mediating an antibody-dependent cell cytotoxicity (ADCC) response.
160. A method of treating cancer, autoimmune disease, neuronal disease, human immunodeficiency virus (HIV) infection, hematopoietic cell-related diseases, metabolic syndrome, pathogenic disease, viral infection, or bacterial infection, comprising administering a composition comprising an effective amount of the human natural killer cell of claim 157 to a subject in need thereof.
161. The method according to claim 159, wherein the number of the human natural killer cells in the composition is at least 5×10.sup.5 and the cells are in an amount equal to or more than 5% by number, based on the total number of the cells in the composition as 100%.
162. The method according to claim 159, wherein the method is for treating cancer.
163. A human natural killer cell which is deposited at NPMD having the deposit number NITE BP-03017.
164. A composition substantially enriched in human CD16.sup.+ natural killer cells, wherein the number of the human CD16.sup.+ natural killer cells in the composition is at least 5×10.sup.5 and the human CD16.sup.+ natural killer cells are in an amount equal to or more than 5% by number, based on the total number of the cells in the composition as 100%; the human CD16.sup.+ natural killer cell is deposited at NPMD having the deposit number NITE BP-03017.
Description
BRIEF DESCRIPTION OF THE DRAW
[0204]
[0205]
[0206]
[0207]
[0208]
[0209]
[0210]
[0211]
[0212]
[0213]
[0214]
[0215]
[0216]
[0217]
[0218]
[0219]
[0220]
[0221]
[0222]
[0223]
[0224]
[0225]
[0226]
[0227]
[0228]
[0229]
[0230]
DETAILED DESCRIPTION OF THE INVENTION
[0231] The following is a detailed description using the embodiments of the present invention as well as the techniques and features of the present invention, however, these embodiments are not intended to limit the invention, any changes and modifications made without departing from the spirit and scope of the invention by anyone who is familiar with this technology are intended to be included in the scope of the invention.
Embodiment 1: Obtaining Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line
[0232] Please refer to
[0233] Step S11: Obtaining a population of human peripheral blood natural killer cells derived from a cell population having the deposit number ATCC CRL-2407; Step S12: Contacting the population of human peripheral blood natural killer cells with an antibody specific for a CD16 receptor; Step S13: Separating cells that are specifically bound by the antibody thereby obtaining the non-transgenic human CD16.sup.+ natural killer cell line
[0234] Preferably, in Step S12, the CD16 receptor is a CD16a receptor.
[0235] Preferably, flow cytometry, bead, or any material with antibody-modified surface is used to separate the cells that are specifically bound by the antibody in Step S13.
[0236] Preferably, the term “non-transgenic human CD16 natural killer cell line” refers to non-genetically modified human CD16.sup.+ natural killer cell line and/or human CD16.sup.+ natural killer cell line without synthetic or exogenous polynucleotide sequence.
[0237] Detailed description of preferred embodiment is elaborated below.
Embodiment 1.1 Label and Sorting of Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line
[0238] This embodiment consists of an experimental group and a control group. The population of human peripheral blood natural killer cells with the deposit number ATCC CRL-2407 was centrifuged at a speed of 100˜1000×g for 3˜5 minutes. The supernatant was removed, and the population of human peripheral blood natural killer cells was resuspended with a buffer. The population of human peripheral blood natural killer cells was evenly distributed into the cell culture dishes of the control group and the experimental group. The population of human peripheral blood natural killer cells of experimental group was cultured in said cell culture dishes and then mixed with CD16 fluorescently labeled antibody (CD16-PE-Cy7, an antibody against CD16a receptor and CD16b receptor) to label the cells expressing CD16 receptor in the population of human peripheral blood natural killer cells; while the population of human peripheral blood natural killer cells of the control group was mixed with an equal volume of the buffer. The cells in the experimental group and control group were separately centrifuged, the supernatant was removed, and a sorting buffer was added to adjust the cell concentration to 1×10.sup.7 cells per mL. Finally, the cell population of the experimental and control groups were analyzed using a cell sorter.
[0239] Wherein, the buffer was Pre-Sort buffer. Flow cytometry sample preparation buffers, or Dulbecco's phosphate buffer saline (DPBS). The sorting buffer was Pre-Sort buffer, Flow cytometry sample preparation buffers, or Dulbecco's phosphate buffer saline (DPBS) supplemented with fetal bovine serum (FBS). The cell sorter was, for example, a flow cytometer of Becton Dickinson-FACSAria Illu model.
[0240] Preferably, the sorting buffer comprises 0.1˜10% (Volume percent, vol %, v/v) Fetal bovine serum (Fetal Bovine Serum, FBS).
[0241] Preferably, the sorting time is 1 hour, and the sorting speed is 50-70000 events/second.
[0242] After using the forward scatter (FSC) and side scatter (SSC) of the cell sorter to analyze 110,000 particles in the control group and the experimental p respectively, 6771 particles in the 10,000 particle in the control group were cells (that the number of cells is 67.7% when the number of particles is 100%), and 6944 particles in the 10,000 particles in the experimental group were cells (when the number of particles is 100″, the number of cells accounted for 69.4%).
[0243] The results for fluorescent analysis of the control group cells are shown in
[0244] In
[0245] The results in
[0246] The results in
[0247] Cells expressing the CD16 receptor were sorted from the experimental group cells in order to obtain high-purity CD16.sup.+ cells (hereinafter referred to as “purified CD16.sup.+ cell population”, “isolated oNK”, or “isolated non-transgenic human CD16.sup.+ natural killer cell line”.)
[0248] Please refer to
[0249] The aforesaid cells expressing CD16 receptor in the purified CD16.sup.+ cell population are non-transgenic cells; all of the aforesaid cells expressing CD16 receptor in the purified CD16.sup.+ cell population have the feature of CD3.sup.−CD56.sup.+ after analysis, they can be continuously subcultured and are non-tumorigenic; therefore, aforesaid cell expressing CD16 receptor in the purified CD16.sup.+ cell population is a novel non-transgenic human CD16.sup.+ natural killer cell line.
Embodiment 2: Culturing Human CD16.SUP.+ Natural Killer Cells
[0250] Please refer to
[0251] Step S21: Obtaining human CD16.sup.+ natural killer cells;
[0252] Step S22: In the container, contacting the human CD16.sup.+ natural killer cells with a culture medium comprising human platelet lysate and IL-2; and
[0253] Step S23: Culturing the human CD16.sup.+ natural killer cells for multiple days to proliferate the human CD16.sup.+ natural killer cells.
[0254] The following describes a specific embodiment of culturing a non-transgenic human CD16.sup.+ natural killer cell line by the present invention, but the application of the invention is not limited thereto, which means the invention can also be used for culturing other human CD16.sup.+ natural killer cells. For example, primary CD16.sup.+ natural killer cell isolated from autologous or allogeneic blood, CD16-transgenic NK-92 cell line, or other human CD16.sup.+ natural killer cells.
Embodiment 2.1 Culturing Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line
[0255] Step S21′: The purified CD16.sup.+ cell population (the proportion of cell expressing CD16 receptor was as high as 99%) sorted by Embodiment 1 was centrifuged and the supernatant was removed.
[0256] Step S22′: after resuspending the cells with 1 mL of cell culture medium, the cell suspension was placed in a first container to make the first container contain 6 54×10.sup.5 non-transgenic human CD16.sup.+ natural killer cell line in 40 mL cell culture medium; the cell culture medium comprises: 0.5%-30% (Volume percent, vol %, v/v) Human platelet lysate; 100-3000 IU/mL Interleukin 2 (IL-2); and DMEM culture medium (Dulbecco's Modified Eagle Medium), alpha modification of Eagle's minimum essential medium, or XVIVO 10 culture medium.
[0257] Step S23′: After multiple days of culture, a composition substantially enriched in human CD16.sup.+ natural killer cells was obtained, and in the composition substantially enriched in human CD16.sup.+ natural killer cells, the number of non-transgenic human CD16.sup.+ natural killer cell line is at lease 5×10.sup.5; the multiple days are, for example, 1 days to 3 years.
[0258] Preferably, the multiple days are 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, or 3 years.
[0259] Preferably, the cell culture medium comprises 0.5%, 1%, 1.5%, 1.6%, 2%, 2.5%, 2.6%, 3%, 3.5%, 3.6%, 4%, 4.5%, 4.6%, 5.0%, 5.1%, 5.5%, 5.6%, 6%, 6.1%, 6.5%, 6.6%, 7%, 7.1%, 7.5%, 7.6%, 8%, 8.1%, 8.5%, 8.6%, 9%, 9.1%, 9.5%, 9.6%, or 10% (Volume percent, vol %, v/v) human platelet lysate.
[0260] Preferably, the cell culture medium comprises 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, or 3000 IU/mL IL-2.
[0261] Preferably, Step S23 ‘further comprise substeps:
[0262] Step S231′: after multiple days of culture, the number of the cells in the cell culture medium reached the first cell number, and the first cell number was 1.25×10.sup.6˜5×10.sup.6;
[0263] Step S232′: The cell suspension was placed in a second container to make the number of cells in the second container be the first cell number; after multiple days of culture, the number of the cells reached the second cell number, and the second cell number was 5×10.sup.7˜1×10.sup.9; and
[0264] Step S233′: The cell suspension was placed in a third container to make the number of cells in the third container be the second cell number; after multiple days of culture, the number of the cells reached the third cell number in order to obtain a composition substantially enriched in human CD16.sup.+ natural killer cells; the third cell number was, for example, 5×10.sup.9, or 1×10.sup.40.
[0265] Wherein, the first container was, for example, a T25 cell culture flask (T25 flask), or G-Rex 6-well cell culture plate. The second and third containers comprised a gas permeable but water impermeable membrane, or, the second and third container can make concentration of the dissolved oxygen fully aerated or make the concentration of the dissolved glucose in the culture medium maintain in the 1500-5000 mg/L. Preferably, the second container was, for example, G-Rex 100M bottle (Product number 81100, WILSON WOLF, USA), the third container was, for example, G-Rex-500M (Product number 85500S, WILSON WOLF, USA). Please refer to the product manual of these containers for the instruction of using G-Rex 6M 6-well cell culture plate-, G-Rex 100M bottle, and G-Rex-500M.
[0266] In the steps S23′ and S231′˜S233′, 0.5%-30% (Volume percent, vol %, v/v) Human platelet lysate and 100-3000 IU/mL Interleukin 2 (IL-2) were added to a medium for culturing the cells And the medium is for example, DMEM culture medium (Dulbecco's Modified Eagle Medium), alpha modification of Eagle's minimum essential medium, XVIVO 10 culture medium, or X-VIVO 10 Serum-free Hemapoietic Cell Medium.
[0267] In the steps S23′ and S231′˜S233′, the cells were incubated under the condition of 37° C. and 5% carbon dioxide.
Embodiment 2.2 Detecting Cell Viability of the Cultured Cells Obtained from Embodiment 2.1
[0268] Each sample of the cell suspensions, which were obtained by culturing for different days with the culture method disclosed in the embodiments 2.1, was mixed with an equal volume of Trypan blue, and the number of cells and the cell survival rate were observed.
[0269] The experimental results showed that after culturing for 7, 16, 21, 28, 37, 42, 49, 65, 92, 97, 103, 134, 166, 184, and 202 days, the number of cells respectively reached 1.61×10.sup.6, 1.01×10.sup.9, 2.53×10.sup.9, 5.06×10.sup.9, 1.01×10.sup.10, 1.62×10.sup.10, 3.24×10.sup.10, 1.13×10.sup.11, 1.81×10.sup.15, 3.25×10.sup.16, 6.50×10.sup.17, 1.35×10.sup.22, 3.24×10.sup.27, 1.30×10.sup.33, and 1.04×10.sup.39. Please refer to
Embodiment 3: Detection of Cell Condition and Cell Surface Markers
Embodiment 3.1 Long-Term Culture of Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line by the Culture Method of the Present Invention
[0270] There are two experimental trials in this embodiment. The first batch of the purified CD16.sup.+ cell population and the second batch of the purified CD16.sup.+ cell population (the proportions of cells expressing the CD16 receptor in both of the batches were as high as 99%) were sorted by the method of Embodiment 1.1, then the first batch of the purified CD16.sup.+ cell population and the second batch of the purified CD16.sup.+ cell population were cultured respectively by the culture method of Embodiment 2.1 to obtain the cell suspensions of the first experimental trial and the cell suspensions of the second experimental trial. The first batch of the purified CD16.sup.+ cell population was cultured for 35 days in total, while the second batch of the purified CD16.sup.+ cell population was cultured for at least a long period of time until day 202.
Embodiment 3.2 Detecting the Condition of the Cultured Cells
[0271] Each sample of the cell suspensions, which were obtained at different time points in Embodiment 3.1, was centrifuged; the supernatant was removed, the cells were resuspended in the buffer, then mix with 1 μL of propidium iodide (PI). The cell sorter or flow cytometer was used to detect whether the cells were stained with propidium iodide to determine the percentage of cells that were undergoing apoptosis or have died.
Embodiment 3.3 Detection of CD56, CD3, and CD2 Surface Markers of the Cultured Cells
[0272] Each sample of the cell suspensions, which were obtained at different time points in Embodiment 3.1, was centrifuged; the supernatant was removed, the cells were resuspended in the buffer, then mixed with 1 μL of CD56 fluorescent labeled antibody (Cat. No. 318304, Biolegend, USA), 1 μL of CD3 fluorescent labeled antibody (Cat. No. 300410, Biolegend, USA), and 1 μL of CD2 fluorescent labeled antibody (Cat. No. 300222, Biolegend, USA) to simultaneously label cells expressing CD56 molecule, CD3 molecule, and/or CD2 molecule. Finally, the cell sorter or flow cytometer was used to analyze whether the cells exhibited CD56 molecules, CD3 molecules, and/or CD2 molecules, and the percentage of cells with various cell surface makers was calculated.
Embodiment 3.4 Detection of CD16 Surface Markers of the Cultured Cells
[0273] Each sample of the cell suspensions, which were obtained at different time points in Embodiment 3.1, was centrifuged; the supernatant was removed, the cells were resuspended in the buffer, then mixed with 1 μL of CD16 fluorescent labeled antibody (Cat. No. 302016, Biolegend, USA) to label cells expressing the CD16 receptor. Finally, the cell sorter was used to analyze whether the cells exhibited CD16 receptor, and the percentage of cells with CD16 receptor was calculated.
Embodiment 3.5 Detection of Cytotoxic Function of the Cultured Cells
[0274] xCELLigence Real Time Cell Analysis System (xCELLigence RTCA system, ACEA Biosciences Inc., USA) was used in this embodiment to detect the cytotoxic ability of the cultured cell toward target cells. This embodiment comprised a 96 well xCELLigence E-Plate to carry out cytotoxicity test, and the wells in xCELLigence E-Plate were divided into control wells, experimental wells, and target cell maximum lysis control well. The effector cells used in this embodiment were the cell suspensions obtained by culturing at different time points in Embodiment 3.1, and the target cells were SK-OV-3 cell line (HTB-77, purchased from ATCC), which is an adherent ovarian cancer cell line. SK-OV-3 cells were seeded in control well, experimental well, and target cell maximum lysis control well, so that each well-contained 20000 SK-OV-3 cells, and then allowed it to sit 30 minutes.
[0275] A sample of the cell suspension obtained in Embodiment 3.1 was added to the experimental well, and the ratio of the number of effector cell to the number of SK-OV-3 cells (target cells) was 2, 5 and 10; added a tenth equal volume of lysis buffer to the sample of cell suspension into target cell maximum lysis control well; any sample or lysis buffer was not added to control well. The xCELLigence E-Plate was placed in the xCELLigence Real Time Cell Analysis System to detect real time change in the cell index (CI) under the condition of 37° C. and 5% carbon dioxide.
[0276] Wherein, the greater the number of target cells attached to the bottom of the xCELLigence E-Plate, the higher the cell index detected by the xCELLigence Real Time Cell Analysis System. Therefore, the cell index can be used to convert the percentage of target cells that are lysed in the experimental well. The formula used to convert the cell index to the percentage of target cells that are lysed in the experimental well is:
Percentage of lysed target cell (%)=1−[(cell index of experimental well−cell index of target cell maximum lysis control well)(cell index of control well-cell index of target cell maximum lysis control well)]×100%
[0277] Please refer to Table 1 and Table 2. Table 1 shows the results of the cell suspensions obtained from the first experimental trial, and Table 2 shows the results of the cell suspension obtained from the second experimental trial.
[0278] In Table 1, the first column “day” indicates the number of culture days; the second column “PI.sup.+” indicates the percentage of cells undergoing apoptosis or have died, based on the total number of the cells in the cell suspension as 100%; since natural killer cells, CD4.sup.+ T cells, and CD8.sup.+ T cells all exhibit CD56.sup.+ (Pernick, N, 2018), so the third column “CD56.sup.+” indicates the percentage of the total number of natural killer cells, CD4.sup.+ T cells, and CD8.sup.+ T cells, based on the total number of the cells in the cell suspension as 100%; since T cells all exhibit CD3.sup.+ (Pernick, N, 2018), the fourth column “CD3.sup.+” indicates the percentage of cells that are not T cells, based on the total number of the cells in the cell suspension as 100%; since natural killer cells, peripheral blood T cells, and most thymocytes all exhibit CD2.sup.+ (Pernick, N, 2018) and the cells to be bested in Embodiment 3 are derived from peripheral blood, so the fifth column “CD2.sup.+” indicates the percentage of the total number of natural killer cells and T cells, based on the total number of the cells in the cell suspension as 100%; the sixth column “CD56.sup.+CD3.sup.+” indicates the percentage of natural killer cells, based on the total number of the cells in the cell suspension as 100%; the seventh column “CD56.sup.+CD2.sup.+” indicates percentage of the total number of natural killer cells and T cells, based on the total number of the cells in the cell suspension as 100%; since natural killer cell and macrophage exhibit CD16.sup.+ (Pernick, N, 2018), and CD16 is involved in Antibody-dependent cell cytotoxicity (ADCC), the eighth column “CD16.sup.+” indicates the percentage of the total number of natural killer cells and macrophages with ADCC function, based on the total number of the cells in the cell suspension as 100%; the ninth column “CD56.sup.+CD16.sup.+” indicates the percentage of natural killer cells with ADCC function, based on the total number of natural killer cells (i.e., CD56.sup.+CD3.sup.− cells) as 100%.
[0279] The indication of the first to eighth columns in Table 2 is the same as in Table 1; when the ninth column “killing test” marks “✓” symbol, this indicates that the cytotoxic function of the cells in the cell suspension at certain time point was simultaneously tested and confirmed that the cells have cytotoxic function.
[0280] Table 1 shows that (1) in the cell suspension that was obtained after the first batch of the purified CD16.sup.+ cell population (wherein the proportion of human CD16.sup.+ natural killer cell line is as high as 99%) was cultured for 7˜35 days, the percentage of cells undergoing apoptosis or have died is 5.65%˜7.34%, thus, the percentage of cell survival during culture is 92.66%˜94.35%; (2) in the cell suspension that was obtained after the first batch of the purified CD16.sup.+ cell population was cultured for 7˜35 days, the percentage of total number of natural killer cell, CD4.sup.+ T cell, and CD8.sup.+ T cell is 99.0˜99.56%, based on the total number of the cells in the cell suspension as 100%; (3) in the cell suspension that was obtained after the first batch of the purified CD16.sup.+ cell population was cultured for 7˜35 days, the percentage of cells that are not T cells is 99.8˜100%, based on the total number of the cells in the cell suspension as 100%; (4) in the cell suspension that was obtained after the first batch of the purified CD16.sup.+ cell population was cultured for 7˜35 days, the percentage of total number of natural killer cell and T cell is 98.0˜99.22%, based on the total number of the cells in the cell suspension as 100%; (5) in the cell suspension that was obtained after the first batch of the purified CD16.sup.+ cell population was cultured for 7˜35 days, the percentage of natural killer cells is 98.21˜98.76%, based on the total number of the cells in the cell suspension as 100%; (6) in the cell suspension that was obtained after the first batch of the purified CD16.sup.+ cell population was cultured for 7˜35 days, the percentage of total number of natural killer cell and T cell is 98.7˜99.33%, based on the total number of the cells in the cell suspension as 100%; (7) in the cell suspension that was obtained after the first batch of the purified CD16.sup.+ cell population was cultured for 7˜35 days, the percentage of the total number of natural killer cells and macrophages with ADCC function is 90.17˜92.36%, based on the total number of the cells in the cell suspension as 100%; (8) in the cell suspension that was obtained after the first batch of the purified CD16″ cell population was cultured for 7˜35 days, the percentage of natural killer cell with ADCC function is 88.79˜92.11%, based on the total number of natural killer cell (i.e., CD56.sup.+CD3.sup.− cell) as 100%.
[0281] Table 1 the test result of cell condition and cell surface marker of the cell suspension obtained by culturing the first batch of the purified CD16.sup.+ cell population.
TABLE-US-00001 PI.sup.+ CD56.sup.+ CD3.sup.− CD2.sup.+ CD56.sup.+CD3.sup.− CD56.sup.+CD2.sup.+ CD16.sup.+ CD56.sup.+/CD16.sup.+ (% of total (% of total (% of total (% of total (% of total (% of total (% of total (% of CD56.sup.+CD3.sup.− Day cells) cells) cells) cells) cells) cells) cells) cells) 7 6.54 99.45 100.00 98.08 98.76 99.01 90.17 — 16 5.65 99.08 99.96 98.86 98.21 98.78 90.35 — 21 7.34 99.56 99.9 98.75 98.71 99.33 90.67 — 23 — — — — — — — 88.79 26 — — — — — — — 90.51 28 7.18 99.33 99.88 99.22 98.29 99.15 92.36 — 30 — — — — — — — 92.11 35 — — — — — — — 91.37
[0282] Table 2 shows that (1) in the cell suspension that was obtained after the second batch of the purified CD16.sup.+ cell population (wherein the proportion of human CD16.sup.+ natural killer cell line is as high as 99%) was cultured for 7-202 days, the percentage of cells undergoing apoptosis or have died is 2.7%-10.5%, thus, the percentage of cell survival during culture is 89.5%-97.3%; (2) in the cell suspension that was obtained after the second batch of the purified CD16.sup.+ cell population was cultured for 7-202 days, the percentage of total number of natural killer cell, CD4.sup.+ T cell, and CD8.sup.+ T cell is 98.85%-99.65%, based on the total number of the cells in the cell suspension as 100%; (3) in the cell suspension that was obtained after the second batch of the purified CD16.sup.+ cell population was cultured for 7-202 days, the percentage of cells that are not T cells is 99.82%-100%, based on the total number of the cells in the cell suspension as 100%; (4) in the cell suspension that was obtained after the second batch of the purified CD16.sup.+ cell population was cultured for 7-202 clays, the percentage of total number of natural killer cell and T cell is 94.5%-99.68%, based on the total number of the cells in the cell suspension as 100%; (5) in the cell suspension that was obtained after the second batch of the purified CD16.sup.+ cell population was cultured for 7-202 days, the percentage of natural killer cells is 97.65%-99.05%, based on the total number of the cells in the cell suspension as 100%; (6) in the cell suspension that was obtained after the second batch of the purified CD16.sup.+ cell population was cultured for 7-202 days, the percentage of total number of natural killer cell and T cell is 97.83%-99.61%, based on the total number of the cells in the cell suspension as 100%; (7) in the cell suspension that was obtained after the second batch of the purified CD16.sup.+ cell population was cultured for 7-202 days, the percentage of the total number of natural killer cells and macrophages with ADCC function is 83.88%-94.04%%, based on the total number of the cells in the cell suspension as 100%; (8) The cell in the cell suspension that was obtained after the second batch of the purified CD16.sup.+ cell population was cultured for 7-202 days was confirmed to have cytotoxic function.
[0283] The cell suspension obtained by culturing for 28 days with the culture method disclosed in the embodiment 2.1 has been deposited at NPMD with the deposit number NITE BP-03017. The results disclosed in this invention indicate that the oNK cell line could retain its capability to proliferate after subculture for at least 3 months and thus may comprised deregulated genes responsible for cell growth control (e.g. the oNK cell line may comprised an inactive tumor suppressor gene, or a mutated and highly expressed oncogene).
[0284] Table 2 the test results of cell condition, cell surface marker and cytotoxicity of the cell suspension obtained by culturing the second batch of the purified CD16.sup.+ cell population.
TABLE-US-00002 PI.sup.+ CD56.sup.+ CD3.sup.− CD2.sup.+ CD56.sup.+CD3.sup.− CD56.sup.+CD2.sup.+ CD16.sup.+ Total cell (% of total (% of total (% of total (% of total (% of total (% of total (% of total Killing Day number cells) cells) cells) cells) cells) cells) cells) test 7 1.61 × 10.sup.6 5.97 99.45 100.00 98.08 98.76 99.01 90.17 16 1.01 × 10.sup.9 5.65 99.09 99.96 98.86 98.21 98.8 90.36 21 2.53 × 10.sup.9 6.2 99.56 99.91 98.75 98.72 99.33 90.7 28 5.06 × 10.sup.9 6.46 99.33 99.88 99.22 98.29 99.15 92.36 37 1.01 × 10.sup.10 10.5 98.85 99.99 98.48 97.65 98.66 91.96 42 1.62 × 10.sup.10 9.63 99.15 100.00 98.24 98.06 98.8 93.09 49 3.24 × 10.sup.10 6.31 98.99 100.00 94.5 97.71 97.83 94.04 65 1.13 × 10.sup.11 4.41 99.15 99.99 98.55 97.81 98.85 90.35 92 1.81 × 10.sup.15 2.7 99.62 99.99 99.43 98.58 99.42 85.99 ✓ 97 3.25 × 10.sup.16 7.91 99.23 99.90 99.58 98.3 99.05 86.98 ✓ 103 6.54 × 10.sup.17 3.17 99.65 99.82 99.5 98.71 99.45 83.88 ✓ 134 1.35 × 10.sup.22 3.09 99.62 99.99 99.68 98.75 99.42 86.18 ✓ 166 3.24 × 10.sup.27 4.74 99.17 100.00 99.06 99.05 99.61 89.93 ✓ 184 1.30 × 10.sup.33 7.87 99.61 99.99 98.23 98.77 99.37 92.38 ✓ 202 1.04 × 10.sup.39 5.36 99.59 99.96 97.52 98.94 99.33 93.02 ✓
Embodiment 4: Non-Tumorigenicity of Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line
[0285] Six to eight-week-old female BALB/c nude mice (purchased from The Jackson Laboratory or BioLasco, Taiwan) were used in this Embodiment. 30 mice were randomly assigned into six groups, which were a SK-OV-3 group, Raji group, Daudi group, oNK group. γ-ray irradiated ACE-oNK group, and DPBS group.
[0286] A human ovarian cancer cell line “SK-OV-3” (Purchased from ATCC; The deposit number is ATCC HTB-77), human B lymphoblastoid cell lines “Raji” (Purchased from ATCC; The deposit number is ATCC CCL-86) and “Daudi” (Purchased from ATCC; The deposit number is ATCC CCL-213), a cell suspension that was obtained by culturing for 88 days with the culture method disclosed in the embodiments 2.1 (88-day cultured oNK suspension of the present invention, refer to as 88-day cultured oNK suspension), and a γ-ray irradiated ACE-oNK cell suspension were used in this Embodiment. The method for preparing γ-ray irradiated ACE-oNK cell suspension was described below.
[0287] γ-ray irradiated ACE-oNK cell suspension: the cell suspension that was obtained by culturing for 84 days with the culture method disclosed in the embodiments 2.1 (84-day cultured oNK suspension of the present invention, refer to as 84-day cultured oNK suspension) were gamma irradiated at dose 10 Gy. After binding Trastuzumab to cells in the γ-ray irradiated 84-day cultured oNK suspension using a cell linker and a Trastuzumab linker which are complementary, they-ray irradiated ACE-oNK cell suspension were obtained.
[0288] The procedure of binding Trastuzumab to cells (e.g., natural killer cells, cells in the 60-day cultured oNK suspension, cells in the γ-ray irradiated 60-day cultured oNK suspension) was as follows: (A) The step of preparing cell linker and binding the cell linker to the cell in order to prepare a cell-ssDNA conjugate; (B) The step of preparing Trastuzumab linker and binding the Trastuzumab linker to Trastuzumab in order to prepare the Trastuzumab-ssDNA conjugate; (C) Mixing cell-ssDNA conjugate and Trastuzumab-ssDNA conjugate to combine cell-ssDNA conjugate and Trastuzumab-ssDNA conjugate through the cell linker and its complementary sequence on the Trastuzumab linker in order to prepare Trastuzumab-conjugated cells.
[0289] Wherein the step (A) of preparing cell linker and binding the cell linker to the cell comprises the following steps (a1)˜(a4):
[0290] Step (a1) A first single strand DNA was obtained, wherein the sequence of the first single strand DNA was SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7.
[0291] Step (a2) The 5′ end of the first single strand DNA was modified as 5′ end thiol-modified first single strand DNA to obtain the cell linker stock. The cell linker stock is also commercially available from Integrated DNA Technologies. Actual methods of modification are known, or will be apparent, to those skilled in the art (Zimmermann, J, 2010).
[0292] Step (a3) 10-500 μL cell linker stock and 0.1-10 μL NHS-Maleimide (commercially available from Fisher Scientific) were mixed and incubated for 1-60 minute(s).
[0293] Step (a4) The mixture obtained from Step (a3) were mixed with 1×10.sup.6-1×10.sup.8 cells and incubated for 1-60 minutes to obtain cell-ssDNA conjugate.
[0294] The step (B) of preparing Trastuzumab linker and binding the Trastuzumab linker to Trastuzumab comprises the following steps (b1)˜(b4):
[0295] Step (b1) A second single strand DNA was obtained, wherein the sequence of the second single strand DNA was SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO:10, and the sequence of the second single strand DNA is the complementary strand to the first single strand DNA.
[0296] Step (b2) The 5′ end of the second single strand DNA was modified as 5′ end thiol-modified second single strand DNA to obtain a Trastuzumab linker stock. The Trastuzumab linker stock is also commercially available from Integrated DNA Technologies. Actual methods of modification are known, or will be apparent, to those skilled in the art (Zimmermann, J, 2010).
[0297] Step (b3) 10-500 μL Trastuzumab linker stock and 0.1-10 μL NHS-Maleimide (commercially available from Fisher Scientific) were mixed and incubated for 1-60 minute(s).
[0298] Step (b4) The mixture obtained from Step (b3) were mixed with 10-100 μL Trastuzumab stock (commercially available from Roche) and incubated for 10 minutes to 3 hours to obtain Trastuzumab-ssDNA conjugate.
[0299] The cell-ssDNA conjugate and the Trastuzumab-ssDNA conjugate were mixed to obtain Trastuzumab-conjugated cell such as cells in the γ-ray irradiated ACE-oNK cell suspension.
[0300] 1×10.sup.7 SK-OV-3 cells, 1×10.sup.7 Raji cells, 1×10.sup.7 Daudi cells, 1×10.sup.7 cells in the 60-day cultured oNK suspension, and 1×10.sup.7 cells in γ-ray irradiated ACE-oNK cell suspension were suspended respectively in 100 μL of Dulbecco's Phosphate-Buffered Saline (DPBS) to obtain different cell suspensions. The cell suspensions and 100 μL of DPBS were subcutaneously implanted in female BALB/c nude mice in SK-OV-3 group, Raji group, Daudi group, oNK group, γ-ray irradiated ACE-oNK group, and DPBS group on Day 0 respectively. Tumor growth in each mouse was observed on Day 14, Day 21, Day 24, Day 42, and Day 59, and the mice were euthanized on Day 59.
[0301] Please refer to Table 3. Table 3 shows the results of tumor formation in nude mice xenografted with different cell lines.
[0302] Table 3 shows that there was no tumor formation in the mice of DPBS groups (negative control group) throughout the study period (0/5, 0%), while all five mice in SK-OV-3 group (positive control group) developed tumors (5/5, 100%). For mice xenografted with lymphoma cell line Daudi, 4 out of 5 mice in Daudi group developed tumors (4/5, 80%) that lasted until end of study (Day 59). For mice xenografted with lymphoma cell line Raji, 1 out of 5 (1/5) mice harbored detectable tumor before Day 42, but then returned to unmeasurable size by end of study.
[0303] For mice xenografted with oNK cells or γ-ray irradiated ACE-oNK cells of the present invention, there was no tumor formation in mice in oNK group and γ-ray irradiated ACE-oNK group throughout the study period (0/5, 0%). These study results provide evidence that non-irradiated oNK cells and the Trastuzumab-conjugated irradiated ACE-oNK cells are non-tumorigenic and safe for future clinical application and disease treatment.
[0304] Table 3 the results of tumor formation in nude mice xenografted with different cell lines.
TABLE-US-00003 Tumor incidence Cell type Day 14 Day 21 Day 24 Day 42 Day 59 SK-OV-3 5/5 5/5 5/5 5/5 5/5 suspension Raji 1/5 1/5 1/5 0/5 0/5 suspension Daudi 0/5 3/5 4/5 4/5 4/5 suspension oNK 0/5 0/5 0/5 0/5 0/5 suspension ACE-oNK-HER2 0/5 0/5 0/5 0/5 0/5 suspension DPBS 0/5 0/5 0/5 0/5 0/5
Embodiment 5: The Comparison of the Cytotoxic Activity Between the Cultured Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line and NK-92 Cell Line
[0305] The experimental method of this embodiment is almost the same as that of Embodiment 3.5, except that (1) the effector cell used in this embodiment is {circle around (1)} the cell suspension that was obtained by culturing for 33 days with the culture method disclosed in the embodiments 2.1 (33-day cultured oNK suspension of the present invention, refer to as 33-day cultured oNK suspension wherein the proportion of human CD16.sup.+ natural killer cell line is 91.74%), or {circle around (2)} the population of human peripheral blood natural killer cells having the deposit number ATCC CRL-2407 (refer to as NK-92 suspension wherein the proportion of NK-92 cell line is at least 98% as shown in
[0306] Please refer to
[0307] Thus, the result shows that: as compare with NK-92 cells (NK-92 is a CD16.sup.− natural killer cell line and thus unable to destroy cancer cells through ADCC process), oNK cells that were not activated to induce ADCC reaction could cause about 21-fold increase of cytotoxicity (49.68÷2.4=21). This is an unexpected result.
[0308] Moreover, based on this result, applicant believe that after isolating human CD16.sup.+ natural killer cell line from the 33-day cultured oNK suspension (cultured oNK) and isolating CD16.sup.− natural killer cell line (NK-92) from the NK-92 suspension, similar unexpected result could be observed.
Embodiment 6: The Comparison of the Cytotoxic Activity Between Different Amount of Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line
[0309] The experimental method of this embodiment is almost the same as that of Embodiment 3.5, except that (1) the effector cell used in this embodiment is {circle around (1)} the cell suspension that was obtained by culturing for X days with the culture method disclosed in the embodiments 2.1 (X-day cultured oNK suspension of the present invention wherein the proportion of human CD16.sup.+ natural killer cell line is 8.91%, refer to as suspension with small number of oNK cells), {circle around (2)} the cell suspension that was obtained by culturing for Y days with the culture method disclosed in the embodiments 2.1 Y-day cultured oNK of the present invention wherein the proportion of human CD16.sup.+ natural killer cell line is 64.15%, refer to as suspension with medium number of oNK cells), {circle around (3)} the cell suspension that was obtained by culturing for Z days with the culture method disclosed in the embodiments 2.1 (Z-day cultured oNK of the present invention wherein the proportion of human CD16.sup.+ natural killer cell line is 91.74%, refer to as suspension with large number of oNK cells), {circle around (4)} the population of human peripheral blood natural killer cells with the deposit number ATCC CRL-2407 (refer to as NK-92 suspension wherein the proportion of NK-92 cell line is at least 98% as shown in
[0310] The method for preparing the suspension with small number of ACE-oNK-HER2 cells, the suspension with medium number of ACE-oNK-HER2 cells, and the suspension with large number of ACE-oNK-HER2 cells were described below.
[0311] The suspension with small number of ACE-oNK-HER2 cells: the total cells in “the suspension with small number of oNK cells” were linked with Trastuzumab by using a cell linker and a Trastuzumab linker that are complementary, and therefore the suspension with small number of ACE-oNK-HER2 cells were obtained wherein the proportion of ACE-oNK-HER2 cells is about 8.91%.
[0312] The suspension with medium number of ACE-oNK-HER2 cells: the total cells in “the suspension with medium number of oNK cells” were linked with Trastuzumab by using a cell linker and a Trastuzumab linker that are complementary, and therefore the suspension with medium number of ACE-oNK-HER2 cells was obtained wherein the proportion of ACE-oNK-HER2 cells is about 64.15%.
[0313] The suspension with large number of ACE-oNK-HER2 cells: the total cells in “the suspension with large number of oNK cells” were linked with Trastuzumab by using a cell linker and a Trastuzumab linker that are complementary, and therefore the suspension with large number of ACE-oNK-HER2 cells was obtained wherein the proportion of ACE-oNK-HER2 cells is about 91.74%.
[0314] The procedure of binding Trastuzumab to cells (cells in the suspension with small number of oNK cells, the suspension with medium number of oNK cells, or the suspension with large number of oNK cells) is same as that of Embodiment 4.
[0315] Please refer to
[0316]
[0317] Thus, the result shows that: as compare with NK-92 cells (NK-92 is a CD16.sup.− natural killer cell line and thus unable to destroy cancer cells through ADCC process), the suspension with small number of oNK cells (wherein the proportion of human CD16.sup.+ natural killer cell line is 8.91%) is enough to cause about 10-fold increase of cytotoxicity (25÷2.4=10). This is an unexpected result. Therefore, it indicated that human CD16.sup.+ natural killer cell line in an amount equal to or more than 5% by number is enough to kill cancer cells, based on the total number of the cells in the composition as 100%. Based on this result, applicant believes that similar unexpected result could be observed in clinical trials.
[0318] The result also shows that the suspension with medium or large number of oNK cells (wherein the proportion of human CD16.sup.+ natural killer cell line is 64.15% or 91.74%) could cause about 20-21 fold increase of cytotoxicity (47.60÷2.4=20; 49.68÷2.4=21). Therefore, it indicates that the more the human CD16.sup.+ natural killer cell line, the more the cancer cells are killed and then reach a plateau as the human CD16.sup.+ natural killer cell line in an amount equal to about 60%-65% by number, based on the total number of the cells in the composition as 100%. Based on this result, applicant believes that similar result could be observed in clinical trials.
[0319]
[0320] Thus, the result shows that: when the non-transgenic human CD16.sup.+ natural killer cell line obtained by the culture of the present invention was linked with antibodies targeting the tumor-associated antigens (such as Trastuzumab) by using a cell linker and a antibody liner (such as Trastuzumab linker) which are complementary and thus could be activated to induce ADCC reaction, the cytotoxic effect was significantly increased by 14.4%-38.7% (62.00%−47.60%=14.4%; 63.70%−25.00%=38.7%).
[0321] The result also shows that exogeneous targeting unit complexed-oNK cell (such as anti-HER2 antibody-conjugated oNK cells) in an amount equal to or more than 5% by number is enough to kill cancer cells through ADCC process; it also indicates that the more the exogeneous targeting unit complexed-oNK cell, the more the cancer cells are killed through ADCC process and reach a first plateau as the exogeneous targeting unit complexed-oNK cell in an amount equal to about 5%-10% by number, based on the total number of the cells in the composition as 100%. Based on this result, applicant believes that similar result could be observed in clinical trials.
Embodiment 7: The Comparison of the Cytotoxic Activity Between the Anti-HER2 Antibody-Conjugated Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line and the Anti-HER2 Antibody Co-Cultured Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line
[0322] The experimental method of this embodiment is almost the same as that of Embodiment 3.5, except that (1) the effector cell used in this embodiment is {circle around (1)} cell suspensions obtained by culturing for 55 days with the culture method disclosed in the embodiments 2.1 (refer to as 55-day cultured oNK suspension), or {circle around (2)} cell suspension with ACE-oNK-HER2 cells (the total cells in “55-day cultured oNK suspension” were linked with Trastuzumab by using a cell linker and a Trastuzumab linker that are complementary as described in Embodiment 4); (2) the ratio of the number of effector cells (the total cells in the 55-day cultured oNK suspension or the total cells in the cell suspension with ACE-oNK-HER2 cells) to the number of SK-OV-3 cells (target cells) is 1:1 (ET1), 2:1 (ET2), or 5:1 (ET5); and (3) In the experimental wells for the 55-day cultured oNK suspension, equivalent amount of Trastuzumab as the total amount of the Trastuzumab linked to the cells in the cell suspension with ACE-oNK-HER2 cells at E:T ratio of 1 (0.55 ng), 2 (1.10 ng) and 5 (2.75 ng) was added. The detail procedure was described below.
[0323] The wells in xCELLigence E-Plate were divided into control wells, ACE-oNK-HER2 ET1 experimental well, ACE-oNK-HER2 ET2 experimental well, ACE-oNK-HER2 ET5 experimental well, oNK and Herceptin ET1 experimental well, oNK and Herceptin ET2 experimental well, oNK and Herceptin ET5 experimental well, and target cell maximum lysis control well. SK-OV-3 cells were seeded in control well, ACE-oNK-HER2 ET1 experimental well, ACE-oNK-HER2 ET2 experimental well, ACE-oNK-HER2 ET5 experimental well, oNK and Herceptin ET1 experimental well, oNK and Herceptin ET2 experimental well, oNK and Herceptin ET5 experimental well, and target cell maximum lysis control well, so that each well-contained 20000 SK-OV-3 cells, and then allowed it to sit 30 minutes.
[0324] 20000, 40000, or 100000 cells in the cell suspension with ACE-oNK-HER2 cells was added to the ACE-oNK-HER2 ET1 experimental well, ACE-oNK-HER2 ET2 experimental well, and ACE-oNK-HER2 ET5 experimental well respectively; hence, the ratio of the number of effector cell (the total cells in the cell suspension with ACE-oNK-HER2 cells) to the number of SKOV-3 cells (target cells) was 1, 2 and 5.
[0325] Both of 20000, 40000, or 100000 cells in the 55-day cultured oNK suspension and 0.55, 1.10, or 2.75 ng of Trastuzumab (an antibody against HER2 protein with product name as Herceptin was purchased from Roche, Swiss) were added to the “oNK and Herceptin ET1 experimental well”, “oNK and Herceptin ET2 experimental well”, and “oNK and Herceptin ET5 experimental well” respectively. Therefore, the ratio of the number of effector cell (the total cells in the 55-day cultured oNK suspension) to the number of SK-OV-3 cells (target cells) was 1, 2 and 5; the amount of Trastuzumab in the “oNK and Herceptin ET1 experimental well”, “oNK and Herceptin ET2 experimental well”, or “oNK and Herceptin ET5 experimental well” was respectively same as the total amount of the Trastuzumab linked to the cells in the ACE-oNK-HER2 ET1 experimental well, ACE-oNK-HER2 ET2 experimental well, and ACE-oNK-HER2 ET5 experimental well.
[0326] Please refer to
[0327] Thus, the result shows that: as compare with oNK cells that were co-cultured with IgG antibodies targeting the tumor-associated antigens, ACE-oNK-HER2 cells that were linked (conjugated) with IgG antibodies targeting the tumor-associated antigens could cause 9-∞ fold increase of cytotoxicity at lower doses (ET1 with 0.55 ng Trastuzumab, or ET2 with 1.10 ng Trastuzumab; 65.60÷7.30=9; 31.40÷0.00=∞; ∞ is a symbol that represents an infinitely large number). That is, “linking CD16.sup.+ natural killer cells with anti-tumor antigen antibody” (e.g. linking cultured oNK with Trastuzumab) makes an unexpected result, and linking CD16.sup.+ natural killer cells with anti-tumor antigen antibody” make effective and safer therapy based on lower dose treatment could be achieved.
[0328] Moreover, based on this result, applicant believes that after isolating human CD16.sup.+ natural killer cell line from the 55-day cultured oNK suspension (cultured oNK) and isolating Trastuzumab-linked CD16.sup.+ natural killer cells (ACE-oNK-HER2 cells) from the cell suspension with ACE-oNK-HER2 cells, similar unexpected result could be observed.
Embodiment 8: Detection of Genomic DNA of Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line
Embodiment 8.1 Detection of DNA Sequence Encoding CD16 Receptor by Droplet Digital PCR (ddPCR
[0329] Droplet Digital PCR (ddPCR) was used in this embodiment to detect DNA sequence encoding CD16 receptor of cultured non-transgenic human CD16.sup.+ natural killer cell line in the present invention (oNK) or CD16-transgenic NK-92 cell line (yNK).
[0330] Cell suspensions obtained by culturing for M days with the culture method disclosed in the embodiments 2.1 (refer to as M-day cultured oNK suspension) and CD16-transgenic NK-92 cell line (Purchased from ATCC with the deposit number is ATCC PTA-6967; refer to as yNK) were used in this embodiment. Genomic DNA of yNK and cells in the M-day cultured oNK suspension were isolated by Blood & Cell Culture DNA Mini Kit (Purchased from Qiagen).
[0331] yNK sample or oNK sample: 50 ng genomic DNA isolated from yNK or M-day cultured oNK suspension was mixed with 10 μL ddPCR™ Supermix for Probes (2X) (Catalog number #1863026; Purchased from Bio-Rad), 1 μL BstXI restriction enzyme (Product name BstXI; Catalog number R0113S; Purchased form BioLabs), and 1 μL Mixture of CD16 F176F hydrolysis probe and CD16 F176V hydrolysis probe (Assay ID: C_25815666_10; Purchased form ThermoFisher; The Context Sequence [VIC/FAM]: TCTGAAGACACATTTTTACTCCCAA[C/A]AAGCCCCCTGCAGAAGTAGGAGCCG (SEQ ID NO: 41); https://www.thermofisher.com/order/genome-database/details/genotyping/C_25815666_10?CID=&ICID=&subtype=), and the final volume is 20 μL.
[0332] No-template control sample: water, 10 μL ddPCR™ Supermix for Probes (2X), BstXI restriction enzyme, and 1 μL Mixture of CD16 F176F hydrolysis probe and CD16 F176V hydrolysis probe were mixed, and the final volume is 20 μL.
[0333] ddPCR experiments were performed using the QX100/QX200 Droplet Digital PCR (ddPCR) system (Purchased from Bio-Rad). First, samples are placed into a QX100 or QX200 Droplet Generator (a machine in the QX100/QX200 Droplet Digital PCR system) to partition each sample into 15000-20000 droplets (nanoliter-sized droplet).
[0334] Second, the wells in the 96 well plate (Product name: DG8 cartridge; Purchased from Bio-Rad) were divided into no-template control well, yNK well, and oNK well, and these wells are for no-template control group (NTC group), yNK group, and oNK group respectively. Nanolized no-template control sample, yNK sample, and oNK sample were respectively transferred into the no-template control well, yNK well, and oNK well.
[0335] Third, for the PCR amplification process, thermocycling conditions were 95° C. for 10 min, 45 cycles of 95° C. for 15 s, and 60° C. for 1 min, followed by 98° C. for 10 min then hold at 4° C. The ramp rate for each step was set to 2° C./s.
[0336] CD16 F176F hydrolysis probe is a probe labeled with FAM reporter fluorophore, and CD16 F176V hydrolysis probe is a probe labeled with VIC reporter fluorophore. The main steps in the PCR amplification process are denaturation, annealing, and extension. During annealing, the hydrolysis probe (such as CD16 F176F hydrolysis probe or CD16 F176V hydrolysis probe) binds to the target sequence; then during extension, the reporter labeled at the 5′ end of the probe is cleaved and free reporter fluoresces. The sequence of CD16 F176F hydrolysis probe is SEQ ID NO:11 and thus is expected to be able to detect DNA sequence encoding CD16 receptor located on q arm of chromosome 1 at position 1q23.3; the sequence of CD16 F176V hydrolysis probe is SEQ ID NO:12 and is expected to be able to detect the synthetic DNA sequence in yNK.
[0337] Please note that the DNA sequence encoding CD16 receptor located on q arm of chromosome 1 at position 1q23.3 in oNK would be transcribed to CD16 F176F mRNA then translated to CD16 F176F protein, wherein the sequence of the DNA encoding CD16 receptor located on q arm of chromosome 1 at position 1q23.3 in oNK comprises SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:19; the sequence of CD16 F176F mRNA comprises SEQ ID NO:13; the sequence of CD16 F176F protein comprises SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:14, or SEQ ID NO:20. The synthetic DNA sequence encoding CD16 receptor in yNK would be transcribed to CD16 F176V mRNA then translated to CD16 F176V protein, and the sequence of CD16 F176V mRNA is SEQ ID NO:15; the sequence of CD16 F176V protein is SEQ ID NO:16.
[0338] Forth, for droplet reading process, droplets were read using a QX100/QX200 Droplet Reader (a machine in the QX100/QX200 Droplet Digital PCR system), in which droplets were spaced out individually for fluorescence reading and therefore each droplet was analyzed individually using a two-color detection system (set to detect FAM and VIC). Positive droplets, which contain at least one copy of the target DNA molecule (such as CD16 F176F hydrolysis probe detected DNA molecule or CD16 F176V hydrolysis probe detected molecule), exhibit increased fluorescence compared to negative droplets.
[0339] Please refer to
[0340] In NTC group, there were only 1 positive droplet containing CD16 F176F hydrolysis probe-detectable DNA molecule and 4 positive droplets containing CD16 F176V hydrolysis probe-detectable DNA molecules in total 14568 collected droplets (events). In yNK group, there were 6737 positive droplets containing CD16 F176F hydrolysis probe-detectable DNA molecules and 8152 positive droplets containing CD16 F176V hydrolysis probe-detectable DNA molecules in total 14230 collected droplets (events). In oNK group, there were 7637 positive droplets containing CD16 F176F hydrolysis probe-detectable DNA molecules and 5333 positive droplets containing CD16 F176V hydrolysis probe-detectable DNA molecule in total 14230 collected droplets (events).
[0341] Thus, the result shows that using ddPCR system to analyze the genomic DNA of yNK cells, the ratio of CD16 F176F hydrolysis probe-detectable DNA molecule to CD16 F176V hydrolysis probe-detectable DNA molecule was 0.83 (6737÷8152=0.83), whereas using ddPCR system to analyze the genomic DNA of oNK cells, the ratio of CD16 F176F hydrolysis probe-detectable DNA molecule to CD16 F176V hydrolysis probe-detectable DNA molecule was 1.43 (7637÷5333=1.43).
[0342] That is, by using ddPCR system to analyze the genomic DNA of human CD16.sup.+ natural killer cell line (oNK) in the present invention, the ratio of CD16 F176F hydrolysis probe-detectable DNA molecule to CD16 F176V hydrolysis probe-detectable DNA molecule was equal to or higher than 1 (the number of CD16 F176F probe detectable DNA molecule÷the number of CD16 F176V probe detectable DNA molecule ≥1).
[0343] Moreover, based on this result, applicant believes that after isolating human CD16.sup.+ natural killer cell line from the M-day cultured oNK suspension (cultured oNK), similar result could be observed.
[0344] Based on applicant's experience, another hydrolysis probes with sequence SEQ ID NO:17 or SEQ ID NO:18 could detect DNA sequence encoding CD16 receptor in other CD16-transgenic NK cells.
Embodiment 8.2 Detection of DNA Sequence Encoding CD16 Receptor by Fluorescence In Situ Hybridization (FISH
[0345] Two-color fluorescence in situ hybridization (FISH) was used in this embodiment to detect transgenic, synthetic, genetically modified, or deliberately delivered DNA sequence encoding the CD 16a receptor in human natural killer cells.
[0346] The cultured non-transgenic human CD16.sup.+ natural killer cell line in the present invention (oNK) is used as an example to show the result of the human cell with no transgenic, synthetic, genetically modified, or deliberately delivered DNA sequence encoding the CD 16 receptor, whereas the CD16-transgenic NK-92 cell line (yNK) is used as an example to show the result of the human cell with transgenic, synthetic, genetically modified, or deliberately delivered DNA sequence encoding the CD 16 receptor.
[0347] For the detail, the isolated CD16.sup.+ NK cells (oNK cells) from the cell suspensions obtained by culturing for N days with the culture method disclosed in the embodiments 2.1 (refer to as N-day cultured oNK suspension) and CD16-transgenic NK-92 cell line (Purchased from ATCC with the deposit number is ATCC PTA-6967; refer to as yNK) were used in this embodiment.
[0348] Kallioniemi disclosed the details of the two-color fluorescence in situ hybridization (FISH) method in 1996, and a short extract is presented below.
[0349] First, nuclei from 1×10.sup.7 yNK cells or oNK cells (CD16.sup.+ NK cells) isolated form the N-day cultured oNK suspension are prepared according to protocols used in DNA flow cytometry (Kallioniemi et al., 1996; Vindelov et al., 1983). For the detail, the cell pellet is incubated in a hypotonic detergent solution and brief trypsin digestion.
[0350] Second, nuclei are dropped on microscope slides, air-dried, and fixed in methanol acetic acid.
[0351] Third, prior to hybridization, the target cells are treated with proteinase K or other proteolytic enzymes to improve probe penetration.
[0352] Forth, denaturation of target cells is usually accomplished by immersing slides in a denaturation solution (70% formamide, 2×SSC) for 2-4 min at 70° C., followed by ethanol fixation and dehydration. Denaturation time and temperature have to be optimized according to the characteristics of the target cells.
[0353] Fifth, Prior to hybridization, 20-60 ng of the first fluorescent dye-labeled FCGR3A FISH Probe (a test probe that could detect all of the human DNA sequence encoding CD16a receptor; Purchased from Empire Genomics), 20-60 ng of the second fluorescent dye-labeled Chromosome 1 Control Probe (a reference probe; Purchased from Empire Genomics), and blocking DNA (unlabeled Cot-1 or placental DNA) are added to a formamide-based hybridization buffer. It is necessary to use the blocking DNA when the probe contains repetitive sequences that will hybridize to multiple locations in the genome. Hybridization mixture is heated to 70° C. for 5 min to denature the probe fragments then applied on the target slide; a cover slip is applied and sealed with rubber cement. Hybridization is performed overnight at 37° C. in a moist chamber.
[0354] Sixth, unbound probes are washed.
[0355] Seventh, Target nuclei are counterstained with a DNA stain, typically propidium iodide or DAPI.
[0356] The hybridizations are evaluated with a regular high-quality epifluorescence microscope. Almost any recent microscope model from the major manufacturers (Zeiss, Leitz, Olympus, and Nikon) is suitable for gene-specific FISH analysis; the 60X Plan Apos or other objectives in which chromatic aberrations are carefully corrected are preferred. The number of test and reference probe signals is evaluated from a minimum of 100 randomly chosen nuclei throughout the slide. Only morphologically intact and nonoverlapping nuclei are counted. Because the nuclei are three-dimensional, it is necessary to move the focus throughout the depth of the nuclei to obtain the correct signal count.
[0357] Several formats are typically used for reporting the results of gene-specific FISH, for example: (1) the number of test probe signals per cell; (2) the number of signals per cell from the test probe divided by those from the reference probe; or (3) the percentage of cells where the test probe signal number is present at a higher or lower copy number than the reference probe.
[0358] Please refer to
[0359] Based on applicant's experience, the number of FCGR3A FISH Probe (a test probe which could detect all of the human DNA sequence encoding CD16a receptor) signals per oNK cell would be 2 (the actual gene copy number per cell), and two-color FISH pattern of oNK would look like
Embodiment 9: Effect of Freezing and Thawing on the Survival Rate of Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line
[0360] The purified CD16.sup.+ cell population (the proportion of cells expressing CD16 receptor was as high as 99%) was sorted by the method of Embodiment 1.1, and then the purified CD16.sup.+ cell population was cultured for 21 days by the culture method of Embodiment 2.1 (purified CD CD16.sup.+ cell population was subcultured for 8 times). The sample of the cell solution was mixed with an equal volume of Trypan blue, then subjected to cell count and learned that the cell survival rate is 95%. Take a sufficient amount of the cell solution that contained 2×10.sup.7 viable cells, then perform the following freezing and thawing procedures.
[0361] Freezing procedure: centrifuged the cell solution containing 2×10.sup.7 viable cells, and removed the supernatant then resuspend the cell using 1 mL of frozen medium (CryoStor® CS10 Freeze Media, containing 10 vol % DMSO, BioLife Solutions, USA). The cell suspension was placed in a cryotube, and the cryotube was placed in the CoolCell Cell freezing container (Corning, USA), then stored the CoolCell Cell freezing container in a −80° C. refrigerator overnight (which decreased 1° C. per minute). The cryotube was transferred and stored in liquid nitrogen for 17 days.
[0362] Thawing procedure: place the cryotube in a 37° C. water bath to quickly thaw the cell suspension, and mix 1 mL of cell suspension with 9 mL of cell culture medium in Embodiment 2.1. After mixing a sample of the cell mixture with an equal volume of Trypan blue, the cell number and cell viability were observed.
[0363] The experimental results showed that 1.95×10.sup.7 cell survived after thawing, and the Recovery rate was as high as 97.5%[(1.95×10.sup.7)÷(2×10.sup.7)×100%=97.5%], and the cell survival rate was 96% that had no significant difference from viability (95%) before freezing.
Embodiment 10: Cytotoxic Activity of Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line
[0364] The experimental method of this embodiment is almost the same as that of Embodiment 3.5, except that (1) the effector cell used in this embodiment is Ctrl oNK cells, Ctrl yNK cells, ACE-oNK cells, or ACE-yNK cells; and (2) the ratio of the number of effector cells to the number of SKOV-3 cells (target cells) is 2:1 (ET2) or 5:1 (ET5).
[0365] Ctrl oNK cell: Ctrl oNK cells are the cultured cell population after the purified CD16.sup.+ cell populations (wherein the proportion of non-transgenic human CD16.sup.+ natural killer cell line is as high as 99%) were cultured for 26 days by using the method of Embodiment 2.1.
[0366] Ctrl yNK cell: Ctrl yNK cells are CD16-transgenic NK-92 cell line (Purchased from ATCC; The deposit number is ATCC PTA-6967);
[0367] ACE-oNK cell: ACE-oNK cells are cells obtained by binding Trastuzumab to Ctrl oNK cells using a cell linker and a Trastuzumab linker that are complementary.
[0368] ACE-yNK cell: ACE-yNK cells are cells obtained by binding Trastuzumab (an antibody against HER2 protein, product name as Herceptin, purchased from Roche Swiss) to Ctrl yNK cells using a cell linker and a Trastuzumab linker that are complementary.
[0369] The procedure of binding Trastuzumab to natural killer cells (e.g., Ctrl oNK cells or Ctrl yNK cells) are as follows: (A) The step of preparing cell linker and binding the cell linker to the natural killer cell in order to prepare an NK-ssDNA conjugate; (B) The step of preparing Trastuzumab linker and binding the Trastuzumab linker to Trastuzumab in order to prepare the Trastuzumab-ssDNA conjugate; (C) Mixing NK-ssDNA conjugate and Trastuzumab-ssDNA conjugate to combine NK-ssDNA conjugate and Trastuzumab-ssDNA conjugate through the cell linker and its complementary sequence on the Trastuzumab linker in order to prepare Trastuzumab-conjugated natural killer cells (e.g., ACE-oNK cells or ACE-yNK cells).
[0370] Wherein the step (A) of preparing cell linker and binding the cell linker to the natural killer cell comprises the following steps (a1)˜(a4):
[0371] Step (a1) A first single strand DNA was obtained, wherein the sequence of the first single strand DNA was SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7.
[0372] Step (a2) The 5′ end of the first single strand DNA was modified as 5′ end thiol-modified first single strand DNA to obtain the cell linker stock. The cell linker stock is also commercially available from Integrated DNA Technologies. Actual methods of modification are known, or will be apparent, to those skilled in the art (Zimmermann, J, 2010).
[0373] Step (a3) 10-500 μL cell linker stock and 0.1-10 μL NHS-Maleimide (commercially available from Fisher Scientific) were mixed and incubated for 1-60 minute(s).
[0374] Step (a4) The mixture obtained from Step (a3) were mixed with 1×10.sup.6-1×10.sup.8 natural killer cells and incubated for 1-60 minutes to obtain NK-ssDNA conjugate.
[0375] the step (B) of preparing Trastuzumab linker and binding the Trastuzumab linker to Trastuzumab comprises the following steps (b1)˜(b4):
[0376] Step (b1) A second single strand DNA was obtained, wherein the sequence of the second single strand DNA was SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO:10, and the sequence of the second single strand DNA is the complementary strand to the first single strand DNA.
[0377] Step (b2) The 5′ end of the second single strand DNA was modified as 5′ end thiol-modified second single strand DNA to obtain the Trastuzumab linker stock. The Trastuzumab linker stock is also commercially available from Integrated DNA Technologies. Actual methods of modification are known, or will be apparent, to those skilled in the art (Zimmermann, J, 2010).
[0378] Step (b3) 10-500 μL Trastuzumab linker stock and 0.1-10 μL NHS-Maleimide (commercially available from Fisher Scientific) were mixed and incubated for 1-60 minute(s).
[0379] Step (b4) The mixture obtained from Step (b3) were mixed with 10-100 μL Trastuzumab stock (commercially available from Roche) and incubated for 10 minutes to 3 hours to obtain Trastuzumab-ssDNA conjugate.
[0380] Please refer to
[0381] Please refer to
[0382] The results of
[0383] The results in
Embodiment 11: Culturing Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line with Different Concentration of Human Platelet Lysate
[0384] The experimental method of this embodiment is almost the same as that of Embodiment 2.1, except that (1) in Step S22′, all of the cells in the cell suspensions obtained by culturing for 9 days with the culture method disclosed in the embodiments 2.1 (refer to as 9-day cultured oNK suspension) were cultured in this embodiment and the number of cells in the first container in Step S22′ was 5×10.sup.6; and (2) the cell culture medium comprises 500 IU/mL IL-2 and {circle around (1)} 2.5% human platelet lysate, {circle around (2)} 5.0% human platelet lysate, {circle around (3)} 10.0% human platelet lysate, or {circle around (4)} 5.0% human serum (comprising no human platelet lysate).
[0385] The experimental method of detecting cell number, cell viability, and CD16 surface marker of the cultured cells in this embodiment is the same as that of Embodiment 2.2 and 3.4.
[0386] Please refer to
[0387]
[0388]
[0389]
[0390] Moreover, based on this result, applicant believes that after isolating human CD16.sup.+ natural killer cell line from the 9-day cultured oNK suspension (cultured oNK), similar result could be observed.
Embodiment 12: Culturing Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line with Different Concentration of IL-2
[0391] The experimental method of this embodiment is almost the same as that of Embodiment 2.1, except that (1) in Step S22′, all of the cells in the cell suspensions obtained by culturing for 9 days with the culture method disclosed in the embodiments 2.1 (refer to as 9-day cultured oNK suspension) were cultured in this embodiment and the number of cells in the first container in Step S22′ was 5×10.sup.6; and (2) the cell culture medium comprises 5.0% human platelet lysate and {circle around (1)} 100 IU/mL IL-2, {circle around (2)} 200 IU/mL IL-2, 500 IU/mL IL-2, 750 IU/mL IL-2, or 1000 IU/mL IL-2.
[0392] Please note that both of IL-2 and human platelet lysate were required for expansion human CD16.sup.+ natural killer cells. In this embodiment, 1.8×10.sup.7 IU/mL IL-2 was equal to 1.1 mg/mL IL-2. Therefore, 100 IU/mL IL-2 was equal to 0.0612 μg/mL IL-2; 200 IU/mL IL-2 was equal to 0.1224 μg/mL IL-2; 500 IU/mL IL-2 was equal to 0.306 μg/mL IL-2; 750 IU/mL IL-2 was equal to 0.459 μg/mL IL-2; and 1000 IU/mL IL-2 was equal to 0.612 μg/mL IL-2.
[0393] The experimental method of detecting cell number, cell viability, and CD16 surface marker of the cultured cells in this embodiment is the same as that of Embodiment 2.2 and 3.4.
[0394] Please refer to
[0395]
[0396]
[0397]
[0398] Moreover, based on this result, applicant believes that after isolating human CD16.sup.+ natural killer cell line from the 9-day cultured oNK suspension (cultured oNK), similar results could be observed.
Embodiment 13: Culturing Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line in Different Container
[0399] The experimental method of this embodiment is almost the same as that of Embodiment 2.1, except that (1) in Step S22′, all of the cells in the cell suspensions obtained by culturing for 9 days with the culture method disclosed in the embodiments 2.1 (refer to as 9-day cultured oNK suspension) were cultured in this embodiment and the number of cells in the first container in Step S22′ was 5×10.sup.6; (2) the cell culture medium comprises 500 IU/mL IL-2 and 5.0% human platelet lysate; and (3) the containers used in this embodiment are {circle around (1)} air-permeable container such as G-Rex 6-well culture plate or {circle around (2)} non air-permeable container such as T25 cell culture flask.
[0400] The experimental method of detecting cell number, cell viability, and CD16 surface marker of the cultured cells in this embodiment is the same as that of Embodiment 2.2 and 3.4.
[0401] Please refer to
[0402]
[0403]
[0404]
[0405] Moreover, based on this result, applicant believes that after isolating human CD16.sup.+ natural killer cell line from the 9-day cultured oNK suspension (cultured oNK), similar result could be observed.
Embodiment 14: Prepare Exogenous Targeting Unit Complexed-oNK Cells
[0406] In this embodiment, applicant prepares an exogenous targeting unit complexed-oNK cell to which at least an exogenous targeting unit complexed. The exogenous targeting unit comprises an targeting moiety which exhibits specific binding to a biological marker on a target cell, and the targeting moiety could bind to a biological marker selected form cancer antigen, glycolipid, glycoprotein, cluster of differentiation antigen present on cells of a hematopoietic lineage, gamma-glutamyltranspeptidase, adhesion protein, hormone, growth factor, cytokine, ligand receptor, ion channel, membrane-bound form of an immunoglobulin μ. chain, alfa-fetoprotein, C-reactive protein, chromogranin A, epithelial mucin antigen, human epithelium specific antigen, Lewis(a) antigen, multidrug resistance related protein, Neu oncogene protein, neuron specific enolase, P-glycoprotein, multidrug-resistance-related antigen, p170, multidrug-resistance-related antigen, prostate specific antigen, NCAM, ganglioside molecule, MART-1, heat shock protein, sialylTn, tyrosinase, MUC-1, HER-2/neu, KSA, PSMA, p53, RAS, EGF-R, VEGF, or MAGE. The targeting moiety is not a nucleic acid and is not produced by the exogenous targeting unit complexed-oNK cell.
[0407] The procedure of binding a targeting moiety (such as Trastuzumab which is against HER2 protein) to oNK cells are as follows: (A) The step of preparing cell linker and binding the cell linker to the natural killer cell in order to prepare an NK-ssDNA conjugate; (B) The step of preparing targeting moiety linker (such as Trastuzumab linker) and binding the targeting moiety linker to the targeting moiety in order to prepare the targeting moiety-ssDNA conjugate; (C) Mixing NK-ssDNA conjugate and targeting moiety-ssDNA conjugate to combine NK-ssDNA conjugate and targeting moiety-ssDNA conjugate through the cell linker and its complementary sequence on the targeting moiety linker in order to prepare exogenous targeting unit complexed-conjugated natural killer cells (e.g., ACE-oNK cells or ACE-yNK cells).
[0408] Wherein the step (A) of preparing cell linker and binding the cell linker to the natural killer cell comprises the following steps (a1)˜(a4):
[0409] Step (a1) A first single strand DNA was obtained, wherein the sequence of the first single strand DNA was SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7.
[0410] Step (a2) The 5′ end of the first single strand DNA was modified as 5′ end thiol-modified first single strand DNA to obtain the cell linker stock. The cell linker stock is also commercially available from Integrated DNA Technologies. Actual methods of modification are known, or will be apparent, to those skilled in the art (Zimmermann, J, 2010).
[0411] Step (a3) 10-500 μL cell linker stock and 0.1-10 μL NHS-Maleimide (commercially available from Fisher Scientific) were mixed and incubated for 1-60 minute(s).
[0412] Step (a4) The mixture obtained from Step (a3) were mixed with 1×10.sup.6-1×10.sup.8 natural killer cells and incubated for 1-60 minutes to obtain NK-ssDNA conjugate.
[0413] The step (B) of preparing targeting moiety linker and binding the targeting moiety linker to targeting moiety comprises the following steps (b1)˜(b4):
[0414] Step (b1) A second single strand DNA was obtained, wherein the sequence of the second single strand DNA was SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO:10, and the sequence of the second single strand DNA is the complementary strand to the first single strand DNA.
[0415] Step (b2) The 5′ end of the second single strand DNA was modified as 5′ end thiol-modified second single strand DNA to obtain the targeting moiety linker stock. The targeting moiety linker stock is also commercially available from Integrated DNA Technologies. Actual methods of modification are known, or will be apparent, to those skilled in the art (Zimmermann, J, 2010).
[0416] Step (b3) 10-500 μL targeting moiety linker stock and 0.1-10 μL NHS-Maleimide (commercially available from Fisher Scientific) were mixed and incubated for 1-60 minute(s). Step (b4) The mixture obtained from Step (b3) were mixed with 10-100 μL targeting moiety stock (commercially available from Roche) and incubated for 10 minutes to 3 hours to obtain targeting moiety-ssDNA conjugate.
[0417] The targeting moiety could be a peptide, protein, or aptamer, wherein the protein could be an antibody against a cancer antigen selected from HER2/neu (ERBB2), HER3 (ERBB3), EGFR, VEGF, VEGFR2, GD2, CTLA4, CD19, CD20, CD22, CD30, CD33 (Siglec-3), CD52 (CAMPATH-1 antigen), CD326 (EpCAM), CA-125 (MUC16), MMP9, DLL3, CD274 (PD-L1), CEA, MSLN (mesothelin), CA19-9, CD73, CD205 (DEC205), CD51, c-MET, TRAIL-R2, IGF-1R, CD3, MIF, folate receptor alpha (FOLR1), CSF1, OX-40, CD137, TfR, MUC1, CD25 (IL-2R), CD115 (CSF1R), IL1B, CD105 (Endoglin), KIR, CD47, CEA, IL-17A, DLL4, CD51, angiopoietin 2, neuropilin-1, CD37, CD223 (LAG-3), CD40, LIV-1 (SLC39A6), CD27 (TNFRSF7), CD276 (B7-H3), Trop2, Claudin1 (CLDN1), PSMA, TIM-1 (HAVcr-1), CEACAM5, CD70, LY6E, BCMA, CD135 (FLT3), APRIL, TF(F3), nectin-4, FAP, GPC3, FGFR3, a killer-cell immunoglobulin-like receptors (KIRs), a TNF receptor protein, an immunoglobulin protein, a cytokine receptor, an integrin, activating NK cell receptors, and combinations thereof.
Embodiment 15: Prepare Chimeric Antigen Receptor (CAR)-Expressed oNK Cells
[0418] The method for preparing oNK cells comprising a synthetic, genetically modified and/or deliberately delivered polynucleotide encoding a chimeric antigen receptor (CAR) comprising a target-binding single-chain variable fragment (scFv) against target antigen is disclosed in this embodiment, wherein the chimeric antigen receptor is selected from CD2, CD3 delta, CD3 epsilon, CD3 gamma, CD4, CD7, CD8a, CD8, CD1 1a (ITGAL), CD1 1b (ITGAM), CD1 1c (ITGAX), CD1 1d (ITGAD), CD 18 (ITGB2), CD 19 (B4), CD27 (TNFRSF7), CD28, CD29 (ITGB1), CD30 (TNFRSF8), CD40 (TNFRSF5), CD48 (SLAMF2), CD49a (ITGA1), CD49d (ITGA4), CD49f (ITGA6), CD66a (CEACAM1), CD66b (CEACAM8), CD66c (CEACAM6), CD66d (CEACAM3), CD66e (CEACAM5), CD69 (CLEC2), CD79A (B-cell antigen receptor complex-associated alpha chain), CD79B (B-cell antigen receptor complex-associated beta chain), CD84 (SLAMF5), CD96 (Tactile), CD100 (SEMA4D), CD103 (ITGAE), CD134 (OX40), CD137 (4-1BB), CD150 (SLAMF1), CD158A (KIR2DL1), CD158B1 (KIR2DL2), CD158B2 (KIR2DL3), CD158C (KIR3DP1), CD158D (KIRDL4), CD158F1 (KIR2DL5A), CD158F2 (KIR2DL5B), CD158K (KIR3DL2), CD160 (BY55), CD162 (SELPLG), CD226 (DNAM1), CD229 (SLAMF3), CD244 (SLAMF4), CD247 (CD3-zeta), CD258 (LIGHT), CD268 (BAFFR), CD270 (TNFSF14), CD272 (BTLA), CD276 (B7-H3), CD279 (PD-1), CD314 (NKG2D), CD319 (SLAMF7), CD335 (NK-p46), CD336 (NK-p44), CD337 (NK-p30), CD352 (SLAMF6), CD353 (SLAMF8), CD355 (CRTAM), CD357 (TNFRSF18), inducible T cell co-stimulator (ICOS), LFA-1 (CD1 1a/CD18), NKG2C, DAP-10, ICAM-1, NKp80 (KLRF1), IL-2R beta, IL-2R gamma, IL-7R alpha, LFA-1, SLAMF9, LAT, GADS (GrpL), SLP-76 (LCP2), PAG1/CBP, a CD83 ligand, Fc gamma receptor, MHC class 1 molecule, MHC class 2 molecule, a TNF receptor protein, an immunoglobulin protein, a cytokine receptor, an integrin, activating NK cell receptors, a Toll-like receptor, HER2, BCMA, PD-L1, and combinations thereof.
[0419] Take CD19 as an example to explain the method of preparing oNK comprising a synthetic, genetically modified and/or deliberately delivered polynucleotide encoding a chimeric antigen receptor (CAR) comprising a target-binding single-chain variable fragment (scFv) against CD19 as below. oNK cells were harvested and treated with 6 μM of 5Z-7-Oxozeaenol (TAK1 inhibitor) for 30 min. The 5Z-7-Oxozeaenol-treated cells were treated with Trasdux (transduction enhancer) and infected with lentivirus particles produced by anti-CD19 scFv CAR-expressing construct in CD810A-1 vector at m.o.i. of 9. The cells were centrifuged at 1000×g for 70 min, and then incubated at 37° C. for 4 hr. The cells were further centrifuged at 200×g for 5 min and the supernatant was removed. The infected cells were resuspended with fresh growth media and cultured at 37° C. in G-Rex plate.
[0420] To enrich CAR-expressing populations, the cells were centrifuged at 400×g for 5 min and washed by MACS buffer. The cells were further stained with anti-Myc Ab-APC and DAPI. After washed by DPBS, the APC.sup.+ DAPI.sup.− cells were sorted out by cell sorter and then expanded in fresh growth media in G-Rex.
[0421] From the embodiments of the present invention, it demonstrated that all of the non-transgenic human CD16.sup.+ natural killer cell line obtained by the method of the present invention, the exogenous targeting unit complexed-natural killer cell of the present invention, and the chimeric antigen receptor (CAR)-expressed oNK cells of the invention can indeed kill the target cell (e.g., cancer cells) though ADCC-like process. Therefore, the applicable fields of the non-transgenic human CD16.sup.+ natural killer cell line, obtained by the culture method of the present invention, include but not limited to cancer treatment, autoimmune disease treatment, neuronal disease treatment, human immunodeficiency virus (HIV) eradication, hematopoietic cell-related diseases, metabolic syndrome treatment, pathogenic disease treatment, treatment of viral infection, and treatment of bacterial infection. [0422] Reference 1—Eileen Scully and Galit Alter, 2016. NK cells in HIV disease. Curr HIV/AIDS Rep. 13(2):85-94. [0423] Reference 2—Jordan S. Orange, 2013. Natural killer cell deficiency. J Allergy Clin Immunol. 132(3):515-525. [0424] Reference 3—Kallioniemi A, Visakorpi T, Karlui R, Pinkel D, and Kallioniemi OP, 1996. Gene Copy number analysis by fluorescence in situ hybridization and comparative genomic hybridization. Methods. 9(1):113-121. [0425] Reference 4—Littwitz-Salomon E, Dittmer U, Sutter K, 2016. Insufficient natural killer cell responses against retroviuses: how to improve NK cell killing of retrovirus-infected cells. Retrovirology. 13(1):77. [0426] Reference 5—Pernick, N, 2018.
[0427] http://www.pathologyoutlines.com/topic/cdmarkerscd56.html
[0428] http://www.pathologyoutlines.com/topic/cdmarkerscd3.html
[0429] http://www.pathologyoutlines.com/topic/cdmarkerscd2.html
[0430] http://www.pathologyoutlines.com/topic/cdmarkerscd16.html [0431] Reference 6—Rezvani K and Rouce RH, 2015. The application of natural killer cell immunotherapy for the treatment of cancer. Front Immunol. 6:578. [0432] Reference 7—Vindelov, L. L., Christensen, I. J., and Nissen, N. I., 1983. A Detergent-trypsin method for the preparation of nuclei for flow cytometric DNA analysis. Cytometry. 3(5), 323-327. [0433] Reference 8—Zimmermann, J, Nicolaus, T, Neuert, G. and Blank, K. 2010. Thiol-based, site-specific and covalent immobilization of biomolecules for single-molecule experiments. Nat. Protoc. 5(6):975-985.
[0434] The foregoing descriptions are merely the preferred embodiments of the present invention and are not intended to limit the scope of the patent application of the present invention. Therefore, any alteration or modification that does not depart from the spirits disclosed herein should be included within the scope of the patent application of the present invention.